Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

Science.gov (United States)

Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

2010-06-18

Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

Science.gov (United States)

Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

2013-01-01

Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

Science.gov (United States)

Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

2010-07-15

The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

Science.gov (United States)

Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

2017-07-06

Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

Science.gov (United States)

Su, S; Bird, R C

1995-09-15

A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

Directory of Open Access Journals (Sweden)

Arava Yoav

2007-08-01

Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

A combined cryo-EM and molecular dynamics approach reveals the mechanism of ErmBL-mediated translation arrest

Science.gov (United States)

Arenz, Stefan; Bock, Lars V.; Graf, Michael; Innis, C. Axel; Beckmann, Roland; Grubmüller, Helmut; Vaiana, Andrea C.; Wilson, Daniel N.

2016-07-01

Nascent polypeptides can induce ribosome stalling, regulating downstream genes. Stalling of ErmBL peptide translation in the presence of the macrolide antibiotic erythromycin leads to resistance in Streptococcus sanguis. To reveal this stalling mechanism we obtained 3.6-Å-resolution cryo-EM structures of ErmBL-stalled ribosomes with erythromycin. The nascent peptide adopts an unusual conformation with the C-terminal Asp10 side chain in a previously unseen rotated position. Together with molecular dynamics simulations, the structures indicate that peptide-bond formation is inhibited by displacement of the peptidyl-tRNA A76 ribose from its canonical position, and by non-productive interactions of the A-tRNA Lys11 side chain with the A-site crevice. These two effects combine to perturb peptide-bond formation by increasing the distance between the attacking Lys11 amine and the Asp10 carbonyl carbon. The interplay between drug, peptide and ribosome uncovered here also provides insight into the fundamental mechanism of peptide-bond formation.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

Science.gov (United States)

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ribosomes slide on lysine-encoding homopolymeric A stretches

Science.gov (United States)

Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

2015-01-01

Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

Architecture of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

2014-01-23

Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

Science.gov (United States)

Kimura, J; Kimura, M

1987-09-05

The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

Directory of Open Access Journals (Sweden)

Anne Kathrin Hett

Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

Science.gov (United States)

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

Science.gov (United States)

Alejo, Jose Luis

In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

Directory of Open Access Journals (Sweden)

Virginie Marcel

Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

Science.gov (United States)

Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

2017-06-29

Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

Science.gov (United States)

Alejo, Jose L; Blanchard, Scott C

2017-10-10

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

Science.gov (United States)

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

Ribosomal trafficking is reduced in Schwann cells following induction of myelination

Directory of Open Access Journals (Sweden)

James M. Love

2015-08-01

Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

Science.gov (United States)

Rodnina, Marina V; Wintermeyer, Wolfgang

2011-04-01

Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

Science.gov (United States)

Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

2012-10-01

YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

Science.gov (United States)

Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

2014-01-01

Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

5S rRNA and ribosome.

Science.gov (United States)

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

In vitro degradation of ribosomes.

Science.gov (United States)

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

Science.gov (United States)

Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

2015-11-05

The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

International Nuclear Information System (INIS)

Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

1981-01-01

The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

International Nuclear Information System (INIS)

Burkhardt, N.

1997-01-01

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

Science.gov (United States)

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

Science.gov (United States)

Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

2016-01-15

The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

Directory of Open Access Journals (Sweden)

Bani Kumar Pathak

Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

Science.gov (United States)

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

Directory of Open Access Journals (Sweden)

Pierre Bonnin

2017-05-01

Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

Directory of Open Access Journals (Sweden)

Maria Augusta Dario

2017-07-01

Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

International Nuclear Information System (INIS)

Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

2008-01-01

The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

The complete structure of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

2014-11-13

Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

DNA replication stress restricts ribosomal DNA copy number.

Science.gov (United States)

Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

2017-09-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

DNA replication stress restricts ribosomal DNA copy number

Science.gov (United States)

Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

2017-01-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

DNA replication stress restricts ribosomal DNA copy number.

Directory of Open Access Journals (Sweden)

Devika Salim

2017-09-01

Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

A ribosome without RNA

Directory of Open Access Journals (Sweden)

Harold S Bernhardt

2015-11-01

Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

Directory of Open Access Journals (Sweden)

John N Griffin

2015-03-01

Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

Replication and meiotic transmission of yeast ribosomal RNA genes.

Science.gov (United States)

Brewer, B J; Zakian, V A; Fangman, W L

1980-11-01

The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

Directory of Open Access Journals (Sweden)

Monique N O'Leary

Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

DEFF Research Database (Denmark)

Grankowski, N; Gasior, E; Issinger, O G

1993-01-01

Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

The ribosome uses two active mechanisms to unwind messenger RNA during translation.

Science.gov (United States)

Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

2011-07-06

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

2012-03-23

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

2012-01-01

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

sORFs.org: a repository of small ORFs identified by ribosome profiling.

Science.gov (United States)

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-04

With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

Science.gov (United States)

Yu, Shoukai; Lemos, Bernardo

2016-12-31

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

Science.gov (United States)

Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

2016-01-01

Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1997-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1998-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Differential Stoichiometry among Core Ribosomal Proteins

Directory of Open Access Journals (Sweden)

Nikolai Slavov

2015-11-01

Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

DEFF Research Database (Denmark)

Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

2009-01-01

In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

Control of ribosome formation in rat heart

International Nuclear Information System (INIS)

Russo, L.A.

1987-01-01

Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

Science.gov (United States)

Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

2016-01-14

Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

Science.gov (United States)

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

Crystallization of ribosomes from Thermus thermophilus

International Nuclear Information System (INIS)

Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

1987-01-01

An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

Unusual event report from Oskarshamn

International Nuclear Information System (INIS)

1996-01-01

The title of the report was intended to reflect the cause of the shutdown and the report to be regarded as a summary of the deficiencies that had been revealed and remedied. No single deficiency was regarded as reportable as an unusual event, but taken together the identified deficiencies deviated from the assumed safety level to the extent that it should be reported. The unusual event report refers to two main documents presenting measures taken to return to reported safety level, one concerning technical and one organizational measures

Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

Directory of Open Access Journals (Sweden)

Kirsten Kehrein

2015-02-01

Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

OpenAIRE

Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

2014-01-01

Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

Ribosomal Antibiotics: Contemporary Challenges

Directory of Open Access Journals (Sweden)

Tamar Auerbach-Nevo

2016-06-01

Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

International Nuclear Information System (INIS)

Singh, H.; Bishop, J.

1984-01-01

It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

Science.gov (United States)

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

Science.gov (United States)

Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

2016-01-01

Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

Science.gov (United States)

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

Science.gov (United States)

Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

2017-05-19

During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

Placeholder factors in ribosome biogenesis: please, pave my way

Directory of Open Access Journals (Sweden)

Francisco J. Espinar-Marchena

2017-04-01

Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

Science.gov (United States)

Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

2015-01-01

Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Science.gov (United States)

Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

2016-02-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Directory of Open Access Journals (Sweden)

Nerea Irigoyen

2016-02-01

Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

Science.gov (United States)

Xie, Ping

2014-12-01

We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

2015-04-17

Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

Science.gov (United States)

Hatakeyama, T; Hatakeyama, T; Kimura, M

1988-11-21

The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

Defective ribosome assembly in Shwachman-Diamond syndrome.

Science.gov (United States)

Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

2011-10-20

Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

Science.gov (United States)

Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

2017-07-25

Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

Emerging functions of ribosomal proteins in gene-specific transcription and translation

International Nuclear Information System (INIS)

Lindstroem, Mikael S.

2009-01-01

Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

Science.gov (United States)

Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

2016-01-01

The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

Unusual raptor nests around the world

Science.gov (United States)

Ellis, D.H.; Craig, T.; Craig, E.; Postupalsky, S.; LaRue, C.T.; Nelson, R.W.; Anderson, D.W.; Henny, C.J.; Watson, J.; Millsap, B.A.; Dawson, J.W.; Cole, K.L.; Martin, E.M.; Margalida, A.; Kung, P.

2009-01-01

From surveys in many countries, we report raptors using unusual nesting materials (e.g., paper money, rags, metal, antlers, and large bones) and unusual nesting situations. For example, we documented nests of Steppe Eagles Aquila nipalensis and Upland Buzzards Buteo hemilasius on the ground beside well-traveled roads, Saker Falcon Falco cherrug eyries in attics and a cistern, and Osprey Pandion haliaetus nests on the masts of boats and on a suspended automobile. Other records include a Golden Eagle A. chrysaetos nest 7.0 m in height, believed to be the tallest nest ever described, and, for the same species, we report nesting in rudimentary nests. Some nest sites are within a few meters of known predators or competitors. These unusual observations may be important in revealing the plasticity of a species' behavioral repertoire. ?? 2009 The Raptor Research Foundation, Inc.

Eukaryotic ribosome display with in situ DNA recovery.

Science.gov (United States)

He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

2012-01-01

Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

An unusual correlation between ppGpp pool size and rate of ribosome synthesis during partial pyrimidine starvation of Escherichia coli

DEFF Research Database (Denmark)

Vogel, Ulla; Pedersen, Steen; Jensen, Kaj Frank

1991-01-01

Escherichia coli was exposed to partial pyrimidine starvation by feeding a pyrBI strain orotate as the only pyrimidine source. Subsequently, differential rates of synthesis of rRNA and of a few ribosome-associated proteins as well as the pool sizes of nucleoside triphosphates and ppGpp were measu...

Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

Energy Technology Data Exchange (ETDEWEB)

Sameshima, M; Ito, K; Iwabuchi, M

1972-01-01

In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

DEFF Research Database (Denmark)

Poulsen, S M; Karlsson, M; Johansson, L B

2001-01-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

Directory of Open Access Journals (Sweden)

Fucini Paola

2004-04-01

Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

The Phosphorylation of Ribosomal Protein in Lemna minor

Science.gov (United States)

Trewavas, A.

1973-01-01

Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

Directory of Open Access Journals (Sweden)

Brittany Burton

Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

DEFF Research Database (Denmark)

Issinger, O G

1977-01-01

Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

On the control of ribosomal protein biosynthesis in Escherichia coli

International Nuclear Information System (INIS)

Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

1977-01-01

The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

Science.gov (United States)

Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

2014-10-14

Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

Science.gov (United States)

Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

2015-07-08

Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

NARCIS (Netherlands)

Essers, P.B.M.

2013-01-01

Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

Structural Analysis of Insulin Minisatellite Alleles Reveals Unusually Large Differences in Diversity between Africans and Non-Africans

Science.gov (United States)

Stead, John D. H.; Jeffreys, Alec J.

2002-01-01

The insulin minisatellite (INS VNTR) associates with susceptibility to a variety of diseases. We have developed a high-resolution system for analyzing variant repeat distributions applicable to all known minisatellite alleles, irrespective of size, which allows lineages of related alleles to be identified. This system has previously revealed extremely low structural diversity in the minisatellite among northern Europeans from the United Kingdom, with all alleles belonging to one of only three highly diverged lineages called “I,” “IIIA,” and “IIIB.” To explore the origins of this remarkably limited lineage diversity, we have characterized an additional 780 alleles from three non-African and three African populations. In total, 22 highly diverged lineages were identified, with structural intermediates absent from extant populations, suggesting a bottleneck within the ancestry of all humans. The difference between levels of diversity in Africans and non-Africans is unusually large, with all 22 lineages identified in Africa compared with only three lineages seen not only in the United Kingdom but also in the other non-African populations. We also find evidence for overrepresentation of lineage I chromosomes in non-Africans. These data are consistent with a common out-of-Africa origin and an unusually tight bottleneck within the ancestry of all non-African populations, possibly combined with differential and positive selection for lineage I alleles in non-Africans. The important implications of these data for future disease-association studies are discussed. PMID:12404181

Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

Science.gov (United States)

Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

1991-06-01

Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

Science.gov (United States)

Catania, Francesco; Lynch, Michael

2010-05-04

In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

1975-06-01

Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

Science.gov (United States)

Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

2017-01-01

Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

International Nuclear Information System (INIS)

Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

2013-01-01

Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

Peroneal Arteriovenous Fistula and Pseudoaneurysm: An Unusual Presentation

Directory of Open Access Journals (Sweden)

Kevin C. Ching

2014-01-01

Full Text Available Peroneal artery arteriovenous fistulas and pseudoaneurysms are extremely rare with the majority of reported cases due to penetrating, orthopedic, or iatrogenic trauma. Failure to diagnose this unusual vascular pathology may lead to massive hemorrhage or limb threatening ischemia. We report an interesting case of a 14-year-old male who presented with acute musculoskeletal pain of his lower extremity. Initial radiographs were negative. Further imaging workup revealed a peroneal arteriovenous fistula with a large pseudoaneurysm. After initial endovascular intervention was unsuccessful, the vessels were surgically ligated in the operating room. Pathology revealed papillary endothelial hyperplasia consistent with an aneurysm and later genetic testing was consistent with Ehlers-Danlos syndrome Type IV. This case illustrates an unusual cause of acute atraumatic musculoskeletal pain and uncommon presentation of Ehlers-Danlos syndrome.

An unusual case of calcineurine inhibitor pain syndrome.

Science.gov (United States)

Nickavar, Azar; Mehrazma, Mitra; Hallaji, Farideh

2014-09-01

Cyclosporine induced pain syndrome (CIPS) is a newly diagnosed complication of calcineurine inhibitors, mainly observed in solid organ and hematopoetic transplantations. The present case is a male child with steroid resistant nephrotic syndrome on low therapeutic level cyclosporine treatment. He presented with intractable and debilitating leg pain, with no reported history of previous injury or trauma. The pain was reluctant to antimicrobial and sedative treatment. MRI revealed bone marrow and soft tissue edema in the mid shaft of patient's right leg. Inspite of unusual manifestations, CIPS was suggested and cyclosporine discontinued. However, the pain did not improve and was resistant to calcium blocker. Subsequently, core decompression was performed as an unusual treatment of CIPS, revealing normal bone morphology. The pain improved rapidly and the patient was discharged a few days later.

gamma. radiation effect on the functional properties of the cotton ribosomes

Energy Technology Data Exchange (ETDEWEB)

Ibragimov, A P; Safarov, Sh

1973-01-01

A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

Interaction of tRNA with Eukaryotic Ribosome

Directory of Open Access Journals (Sweden)

Dmitri Graifer

2015-03-01

Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

Macrolide antibiotic interaction and resistance on the bacterial ribosome.

Science.gov (United States)

Poehlsgaard, Jacob; Douthwaite, Stephen

2003-02-01

Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

Cis-regulatory RNA elements that regulate specialized ribosome activity.

Science.gov (United States)

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Yeast ribosomal proteins

International Nuclear Information System (INIS)

Otaka, E.; Kobata, K.

1978-01-01

The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

Science.gov (United States)

Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

2018-01-01

Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

International Nuclear Information System (INIS)

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

2016-01-01

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

Science.gov (United States)

Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

2017-02-15

Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

Science.gov (United States)

Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

2018-04-20

Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

Science.gov (United States)

Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

2016-01-25

Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

Science.gov (United States)

Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

2016-06-01

Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Trapping the ribosome to control gene expression.

Science.gov (United States)

Boehringer, Daniel; Ban, Nenad

2007-09-21

Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

Science.gov (United States)

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

International Nuclear Information System (INIS)

Gorelic, L.; Parker, D.

1978-01-01

The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

cDNA, genomic sequence cloning and analysis of the ribosomal ...

African Journals Online (AJOL)

Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

Science.gov (United States)

Hatakeyama, T; Kimura, M

1988-03-15

Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

Unusual anatomy of maxillary central incisor with two roots

Directory of Open Access Journals (Sweden)

T S Ashwini Shivakumar

2012-01-01

Full Text Available Introduction: Knowledge of root canal morphology is essential for successful endodontic therapy. Failure to recognize unusual root canal anatomy may lead to unsuccessful endodontic treatment. Case Report: This case report describes the successful endodontic treatment of the maxillary central incisor with unusual anatomy of two roots and two root canals. A 23-year-old male patient was referred for dental consultation with discoloration of the maxillary right central incisor with periapical lesion, which revealed unusual anatomy of root on radiographic examination, and was confirmed upon exploration. Discussion: As described by Vertucci, the maxillary central incisor presents a single root and single root canal in 100% of the cases. However, few cases of maxillary central incisors with two canals were reported in the literature, most of which were associated with developmental anomalies like fusion, germination or dens invaginatus. Clinician should be aware of the unusual anatomical variations that should be detected by the different diagnostic resources available.

Control of ribosome traffic by position-dependent choice of synonymous codons

DEFF Research Database (Denmark)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

Science.gov (United States)

Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

2014-01-01

Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

GTPases and the origin of the ribosome

Directory of Open Access Journals (Sweden)

Smith Temple F

2010-05-01

Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

Directory of Open Access Journals (Sweden)

Lynch Michael

2010-05-01

Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Multiple-Site Trimethylation of Ribosomal Protein L11 by the PrmA Methyltransferase

Energy Technology Data Exchange (ETDEWEB)

Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

2008-01-01

Ribosomal protein L11 is a universally conserved component of the large subunit, and plays a significant role during initiation, elongation, and termination of protein synthesis. In Escherichia coli, the lysine methyltransferase PrmA trimethylates the N-terminal a-amino group and the -amino groups of Lys3 and Lys39. Here, we report four PrmA-L11 complex structures in different orientations with respect to the PrmA active site. Two structures capture the L11 N-terminal a-amino group in the active site in a trimethylated postcatalytic state and in a dimethylated state with bound S-adenosyl-L-homocysteine. Two other structures show L11 in a catalytic orientation to modify Lys39 and in a noncatalytic orientation. The comparison of complex structures in different orientations with a minimal substrate recognition complex shows that the binding mode remains conserved in all L11 orientations, and that substrate orientation is brought about by the unusual interdomain flexibility of PrmA.

Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

DEFF Research Database (Denmark)

Issinger, O G; Beier, H

1978-01-01

Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

The rarity of "unusual" [corrected] dispositions of victim bodies: staging and posing.

Science.gov (United States)

Keppel, Robert D; Weis, Joseph G

2004-11-01

The act of leaving a victim's body in an unusual position is a conscious criminal action by an offender to thwart an investigation, shock the finder and investigators of the crime scene, or give perverted pleasure to the killer. The unusual position concepts of posing and staging a murder victim have been documented thoroughly and have been accepted by the courts as a definable phenomenon. One staging case and one posing case are outlined and reveal characteristics of those homicides. From the Washington State Attorney General's Homicide Investigation and Tracking System's database on murder covering the years 1981-2000 (a total of 5,224 cases), the relative frequency of unusual body dispositions is revealed as a very rare occurrence. Only 1.3% of victims are left in an unusual position, with 0.3% being posed and 0.1% being staged. The characteristics of these types of murders also set them apart: compared to all other murders, in staged murders the victims and killers are, on average, older. All victims and offenders in the staged murders are white, with victims being disproportionately white in murders with any kind of unusual body disposition. Likewise, females stand out as victims when the body is posed, staged, or left in other unusual positions. Whereas posed bodies are more likely to include sexual assault, often in serial murders, there is no evidence of either in the staged cases. Lastly, when a body is left in an unusual position, binding is more likely, as well as the use of more "hands on" means of killing the victim, such as stabbing or cutting weapons, bludgeons, ligatures, or hands and feet.

Expanding the ribosomal universe.

Science.gov (United States)

Dinman, Jonathan D; Kinzy, Terri Goss

2009-12-09

In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

A solitary bronchial papilloma with unusual endoscopic presentation: case study and literature review

Directory of Open Access Journals (Sweden)

Frejeville Marie

2009-08-01

Full Text Available Abstract Background Solitary endobronchial papillomas (SEP are rare tumors and most of them are described by case report. A misdiagnosis is common with viral related papillomas. A histopathological classification has recently permitted a major advancement in the understanding of the disease. Case Presentation We report a case of a mixed bronchial papilloma with an unusual endoscopic presentation. The literature was extensively reviewed to ascertain the unusual characteristics of the current case. A 39-year of age male was referred to our institution for the investigation of a slight hemoptysis. Routine examination was normal. A fibroscopy revealed an unusual feature of the right main bronchus. The lesion was a plane, non-bleeding, non-glistering sub-mucosal proliferation. No enhanced coloration was noticed. Biopsies revealed a mixed solitary bronchial papilloma. In situ HPV hybridization was negative. Endoscopic treatment (electrocautery was effective with no relapse. Conclusion This lesion contrasts with the data of the literature where papilloma were described as wart-like lesions or cauliflower tumors, with symptoms generally related to bronchial obstruction. We advise chest physicians to be cautious with unusually small swollen lesions of the bronchi that may reveal a solitary bronchial papilloma. Endoscopic imaging can significantly contribute to the difficult diagnosis of SEP by pulmonary physicians and endoscopists.

Control of ribosome traffic by position-dependent choice of synonymous codons

International Nuclear Information System (INIS)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

Science.gov (United States)

Wang, Hao; Kingsford, Carl; McManus, C Joel

2018-03-15

Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

Expression of ribosomal genes in pea cotyledons at the initial stages of germination

International Nuclear Information System (INIS)

Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

1986-01-01

The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

Directory of Open Access Journals (Sweden)

Ilana C. Agmon

2016-12-01

Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

International Nuclear Information System (INIS)

Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

1990-01-01

The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

Science.gov (United States)

Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

2012-01-01

Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

Science.gov (United States)

Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

2014-01-01

The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

An Unusual Case of Gastrointestinal Bleeding

Directory of Open Access Journals (Sweden)

Kristin N. Fiorino

2011-01-01

Full Text Available A 10-year-old boy presented with a 3-day history of worsening abdominal pain, fever, emesis and melena. Abdominal ultrasound revealed a right upper quadrant mass that was confirmed by computed tomography angiogram (CTA, which showed an 8 cm well-defined retroperitoneal vascular mass. 123Iodine metaiodobenzylguanidine (123MIBG scan indicated uptake only in the abdominal mass. Subsequent biopsy revealed a paraganglioma that was treated with chemotherapy. This case represents an unusual presentation of a paraganglioma associated with gastrointestinal (GI bleeding and highlights the utility of CTA and 123MIBG in evaluation and treatment.

Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

DEFF Research Database (Denmark)

Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

2008-01-01

indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

Structure based hypothesis of a mitochondrial ribosome rescue mechanism

Directory of Open Access Journals (Sweden)

Huynen Martijn A

2012-05-01

Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

Directory of Open Access Journals (Sweden)

Anne Kathrin Hett

2011-03-01

Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.Se presenta la primera descripción del cariotipo de Mugil incilis de Venezuela. El complemento cromosómico está compuesto por 48 cromosomas acrocéntricos uniformemente decrecientes en tamaño. Por lo tanto, los homólogos no pueden ser claramente identificados, con excepción de uno de los pares de mayor tamaño, clasificado como número 1, cuyos homólogos poseen una constricción secundaria subcentromérica, y el par de cromosomas número 24, considerablemente más pequeño que los otros. El bandeo-C reveló bloques heterocromáticos en las regiones centroméricas/pericentroméricas de todos los cromosomas, más conspicuas en el cromosoma 1 en el que las señales C

Mechanism of recycling of post-termination ribosomal complexes in ...

Indian Academy of Sciences (India)

Madhu

all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

Expression of protein-coding genes embedded in ribosomal DNA

DEFF Research Database (Denmark)

Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

2007-01-01

Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

Computational resources for ribosome profiling: from database to Web server and software.

Science.gov (United States)

Wang, Hongwei; Wang, Yan; Xie, Zhi

2017-08-14

Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

Directory of Open Access Journals (Sweden)

Katherine I. Farley-Barnes

2018-02-01

Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

DEFF Research Database (Denmark)

Rosendahl, G; Douthwaite, S

1993-01-01

RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

International Nuclear Information System (INIS)

Boehm, H.; Stahl, J.; Bielka, H.

1979-01-01

N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

International Nuclear Information System (INIS)

Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

1987-01-01

The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

International Nuclear Information System (INIS)

Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

2008-01-01

The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

Directory of Open Access Journals (Sweden)

Jennifer L Houmani

Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

OpenAIRE

Ruggero, D; Londei, P

1996-01-01

Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

An unusual foreign body of esophagus

Directory of Open Access Journals (Sweden)

Surinder K Singhal

2010-07-01

Full Text Available We report a rare case of an unusually long foreign body (Datun impacted in the esophagus of a 56 year-old gentleman. He was literate, without any psychiatric illness and had been using “Neem” (Azadirachta indica stick for cleaning his teeth for the past twenty years. Neem sticks are used for brushing teeth, perhaps one of the earliest and very effective dental care. On closer questioning he revealed his habit of passing the Neem stick into his throat with the aim of cleaning it too while cleaning his teeth. He presented to our emergency early in the morning with this strange long foreign body impacted in his esophagus which was removed successfully using a Jackson’s adult rigid oesophagoscope. We believe this to be the first case of such an unusually long foreign body to be reported in the literature.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan

2015-08-13

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

2015-01-01

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

Protein-protein interactions within late pre-40S ribosomes.

Directory of Open Access Journals (Sweden)

Melody G Campbell

2011-01-01

Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

Science.gov (United States)

Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

2005-11-01

Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

Proto-ribosome: a theoretical approach based on RNA relics

OpenAIRE

Demongeot, Jacques

2017-01-01

We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

Magnetic vortex excitation as spin torque oscillator and its unusual trajectories

Science.gov (United States)

Natarajan, Kanimozhi; Muthuraj, Ponsudana; Rajamani, Amuda; Arumugam, Brinda

2018-05-01

We report an interesting observation of unusual trajectories of vortex core oscillations in a spin valve pillar. Micromagnetic simulation in the composite free layer spin valve nano-pillar shows magnetic vortex excitation under critical current density. When current density is slightly increased and wave vector is properly tuned, for the first time we observe a star like and square gyration. Surprisingly this star like and square gyration also leads to steady, coherent and sustained oscillations. Moreover, the frequency of gyration is also very high for this unusual trajectories. The power spectral analysis reveals that there is a marked increase in output power and frequency with less distortions. Our investigation explores the possibility of these unusual trajectories to exhibit spin torque oscillations.

Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

International Nuclear Information System (INIS)

Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

2013-01-01

Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

Science.gov (United States)

MacConnell, W P; Kaplan, N O

1982-05-25

The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

Science.gov (United States)

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

International Nuclear Information System (INIS)

Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

2016-01-01

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

Energy Technology Data Exchange (ETDEWEB)

Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

2016-04-22

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Senescent changes in the ribosomes of animal cells in vivo and in vitro

Science.gov (United States)

Miquel, J.; Johnson, J. E., Jr.

1979-01-01

The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

Science.gov (United States)

Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

2001-09-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

Rigor mortis in an unusual position: Forensic considerations.

Science.gov (United States)

D'Souza, Deepak H; Harish, S; Rajesh, M; Kiran, J

2011-07-01

We report a case in which the dead body was found with rigor mortis in an unusual position. The dead body was lying on its back with limbs raised, defying gravity. Direction of the salivary stains on the face was also defying the gravity. We opined that the scene of occurrence of crime is unlikely to be the final place where the dead body was found. The clues were revealing a homicidal offence and an attempt to destroy the evidence. The forensic use of 'rigor mortis in an unusual position' is in furthering the investigations, and the scientific confirmation of two facts - the scene of death (occurrence) is different from the scene of disposal of dead body, and time gap between the two places.

What limits production of unusual monoenoic fatty acids in transgenic plants?

Science.gov (United States)

Suh, Mi Chung; Schultz, David J; Ohlrogge, John B

2002-08-01

Unusual monounsaturated fatty acids are major constituents (greater than 80%) in seeds of Coriandrum sativum L. (coriander) and Thunbergia alata Bojer, as well as in glandular trichomes (greater than 80% derived products) of Pelargonium x hortorum (geranium). These diverged fatty acid structures are produced via distinct plastidial acyl-acyl carrier protein (ACP) desaturases. When expressed in Arabidopsis thaliana (L.) Heynh. under strong seed-specific promoters the unusual acyl-ACP desaturases resulted in accumulation of unusual monoene fatty acids at 1-15% of seed fatty acid mass. In this study, we have examined several factors that potentially limit higher production of unusual monoenes in transgenic oilseeds. (i) Immunoblots indicated that the introduced desaturases were expressed at levels equivalent to or higher than the endogenous delta9 18:0-ACP desaturase. However, the level of unusual fatty acid produced in transgenic plants was not correlated with the level of desaturase expression. (ii) The unusual desaturases were expressed in several backgrounds, including antisense 18:0-ACP desaturase plants, in fab1 mutants, and co-expressed with specialized ACP or ferredoxin isoforms. None of these experiments led to high production of expected products. (iii) No evidence was found for degradation of the unusual fatty acids during seed development. (iv) Petroselinic acid added to developing seeds was incorporated into triacylglycerol as readily as oleic acid, suggesting no major barriers to its metabolism by enzymes of glycerolipid assembly. (v) In vitro and in situ assay of acyl-ACP desaturases revealed a large discrepancy of activity when comparing unusual acyl-ACP desaturases with the endogenous delta9 18:0-ACP desaturase. The combined results, coupled with the sensitivity of acyl-ACP desaturase activity to centrifugation and low salt or detergent suggests low production of unusual monoenes in transgenic plants may be due to the lack of, or incorrect assemble of

Hepatobiliary fascioliasis: a case with unusual radiological features.

Science.gov (United States)

Yeşildağ, Ahmet; Senol, Altuğ; Köroğlu, Mert; Koçkar, Cem; Oyar, Orhan; Işler, Mehmet

2010-12-01

We report a case of hepatobiliary fascioliasis presenting with unusual radiological findings that have not been reported previously. Imaging studies revealed hepatic cystic pouches communicating with intrahepatic bile ducts. Snail-like, oval shaped and conglomerated echogenic particles with no acoustic shadowing, suggesting F. hepatica, were detected in these cystic pouches. In addition, secondary sclerosing cholangitis developed after fascioliasis.

γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

International Nuclear Information System (INIS)

Suessmuth, R.; Widmann, A.

1979-01-01

γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

Directory of Open Access Journals (Sweden)

Bruce R. Levin

2017-02-01

Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

DEFF Research Database (Denmark)

Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

2011-01-01

Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

Directory of Open Access Journals (Sweden)

Gray Michael W

2005-08-01

Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

Studies on the catalytic rate constant of ribosomal peptidyltransferase.

Science.gov (United States)

Synetos, D; Coutsogeorgopoulos, C

1987-02-20

A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

Science.gov (United States)

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Further characterization of ribosome binding to thylakoid membranes

International Nuclear Information System (INIS)

Hurewitz, J.; Jagendorf, A.T.

1987-01-01

Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

Structure of Vibrio cholerae ribosome hibernation promoting factor

International Nuclear Information System (INIS)

De Bari, Heather; Berry, Edward A.

2013-01-01

The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

Science.gov (United States)

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

Science.gov (United States)

Yonath, Ada

An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

DEFF Research Database (Denmark)

Issinger, O G

1977-01-01

A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

Simulation and analysis of single-ribosome translation

International Nuclear Information System (INIS)

Tinoco, Ignacio Jr; Wen, Jin-Der

2009-01-01

In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

Science.gov (United States)

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

Science.gov (United States)

Andreeva, Irena

2018-01-01

During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

Myofibroblastoma: An Unusual Rapidly Growing Benign Tumour in a Male Breast

International Nuclear Information System (INIS)

Rafique, A.; Arshad, A.

2013-01-01

Myofibroblastoma is an unusual benign tumour of the breast predominantly seen in men in their sixth to seventh decade. The gross appearance is that of a well circumscribed nodule, characteristically small, seldom exceeding 3 cm. We present a case of an unusually large myofibroblastoma, which mimicked a malignant breast tumour. A 40 years old male, known case of tetralogy of Fallot, was operated in infancy in abroad, presented with a rapid enlargement of right breast over 5 - 6 weeks. Examination revealed a firm 10 cm hemispherical lump occupying the whole of the right breast with normal overlying skin. Since core biopsy was inconclusive, a subcutaneous mastectomy was performed to remove the tumour, which weighed 500 gms. Histopathology and immunocytochemistry revealed a mixed classical and collagenised type of myofibroblastoma. The patient is well with no evidence of recurrence. (author)

Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

Energy Technology Data Exchange (ETDEWEB)

Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

2013-11-15

Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Science.gov (United States)

Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

2016-01-01

Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

Science.gov (United States)

Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

2016-11-01

Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

Energy Technology Data Exchange (ETDEWEB)

Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

2007-01-01

Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

Science.gov (United States)

Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

2016-01-01

Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

Embolia cutis medicamentosa: an unusual adverse reaction to terlipressin

Science.gov (United States)

Gatos-Gatopoulos, Polychronis; Kostantoudakis, Stephanos; Panayiotides, Ioannis G.; Dimitriadis, George D.; Triantafyllou, Konstantinos

2017-01-01

Terlipressin is a synthetic long-acting analog of vasopressin widely used to control variceal bleeding by lowering portal venous pressure. We report an unusual adverse reaction to terlipressin in a 78-year-old patient with esophageal variceal bleeding who developed skin necrosis soon after treatment initiation. Skin biopsy revealed embolia cutis medicamentosa. PMID:29118569

[Family of ribosomal proteins S1 contains unique conservative domain].

Science.gov (United States)

Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

2010-01-01

Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

International Nuclear Information System (INIS)

Denslow, N.D.; O'Brien, T.W.

1984-01-01

To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

Molecular dynamics simulation of ribosome jam

KAUST Repository

Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

2011-01-01

We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

Science.gov (United States)

Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

2004-12-01

The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

An Unusual Accumulation of Ribosomal Multigene Families and Microsatellite DNAs in the XX/XY Sex Chromosome System in the Trans-Andean Catfish Pimelodella cf. chagresi (Siluriformes:Heptapteridae).

Science.gov (United States)

Conde-Saldaña, Cristhian Camilo; Barreto, Cynthia Aparecida Valiati; Villa-Navarro, Francisco Antonio; Dergam, Jorge Abdala

2018-02-01

This work constitutes the first cytogenetic characterization of a trans-Andean species of Heptapteridae. The catfish Pimelodella cf. chagresi from the Upper Rio Magdalena was studied, applying standard cytogenetic techniques (Giemsa, C-banding, and argyrophilic nucleolar organizer region [Ag-NOR]) and fluorescence in situ hybridization techniques using repetitive DNA probes: microsatellites (CA 15 and GA 15 ) and ribosomal RNA (rRNA) multigene families (18S and 5S recombinant DNA [rDNA] probes). The species showed a unique diploid chromosome number 2n = 50 (32m [metacentrics] +14sm [submetacentrics] +4st [subtelocentrics]) and a XX/XY sex chromosomal system, where the heteromorphic Y-chromosome revealed a conspicuous accumulation of all the assayed domains of repetitive DNA. P. cf. chagresi karyotype shares common features with other Heptapteridae, such as the predominance of metacentric and submetacentric chromosomes, and one pair of subtelomeric nucleolar organizer regions (NORs). These results reflect an independent karyological identity of a trans-Andean species and the relevance of repetitive DNA sequences in the process of sex chromosome differentiation in fish; it is the first case of syntenic accumulation of rRNA multigene families (18S and 5S rDNA) and microsatellite sequences (CA 15 and GA 15 ) in a differentiated sex chromosome in Neotropical fish.

Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Galas, D J; Branscomb, E W

1976-08-12

The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

Science.gov (United States)

Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

2012-02-01

Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

Science.gov (United States)

Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

2016-03-22

Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

Directory of Open Access Journals (Sweden)

Alexander M. Brannan

2015-12-01

Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

Science.gov (United States)

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

The ribosome-associated complex antagonizes prion formation in yeast.

Science.gov (United States)

Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

2015-01-01

The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

Protein folding on the ribosome studied using NMR spectroscopy

Science.gov (United States)

Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

2013-01-01

NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

Science.gov (United States)

Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

2016-10-01

The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

DEFF Research Database (Denmark)

Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

2003-01-01

The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

Science.gov (United States)

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

The nuclear import of ribosomal proteins is regulated by mTOR

Science.gov (United States)

Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

2014-01-01

Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

POEMS syndrome: unusual radiographic, scintigraphic and CT features

International Nuclear Information System (INIS)

Narvaez, J.A.; Majos, C.; Valls, C.; Fernandez-Cabrera, L.; Narvaez, J.

1998-01-01

POEMS syndrome is a multisystemic disorder related to a plasma cell dyscrasia. Radiologically, this syndrome is characterized by sclerotic focal bone lesions with a normal radionuclide bone scan. We report a case of POEMS syndrome with an expansile lytic lesion in the sternum showing periosteal reaction and soft tissue mass, which revealed locally increased uptake of radiotracer in bone scintigraphy. These unusual findings and the differential diagnosis are discussed. (orig.)

Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

Science.gov (United States)

Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

2014-07-08

Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

An unusual case of refractory wheeze

Science.gov (United States)

Ramesh, Venkat; Acharya, Vishak; Pai, Narasimha; Krishnan, Ananda

2015-01-01

A 37-year-old man presented with a history of episodic wheeze and breathlessness of 3 years’ duration refractory to treatment. Physical examination revealed diffuse expiratory polyphonic rhonchi while the remainder of the examination including the cardiac examination was reported as normal. Pulmonary function testing revealed mild obstruction with bronchodilator reversibility. The patient was discharged on a 6-month course of antitubercular treatment (ATT) as bronchial brush cytology (obtained via bronchoscopy) was positive for acid-fast bacilli. The patient presented after completing 6 months of ATT with persistent symptoms, a loud S1 and a mid-diastolic murmur at the apex. High-resolution CT of the chest showed bilateral dependent ground glass opacities. An echocardiogram revealed a left atrial myxoma, and normal RV size and pressures. The patient underwent successful surgical removal of the same, and made a complete recovery. Refractory wheeze is a very unusual presentation of a left atrial myxoma. PMID:25733086

Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

Directory of Open Access Journals (Sweden)

Sayaka Tsuji

2017-07-01

Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

Unusual motions in the Wolf-Rayet nebula NGC 6888

International Nuclear Information System (INIS)

Johnson, P.G.; Songsathaporn, R.

1981-01-01

A systematic survey of the velocity structure within the Wolf-Rayet ring nebula NGC 6888 has been undertaken by making observations of the [N II] line profiles. They reveal a hitherto undetected and particularly unusual velocity structure with three of the brightest portions of the circumference of this ring exhibiting triple line components. Possible models to explain these observations are discussed. (author)

Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

Science.gov (United States)

Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

2016-06-27

Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

Science.gov (United States)

Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

1981-01-01

The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

Unusual magnetoresistance in cubic B20 Fe0.85Co0.15Si chiral magnets

Science.gov (United States)

Huang, S. X.; Chen, Fei; Kang, Jian; Zang, Jiadong; Shu, G. J.; Chou, F. C.; Chien, C. L.

2016-06-01

The B20 chiral magnets with broken inversion symmetry and C4 rotation symmetry have attracted much attention. The broken inversion symmetry leads to the Dzyaloshinskii-Moriya that gives rise to the helical and Skyrmion states. We report the unusual magnetoresistance (MR) of B20 chiral magnet Fe0.85Co0.15Si that directly reveals the broken C4 rotation symmetry and shows the anisotropic scattering by Skyrmions with respect to the current directions. The intimacy between unusual MR and broken symmetry is well confirmed by theoretically studying an effective Hamiltonian with spin-orbit coupling. The unusual MR serves as a transport signature for the Skyrmion phase.

Unusual magnetoresistance in cubic B20 Fe0.85Co0.15Si chiral magnets

International Nuclear Information System (INIS)

Huang, S X; Chen, Fei; Zang, Jiadong; Chien, C L; Kang, Jian; Shu, G J; Chou, F C

2016-01-01

The B20 chiral magnets with broken inversion symmetry and C 4 rotation symmetry have attracted much attention. The broken inversion symmetry leads to the Dzyaloshinskii–Moriya that gives rise to the helical and Skyrmion states. We report the unusual magnetoresistance (MR) of B20 chiral magnet Fe 0.85 Co 0.15 Si that directly reveals the broken C 4 rotation symmetry and shows the anisotropic scattering by Skyrmions with respect to the current directions. The intimacy between unusual MR and broken symmetry is well confirmed by theoretically studying an effective Hamiltonian with spin–orbit coupling. The unusual MR serves as a transport signature for the Skyrmion phase. (paper)

Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

Science.gov (United States)

Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

2011-09-28

As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

Science.gov (United States)

Gregory, Steven T.

2018-03-01

Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

Science.gov (United States)

Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

2013-10-17

Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

Directory of Open Access Journals (Sweden)

Gisela Pöll

Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

Science.gov (United States)

Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

2017-05-09

An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

Science.gov (United States)

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

Directory of Open Access Journals (Sweden)

Seema Dharni

2014-01-01

Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Directory of Open Access Journals (Sweden)

Giulio Donati

2013-07-01

Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

Science.gov (United States)

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

POEMS syndrome: unusual radiographic, scintigraphic and CT features

Energy Technology Data Exchange (ETDEWEB)

Narvaez, J.A.; Majos, C.; Valls, C.; Fernandez-Cabrera, L. [Department of CT and MR Imaging, Ciudad Sanitaria y Universitaria de Bellvitge, Barcelona (Spain); Narvaez, J. [Department of Rheumatology, Hospital Princeps d`Espanya, L`Hospitalet de Llobregat, Barcelona (Spain)

1998-02-01

POEMS syndrome is a multisystemic disorder related to a plasma cell dyscrasia. Radiologically, this syndrome is characterized by sclerotic focal bone lesions with a normal radionuclide bone scan. We report a case of POEMS syndrome with an expansile lytic lesion in the sternum showing periosteal reaction and soft tissue mass, which revealed locally increased uptake of radiotracer in bone scintigraphy. These unusual findings and the differential diagnosis are discussed. (orig.) With 3 figs., 8 refs.

Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

Science.gov (United States)

Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

2017-02-21

Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

Ribosome evolution: Emergence of peptide synthesis machinery

Indian Academy of Sciences (India)

suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

Energy Technology Data Exchange (ETDEWEB)

Kolb, V A; Kammer, A A; Spirin, A S

1987-01-01

The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

Directory of Open Access Journals (Sweden)

Gayani N. P. Dedduwa-Mudalige

2015-09-01

Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Jun-ichi Kakehi

Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

An unusual clinical presentation of gingival melanoacanthoma

Directory of Open Access Journals (Sweden)

S. P. K. Kennedy Babu

2013-01-01

Full Text Available Gingival melanoacanthoma is a rare, benign pigmented lesion characterized clinically by sudden onset and rapid growth of a macular brown black lesion and histologically by acanthosis of superficial epithelium and proliferation of dendritic melanocytes. This article reports a previously undescribed case of pigmented unilateral diffuse gingival enlargement, which on histopathological examination proved to be melanoacanthoma. Intraoral examination revealed pigmented unilateral diffuse gingival enlargement in relation to second and third quadrants buccally, palatally/lingually. Based on these clinical findings, gingivectomy was performed and the excised tissue was sent for biopsy. Microscopic examination revealed acanthotic and parakeratotic surface epithelium with dendritic melanocytes distributed in basal and suprabasal layers of the epithelium. 1 year follow-up recall revealed no recurrence of lesion at the surgical sites. Our patient exhibits an unusual clinical presentation of melanoacanthoma of gingiva. Pigmented gingival overgrowth of recent origin and without any etiologic factors warrants histopathologic examination.

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

Science.gov (United States)

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

Energy Technology Data Exchange (ETDEWEB)

Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

2011-09-02

Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

Directory of Open Access Journals (Sweden)

Deborah Chiabrando

2010-01-01

Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

Science.gov (United States)

Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

2006-02-01

Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

Science.gov (United States)

Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

2012-05-01

The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

Directory of Open Access Journals (Sweden)

Hyouta eHimeno

2014-04-01

Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

A streamlined ribosome profiling protocol for the characterization of microorganisms

DEFF Research Database (Denmark)

Latif, Haythem; Szubin, Richard; Tan, Justin

2015-01-01

Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

Is The Ribosome Targeted By Adaptive Mutations

DEFF Research Database (Denmark)

Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

2015-01-01

Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

Transparent control of three-body selective destruction of tunneling via unusual states

International Nuclear Information System (INIS)

Luo, Yunrong; Tan, Jintao; Hai, Wenhua; Lu, Gengbiao

2015-01-01

We study transparent control of quantum tunneling via unusual analytical solutions for three bosons held in a driven double-well. Under high-frequency approximation, we analytically obtain the fine band structure and general non-Floquet state. At some collapse points of the quasi-energy spectra, the latter becomes the unusual special states. Based on the analytical results and their numerical correspondences, we clearly reveal the mechanism of coherent tunneling and suggest a scheme to transparently control the tunneling of three bosons from one well to another. The results can be observed with the current experimental capability (Chen et al 2011 Phys. Rev. Lett. 107 210405) (paper)

Simulating movement of tRNA through the ribosome during hybrid-state formation.

Science.gov (United States)

Whitford, Paul C; Sanbonmatsu, Karissa Y

2013-09-28

Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

Science.gov (United States)

Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

2013-07-01

Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

Unusual manifestations of secondary urothelial carcinoma

Directory of Open Access Journals (Sweden)

Chaohui Lisa Zhao

2016-03-01

Full Text Available High-grade papillary urothelial carcinoma regularly invades the bladder wall, adjacent prostate, seminal vesicles, ureters, vagina, rectum, retroperitoneum, and regional lymph nodes. In advanced stages, it may disseminate to the liver, lungs, and bone marrow. On rare occasions, unusual metastatic foci like skin have been reported. The incidence of urothelial carcinoma has increased with associated rise in variants of urothelial carcinoma and unusual metastatic foci. It is imperative that urologists and pathologists are aware of the unusual variants and unusual metastatic locations to expedite the diagnostic process. Hereby we report an unusual case of secondary involvement of spinal nerve by conventional urothelial carcinoma. Also a second case of rhabdoid variant of urothelial carcinoma showing synchronous involvement of bladder and subcutaneous tissue of upper extremity is presented.

Unusual headache syndromes.

Science.gov (United States)

Queiroz, Luiz P

2013-01-01

Some headache syndromes have few cases reported in the literature. Their clinical characteristics, pathogenesis, and treatment may have not been completely defined. They may not actually be uncommon but rather under-recognized and/or underreported. A literature review of unusual headache syndromes, searching PubMed and ISI Web of Knowledge, was performed. After deciding which disorders to study, relevant publications in scientific journals, including original articles, reviews, meeting abstracts, and letters or correspondences to the editors were searched. This paper reviewed the clinical characteristics, the pathogenesis, the diagnosis, and the treatment of five interesting and unusual headache syndromes: exploding head syndrome, red ear syndrome, neck-tongue syndrome, nummular headache, and cardiac cephalgia. Recognizing some unusual headaches, either primary or secondary, may be a challenge for many non-headache specialist physicians. It is important to study them because the correct diagnosis may result in specific treatments that may improve the quality of life of these patients, and this can even be life saving. © 2013 American Headache Society.

rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

OpenAIRE

O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

2013-01-01

Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

Science.gov (United States)

Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

2008-01-01

Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

Science.gov (United States)

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

Science.gov (United States)

Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

2013-09-01

Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

Energy Technology Data Exchange (ETDEWEB)

Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

2016-11-01

Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

DEFF Research Database (Denmark)

Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

2005-01-01

We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

Secondary structure of the rRNA ITS2 region reveals key evolutionary patterns in acroporid corals.

Science.gov (United States)

Coleman, Annette W; van Oppen, Madeleine J H

2008-10-01

This study investigates the ribosomal RNA transcript secondary structure in corals as confirmed by compensatory base changes in Isopora/Acropora species. These species are unique versus all other corals in the absence of a eukaryote-wide conserved structural component, the helix III in internal transcriber spacer (ITS) 2, and their variability in the 5.8S-LSU helix basal to ITS2, a helix with pairings identical among all other scleractinian corals. Furthermore, Isopora/Acropora individuals display at least two, and as many as three, ITS sequence isotypes in their genome which appear to be capable of function. From consideration of the conserved elements in ITS2 and flanking regions, it appears that there are three major groups within the IsoporaAcropora lineage: the Isopora + Acropora "longi" group, the large group including Caribbean Acropora + the Acropora "carib" types plus the bulk of the Indo-Pacific Acropora species, and the remaining enigmatic "pseudo" group found in the Pacific. Interbreeding is possible among Caribbean A. palmata and A. cervicornis and among some species of Indo-Pacific Acropora. Recombinant ITS sequences are obvious among these latter, such that morphology (as represented by species name) does not correlate with common ITS sequence. The combination of characters revealed by RNA secondary structure analyses suggests a recent past/current history of interbreeding among the Indo-Pacific Acropora species and a shared ancestry of some of these with the Caribbean Acropora. The unusual absence of helix III of ITS2 of Isopora/Acropora species may have some causative role in the equally unusual instability in the 5.8S-LSU helix basal to ITS2 of this species complex.

An unusual case of total ophthalmoplegia

Directory of Open Access Journals (Sweden)

Chowdhury Ravindra

2009-01-01

Full Text Available An eight-year-old male child presented with drooping of the left eyelid with a history of penetrating injury of hard palate by an iron spoon seven days ago, which had already been removed by the neurosurgeon as the computed tomography scan revealed a spoon in the left posterior ethmoid and sphenoid bone penetrating into the middle cranial fossa. On examination, visual acuity was 20/20 in each eye and left eye showed total ophthalmoplegia. Oral cavity revealed a hole in the left lateral part of the hard palate. We managed the case with tapering dose of systemic prednisolone. The total ophthalmoplegia was markedly improved in one month. Cases of foreign bodies in the orbit with intracranial extension are not unusual, but the path this foreign body traveled through the hard palate without affecting the optic nerve, internal carotid artery or cavernous sinus makes an interesting variation.

Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

Institute of Scientific and Technical Information of China (English)

Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

2017-01-01

As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

Proteinase 3 carries small unusual carbohydrates and associates with αlpha-defensins

DEFF Research Database (Denmark)

Zoega, Morten; Ravnsborg, Tina; Højrup, Peter

2012-01-01

with carbohydrates at Asn 102 and 147 carrying unusual small moieties indicating heavy processing. Mass spectrometric analysis and immuno blotting revealed strong association of highly purified PR3 with α-defensins and oligomers hereof. Irreversible inhibition of PR3 by α1-antitrypsin did not affect its association...

Unusual structural transition of antimicrobial VP1 peptide.

Science.gov (United States)

Shanmugam, Ganesh; Phambu, Nsoki; Polavarapu, Prasad L

2011-05-01

VP1 peptide, an active domain of m-calpain enzyme with antimicrobial activity is found to undergo an unusual conformational transition in trifluoroethanol (TFE) solvent. The nature of, and time dependent variations in, circular dichroism associated with the amide I vibrations, suggest that VP1 undergoes self-aggregation forming anti-parallel β-sheet structure in TFE. Transmission electron micrograph (TEM) images revealed that β-sheet aggregates formed by VP1 possess fibril-like assemblies. Copyright © 2011 Elsevier B.V. All rights reserved.

Cervical Lymph Node Metastasis: Unusual Presentation of Adenoid Cystic Carcinoma - Diagnosed By FNAC

Directory of Open Access Journals (Sweden)

Archana Buch

2015-01-01

Full Text Available Adenoid cystic carcinoma (ACC is a rare neoplasm that usually arises from minor salivary glands. It is characteristically locally infiltrative, exhibiting perineural invasion, has a tendency for local recurrence and prolonged clinical course. A 60 year old male, chronic smoker presented with swelling of the left cervical lymph node since two months. Examination revealed a solitary firm, non tender, non mobile left cervical swelling measuring 2 x 1 cm. Fine Needle Aspiration Cytology (FNAC was done from the cervical lymph node. The diagnosis of metastatic deposits of ACC was given. Detail examination of the oral cavity revealed a small swelling at the floor of the mouth. Biopsy of the swelling confirmed ACC on histopathological examination. An unusual feature of adenoid cystic carcinoma is the low incidence of metastases to regional lymph nodes. The case is presented to highlight its unusual presentation and utility of FNAC in rapid diagnosis.

Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

Energy Technology Data Exchange (ETDEWEB)

Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

1978-01-01

Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

Assembly constraints drive co-evolution among ribosomal constituents.

Science.gov (United States)

Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

2015-06-23

Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

DEFF Research Database (Denmark)

Long, K. S.; Hansen, L. K.; Jakobsen, L.

2006-01-01

Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

International Nuclear Information System (INIS)

Ekert, Bernard; Giocanti, Nicole

1976-01-01

γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

DEFF Research Database (Denmark)

Tchórzewski, M; Boldyreff, B; Issinger, O

2000-01-01

The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

Structure of the Human Mitochondrial Ribosome Studied In Situ by Cryoelectron Tomography.

Science.gov (United States)

Englmeier, Robert; Pfeffer, Stefan; Förster, Friedrich

2017-10-03

Mitochondria maintain their own genome and its corresponding protein synthesis machine, the mitochondrial ribosome (mitoribosome). Mitoribosomes primarily synthesize highly hydrophobic proteins of the inner mitochondrial membrane. Recent studies revealed the complete structure of the isolated mammalian mitoribosome, but its mode of membrane association remained hypothetical. In this study, we used cryoelectron tomography to visualize human mitoribosomes in isolated mitochondria. The subtomogram average of the membrane-associated human mitoribosome reveals a single major contact site with the inner membrane, mediated by the mitochondria-specific protein mL45. A second rRNA-mediated contact site that is present in yeast is absent in humans, resulting in a more variable association of the human mitoribosome with the inner membrane. Despite extensive structural differences of mammalian and fungal mitoribosomal structure, the principal organization of peptide exit tunnel and the mL45 homolog remains invariant, presumably to align the mitoribosome with the membrane-embedded insertion machinery. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

Science.gov (United States)

Högenauer, G; Ruf, C

1981-01-01

Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

Ribosome•RelA structures reveal the mechanism of stringent response activation

Science.gov (United States)

Loveland, Anna B; Bah, Eugene; Madireddy, Rohini; Zhang, Ying; Brilot, Axel F; Grigorieff, Nikolaus; Korostelev, Andrei A

2016-01-01

Stringent response is a conserved bacterial stress response underlying virulence and antibiotic resistance. RelA/SpoT-homolog proteins synthesize transcriptional modulators (p)ppGpp, allowing bacteria to adapt to stress. RelA is activated during amino-acid starvation, when cognate deacyl-tRNA binds to the ribosomal A (aminoacyl-tRNA) site. We report four cryo-EM structures of E. coli RelA bound to the 70S ribosome, in the absence and presence of deacyl-tRNA accommodating in the 30S A site. The boomerang-shaped RelA with a wingspan of more than 100 Å wraps around the A/R (30S A-site/RelA-bound) tRNA. The CCA end of the A/R tRNA pins the central TGS domain against the 30S subunit, presenting the (p)ppGpp-synthetase domain near the 30S spur. The ribosome and A/R tRNA are captured in three conformations, revealing hitherto elusive states of tRNA engagement with the ribosomal decoding center. Decoding-center rearrangements are coupled with the step-wise 30S-subunit 'closure', providing insights into the dynamics of high-fidelity tRNA decoding. DOI: http://dx.doi.org/10.7554/eLife.17029.001 PMID:27434674

Vaginal haemangioendothelioma: an unusual tumour.

LENUS (Irish Health Repository)

Mohan, H

2012-02-01

Vaginal tumours are uncommon and this is a particularly rare case of a vaginal haemangioendothelioma in a 38-year-old woman. Initial presentation consisted of symptoms similar to uterovaginal prolapse with "something coming down". Examination under anaesthesia demonstrated a necrotic anterior vaginal wall tumour. Histology of the lesion revealed a haemangioendothelioma which had some features of haemangiopericytoma. While the natural history of vaginal haemangioendothelioma is uncertain, as a group, they have a propensity for local recurrence. To our knowledge this is the third reported case of a vaginal haemangioendothelioma. Management of this tumour is challenging given the paucity of literature on this tumour. There is a need to add rare tumours to our "knowledge bank" to guide management of these unusual tumours.

Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

Science.gov (United States)

Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

1998-01-01

Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

48 CFR 32.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 32.114 Unusual contract financing. Any contract financing arrangement that deviates from this part is unusual contract financing...

Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

International Nuclear Information System (INIS)

Tejedor, F.; Amils, R.; Ballesta, J.P.

1985-01-01

Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

48 CFR 432.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.114 Unusual contract financing. The HCA is authorized to approve unusual contract financing. The signed determination and finding...

48 CFR 1332.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 1332.114 Unusual contract financing. The designee authorized to approve unusual contract financing arrangements is set forth in CAM...

Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

International Nuclear Information System (INIS)

Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

1982-01-01

The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

Enterovirus 71-related encephalomyelitis: usual and unusual magnetic resonance imaging findings

International Nuclear Information System (INIS)

Jang, Seonah; Suh, Sang-Il; Ha, Su Min; Seol, Hae-Young; Byeon, Jung Hye; Eun, Baik-Lin; Lee, Young Hen; Seo, Hyung Suk; Eun, So-Hee

2012-01-01

Most enterovirus (EV) 71 infections manifest as mild cases of hand-foot-mouth disease (HFMD)/herpangina with seasonal variations, having peak incidence during the summer. Meanwhile, EV 71 may involve the central nervous system (CNS), causing severe neurologic disease. In many cases, enteroviral encephalomyelitis involves the central midbrain, posterior portion of the medulla oblongata and pons, bilateral dentate nuclei of the cerebellum, and the ventral roots of the cervical spinal cord, and the lesions show hyperintensity on T2-weighted and fluid-attenuation inversion recovery (FLAIR) images. Our goal was to review usual and unusual magnetic resonance (MR) findings in CNS involvement of enteroviral infection. Among consecutive patients who had HFMD and clinically suspected encephalitis or myelitis and who underwent brain or spinal MR imaging, five patients revealed abnormal MR findings. Diffusion-weighted and conventional MR and follow-up MR images were obtained. From cerebrospinal fluid, stool, or nasopharyngeal swabs, EV 71 was confirmed in all patients. MR imaging studies of two patients showed hyperintensity in the posterior portion of the brainstem on T2-weighted and FLAIR images, which is the well-known MR finding of EV 71 encephalitis. The remaining three cases revealed unusual manifestations: leptomeningeal enhancement, abnormal enhancement along the ventral roots at the conus medullaris level without brain involvement, and hyperintensity in the left hippocampus on T2/FLAIR images. EV 71 encephalomyelitis shows relatively characteristic MR findings; therefore, imaging can be helpful in radiologic diagnosis. However, physicians should also be aware of unusual radiologic manifestations of EV 71. (orig.)

Enterovirus 71-related encephalomyelitis: usual and unusual magnetic resonance imaging findings

Energy Technology Data Exchange (ETDEWEB)

Jang, Seonah; Suh, Sang-Il; Ha, Su Min; Seol, Hae-Young [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Byeon, Jung Hye; Eun, Baik-Lin [Korea University Guro Hospital, Korea University College of Medicine, Department of Pediatrics, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Ansan (Korea, Republic of); Eun, So-Hee [Korea University Ansan Hospital, Korea University College of Medicine, Department of Pediatrics, Ansan (Korea, Republic of)

2012-03-15

Most enterovirus (EV) 71 infections manifest as mild cases of hand-foot-mouth disease (HFMD)/herpangina with seasonal variations, having peak incidence during the summer. Meanwhile, EV 71 may involve the central nervous system (CNS), causing severe neurologic disease. In many cases, enteroviral encephalomyelitis involves the central midbrain, posterior portion of the medulla oblongata and pons, bilateral dentate nuclei of the cerebellum, and the ventral roots of the cervical spinal cord, and the lesions show hyperintensity on T2-weighted and fluid-attenuation inversion recovery (FLAIR) images. Our goal was to review usual and unusual magnetic resonance (MR) findings in CNS involvement of enteroviral infection. Among consecutive patients who had HFMD and clinically suspected encephalitis or myelitis and who underwent brain or spinal MR imaging, five patients revealed abnormal MR findings. Diffusion-weighted and conventional MR and follow-up MR images were obtained. From cerebrospinal fluid, stool, or nasopharyngeal swabs, EV 71 was confirmed in all patients. MR imaging studies of two patients showed hyperintensity in the posterior portion of the brainstem on T2-weighted and FLAIR images, which is the well-known MR finding of EV 71 encephalitis. The remaining three cases revealed unusual manifestations: leptomeningeal enhancement, abnormal enhancement along the ventral roots at the conus medullaris level without brain involvement, and hyperintensity in the left hippocampus on T2/FLAIR images. EV 71 encephalomyelitis shows relatively characteristic MR findings; therefore, imaging can be helpful in radiologic diagnosis. However, physicians should also be aware of unusual radiologic manifestations of EV 71. (orig.)

Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

Science.gov (United States)

Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

2013-08-08

Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

Unusual imaging presentation of spinal glomus tumor: case report

OpenAIRE

Kuo, Chao-Hung; Huang, Wen-Cheng; Wu, Jau-Ching

2017-01-01

A glomangioma, also known as a glomus tumor, is a benign lesion and had rare occurrence of spine region. In this study, we presented a spinal glomus tumor with an unusual radiological presentation, which is different from osteolytic intraosseous patterns illustrated before. A 26-year-old male with compressive myelopathy caused by epidural intraspinal lesion over T11 level. Radiological presentation revealed reactive sclerotic change over the body and lamina was found on the same level in comp...

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

A new version of the RDP (Ribosomal Database Project)

Science.gov (United States)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

An unusual manifestation of acute appendicitis with left flank pain

Directory of Open Access Journals (Sweden)

Roland Talanow, MD, PhD

2008-08-01

Full Text Available The author presents a case with an unusual presentation of early appendicitis. The patient presented initially with left sided flank pain. Workup for nephrolithiasis, including non-contrast CT of the abdomen and pelvis was negative for renal stones or hydronephrosis. After discharge, the patient presented one week later in the ED with right lower quadrant pain. Contrast enhanced CT of the abdomen revealed perforated appendicitis.

Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

Science.gov (United States)

Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

2017-09-01

Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

Endodontic treatment of an unusual connation of permanent mandibular molars: a case report.

Science.gov (United States)

Liu, Shengbo; Fan, Bing; Peng, Bin; Fan, Mingwen; Bian, Zhuan

2006-10-01

A 27-year-old patient with an anomalous mandibular molar was referred for endodontic therapy. Clinical and radiographic examination revealed the connation of a second mandibular molar with a third molar. Challenging endodontic therapy was performed in the unusual connated molars. A 2-year recall showed good treatment result.

Pactamycin binding site on archaebacterial and eukaryotic ribosomes

International Nuclear Information System (INIS)

Tejedor, F.; Amils, R.; Ballesta, J.P.G.

1987-01-01

The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

Ribosome-catalyzed formation of an abnormal peptide analogue

International Nuclear Information System (INIS)

Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

1986-01-01

The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

Science.gov (United States)

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

Science.gov (United States)

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

Directory of Open Access Journals (Sweden)

Shunfei Yan

2017-01-01

Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

Science.gov (United States)

Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

2018-03-15

Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

Incidental discovery of an unusual right atrial membrane in an adult patient

Directory of Open Access Journals (Sweden)

Nasrin N Aldawoodi

2012-01-01

Full Text Available We describe presence of an unusual right atrial membrane in a 30-year old female with end stage renal disease, hypertension and peripheral vascular disease. The patient was scheduled for midline sternotomy and pericardiotomy and removal of a migrated vascular stent in the right pulmonary artery. An intraoperative transesophageal echocardiogram (TEE revealed an unusual membranous structure with fenestrations that stretched across the right atrium with attachments superiorly at the free wall and inferiorly at the inter-atrial septum. There was no evidence of flow obstruction across the tricuspid valve. Some of the considerations for the likely diagnosis of this structure were a prominent Eustachian valve, persistent Chiari network, aneurysmal inter-atrial septum, an inter-atrial septal cyst or Cor triatriatum dexter (CTD.

Radiographic evaluation and unusual bone formations in different genetic patterns in synpolydactyly

International Nuclear Information System (INIS)

Yucel, Aylin; Acar, Murat; Kuru, Ilhami; Bozan, M. Eray; Solak, Mustafa

2005-01-01

To compare the radiological findings of heterozygous and homozygous subjects with synpolydactyly (SPD) and to discuss their unusual bone formations. Families with hand and foot SPD were examined. Genetic analysis was performed with blood samples and the pedigree was constructed. The affected individuals, especially those with distinctive phenotypic features, were invited to our orthopaedics clinic for further diagnostic studies. All participants underwent detailed clinical and X-ray examinations. Of the invited patients, 16 (five female and 11 male; age range 4-37 years, mean age 10.75 years) were included in our study, and hand and foot radiographs were obtained. All subjects had bilateral hand radiographs (32 hands), and 14 had bilateral foot radiographs (28 feet). Genetic analysis revealed 12 heterozygote (75%) and four (25%) homozygote phenotypes. Among patients enrolled into the study nine (three homozygotes, six heterozygotes) had SPD of both hands and feet bilaterally (tetrasynpolydactyly). Six unusual bone formations were observed in the hands and feet: delta phalanx, delta metacarpal/metatarsal, kissing delta phalanx, true double epiphysis, pseudoepiphysis and cone-shaped epiphysis. There were major differences in radiological and clinical manifestations of homozygote and heterozygote phenotypes. The homozygous SPD presented with very distinctive unusual bone formations. The existence and variety of unusual bones may indicate the severity of penetrance and expressivity of SPD. (orig.)

Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

Science.gov (United States)

Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

2016-07-01

The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

Science.gov (United States)

Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

2011-01-01

We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

DEFF Research Database (Denmark)

Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

2018-01-01

Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

Lassomycin, a ribosomally synthesized cyclic peptide, kills mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2.

Science.gov (United States)

Gavrish, Ekaterina; Sit, Clarissa S; Cao, Shugeng; Kandror, Olga; Spoering, Amy; Peoples, Aaron; Ling, Losee; Fetterman, Ashley; Hughes, Dallas; Bissell, Anthony; Torrey, Heather; Akopian, Tatos; Mueller, Andreas; Epstein, Slava; Goldberg, Alfred; Clardy, Jon; Lewis, Kim

2014-04-24

Languishing antibiotic discovery and flourishing antibiotic resistance have prompted the development of alternative untapped sources for antibiotic discovery, including previously uncultured bacteria. Here, we screen extracts from uncultured species against Mycobacterium tuberculosis and identify lassomycin, an antibiotic that exhibits potent bactericidal activity against both growing and dormant mycobacteria, including drug-resistant forms of M. tuberculosis, but little activity against other bacteria or mammalian cells. Lassomycin is a highly basic, ribosomally encoded cyclic peptide with an unusual structural fold that only partially resembles that of other lasso peptides. We show that lassomycin binds to a highly acidic region of the ClpC1 ATPase complex and markedly stimulates its ATPase activity without stimulating ClpP1P2-catalyzed protein breakdown, which is essential for viability of mycobacteria. This mechanism, uncoupling ATPase from proteolytic activity, accounts for the bactericidal activity of lassomycin. Copyright © 2014 Elsevier Ltd. All rights reserved.

Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

Science.gov (United States)

2017-02-01

and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

Science.gov (United States)

Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

2004-01-01

Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

An Unusual Case of Rapidly Progressive Hyperbilirubinemia

Directory of Open Access Journals (Sweden)

Kimberly M. Thornton

2013-01-01

Full Text Available We present an unusual case of hyperbilirubinemia with rapid early progression leading to bilirubin encephalopathy in a term neonate. Despite early recognition and intervention, the total serum bilirubin reached a maximum level of 39 mg/dL at 32 hours of life. Prior to an emergent exchange transfusion, the patient’s diagnostic evaluation was significant for Coombs-negative microangiopathic hemolytic anemia and thrombocytopenia. Further testing revealed a deficiency of ADAMTS13 protein, or von Willebrand factor-cleaving protease, a finding diagnostic of congenital thrombotic thrombocytopenic purpura, or Upshaw-Schulman syndrome. This rare disease is often misdiagnosed, especially in the newborn period.

An unusual presentation of multiple cavitated lung metastases from colon carcinoma

Directory of Open Access Journals (Sweden)

Iannace Alessandro

2011-05-01

Full Text Available Abstract Background Consolidation with or without ground-glass opacity is the typical radiologic finding of lung metastases of adenocarcinoma from the gastrointestinal tract. Lung excavated metastases from gastrointestinal carcinoma are very rare. Case presentation The authors describe an unusual presentation of multiple cavitated lung metastases from colon adenocarcinoma and discuss the outcome of a patient. The absence both of symptoms and other disease localizations, the investigations related to different diagnostic hypotheses and the empirical treatments caused a delay in correct diagnosis. Only a transparietal biopsy revealed the neoplastic origin of nodules. Conclusions This report demonstrates that although lung excavated metastases are described in literature, initial failure to reach a diagnosis is common. We would like to alert clinicians and radiologists to the possibility of unusual atypical features of pulmonary metastases from colon adenocarcinoma.

Unusual Case of Severe Lactic Acidosis in a Liver Transplant Patient

Directory of Open Access Journals (Sweden)

Shweta Yemul Golhar

2017-01-01

Full Text Available Lactic acidosis is a standard indicator for oxygen debt and some other very significant causes. We describe a case of liver transplant patient presenting with vague abdominal pain and lactic acidosis without any liver dysfunction/failure/ischemia/rejection or sepsis. The imaging studies showed vague bowel edema and normal hepatic perfusion. The patient continued to deteriorate with rising lactic acidosis when a repeat CT abdomen eventually showed signs of lymphomatosis peritonei. Biopsy revealed the unusual diagnosis of posttransplant lymphoproliferative disorder. Immediate discontinuation of immunosuppression and initiation of chemotherapy led to clinical improvement. Our intention of presenting this case is to increase awareness of posttransplant lymphoma and propose lactic acidosis as not only an indicator of liver dysfunction or rejection but also an aid for diagnosis of this unusual but fatal and potentially curable condition.

Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

Science.gov (United States)

Mallik, Saurav; Kundu, Sudip

2015-01-01

Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

Defining the bacteroides ribosomal binding site.

Science.gov (United States)

Wegmann, Udo; Horn, Nikki; Carding, Simon R

2013-03-01

The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

Energy Technology Data Exchange (ETDEWEB)

Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

2017-08-28

Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

Emergence of robust growth laws from optimal regulation of ribosome synthesis.

Science.gov (United States)

Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence

2014-08-22

Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

Science.gov (United States)

He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

2009-12-31

We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

The structure of an unusual leghemoglobin gene from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1983-01-01

A clone containing an unusual leghemoglobin (Lb) gene was isolated from a soybean DNA library present in Charon 4A phage. DNA sequence analysis revealed that the isolated Lb gene has three intervening sequences (IVS-1, IVS-2 and IVS-3) located in the same positions as those found in other Lb gene...... is mutated in two regions which seem to be important for transcription. It is, therefore, tentatively suggested that the isolated Lb gene is non-functional, and consequently is an Lb pseudogene. Udgivelsesdato: 1983-null...

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

Directory of Open Access Journals (Sweden)

Mickey R. Miller

2014-09-01

Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

Unusual Metastatic Patterns of Invasive Lobular Carcinoma of the Breast

OpenAIRE

Sobinsky, Justin D.; Willson, Thomas D.; Podbielski, Francis J.; Connolly, Mark M.

2013-01-01

Invasive lobular carcinoma of the breast has similar patterns of metastatic disease when compared to invasive ductal carcinoma; however, lobular carcinoma metastasizes to unusual sites more frequently. We present a 65-year-old female with a history of invasive lobular breast carcinoma (T3N3M0) treated with modified radical mastectomy and aromatase-inhibitor therapy who underwent a surveillance PET scan, which showed possible sigmoid cancer. Colonoscopy with biopsy revealed a 3?cm sigmoid aden...

Interplay of ribosomal DNA loci in nucleolar dominance: dominant NORs are up-regulated by chromatin dynamics in the wheat-rye system.

Directory of Open Access Journals (Sweden)

Manuela Silva

Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin

Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

Science.gov (United States)

Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

2015-06-01

The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

Science.gov (United States)

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

An unusually strong Einstein ring in the radio source PKS1830-211

International Nuclear Information System (INIS)

Jauncey, D.L.

1991-01-01

RADIO observations of the strong, flat-spectrum radio source PKS1830-211 revealed a double structure, with a separation of 1 arcsec, suggesting that it might be a gravitationally lensed object. We have now obtained high-resolution radio images of PKS1830-211 from several interferometric radiotelescope networks, which show an unusual elliptical ring-like structure connecting the two brighter components. The presence of the ring, and the similarity of the two brighter spots, argue strongly that this is indeed a gravitationally lensed system, specifically an Einstein ring in which lens and lensed object are closely aligned. Although the source is close to the galactic plane, it seems that both the lens and background (lensed) object are extragalactic. This object is one hundred times brighter than either of the two previously discovered radio Einstein rings, and is among the six brightest flat-spectrum sources in the sky. Its brightness makes it a peculiar object: it must involve either a chance alignment of a lensing object with an unusually bright background source, or an alignment with a less bright object but amplified to an unusual degree. (author)

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

Science.gov (United States)

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

2015-11-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

(Brassicaceae) based on nuclear ribosomal ITS DNA sequences

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

Architecture of the E.coli 70S ribosome

DEFF Research Database (Denmark)

Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

1997-01-01

The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

Directory of Open Access Journals (Sweden)

Ian M Willis

2008-07-01

Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

Unusual Presentation of Popliteal Cyst on Magnetic Resonance Imaging

Directory of Open Access Journals (Sweden)

Tsuyoshi Ohishi

2016-01-01

Full Text Available Popliteal cyst commonly presents as an ellipsoid mass with uniform low signal intensity on T1-weighted magnetic resonance images and high signal intensity on T2-weighted images. Here, we describe a popliteal cyst with unusual appearance on magnetic resonance imaging, including heterogeneous intermediate signal intensity on T2-weighted images. Arthroscopic cyst decompression revealed that the cyst was filled with necrotic synovial villi, indicative of rheumatoid arthritis. Arthroscopic enlargement of unidirectional valvular slits with synovectomy was useful for the final diagnosis and treatment.

p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

Directory of Open Access Journals (Sweden)

Kiran Hasygar

2014-11-01

Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

NARCIS (Netherlands)

Linskens, Maarten H.K.; Huberman, Joel A.

1988-01-01

Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

Ribosomal DNA internal transcribed spacer 1 and internal ...

African Journals Online (AJOL)

USER

2010-07-26

Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

Temporo-mandibular joint dislocation: an unusual complication of transoesophageal echocardiography.

Science.gov (United States)

Anantharam, Brijesh; Chahal, Navtej; Stephens, Nigel; Senior, Roxy

2010-03-01

Temporo-mandibular joint (TMJ) dislocation is an unusual complication of transoesophageal echocardiography (TEE). We report a rare case of bilateral TMJ dislocation in an 84-year-old man prior to DC cardioversion (DCCV) for atrial flutter. Shortly after TEE and DCCV, the patient complained of bilateral facial pain. An orthopantomogram revealed bilateral TMJ dislocation. A closed reduction was performed by maxillo-facial surgeons under intravenous anaesthesia. Although very uncommon, the physician should be aware of the complication and its management.

Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

International Nuclear Information System (INIS)

Tejedor, F.; Ballesta, J.P.

1986-01-01

Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

Science.gov (United States)

Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

2017-12-01

Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

Science.gov (United States)

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

Science.gov (United States)

Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

2012-12-18

Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

DEFF Research Database (Denmark)

Long, Katherine S.; Vester, Birte

2012-01-01

Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

DEFF Research Database (Denmark)

Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

2017-01-01

Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

Science.gov (United States)

1975-01-01

In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

Science.gov (United States)

Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

2015-11-10

Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

Imaging Findings of an Unusually Located Hydatid Cyst Presented as a Sacrococcygeal Mass

International Nuclear Information System (INIS)

Yilmaz, Guliz; Halil Akpinar, Suha

2015-01-01

Hydatid disease (HD) is a parasitic infection that is most commonly caused by the larval stage of Echinococcus granulosus. Unusual location for this disease can cause diagnostic and therapeutic problems. We herein report a case of sacrococcygeal HD at an unusual location in a 30-year-old woman. She was evaluated using computed tomography (CT) imaging and magnetic resonance imaging (MRI) after the demonstration of the lucent bone lesion on plain pelvic radiography. There was an expansile lytic mass without contrast enhancement suggesting a cystic mass in the sacrococcygeal region. Medical history revealed that she had undergone surgery for liver HD and the serological test results were diagnostic for HD. In light of this, no surgery was carried out for this cystic mass and she was followed with the diagnosis of sacrococcygeal HD

Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

Science.gov (United States)

Nikolaitchik, Olga A; Hu, Wei-Shau

2014-04-01

A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

Unusual Fears in Children with Autism

Science.gov (United States)

Mayes, Susan Dickerson; Calhoun, Susan L.; Aggarwal, Richa; Baker, Courtney; Mathapati, Santosh; Molitoris, Sarah; Mayes, Rebecca D.

2013-01-01

Unusual fears have long been recognized as common in autism, but little research exists. In our sample of 1033 children with autism, unusual fears were reported by parents of 421 (41%) of the children, representing 92 different fears. Many additional children had common childhood fears (e.g., dogs, bugs, and the dark). More than half of children…

Unusual radiological findings of adult-onset pulmonary tuberculosis

International Nuclear Information System (INIS)

Lee, Yong Chul; Lee, Jong Beum; Kim, Sue Hyun

1987-01-01

Usual chest radiographic findings in pulmonary tuberculosis are well described in radiologic literatures for both primary and postprimary phases of disease. During the last decade, many authors have enumerated the unusual manifestations of pulmonary tuberculosis in adult population. These unusual findings usually have been involved in the frequent failure of both radiologist and clinician to recognize that tuberculosis could be the cause of a abnormal chest radiograph in patients who are finally and surprisingly proven to have tuberculosis. Authors have evaluated 249 patients who were admitted and newly proven to have adult-onset pulmonary tuberculosis at Chung-Ang University Hospital from January, 1985 to December, 1986. Unusual findings were noted in 76 (30.5%) of the 249 patients with adult-onset pulmonary tuberculosis. These unusual findings most frequently could be seen in 3rd decades and showed no sex difference in incidence. A broad spectrum of abnormal findings including usual and unusual abnormalities were procedure by adult-onset pulmonary tuberculosis. The unusual radiographic findings were arbitrarily classified. Pleural effusion without parenchymal disease (10.0%), unusual location of infiltrate (5.6%) and atelectasis (3.2%) were relatively common. Hilar and / or mediastinal lymphnode enlargement (1.6%), cavity without parenchymal infiltrates (1.6%), septic lung-like infiltrates (1.6%), completely clear lungs (1.2%), miliary infiltrates (1.2%), fibrocalcific scar-like infiltrates (1.2%), masslike density (1.2%) and rheumatoid lung-like infiltrates (1.2%) were occasionally noted. Pneumothorax without parenchymal disease (0.4%) and bron chocutaneous fistula (0.4%) are. The recognition of these unusual findings could further improve the detection and diagnosis of adult-onset pulmonary tuberculosis

Myasthenia Gravis: Unusual Presentations and Diagnostic Pitfalls.

Science.gov (United States)

Rodolico, Carmelo; Parisi, Daniela; Portaro, Simona; Biasini, Fiammetta; Sinicropi, Stefano; Ciranni, Annamaria; Toscano, Antonio; Messina, Sonia; Musumeci, Olimpia; Vita, Giuseppe; Girlanda, Paolo

2016-08-30

Myasthenia gravis (MG) is an autoimmune disorder presenting with fluctuating, fatigable muscle weakness. Initial symptoms classically involve ocular and proximal limb muscles. Rarely, MG may onset with unusual features, so it can be misdiagnosed with other neuromuscular diseases. To describe unusual and atypical presentations of MG in a large cohort of patients, considering and discussing diagnostic difficulties and pitfalls. We report on 21 out of 508 MG patients, coming to our department in the last 27 years and presenting with atypical or unusual features. The diagnosis was achieved performing a careful clinical examination, a proper neurophysiological assessment, the neostigmine test, the AChR and MuSK antibodies assay and chest CT-scan. Patients with atypical/unusual MG onset were the 4.4% of all MG patients population. We describe seven different clinical categories: asymmetric distal upper limbs weakness, foot drop, isolated triceps brachii weakness and foot drop, post exertional axial weakness with dropped head, acute facial dyplegia, limb-girdle MG and MG with sudden lower limbs weakness and recurrent falls. Atypical and unusual presentations may increase the risk to misdiagnose or delay MG diagnosis. Isolated limb-girdle presentation is the most frequent atypical form in our series.

Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

Science.gov (United States)

Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

2017-05-01

The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

An unusual presentation of a malignant jejunal tumor and a different management strategy

Directory of Open Access Journals (Sweden)

Parida Dillip K

2005-01-01

Full Text Available Abstract Background Malignant small bowel tumors are very rare and leiomyosarcoma accounts for less than 15% of the cases. Management of these tumors is challenging in view of nonspecific symptoms, unusual presentation and high incidence of metastasis. In this case report, an unusual presentation of jejunal sarcoma and management of liver metastasis with radiofrequency ablation (RFA is discussed. Case presentation A 45-year-old male presented with anemia and features of small bowel obstruction. Operative findings revealed a mass lesion in jejunum with intussusception of proximal loop. Resection of bowel mass was performed. Histopathological findings were suggestive of leiomyosarcoma. After 3-years of follow-up, the patient developed recurrence in infracolic omentum and a liver metastasis. The omental mass was resected and liver lesion was managed with radiofrequency ablation. Conclusion Jejunal leiomyosarcoma is a rare variety of malignant small bowel tumor and a clinical presentation with intussusception is unusual. We suggest that an aggressive management approach using a combination of surgery and a newer technique like RFA can be attempted in patients with limited metastatic spread to liver to prolong the long-term survival in a subset of patients.

Molecular dynamics simulation of ribosome jam

KAUST Repository

Matsumoto, Shigenori

2011-09-01

We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

DISCOVERY OF AN UNUSUALLY RED L-TYPE BROWN DWARF

International Nuclear Information System (INIS)

Gizis, John E.; Castro, Philip J.; Faherty, Jacqueline K.; Liu, Michael C.; Aller, Kimberly M.; Shaw, John D.; Vrba, Frederick J.; Harris, Hugh C.; Deacon, Niall R.

2012-01-01

We report the discovery of an unusually red brown dwarf found in a search for high proper motion objects using WISE and 2MASS data. WISEP J004701.06+680352.1 is moving at 0.''44 yr –1 and lies relatively close to the Galactic plane (b = 5. 0 2). Near-infrared photometry and spectroscopy reveals that this is one of the reddest (2MASS J – K s 2.55 ± 0.08 mag) field L dwarfs yet detected, making this object an important member of the class of unusually red L dwarfs. We discuss evidence for thick condensate clouds and speculate on the age of the object. Although models by different research groups agree that thick clouds can explain the red spectrum, they predict dramatically different effective temperatures, ranging from 1100 K to 1600 K. This brown dwarf is well suited for additional studies of extremely dusty substellar atmospheres because it is relatively bright (K s = 13.05 ± 0.03 mag), which should also contribute to an improved understanding of young gas-giant planets and the transition between L and T brown dwarfs.

A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

DEFF Research Database (Denmark)

Long, Katherine S; Porse, Bo T

2003-01-01

, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

Directory of Open Access Journals (Sweden)

O’Farrell Heather C

2012-10-01

Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

An unusual encapsulated collection of urine (urinoma) in an infant with vesicoureteral reflux

International Nuclear Information System (INIS)

Passas, V.; Brountzos, E.; Grilias, D.; Vasilakos, P.

1987-01-01

We describe an unusual case of encapsulated collection of urine (urinoma) in a 7-month-old female infant. The clinical diagnosis was urinary tract infection. The retrograde cysto-urethrogram revealed grade III vesicoureteral reflux, which we believe was the cause of the urinoma. The investigation was completed with isotope and ultrasound studies. High pressure reflux was the cause of the urine extravasation in the perirenal space. (orig.)

Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

Science.gov (United States)

Mustafi, Mainak; Weisshaar, James C

2018-01-16

In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

An Unusual Case of White Piedra Due to Trichosporon inkin Mimicking Trichobacteriosis.

Science.gov (United States)

Zhuang, Kaiwen; Ran, Xin; Dai, Yaling; Tang, Jiaoqing; Yang, Qin; Pradhan, Sushmita; Ran, Yuping

2016-12-01

White piedra is a superficial mycosis characterized by soft, white-to-tan, irregular nodules attached to the hair shafts. A 36-year-old man presented with small lumps in his pubic hair, without any other symptoms. The clinical features were suggestive of trichobacteriosis. Pathology analysis of the infected hair revealed that the concretions surrounding the hair shaft were full of fungal elements, parts of which had invaded into the cuticle. Culture on Sabouraud dextrose agar grew creamy, yellow-white colonies identified as Trichosporon inkin by the sequence of the nuclear ribosomal intergenic spacer region. The condition was treated by shaving the pubic hair and administering antifungal therapy (oral itraconazole and topical ketoconazole).

Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

Science.gov (United States)

Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

2016-09-01

Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

48 CFR 632.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing. 632.114 Section 632.114 Federal Acquisition Regulations System DEPARTMENT OF STATE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 632.114 Unusual contract financing. The...

48 CFR 2432.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Unusual contract financing... DEVELOPMENT GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 2432.114 Unusual contract financing. The Senior Procurement Executive is the agency head for the purpose of...

Ribosomal RNA: a key to phylogeny

Science.gov (United States)

Olsen, G. J.; Woese, C. R.

1993-01-01

As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

Science.gov (United States)

Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

2016-09-01

Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

Science.gov (United States)

Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

2012-04-17

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Siewers, Verena; San-Bento, Rita; Nielsen, Jens

2010-01-01

Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

Unusual inferior dislocation of shoulder: reduction by two-step maneuver: a case report

Directory of Open Access Journals (Sweden)

Patro Dilip K

2009-11-01

Full Text Available Abstract Dislocation of the shoulder is the commonest of all large joint dislocations. Inferior dislocation constitutes 0.5% of all shoulder dislocations. It characteristically presents with overhead abduction of the arm, the humerus being parallel to the spine of scapula. We present an unusual case of recurrent luxatio erecta in which the arm transformed later into an adducted position resembling the more common anterior shoulder dislocation. Such a case has not been described before in English literature. Closed reduction by the two-step maneuver was successful with a single attempt. MRI revealed posterior labral tear and a Hill-Sachs variant lesion on the superolateral aspect of humeral head. Immobilisation in a chest-arm bandage followed by physiotherapy yielded excellent results. The case is first of its kind; the unusual mechanism, unique radiological findings and alternate method of treatment are discussed.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

Science.gov (United States)

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

Science.gov (United States)

Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

1975-01-24

The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

Energy Technology Data Exchange (ETDEWEB)

deLivron, M.; Robinson, V

2008-01-01

BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

Trichosporon inkin and Trichosporon mucoides as unusual causes of white piedra of scalp hair.

Science.gov (United States)

Tendolkar, Uma; Shinde, Alka; Baveja, Sujata; Dhurat, Rachita; Phiske, Meghana

2014-01-01

White piedra of scalp hair is considered a rare entity. We report three cases of this disorder all of whom presented with nodules on the hair. Potassium hydroxide preparations of the hair revealed clustered arthrospores and mature, easily detachable nodules. Cultures grew Trichosporon inkin in 2 patients and Trichosporon mucoides in one patient. Both these fungi are unusual causes of white piedra.

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

Science.gov (United States)

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

2017-06-20

The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

48 CFR 2832.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Unusual contract financing... Contracting Requirements CONTRACT FINANCING Non-Commercial Item Purchase Financing 2832.114 Unusual contract financing. The HCA, or designee at a level not lower than the BPC, is the official authorized to approve...

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

Science.gov (United States)

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

Ribosome-Inactivating Proteins from Plants: A Historical Overview

Directory of Open Access Journals (Sweden)

Andrea Bolognesi

2016-11-01

Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

Directory of Open Access Journals (Sweden)

Abhishek Ghosh

2014-10-01

Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

African Journals Online (AJOL)

The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

DEFF Research Database (Denmark)

Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

1999-01-01

We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

DEFF Research Database (Denmark)

Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

1999-01-01

We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

Rheological Characterization of Unusual DWPF Slurry Samples

International Nuclear Information System (INIS)

Koopman, D. C.

2005-01-01

A study was undertaken to identify and clarify examples of unusual rheological behavior in Defense Waste Processing Facility (DWPF) simulant slurry samples. Identification was accomplished by reviewing sludge, Sludge Receipt and Adjustment Tank (SRAT) product, and Slurry Mix Evaporator (SME) product simulant rheological results from the prior year. Clarification of unusual rheological behavior was achieved by developing and implementing new measurement techniques. Development of these new methods is covered in a separate report, WSRC-TR-2004-00334. This report includes a review of recent literature on unusual rheological behavior, followed by a summary of the rheological measurement results obtained on a set of unusual simulant samples. Shifts in rheological behavior of slurries as the wt. % total solids changed have been observed in numerous systems. The main finding of the experimental work was that the various unusual DWPF simulant slurry samples exhibit some degree of time dependent behavior. When a given shear rate is applied to a sample, the apparent viscosity of the slurry changes with time rather than remaining constant. These unusual simulant samples are more rheologically complex than Newtonian liquids or more simple slurries, neither of which shows significant time dependence. The study concludes that the unusual rheological behavior that has been observed is being caused by time dependent rheological properties in the slurries being measured. Most of the changes are due to the effect of time under shear, but SB3 SME products were also changing properties while stored in sample bottles. The most likely source of this shear-related time dependence for sludge is in the simulant preparation. More than a single source of time dependence was inferred for the simulant SME product slurries based on the range of phenomena observed. Rheological property changes were observed on the time-scale of a single measurement (minutes) as well as on a time scale of hours

Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

Indian Academy of Sciences (India)

Unknown

mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

DEFF Research Database (Denmark)

Thomsen, S.; Hansen, Harald S.; Nyman, U.

1991-01-01

Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

Directory of Open Access Journals (Sweden)

Yanan Sun

Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

Science.gov (United States)

2016-02-11

unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

Science.gov (United States)

Crossland, Hannah; Timmons, James A; Atherton, Philip J

2017-12-01

Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

De novo design and engineering of non-ribosomal peptide synthetases

Science.gov (United States)

Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.

2018-03-01

Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.

Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

International Nuclear Information System (INIS)

Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

1986-01-01

The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Right adrenal abscess -- an unusual complication of acute apendicitis.

Science.gov (United States)

Dimofte, Gabriel; Dubei, Liviu; Lozneanu, Lili-Gabriela; Ursulescu, Corina; Grigora Scedil, Mihai

2004-09-01

Acute appendicitis represents one of the most frequent abdominal emergencies encountered in everyday surgical practice. Local infectious complications are not unusual and retroperitoneal abscesses after acute retrocaecal appendicitis have been previously described. The authors present the case of a 22-years-young female patient, admitted for a right iliac fossa abscess, secondary to gangrenous appendicitis. A right adrenal mass 35/40 mm was revealed during preoperative ultrasound evaluation, which evolved in an adrenal abscess that spontaneously drained 10 days after appendectomy and retrocecal drainage. Adrenal abscesses are exceptionally rare, with only a few cases being reported in the literature, but none of these after acute appendicitis.

Epidural varix at the cervicothoracic junction: unusual cause of quadriplegia: a case report.

Science.gov (United States)

Bapat, Mihir; Metkar, Umesh

2006-02-01

A case report describing an unusual incident of quadriplegia in a young adult male caused by an epidural varix at the cervicothoracic junction. To report an unusual case of quadriplegia caused by an epidural varix at the cervicothoracic junction. Epidural varices are dilated tortuous elongated veins inside the central canal. In degenerative spinal stenosis, these varices are a result of venous stagnation and contribute to the pathogenesis of radicular pain. In the absence of stenosis, primary varicosities develop as a result of dynamic obstruction to venous outflow during spinal movements. A primary epidural varix can produce neurologic deficit similar to a space occupying lesion within the spinal canal. The myeloradiculopathy is of a slow progressive nature. A young man presented with an acute onset flaccid quadriplegia in the absence of significant trauma. Magnetic resonance imaging revealed an extradural space occupying lesion at the cervicothoracic junction that was diagnosed as an isolated epidural varix during surgery. No neurologic recovery occurred. Postoperative magnetic resonance imaging revealed a syrinx in the cervicothoracic cord. In the absence of other precipitating factors, the cord injury was attributed to the epidural varix. A temporary impedance to the venous outflow with the increase in the venous pressure has been hypothesized as the mechanism of cord injury.

Trichosporon inkin and Trichosporon mucoides as unusual causes of white piedra of scalp hair

Directory of Open Access Journals (Sweden)

Uma Tendolkar

2014-01-01

Full Text Available White piedra of scalp hair is considered a rare entity. We report three cases of this disorder all of whom presented with nodules on the hair. Potassium hydroxide preparations of the hair revealed clustered arthrospores and mature, easily detachable nodules. Cultures grew Trichosporon inkin in 2 patients and Trichosporon mucoides in one patient. Both these fungi are unusual causes of white piedra.

Pseudomembranous aspergillus bronchitis in a double-lung transplanted patient: unusual radiographic and CT features

International Nuclear Information System (INIS)

Ducreux, D.; Chevallier, P.; Raffaelli, C.; Padovani, B.; Perrin, C.; Jourdan, J.; Hofman, P.

2000-01-01

Pseudomembranous aspergillus bronchitis is considered as an early form of invasive pulmonary aspergillosis, a well-known airway infection in immunocompromised patients. Radiologic features concerning invasive aspergillosis of the airways have been reported. However, we describe here an unusual feature of invasive aspergillus bronchitis, never reported to date, observed in a double-lung transplanted patient. Chest radiograph and CT revealed significant peribronchial thickening without any parenchymal involvement. (orig.)

RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN

Directory of Open Access Journals (Sweden)

A.A. Alekseeva

2010-01-01

Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130

Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

DEFF Research Database (Denmark)

Richter, W W; Zang, K D; Issinger, O G

1983-01-01

Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

An unusual case of unicystic intramural ameloblastoma and review of the literature

Directory of Open Access Journals (Sweden)

Massimiliano Ricci

2012-01-01

Full Text Available Ameloblastoma is the most common tumor of odontogenic origin. There are various types of this tumor and confusion still exists among the clinicians about the correct classification. Multicystic ameloblastoma is the most frequent subtype while unicystic ameloblastoma can be considered as a variant of the solid or multycistic. This subtype is considered as a less aggressive tumor with a variable recurrence rate. However, its frequency is often underestimated. The aim of this article is reviewing the recent literature about unicystic ameloblastoma using our unusual clinical case as a starting point to illustrate this discussion. A 30-year-old man who had been complaining of slight pain in the premolar and molar area of the left side of mandible had a check up at our department. X-rays revealed a unilocular radiotrasparency with radiopaque margins. The first histological diagnosis was an odontogenic cyst. Successive histological evaluations revealed that ameloblastic epithelial islands were present in lassus connective tissue. We think that our case report provides new insights into the approach to the ameloblastoma diagnosis. We agree with authors who have pointed out that a single small biopsy may often be inadequate for the correct diagnosis of amelobastoma. Moreover, in the light of our experience, it should be kept in mind that ameloblastomas may have sometimes unusual presentations and this fact should induce surgeons and pathologists to consider carefully each lesion.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

Directory of Open Access Journals (Sweden)

Ahmed Neesar

2010-09-01

was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

DEFF Research Database (Denmark)

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

2014-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

Science.gov (United States)

Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

2017-07-01

Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

International Nuclear Information System (INIS)

Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

2007-01-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

An Unusual Case of Metastatic Seminoma in a Dog.

Science.gov (United States)

Dugat, Danielle R; Medici, Emily L; Rochat, Mark C; Arble, Jason A; Snider, Timothy A

2015-01-01

An 8 yr old, reportedly castrated male Boston terrier presented with a history of generalized hyperesthesia and intermittent shifting leg lameness. Physical examination revealed a caudal abdominal mass and bilateral shoulder pain. A complete blood count, serum biochemistry panel, and urinalysis were unremarkable. Thoracic radiographs demonstrated bony proliferation and lysis of the third sternebra, an expansile lesion of the left tenth rib, and lucency in both proximal humeral metaphyses. Abdominal radiographs and ultrasound revealed a soft tissue mass within the caudoventral right abdomen. Ultrasonography also revealed an enlarged lymph node within the right retroperitoneal space. Exploratory laparotomy identified the mass as a retained testicle. A cryptorchidectomy, lymph node biopsy, and bilateral percutaneous core biopsies of the proximal humeri were performed. Histopathologic examination revealed malignant seminoma of the testicle with metastasis to lymph node and bone. Adjuvant chemotherapy was recommended, but it was declined by the owner. All follow-up was lost. This case highlights a unique case for causative hyperesthesia secondary to a novel site of metastasis from malignant seminoma. Metastasis to bone has not been reported in humans or dogs and represents a very unusual and aberrant variant of the normally relatively benign biological behavior of seminoma in the dog.

An Unusual Bone Loss Around Implants

Directory of Open Access Journals (Sweden)

Amirreza Rokn

2013-01-01

Full Text Available AbstractPre-implant disease is an inflammatory process, which can affect the surrounding tissues of a functional Osseointegrated implant that is usually as a result of a disequilibrium between the micro-flora and the body defense system.This case reports a 57 years old male with unusual bone loss around dental implants.This was an unusual case of peri-implantitis which occurred only in the implants on one side of the mouth although they all were unloaded implants.

An unusual case of carbon monoxide poisoning.

Science.gov (United States)

Auger, P L; Levesque, B; Martel, R; Prud'homme, H; Bellemare, D; Barbeau, C; Lachance, P; Rhainds, M

1999-01-01

Carbon monoxide, a gas originating from incomplete combustion of carbon-based fuels, is an important cause of human deaths. In this paper, we describe an unusual carbon monoxide poisoning in a dwelling without obvious sources of combustion gases, for which two adults had to be treated in a hyperbaric chamber. Carbon monoxide readings were taken in the house and in the neighboring homes. Methane gas and nitrogen oxide levels were also monitored in the house air. Soil samples were collected around the house and tested for hydrocarbon residues. The investigation revealed the presence of a pocket of carbon monoxide under the foundation of the house. The first readings revealed carbon monoxide levels of 500 ppm in the basement. The contamination lasted for a week. The investigation indicated that the probable source of contamination was the use of explosives at a nearby rain sewer construction site. The use of explosives in a residential area can constitute a major source of carbon monoxide for the neighboring populations. This must be investigated, and public health authorities, primary-care physicians, governmental authorities, and users and manufacturers of explosives must be made aware of this problem. Images Figure 1 Figure 2 PMID:10379009

An unusual case of carbon monoxide poisoning.

Science.gov (United States)

Auger, P L; Levesque, B; Martel, R; Prud'homme, H; Bellemare, D; Barbeau, C; Lachance, P; Rhainds, M

1999-07-01

Carbon monoxide, a gas originating from incomplete combustion of carbon-based fuels, is an important cause of human deaths. In this paper, we describe an unusual carbon monoxide poisoning in a dwelling without obvious sources of combustion gases, for which two adults had to be treated in a hyperbaric chamber. Carbon monoxide readings were taken in the house and in the neighboring homes. Methane gas and nitrogen oxide levels were also monitored in the house air. Soil samples were collected around the house and tested for hydrocarbon residues. The investigation revealed the presence of a pocket of carbon monoxide under the foundation of the house. The first readings revealed carbon monoxide levels of 500 ppm in the basement. The contamination lasted for a week. The investigation indicated that the probable source of contamination was the use of explosives at a nearby rain sewer construction site. The use of explosives in a residential area can constitute a major source of carbon monoxide for the neighboring populations. This must be investigated, and public health authorities, primary-care physicians, governmental authorities, and users and manufacturers of explosives must be made aware of this problem.

An Unusual Cause of Duodenal Obstruction: Persimmon Phytobezoar.

Science.gov (United States)

Fan, Shengxian; Wang, Jing; Li, Yousheng

2016-12-01

Duodenal phytobezoar, an unusual cause of acute duodenal obstruction, is rarely seen. The most common cause of this type of bezoar is persimmon. It frequently arises from underlying gastrointestinal tract pathologies (gastric surgery, etc.). Here, we report the case of a 66-year-old man who had undergone distal gastrectomy with Billroth I reconstruction for gastric cancer and experienced severe epigastric discomfort, abdominal pain, and vomiting for a few days. The abdominal computed tomography scan showed a large-sized mass in the horizontal portion of the duodenum. On following endoscopic examination, a large phytobezoar was revealed in the duodenum. He was treated with endoscopic fragmentation combined with nasogastric Coca-Cola. The patient tolerated the procedure well and resumed a normal oral diet 3 days later.

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

International Nuclear Information System (INIS)

Dessen, E.M.B.; Perondini, A.L.P.

1979-01-01

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

Science.gov (United States)

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

Science.gov (United States)

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

Science.gov (United States)

Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

2008-02-22

The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

Directory of Open Access Journals (Sweden)

Takuya Kamio

Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

Science.gov (United States)

Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

2003-09-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

Science.gov (United States)

Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

2017-07-01

Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

DEFF Research Database (Denmark)

Douthwaite, S; Powers, T; Lee, J Y

1989-01-01

The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

Cellular Angiofibroma of the Prostate: A Rare Tumor in an Unusual Location

Directory of Open Access Journals (Sweden)

Inez Wyn

2014-01-01

Full Text Available We report the unusual occurrence of a cellular angiofibroma in prostatic tissue. In this case, a 84-year-old man presented in the emergency room with urinary retention. Ultrasound revealed an enlarged prostate, which was suggestive for benign prostatic hyperplasia. The patient was treated with a Millin retropubic prostatectomy. Macroscopically the prostate contained multiple circumscribed nodules. Microscopic examination of the tumor showed the appearance of cellular angiofibroma, consisting of bland spindle cells and prominent, hyalinized vessels. The diagnosis was supported by FISH, which revealed monoallelic loss of RB1/13q14 region, as seen in spindle cell lipoma, (extra- mammary myofibroblastoma, and cellular angiofibroma. Cellular angiofibromas are rare, benign soft tissue tumours and were never reported in the prostatic gland.

Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

International Nuclear Information System (INIS)

Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

2010-01-01

We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

Science.gov (United States)

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

DEFF Research Database (Denmark)

Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

2017-01-01

Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

An Unusual Case of Recurrent Pyocolpos Following Midtrimester Miscarriage Revealed as Obstructed Hemivagina with Ipsilateral Renal Agenesis (OHVIRA Syndrome

Directory of Open Access Journals (Sweden)

Haldar M

2014-08-01

Full Text Available Obstructed hemivagina with ipsilateral renal agenesis (OHVIRA Syndrome is a rare congenital anomaly. It mostly presents with severe dysmenorrhea and a palpable mass due to unilateral hematocolpos. Sometime it presents in unusual way with prolonged vaginal bleeding and profuse vaginal discharge. Here we report case of an 18 years old married female with OHVIRA syndrome presenting late with symptoms of recurrent pyocolpos following dilatation and evacuation for midtrimester miscarriage that was diagnosed on the basis of MRI and managed by vaginal septotomy.

The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

Science.gov (United States)

Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

2011-05-01

The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

Science.gov (United States)

Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

2004-01-01

Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

Weird Astronomy Tales of Unusual, Bizarre, and Other Hard to Explain Observations

CERN Document Server

Seargent, David A.J

2011-01-01

You go out for a night’s observing and look up at the sky. There are all the usual suspects—a splattering of stars, the Moon, Venus, maybe Mercury and Mars. Perhaps you can identify some of the constellations. If you are using binoculars or a small telescope, you can see many wonders not revealed to the naked eye but still well known to telescope users for centuries. But what if you look up and see something completely new, something unexplainable. Do your eyes deceive you? Are you really seeing what you think you are seeing? What should you do? In this fascinating account of the many oddball things people – from novice astronomers to certified experts – have observed over the years, you will be introduced to a number of unusual – and sometimes still unexplainable – phenomena occurring in our usually familiar and reassuring skies. What exactly did they see? What discoveries followed these unusual sightings? What remains unexplained? In addition to the accounts, you will find scattered throughout t...

Sequence analysis and over-expression of ribosomal protein S28 ...

African Journals Online (AJOL)

RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

International Nuclear Information System (INIS)

Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

2006-01-01

Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

An unusual case of Extranodal Rosai-Dorfman Disease manifesting as a bilateral Epibulbar mass.

OpenAIRE

Dr. Swati Ravani; Dr. Jaideep Sharma

2017-01-01

Purpose: To report an unusual presentation of a 24-year-old man with bilateral epibulbar mass, whose presentation was confirmed histopathologically as Rosai Dorfman disease. Method: We studied a retrospective and interventional case report. Results: A 24-year-old man presented with a mass over both eyes, gradually and, progressively increasing over one year. Visual acuity and intraocular pressures were normal in both eyes. Examination revealed bilateral non tender mobile soft in consistency ...

The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

International Nuclear Information System (INIS)

Mori, Tomohiko; Fukuda, Mitsuru

1975-01-01

The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

DEFF Research Database (Denmark)

Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

2011-01-01

Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

Taxonomic Clarification of the Unusual Dinophyte Gymnodinium limneticum Wołosz. (Gymnodiniaceae) from the Tatra Mountains.

Science.gov (United States)

Kretschmann, Juliane; Filipowicz, Natalia H; Owsianny, Paweł M; Zinssmeister, Carmen; Gottschling, Marc

2015-12-01

The Gymnodiniaceae -even in a strict sense- comprise a vast diversity of dinophytes regarding morphology and ecology. Taxonomy and nomenclature of their constituent species remain problematic, although crucial to fully explore the biology of the group. Here, we present the rarely documented dinophyte Gymnodinium limneticum from its type locality at Lake Morskie Oko in Poland, for which we established strains and made extensive morphological studies. The species was unusual in exhibiting capsoid cells as predominant life-history stage, which were embedded and dividing in extensive mucilage leading to an enkaptic pseudocolonial system. We also generated ribosomal RNA sequences that were included in a comprehensive molecular phylogeny. Our species was clearly identified as a member of the Gymnodiniaceae s.str. but within the lineage, it was only distantly related to the type species of Gymnodinium, G. fuscum. Rather, it constituted a monophyletic group together with species assigned to Spiniferodinium and as a nomenclatural result, we propose two new combinations (i.e., Sp. limneticum comb. nov., Sp. palustre comb. nov.). As Spiniferodinium now includes dinophyte species inhabiting marine or freshwater environments as well, our investigations may provide evidence for an evolutionary scenario with corresponding transitions being more frequent than considered before. Copyright © 2015 Elsevier GmbH. All rights reserved.

Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

International Nuclear Information System (INIS)

Stahl, J.; Boehm, H.; Voderberg, M.

1981-01-01

Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

Unusual radiological characteristics of teratoid/rhabdoid brain tumor ...

African Journals Online (AJOL)

We report a case of atypical teratoid rhabdoid brain tumor for 4 months old male child, who presented with unusual radiological findings, that can be confused with other brain tumors ,so we high light these unusual imaging features to aid in making correct diagnosis. Keywords: atypical teratoid–rhabdoid tumor, brain tumor, ...

MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW

Directory of Open Access Journals (Sweden)

Tobias von der Haar

2012-04-01

Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY

Directory of Open Access Journals (Sweden)

A.A. Alekseeva

2011-01-01

Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

The testis: the unusual, the rare and the bizarre

International Nuclear Information System (INIS)

Stewart, V.R.; Sidhu, P.S.

2007-01-01

Ultrasound is the preferred technique when imaging the scrotal contents. Although appearances of many of the more common abnormalities present the examiner with no diagnostic difficulty, the more unusual conditions may present a considerable challenge. Many normal variants, unusual and rare abnormalities may be instantly recognized once seen. The current review highlights the more unusual and rare conditions affecting the scrotal contents in order to allow the reader the opportunity to gain knowledge of their existence and to aid future interpretation of the difficult examination

Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

Science.gov (United States)

Long, Katherine S.

2012-01-01

Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

48 CFR 235.070 - Indemnification against unusually hazardous risks.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Indemnification against unusually hazardous risks. 235.070 Section 235.070 Federal Acquisition Regulations System DEFENSE... DEVELOPMENT CONTRACTING 235.070 Indemnification against unusually hazardous risks. ...

The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

DEFF Research Database (Denmark)

Wekselman, I.; Zimmerman, E.; Davidovich, C.

2017-01-01

in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

Ribosomal PCR and DNA sequencing for detection and identification of bacteria

DEFF Research Database (Denmark)

Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

2014-01-01

-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

DEFF Research Database (Denmark)

Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

2016-01-01

Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

Unusual computed tomography findings and complications in acute appendicitis

International Nuclear Information System (INIS)

Palacio, Glaucia Andrade e Silva; D'Ippolito, Giuseppe

2003-01-01

The objective of this article is to describe and illustrate unusual computed tomography (CT) findings in patients with acute appendicitis. We reviewed the charts of 200 patients with clinical suspicion of acute appendicitis who were submitted to abdominal CT before surgery. Patients with unusual presentation or complications were selected for illustrating the main CT findings. Unusual complications of acute appendicitis were related to anomalous position of the appendix, contiguity to intraperitoneal organs such as the liver, gall bladder, annexes and the bladder and continuous use of anti inflammatory or antibiotics during the diagnostic process. We concluded that CT is a useful diagnostic tool in patients with complicated or unusual presentation acute appendicitis. The first step towards diagnosis in these cases i to have in mind the hypothesis of appendicitis in patients with acute abdominal pain. (author)

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

Science.gov (United States)

Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

2006-01-01

The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

Anubhoothi: a psychopathology of unusual sexual experience

Directory of Open Access Journals (Sweden)

G Ragesh

2016-07-01

Full Text Available The case history and management of a 26 years old adult is reported who presented with an unusual symptom of sexual experience, in the background of symptoms of depression and anxiety; had been given multiple diagnoses at multiple points of time and treated with multiple medications. On establishment of rapport, he revealed details of his unusual experiences, which had been unexplored. When he was about 11 years and ten months, he sat next to a lady; he could perceive a particular experience for the first time in his life. And next time with another lady too he perceived a particular type of smell (“madaka gandha” meaning an intoxicating smell along with the other feelings. He began to have these feelings whenever he was in the vicinity of a female except his mother and sister. The smell reminded him of roses vaguely and was at least ten to 20 times more pleasurable than an orgasm that he got with masturbation. These feelings were more pleasurable than he could ever imagine and happened always with the presence of a female in the vicinity. This was never associated with periods of unresponsiveness or any other history suggestive of seizures. He titled the experience as “anubhoothi”. These experiences occurred on a regular basis for a period of ten months following which there was abrupt cessation of the same, without any intervention. Later he developed all symptoms. A coordinated management plan spearheaded by the multi-disciplinary treatment team could bring down his symptoms as well as make him functional. This case indicates that it is essential to explore abnormalities of experiences to understand the psychopathology and plan management.

The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

Science.gov (United States)

Lin, A; McNally, J; Wool, I G

1983-09-10

The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

Ribosome-dependent ATPase interacts with conserved membrane protein in Escherichia coli to modulate protein synthesis and oxidative phosphorylation.

Directory of Open Access Journals (Sweden)

Mohan Babu

Full Text Available Elongation factor RbbA is required for ATP-dependent deacyl-tRNA release presumably after each peptide bond formation; however, there is no information about the cellular role. Proteomic analysis in Escherichia coli revealed that RbbA reciprocally co-purified with a conserved inner membrane protein of unknown function, YhjD. Both proteins are also physically associated with the 30S ribosome and with members of the lipopolysaccharide transport machinery. Genome-wide genetic screens of rbbA and yhjD deletion mutants revealed aggravating genetic interactions with mutants deficient in the electron transport chain. Cells lacking both rbbA and yhjD exhibited reduced cell division, respiration and global protein synthesis as well as increased sensitivity to antibiotics targeting the ETC and the accuracy of protein synthesis. Our results suggest that RbbA appears to function together with YhjD as part of a regulatory network that impacts bacterial oxidative phosphorylation and translation efficiency.

Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

DEFF Research Database (Denmark)

Aagaard, C; Rosendahl, G; Dam, M

1991-01-01

The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

Directory of Open Access Journals (Sweden)

Anirban Chakraborty

Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

Comparative analysis of chromosomal localization of ribosomal and telomeric DNA markers in three species of Pyrgomorphidae grasshoppers

Directory of Open Access Journals (Sweden)

Olesya G. Buleu

2017-09-01

Full Text Available The karyotypes of three species of Pyrgomorphidae grasshoppers were studied: Zonocerus elegans (Thunberg, 1815, Pyrgomorpha guentheri (Burr, 1899 and Atractomorpha lata (Mochulsky, 1866. Data on karyotypes of P. guentheri and Z. elegans are reported here for the first time. All species have karyotypes consisting of 19 acrocentric chromosomes in males and 20 acrocentric chromosomes in females (2n♂=19, NF=19; 2n♀=20, NF=20 and X0/XX sex determination system. A comparative analysis of the localization of C-heterochromatin, clusters of ribosomal DNA, and telomere repeats revealed inter-species diversity in these cytogenetic markers. These differences indicate that the karyotype divergence in the species studied is not associated with structural chromosome rearrangements, but with the evolution of repeated DNA sequences.

Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

Directory of Open Access Journals (Sweden)

Haiwei Cheng

Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

"Unusual brain stone": heavily calcified primary neoplasm with some features suggestive of angiocentric glioma.

Science.gov (United States)

Sajjad, Jahangir; Kaliaperumal, Chandrasekaran; Bermingham, Niamh; Marks, Charles; Keohane, Catherine

2015-11-01

This 40-year-old man presented with a 5-month history of progressive right-sided headache associated with visual blurring. He also had a history of epilepsy but had been seizure free with medication for the past 10 years. An initial CT scan of his brain performed 16 years previously had revealed a small area of calcification in the right parietal region. In the current presentation, he had a left-sided homonymous hemianopia but no other neurological deficits. A CT scan of his brain showed a much larger calcified, partly cystic lesion in the right parietal region. Because he was symptomatic, the lesion was excised and the cyst was drained. Histological examination of the excised tissue showed an unusual primary tumor that was difficult to classify but had some features of angiocentric glioma. The heavy calcification, mixed-density cell population, and regions with features of angiocentric glioma were most unusual. The patient remained asymptomatic 5 years after surgery, and follow-up scans did not show recurrence.

Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

International Nuclear Information System (INIS)

Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

2010-01-01

Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

Directory of Open Access Journals (Sweden)

Andrea Ciammaruconi

2008-01-01

Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

Radiation heredity: unusual structural-phase states and metallic crystals properties

International Nuclear Information System (INIS)

Melikhov, V.D.; Skakov, M.K.

1998-01-01

Some experimental results allowing to judge about possibilities of unusual structural phase states formation during use irradiation and high temperature treatment of metallic crystals are considered. During study of pure (99.99 %) and especially pure (99.999 %) aluminium it was established, that after heating of preliminary irradiated samples in reactor, and non-irradiated ones up to temperatures above melting point (660 deg C), but not higher than 820 deg C, and cooling an microstructure and substructure of both irradiated and non-irradiated metals have been essentially distinguished with each other. If first of them had typically polycrystal construction, that second one was monocrystal with good developed initial substructure. Radiation effects have been preserved even in liquid metal if it was not overheated higher critical point, which is determined by phase transition from quasi-liquid state to true liquid one. During study of irradiation and postradiation treatment of structure and properties of intermetallides Fe 3 Al it was revealed, that in initially irradiated regulated alloys the radiation effect is preserving at heating of above 0.85 T melt (that essentially exceed order-disorder transition temperature) (550 deg C) in non-irradiated alloys of prolonged exposure and hardening. At that, irradiated-hardened alloy distinguishing from not hardened one by lattice parameter (on 0.1 %), by configuration of nearest surrounding of iron atoms in elementary cell, by regulating extent of different kind of atoms in lattice knocks. It was revealed, that at fluence (5·10 24 n·m 2 ) an appearance of new phases, distinguishing from matrix by component content. It was shown, that irradiation and post-radiation treatment are methods for creation unusual structural-phase states and attach to metals and alloys new properties

Cleft lip and palate: series of unusual clinical cases.

Science.gov (United States)

Paranaíba, Lívia Máris Ribeiro; Miranda, Roseli Teixeira de; Martelli, Daniella Reis Barbosa; Bonan, Paulo Rogério Ferreti; Almeida, Hudson de; Orsi Júnior, Julian Miranda; Martelli Júnior, Hercílio

2010-01-01

Cleft lip and/or palate (CL/P) represent the most common congenital anomalies of the face, corresponding to approximately 65% of all malformations of the craniofacial region. to describe unusual clinical cases of non-syndromic CL/P (CL/PNS), diagnosed in a reference service in Minas Gerais, Brazil, and correlate these alterations with possible risk factors. we carried out a retrospective study, between the years of 1992 and the 1st half of 2009, from medical records. Among the 778 cases of CL/PNS diagnosed in the period of 17 years, 5 (0.64%) were unusual CL/PNS, and all patients were male. It was found that among the 5 patients, 2 had incomplete right cleft lip with incomplete cleft palate, 2 were affected by left incomplete cleft lip and incomplete cleft palate, and 1 had a cleft lip and palate associated with complete right cleft palate. Risk factors such as consanguinity, maternal smoking and alcohol consumption, medication usage during pregnancy, history of abortion and/or stillbirths and maternal diseases were not associated with unusual CL/PNS. This study described 5 unusual cases of CL/PNS in a Brazilian population; no associations with the risk factors analyzed were seen. It also confirmed the unusualness of the prevalence of such alterations.

Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

Directory of Open Access Journals (Sweden)

Tetsuro Kawano

Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

Unusual MRI findings in grey matter heteropia

International Nuclear Information System (INIS)

Soto Ares, G.; Hamon-Kerautret, M.; Leclerc, X.; Pruvo, J.P.; Houlette, C.; Godefroy, O.

1998-01-01

We report unusual MRI patterns in patients with grey matter heterotopia. Standard T1- and T2-weighted spin-echo and inversion-recovery sequences were used in 22 patients presenting with seizures or developmental delay. The images were reviewed for signal change surrounding white matter and for atypical size, morphology or topography. We found 10 cases of subependymal heterotopias 11 of focal subcortical heterotopia and of diffuse subcortical heterotopia. On clinical or MRI grounds, 8 cases were considered unusual: 2 of the subependymal type, 2 of focal subcortical heterotopia with white matter abnormalities, 2 of focal subcortical heterotopia with no clinicoradiological correlation 1 of extensive hemispheric subcortical heterotopia and 1 of diffuse subcortical heterotopia confined to the frontal lobe. The classical classification of heterotopia enables easy radiological diagnosis even in cases with unusual patterns. In some cases, heterogeneity and high signal in surrounding white matter can be found. Cortical dysplasia is the most frequent associated malformation. (orig.)

An unusual recurrence of pruritic creeping eruption after treatment

African Journals Online (AJOL)

abp

2015-08-13

Aug 13, 2015 ... However, an unusual recurrence of the disease in a Ghanaian male after standard treatment was observed ... dog or cat hookworm is not an unusual disease. However ... mistaken for fungal infections or inflammatory skin disorders. Indeed .... drug include dizziness, nausea, vomiting and intestinal cramps.

Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

Science.gov (United States)

Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

2016-09-06

Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Endovascular Treatment of Unusual Multiple Aneurysms of the Internal Carotid Artery-Posterior Communicating Artery Complex

OpenAIRE

Kubo, Michiya; Kuwayama, Naoya; Hirashima, Yutaka; Ohi, Masayoshi; Takami, Masaaki; Endo, Shunro

2000-01-01

A 79-year-old female presented with subarachnoid hemorrhage due to rupture of a rare true posterior communicating artery(PCoA)aneurysm and with poor general condition. Endovascular therapy was performed in the chronic stage. Right carotid angiography just before embolization demonstrated unusual multiple aneurysms of the internal carotid artery(ICA)-PCoA complex. Superselective an-giography and aneurysmography using microcatheter revealed two separate aneurysms arising from the PCoA and the I...

Unusual magnetic resonance imaging features in Menkes disease

International Nuclear Information System (INIS)

Barnerias, C.; Desguerre, I.; Dulac, O.; Bahi-Buisson, N.; Boddaert, N.; Hertz-Pannier, L.; Boddaert, N.; Guiraud, P.; Hertz-Pannier, L.; Dulac, O.; Bahi-Buisson, N.; Hertz-Pannier, L.; Dulac, O.; Bahi-Buisson, N.; De Lonlay, P.

2008-01-01

We present a case of an inherited disorder of copper metabolism, Menkes disease in which MRI studies revealed the coexistence of T2 hyper-signal in the temporal white matter with an increase of apparent diffusion coefficient indicative of vasogenic oedema combined with T2 hyper-signal of the putamen and head of the caudate and decreased apparent diffusion coefficient indicative of cytotoxic oedema. These unusual MRI features emphasize the interest of newly developed techniques in early diagnosis in Menkes disease. The acute cerebral damage might result from the combined effects of acute metabolic stress due to infectious disease and prolonged status epilepticus, acting on a highly susceptible developing brain. Vasogenic oedema in the temporal white matter could be related to prolonged status epilepticus and vascular abnormalities. Cytotoxic oedema of the putamen and head caudate could result from energetic failure. (authors)

Unusual magnetic resonance imaging features in Menkes disease

Energy Technology Data Exchange (ETDEWEB)

Barnerias, C; Desguerre, I; Dulac, O; Bahi-Buisson, N [Hop Necker Enfants Malades, AP-HP, Dept Paediat Neurol and Metab Dis, F-75743 Paris 15 (France); Boddaert, N; Hertz-Pannier, L [Hop Necker Enfants Malad, AP-HP, Dept Pediat Radiol, F-75743 Paris (France); Boddaert, N [CEA, Serv Hosp Frederic Joliot, INSERM, U797, F-91406 Orsay (France); Guiraud, P [Univ Grenoble, Serv Biochim, Genet Hop, Grenoble (France); Hertz-Pannier, L; Dulac, O; Bahi-Buisson, N [INSERM, U663, F-75015 Paris (France); Hertz-Pannier, L; Dulac, O; Bahi-Buisson, N [Univ Paris 05, F-75005 Paris (France); De Lonlay, P [Hop Necker Enfants Malades, AP-HP, Dept Paediat Neurol and Metab Dis, F-75743 Paris 15 (France); Hop Necker Enfants Malades, AP HP, Ctr Reference Malad Metab, F-75743 Paris 15 (France)

2008-07-01

We present a case of an inherited disorder of copper metabolism, Menkes disease in which MRI studies revealed the coexistence of T2 hyper-signal in the temporal white matter with an increase of apparent diffusion coefficient indicative of vasogenic oedema combined with T2 hyper-signal of the putamen and head of the caudate and decreased apparent diffusion coefficient indicative of cytotoxic oedema. These unusual MRI features emphasize the interest of newly developed techniques in early diagnosis in Menkes disease. The acute cerebral damage might result from the combined effects of acute metabolic stress due to infectious disease and prolonged status epilepticus, acting on a highly susceptible developing brain. Vasogenic oedema in the temporal white matter could be related to prolonged status epilepticus and vascular abnormalities. Cytotoxic oedema of the putamen and head caudate could result from energetic failure. (authors)

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

Science.gov (United States)

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

2013-02-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

Science.gov (United States)

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

Science.gov (United States)

Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

2017-12-15

Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

Science.gov (United States)

Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

2016-07-07

A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

Detection of carriers and genetic counseling in duchenne muscular dystrophy by ribosomal protein synthesis.

Science.gov (United States)

Ionasescu, V; Zellweger, H; Burmeister, L

1976-11-01

The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.

Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

DEFF Research Database (Denmark)

Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

2009-01-01

Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

Chlamydia abortus YhbZ, a truncated Obg family GTPase, associates with the Escherichia coli large ribosomal subunit.

Science.gov (United States)

Polkinghorne, Adam; Vaughan, Lloyd

2011-01-01

The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

Identification of nucleolus-associated chromatin domains reveals the role of the nucleolus in the 3D organisation of the A. thaliana genome

Science.gov (United States)

Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Saez-Vasquez, Julio

2017-01-01

The nucleolus is the site of ribosomal RNA (rRNA) gene transcription, rRNA processing and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli by Fluorescence Activated Cell Sorting (FACS) and identified Nucleolus-Associated Chromatin Domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein, NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions and mostly inactive protein-coding genes. However, NADs also include active ribosomal RNA genes, and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. PMID:27477271

Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

Science.gov (United States)

Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

2017-01-01

Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

Emergence of unusual species of enterococci causing infections, South India

Directory of Open Access Journals (Sweden)

Rao Sambasiva R

2005-03-01

emergence of high-level aminoglycoside and beta-lactam resistance among different species apart from intrinsic vancomycin resistance by some species, while all the species tested were susceptible for linezolid and teicoplanin. Conclusion Our study reveals the emergence of multi-drug resistance among unusual species of enterococci posing a serious therapeutic challenge. Precise identification of enterococci to species level enables us to access the species-specific antimicrobial resistance characteristics, apart from knowing the epidemiological pattern and their clinical significance in human infections.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

Science.gov (United States)

Llanos, Susana; Serrano, Manuel

2010-10-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

Unusual Fundus Autofluorescence Appearance in a Patient with Hydroxychloroquine Retinal Toxicity

Directory of Open Access Journals (Sweden)

Sleiman Abou-Ltaif

2015-06-01

Full Text Available Purpose: To report an unusual fundus autofluorescence aspect in a patient with suspected hydroxychloroquine retinal toxicity. Method: Case report of an unusual presentation of a patient treated for 9 consecutive years with a therapeutically recommended dose of hydroxychloroquine. Result: We report the case of a 53-year-old Caucasian female treated with 400 mg hydroxychloroquine for rheumatoid arthritis over 9 years, currently on methotrexate and folinic acid, who stopped treatment 3 years ago. The cumulative dose is estimated at 1.314 kg. She recently noticed a reduction of vision in both eyes to 0.34 logMAR, with colour vision problems and major distortion in central vision. Fundus autofluorescence revealed minimal foveal pigmentary changes and more pronounced changes in the retina elsewhere. Foveal changes were confirmed by optical coherence tomography in both eyes. The patient did not report any colour perception difficulties or night vision problems and has no family history of any eye condition. Her visual field tested by an optician was full, with some central changes. Conclusion: Retinal toxicity from hydroxychloroquine can present in a different aspect than the commonly known retinal toxicity, and it happens even after years of cessation of the drug. The role of cumulative dose in toxicity is supported in this paper.

The antituberculosis antibiotic capreomycin inhibits protein synthesis by disrupting interaction between ribosomal proteins L12 and L10.

Science.gov (United States)

Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong

2014-01-01

Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.

Oat cell carcinoma of the esophagus: Unusual radiological appearances

Energy Technology Data Exchange (ETDEWEB)

Bedi, D.G.; Shaw, M.T.

1986-08-01

Primary oat cell carcinoma of the esophagus is a very rare tumour. The radiographic appearance of the three cases described in this paper are unusual because they resemble benign lesions such as leiomyoma, fibrous polyp and candidiasis. It would be interesting to investigate whether such an unusual appearance is common for this neoplasm.

An unusual oral habit presenting as Dentin Hypersensitivity | Afolabi ...

African Journals Online (AJOL)

We present the case of a 30-year-old man with an unusual oral habit- office pin chewing and filing of the front tooth which resulted in dentine hypersensitivity. Clinical relevance: The role of daily oral habits and techniques of cessation were suggested in the management of dentine hypersensitivity. Keywords: Unusual oral ...

Interesting bone scans - unusual findings

International Nuclear Information System (INIS)

Dobson, M.; Wadhwa, S.S.; Mansberg, R.; Fernandes, V.B.

1997-01-01

A 59-year-old female with carcinoma of the colon and known liver metastatic disease was referred for bone scan to evaluate for bone metastases. Although no bone metastases were found, there was abnormal uptake noted in the liver corresponding to a metastatic calcified lesion. The only other findings were of degenerative disease in the cervical spine, right shoulder and small joints of the hands. A 69-year-old male with carcinoma of the prostate and right side low back pain was referred for bone scan. No focal abnormalities to suggest metastatic disease were identified; findings within the cervical spine, lumber spine and knees were presumed secondary to degenerative disease. Intermittent pain persisted and the patient was referred for a repeat bone scan six months later. Previous scan findings of degenerative disease and no metastatic disease were confirmed; however, closer inspection revealed an enlarged right kidney with significant retention of tracer in the pelvicalyceal system suggesting possible obstruction. A Retrograde pyelogram was performed, and no obvious obstruction demonstrated. As bone scan findings were very suggestive of obstruction, a DTPA scan with lasix was performed showing a dilated right collecting system with no functional obstruction. Given the degree of dilation, it is possible that the patient experiences intermittent PUJ obstruction causing his symptoms. A 33-year-old male with insulin dependent diabetes mellitus and viral arthritis was referred for a bone scan. A three phase revealed increased uptake in the region of the knee and leR proximal tibia. Delayed whole body images revealed multiple focal areas of osteoblastic activity in the leR tibia. Abnormal uptake was also seen in the upper third of the leR femur. The remainder of the skeletal survey was normal. X-ray correlation of the leR tibia and femoral findings was undertaken. Combinating unilateral changes on bone scan and X-ray although very suggestive of sclerotic polyostotic

Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

Directory of Open Access Journals (Sweden)

Ysabel Montoya

2000-08-01

Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Stevens, A.

1980-01-01

By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.

Science.gov (United States)

Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco

2014-12-18

Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Radical SAM Enzymes in the Biosynthesis of Ribosomally Synthesized and Post-translationally Modified Peptides (RiPPs

Directory of Open Access Journals (Sweden)

Alhosna Benjdia

2017-11-01

Full Text Available Ribosomally-synthesized and post-translationally modified peptides (RiPPs are a large and diverse family of natural products. They possess interesting biological properties such as antibiotic or anticancer activities, making them attractive for therapeutic applications. In contrast to polyketides and non-ribosomal peptides, RiPPs derive from ribosomal peptides and are post-translationally modified by diverse enzyme families. Among them, the emerging superfamily of radical SAM enzymes has been shown to play a major role. These enzymes catalyze the formation of a wide range of post-translational modifications some of them having no counterparts in living systems or synthetic chemistry. The investigation of radical SAM enzymes has not only illuminated unprecedented strategies used by living systems to tailor peptides into complex natural products but has also allowed to uncover novel RiPP families. In this review, we summarize the current knowledge on radical SAM enzymes catalyzing RiPP post-translational modifications and discuss their mechanisms and growing importance notably in the context of the human microbiota.

Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

DEFF Research Database (Denmark)

He, Yangzi

and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...