WorldWideScience

Sample records for revealed unusual ribosomal

  1. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  2. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  3. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  4. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    Science.gov (United States)

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  5. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  6. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  7. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  8. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  9. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  10. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  11. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  12. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  13. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  14. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  15. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  16. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  17. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    2011-03-01

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.Se presenta la primera descripción del cariotipo de Mugil incilis de Venezuela. El complemento cromosómico está compuesto por 48 cromosomas acrocéntricos uniformemente decrecientes en tamaño. Por lo tanto, los homólogos no pueden ser claramente identificados, con excepción de uno de los pares de mayor tamaño, clasificado como número 1, cuyos homólogos poseen una constricción secundaria subcentromérica, y el par de cromosomas número 24, considerablemente más pequeño que los otros. El bandeo-C reveló bloques heterocromáticos en las regiones centroméricas/pericentroméricas de todos los cromosomas, más conspicuas en el cromosoma 1 en el que las señales C

  18. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  19. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  20. An unusual correlation between ppGpp pool size and rate of ribosome synthesis during partial pyrimidine starvation of Escherichia coli

    DEFF Research Database (Denmark)

    Vogel, Ulla; Pedersen, Steen; Jensen, Kaj Frank

    1991-01-01

    Escherichia coli was exposed to partial pyrimidine starvation by feeding a pyrBI strain orotate as the only pyrimidine source. Subsequently, differential rates of synthesis of rRNA and of a few ribosome-associated proteins as well as the pool sizes of nucleoside triphosphates and ppGpp were measu...

  1. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  3. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  4. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  6. Structural Analysis of Insulin Minisatellite Alleles Reveals Unusually Large Differences in Diversity between Africans and Non-Africans

    Science.gov (United States)

    Stead, John D. H.; Jeffreys, Alec J.

    2002-01-01

    The insulin minisatellite (INS VNTR) associates with susceptibility to a variety of diseases. We have developed a high-resolution system for analyzing variant repeat distributions applicable to all known minisatellite alleles, irrespective of size, which allows lineages of related alleles to be identified. This system has previously revealed extremely low structural diversity in the minisatellite among northern Europeans from the United Kingdom, with all alleles belonging to one of only three highly diverged lineages called “I,” “IIIA,” and “IIIB.” To explore the origins of this remarkably limited lineage diversity, we have characterized an additional 780 alleles from three non-African and three African populations. In total, 22 highly diverged lineages were identified, with structural intermediates absent from extant populations, suggesting a bottleneck within the ancestry of all humans. The difference between levels of diversity in Africans and non-Africans is unusually large, with all 22 lineages identified in Africa compared with only three lineages seen not only in the United Kingdom but also in the other non-African populations. We also find evidence for overrepresentation of lineage I chromosomes in non-Africans. These data are consistent with a common out-of-Africa origin and an unusually tight bottleneck within the ancestry of all non-African populations, possibly combined with differential and positive selection for lineage I alleles in non-Africans. The important implications of these data for future disease-association studies are discussed. PMID:12404181

  7. Three-dimensional structure of a schistosome serpin revealing an unusual configuration of the helical subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Granzin, Joachim [Institute of Complex Systems, ICS-6: Structural Biochemistry, Forschungszentrum Jülich, 52425 Jülich (Germany); Huang, Ying; Topbas, Celalettin [Department of Cell Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Huang, Wenying [Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Wu, Zhiping [Department of Cell Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Misra, Saurav [Department of Molecular Cardiology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Hazen, Stanley L. [Department of Cell Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Blanton, Ronald E. [Department of Infectious Diseases, Case Western Reserve University, Cleveland, OH 44190 (United States); Lee, Xavier [Department of Cell Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States); Weiergräber, Oliver H., E-mail: o.h.weiergraeber@fz-juelich.de [Institute of Complex Systems, ICS-6: Structural Biochemistry, Forschungszentrum Jülich, 52425 Jülich (Germany)

    2012-06-01

    The crystal structure of ShSPI, a serpin from the blood fluke S. haematobium, reveals some peculiar features of the helical subdomain which have not been observed previously in the serpin superfamily. Parasitic organisms are constantly challenged by the defence mechanisms of their respective hosts, which often depend on serine protease activities. Consequently, protease inhibitors such as those belonging to the serpin superfamily have emerged as protective elements that support the survival of the parasites. This report describes the crystal structure of ShSPI, a serpin from the trematode Schistosoma haematobium. The protein is exposed on the surface of invading cercaria as well as of adult worms, suggesting its involvement in the parasite–host interaction. While generally conforming to the well established serpin fold, the structure reveals several distinctive features, mostly concerning the helical subdomain of the protein. It is proposed that these peculiarities are related to the unique biological properties of a small serpin subfamily which is conserved among pathogenic schistosomes.

  8. Crystal structure of the Alcanivorax borkumensis YdaH transporter reveals an unusual topology

    Science.gov (United States)

    Bolla, Jani Reddy; Su, Chih-Chia; Delmar, Jared A.; Radhakrishnan, Abhijith; Kumar, Nitin; Chou, Tsung-Han; Long, Feng; Rajashankar, Kanagalaghatta R.; Yu, Edward W.

    2015-04-01

    The potential of the folic acid biosynthesis pathway as a target for the development of antibiotics has been clinically validated. However, many pathogens have developed resistance to these antibiotics, prompting a re-evaluation of potential drug targets within the pathway. The ydaH gene of Alcanivorax borkumensis encodes an integral membrane protein of the AbgT family of transporters for which no structural information was available. Here we report the crystal structure of A. borkumensis YdaH, revealing a dimeric molecule with an architecture distinct from other families of transporters. YdaH is a bowl-shaped dimer with a solvent-filled basin extending from the cytoplasm to halfway across the membrane bilayer. Each subunit of the transporter contains nine transmembrane helices and two hairpins that suggest a plausible pathway for substrate transport. Further analyses also suggest that YdaH could act as an antibiotic efflux pump and mediate bacterial resistance to sulfonamide antimetabolite drugs.

  9. Structural Characterization of Maize SIRK1 Kinase Domain Reveals an Unusual Architecture of the Activation Segment

    Directory of Open Access Journals (Sweden)

    Bruno Aquino

    2017-05-01

    Full Text Available Kinases are primary regulators of plant metabolism and excellent targets for plant breeding. However, most kinases, including the abundant receptor-like kinases (RLK, have no assigned role. SIRK1 is a leucine-rich repeat receptor-like kinase (LRR-RLK, the largest family of RLK. In Arabidopsis thaliana, SIRK1 (AtSIRK1 is phosphorylated after sucrose is resupplied to sucrose-starved seedlings and it modulates the sugar response by phosphorylating several substrates. In maize, the ZmSIRK1 expression is altered in response to drought stress. In neither Arabidopsis nor in maize has the function of SIRK1 been completely elucidated. As a first step toward the biochemical characterization of ZmSIRK1, we obtained its recombinant kinase domain, demonstrated that it binds AMP-PNP, a non-hydrolysable ATP-analog, and solved the structure of ZmSIRK1- AMP-PNP co-crystal. The ZmSIRK1 crystal structure revealed a unique conformation for the activation segment. In an attempt to find inhibitors for ZmSIRK1, we screened a focused small molecule library and identified six compounds that stabilized ZmSIRK1 against thermal melt. ITC analysis confirmed that three of these compounds bound to ZmSIRK1 with low micromolar affinity. Solving the 3D structure of ZmSIRK1-AMP-PNP co-crystal provided information on the molecular mechanism of ZmSIRK1 activity. Furthermore, the identification of small molecules that bind this kinase can serve as initial backbone for development of new potent and selective ZmSIRK1 antagonists.

  10. An Unusual Accumulation of Ribosomal Multigene Families and Microsatellite DNAs in the XX/XY Sex Chromosome System in the Trans-Andean Catfish Pimelodella cf. chagresi (Siluriformes:Heptapteridae).

    Science.gov (United States)

    Conde-Saldaña, Cristhian Camilo; Barreto, Cynthia Aparecida Valiati; Villa-Navarro, Francisco Antonio; Dergam, Jorge Abdala

    2018-02-01

    This work constitutes the first cytogenetic characterization of a trans-Andean species of Heptapteridae. The catfish Pimelodella cf. chagresi from the Upper Rio Magdalena was studied, applying standard cytogenetic techniques (Giemsa, C-banding, and argyrophilic nucleolar organizer region [Ag-NOR]) and fluorescence in situ hybridization techniques using repetitive DNA probes: microsatellites (CA 15 and GA 15 ) and ribosomal RNA (rRNA) multigene families (18S and 5S recombinant DNA [rDNA] probes). The species showed a unique diploid chromosome number 2n = 50 (32m [metacentrics] +14sm [submetacentrics] +4st [subtelocentrics]) and a XX/XY sex chromosomal system, where the heteromorphic Y-chromosome revealed a conspicuous accumulation of all the assayed domains of repetitive DNA. P. cf. chagresi karyotype shares common features with other Heptapteridae, such as the predominance of metacentric and submetacentric chromosomes, and one pair of subtelomeric nucleolar organizer regions (NORs). These results reflect an independent karyological identity of a trans-Andean species and the relevance of repetitive DNA sequences in the process of sex chromosome differentiation in fish; it is the first case of syntenic accumulation of rRNA multigene families (18S and 5S rDNA) and microsatellite sequences (CA 15 and GA 15 ) in a differentiated sex chromosome in Neotropical fish.

  11. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  12. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  14. An Unusual Case of Recurrent Pyocolpos Following Midtrimester Miscarriage Revealed as Obstructed Hemivagina with Ipsilateral Renal Agenesis (OHVIRA Syndrome

    Directory of Open Access Journals (Sweden)

    Haldar M

    2014-08-01

    Full Text Available Obstructed hemivagina with ipsilateral renal agenesis (OHVIRA Syndrome is a rare congenital anomaly. It mostly presents with severe dysmenorrhea and a palpable mass due to unilateral hematocolpos. Sometime it presents in unusual way with prolonged vaginal bleeding and profuse vaginal discharge. Here we report case of an 18 years old married female with OHVIRA syndrome presenting late with symptoms of recurrent pyocolpos following dilatation and evacuation for midtrimester miscarriage that was diagnosed on the basis of MRI and managed by vaginal septotomy.

  15. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  16. iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

    Science.gov (United States)

    Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

    2016-06-01

    Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Unusual Presentation of Postradiation Sarcoma With Subsequent Intestinal Metastasis Revealed by 18F-FDG PET/CT.

    Science.gov (United States)

    Lee, Tse-Hao; Chang, Cheng-Pei; Wu, Yuan-Hung; Huang, Wen-Sheng

    2017-10-01

    Radiation-related sarcoma is a rare but serious complication for patients after receiving radiation therapy initially for their primary malignancy. However, it usually takes several years and needs enough in-field radiation dose to develop this sarcoma. We describe a 60-year-old man with right axillary sarcoma revealed by whole-body F-FDG PET/CT 1 year after chemoradiotherapy, which presented ultrashort latency period and did not match the consensus definition of radiation-related sarcoma. Besides, metastatic sarcoma to small intestine was accidentally noted in the F-FDG PET/CT image.

  18. Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

    International Nuclear Information System (INIS)

    Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

    2010-01-01

    We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

  19. The genome and proteome of a Campylobacter coli bacteriophage vB_CcoM-IBB_35 reveal unusual features

    Directory of Open Access Journals (Sweden)

    Carvalho Carla M

    2012-01-01

    Full Text Available Abstract Background Campylobacter is the leading cause of foodborne diseases worldwide. Bacteriophages (phages are naturally occurring predators of bacteria, ubiquitous in the environment, with high host specificity and thus considered an appealing option to control bacterial pathogens. Nevertheless for an effective use of phages as antimicrobial agents, it is important to understand phage biology which renders crucial the analysis of phage genomes and proteomes. The lack of sequence data from Campylobacter phages adds further importance to these studies. Methods vB_CcoM-IBB_35 is a broad lytic spectrum Myoviridae Campylobacter phage with high potential for therapeutic use. The genome of this phage was obtained by pyrosequencing and the sequence data was further analyzed. The proteomic analysis was performed by SDS-PAGE and Mass spectrometry. Results and conclusions The DNA sequence data of vB_CcoM-IBB_35 consists of five contigs for a total of 172,065 bp with an average GC content of 27%. Attempts to close the gaps between contigs were unsuccessful since the DNA preparations appear to contain substances that inhibited Taq and ϕ29 polymerases. From the 210 identified ORFs, around 60% represent proteins that were not functionally assigned. Homology exists with members of the Teequatrovirinae namely for T4 proteins involved in morphogenesis, nucleotide metabolism, transcription, DNA replication and recombination. Tandem mass spectrometric analysis revealed 38 structural proteins as part of the mature phage particle. Conclusions Genes encoding proteins involved in the carbohydrate metabolism along with several incidences of gene duplications, split genes with inteins and introns have been rarely found in other phage genomes yet are found in this phage. We identified the genes encoding for tail fibres and for the lytic cassette, this later, expressing enzymes for bacterial capsular polysaccharides (CPS degradation, which has not been reported

  20. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  2. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  3. Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

    Science.gov (United States)

    Liang, Ping; Nair, Jayakumar R; Song, Lei; McGuire, John J; Dolnick, Bruce J

    2005-01-01

    Background The rTS gene (ENOSF1), first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS) mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis. PMID:16162288

  4. Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

    Directory of Open Access Journals (Sweden)

    McGuire John J

    2005-09-01

    Full Text Available Abstract Background The rTS gene (ENOSF1, first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis.

  5. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  6. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  7. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  8. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  9. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  10. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  11. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  12. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  13. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  14. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  15. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Unusual event report from Oskarshamn

    International Nuclear Information System (INIS)

    1996-01-01

    The title of the report was intended to reflect the cause of the shutdown and the report to be regarded as a summary of the deficiencies that had been revealed and remedied. No single deficiency was regarded as reportable as an unusual event, but taken together the identified deficiencies deviated from the assumed safety level to the extent that it should be reported. The unusual event report refers to two main documents presenting measures taken to return to reported safety level, one concerning technical and one organizational measures

  17. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Genomic structure and expression pattern of MHC IIα and IIβ genes reveal an unusual immune trait in lined seahorse Hippocampus erectus.

    Science.gov (United States)

    Luo, Wei; Wang, Xin; Qu, Hongyue; Qin, Geng; Zhang, Huixian; Lin, Qiang

    2016-11-01

    The major histocompatibility complex (MHC) genes are crucial in the adaptive immune system, and the gene duplication of MHC in animals can generally result in immune flexibility. In this study, we found that the lined seahorse (Hippocampus erectus) has only one gene copy number (GCN) of MHC IIα and IIβ, which is different from that in other teleosts. Together with the lack of spleen and gut-associated lymphatic tissue (GALT), the seahorse may be referred to as having a partial but natural "immunodeficiency". Highly variable amino acid residues were found in the IIα and IIβ domains, especially in the α1 and β1 domains with 9.62% and 8.43% allelic variation, respectively. Site models revealed seven and ten positively selected positions in the α1 and β1 domains, respectively. Real-time PCR experiments showed high expression levels of the MHC II genes in intestine (In), gill (Gi) and trunk kidney (TK) and medium in muscle (Mu) and brood pouch (BP), and the expression levels were significantly up-regulated after bacterial infection. Specially, relative higher expression level of both MHC IIα and IIβ was found in Mu and BP when compared with other fish species, in which MHC II is expressed negligibly in Mu. These results indicate that apart from TK, Gi and In, MU and BP play an important role in the immune response against pathogens in the seahorse. In conclusion, high allelic variation and strong positive selection in PBR and relative higher expression in MU and BP are speculated to partly compensate for the immunodeficiency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Transcriptional analysis of the HeT-A retrotransposon in mutant and wild type stocks reveals high sequence variability at Drosophila telomeres and other unusual features

    Directory of Open Access Journals (Sweden)

    Piñeyro David

    2011-11-01

    Full Text Available Abstract Background Telomere replication in Drosophila depends on the transposition of a domesticated retroelement, the HeT-A retrotransposon. The sequence of the HeT-A retrotransposon changes rapidly resulting in differentiated subfamilies. This pattern of sequence change contrasts with the essential function with which the HeT-A is entrusted and brings about questions concerning the extent of sequence variability, the telomere contribution of different subfamilies, and whether wild type and mutant Drosophila stocks show different HeT-A scenarios. Results A detailed study on the variability of HeT-A reveals that both the level of variability and the number of subfamilies are higher than previously reported. Comparisons between GIII, a strain with longer telomeres, and its parental strain Oregon-R indicate that both strains have the same set of HeT-A subfamilies. Finally, the presence of a highly conserved splicing pattern only in its antisense transcripts indicates a putative regulatory, functional or structural role for the HeT-A RNA. Interestingly, our results also suggest that most HeT-A copies are actively expressed regardless of which telomere and where in the telomere they are located. Conclusions Our study demonstrates how the HeT-A sequence changes much faster than previously reported resulting in at least nine different subfamilies most of which could actively contribute to telomere extension in Drosophila. Interestingly, the only significant difference observed between Oregon-R and GIII resides in the nature and proportion of the antisense transcripts, suggesting a possible mechanism that would in part explain the longer telomeres of the GIII stock.

  20. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  1. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  2. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  3. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  4. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  6. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  7. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  8. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  9. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  10. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  11. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  12. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  13. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  14. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  15. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  16. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  18. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  19. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  20. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  1. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  2. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  3. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  4. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  5. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  6. Unusual raptor nests around the world

    Science.gov (United States)

    Ellis, D.H.; Craig, T.; Craig, E.; Postupalsky, S.; LaRue, C.T.; Nelson, R.W.; Anderson, D.W.; Henny, C.J.; Watson, J.; Millsap, B.A.; Dawson, J.W.; Cole, K.L.; Martin, E.M.; Margalida, A.; Kung, P.

    2009-01-01

    From surveys in many countries, we report raptors using unusual nesting materials (e.g., paper money, rags, metal, antlers, and large bones) and unusual nesting situations. For example, we documented nests of Steppe Eagles Aquila nipalensis and Upland Buzzards Buteo hemilasius on the ground beside well-traveled roads, Saker Falcon Falco cherrug eyries in attics and a cistern, and Osprey Pandion haliaetus nests on the masts of boats and on a suspended automobile. Other records include a Golden Eagle A. chrysaetos nest 7.0 m in height, believed to be the tallest nest ever described, and, for the same species, we report nesting in rudimentary nests. Some nest sites are within a few meters of known predators or competitors. These unusual observations may be important in revealing the plasticity of a species' behavioral repertoire. ?? 2009 The Raptor Research Foundation, Inc.

  7. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  8. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  9. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  10. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  11. Unusual causes of pneumothorax

    Science.gov (United States)

    Ouellette, Daniel R.; Parrish, Scott; Browning, Robert F.; Turner, J. Francis; Zarogoulidis, Konstantinos; Kougioumtzi, Ioanna; Dryllis, Georgios; Kioumis, Ioannis; Pitsiou, Georgia; Machairiotis, Nikolaos; Katsikogiannis, Nikolaos; Tsiouda, Theodora; Madesis, Athanasios; Karaiskos, Theodoros

    2014-01-01

    Pneumothorax is divided to primary and secondary. It is a situation that requires immediate treatment, otherwise it could have severe health consequences. Pneumothorax can be treated either by thoracic surgeons, or pulmonary physicians. In our current work, we will focus on unusual cases of pneumothorax. We will provide the etiology and treatment for each case, also a discussion will be made for each situation. PMID:25337394

  12. Unusual headache syndromes.

    Science.gov (United States)

    Queiroz, Luiz P

    2013-01-01

    Some headache syndromes have few cases reported in the literature. Their clinical characteristics, pathogenesis, and treatment may have not been completely defined. They may not actually be uncommon but rather under-recognized and/or underreported. A literature review of unusual headache syndromes, searching PubMed and ISI Web of Knowledge, was performed. After deciding which disorders to study, relevant publications in scientific journals, including original articles, reviews, meeting abstracts, and letters or correspondences to the editors were searched. This paper reviewed the clinical characteristics, the pathogenesis, the diagnosis, and the treatment of five interesting and unusual headache syndromes: exploding head syndrome, red ear syndrome, neck-tongue syndrome, nummular headache, and cardiac cephalgia. Recognizing some unusual headaches, either primary or secondary, may be a challenge for many non-headache specialist physicians. It is important to study them because the correct diagnosis may result in specific treatments that may improve the quality of life of these patients, and this can even be life saving. © 2013 American Headache Society.

  13. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  14. Cardiopulmonary Resuscitation: Unusual Techniques for Unusual Situations

    Directory of Open Access Journals (Sweden)

    Vidhu Bhatnagar

    2018-01-01

    Full Text Available Background: The cardiopulmonary resuscitation (CPR in prone position has been dealt with in 2010 American Heart Association (AHA guidelines but have not been reviewed in 2015 guidelines. The guidelines for patients presenting with cardiac arrest under general anesthesia in lateral decubitus position and regarding resuscitation in confined spaces like airplanes are also not available in AHA guidelines. This article is an attempt to highlight the techniques adopted for resuscitation in these unusual situations. Aims: This study aims to find out the methodology and efficacy in nonconventional CPR approaches such as CPR in prone, CPR in lateral position, and CPR in confined spaces. Methods: We conducted a literature search using MeSH search strings such as CPR + Prone position, CPR + lateral Position, and CPR + confined spaces. Results: No randomized controlled trials are available. The literature search gives a handful of case reports, some simulation- and manikin-based studies but none can qualify for class I evidence. The successful outcome of CPR performed in prone position has shown compressions delivered on the thoracic spine with the same rate and force as they were delivered during supine position. A hard surface is required under the patient to provide uniform force and sternal counter pressure. Two rescuer technique for providing successful chest compression in lateral position has been documented in the few case reports published. Over the head CPR and straddle (STR, CPR has been utilized for CPR in confined spaces. Ventilation in operating rooms was taken care by an advanced airway in situ. Conclusion: A large number of studies of high quality are required to be conducted to determine the efficacy of CPR in such positions.

  15. Vaginal haemangioendothelioma: an unusual tumour.

    LENUS (Irish Health Repository)

    Mohan, H

    2012-02-01

    Vaginal tumours are uncommon and this is a particularly rare case of a vaginal haemangioendothelioma in a 38-year-old woman. Initial presentation consisted of symptoms similar to uterovaginal prolapse with "something coming down". Examination under anaesthesia demonstrated a necrotic anterior vaginal wall tumour. Histology of the lesion revealed a haemangioendothelioma which had some features of haemangiopericytoma. While the natural history of vaginal haemangioendothelioma is uncertain, as a group, they have a propensity for local recurrence. To our knowledge this is the third reported case of a vaginal haemangioendothelioma. Management of this tumour is challenging given the paucity of literature on this tumour. There is a need to add rare tumours to our "knowledge bank" to guide management of these unusual tumours.

  16. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  17. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  18. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  19. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  20. An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2005-08-01

    Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

  1. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  2. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  4. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  5. Unusual ISS Rate Signature

    Science.gov (United States)

    Laible, Michael R.

    2011-01-01

    On November 23, 2011 International Space Station Guidance, Navigation, and Control reported unusual pitch rate disturbance. These disturbances were an order of magnitude greater than nominal rates. The Loads and Dynamics team was asked to review and analyze current accelerometer data to investigate this disturbance. This paper will cover the investigation process under taken by the Loads and Dynamics group. It will detail the accelerometers used and analysis performed. The analysis included performing Frequency Fourier Transform of the data to identify the mode of interest. This frequency data is then reviewed with modal analysis of the ISS system model. Once this analysis is complete and the disturbance quantified, a forcing function was produced to replicate the disturbance. This allows the Loads and Dynamics team to report the load limit values for the 100's of interfaces on the ISS.

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  8. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  9. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  11. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  12. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  13. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  14. A combined cryo-EM and molecular dynamics approach reveals the mechanism of ErmBL-mediated translation arrest

    Science.gov (United States)

    Arenz, Stefan; Bock, Lars V.; Graf, Michael; Innis, C. Axel; Beckmann, Roland; Grubmüller, Helmut; Vaiana, Andrea C.; Wilson, Daniel N.

    2016-07-01

    Nascent polypeptides can induce ribosome stalling, regulating downstream genes. Stalling of ErmBL peptide translation in the presence of the macrolide antibiotic erythromycin leads to resistance in Streptococcus sanguis. To reveal this stalling mechanism we obtained 3.6-Å-resolution cryo-EM structures of ErmBL-stalled ribosomes with erythromycin. The nascent peptide adopts an unusual conformation with the C-terminal Asp10 side chain in a previously unseen rotated position. Together with molecular dynamics simulations, the structures indicate that peptide-bond formation is inhibited by displacement of the peptidyl-tRNA A76 ribose from its canonical position, and by non-productive interactions of the A-tRNA Lys11 side chain with the A-site crevice. These two effects combine to perturb peptide-bond formation by increasing the distance between the attacking Lys11 amine and the Asp10 carbonyl carbon. The interplay between drug, peptide and ribosome uncovered here also provides insight into the fundamental mechanism of peptide-bond formation.

  15. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  16. An Unusual Case of Gastrointestinal Bleeding

    Directory of Open Access Journals (Sweden)

    Kristin N. Fiorino

    2011-01-01

    Full Text Available A 10-year-old boy presented with a 3-day history of worsening abdominal pain, fever, emesis and melena. Abdominal ultrasound revealed a right upper quadrant mass that was confirmed by computed tomography angiogram (CTA, which showed an 8 cm well-defined retroperitoneal vascular mass. 123Iodine metaiodobenzylguanidine (123MIBG scan indicated uptake only in the abdominal mass. Subsequent biopsy revealed a paraganglioma that was treated with chemotherapy. This case represents an unusual presentation of a paraganglioma associated with gastrointestinal (GI bleeding and highlights the utility of CTA and 123MIBG in evaluation and treatment.

  17. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  18. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  19. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  20. An unusual foreign body of esophagus

    Directory of Open Access Journals (Sweden)

    Surinder K Singhal

    2010-07-01

    Full Text Available We report a rare case of an unusually long foreign body (Datun impacted in the esophagus of a 56 year-old gentleman. He was literate, without any psychiatric illness and had been using “Neem” (Azadirachta indica stick for cleaning his teeth for the past twenty years. Neem sticks are used for brushing teeth, perhaps one of the earliest and very effective dental care. On closer questioning he revealed his habit of passing the Neem stick into his throat with the aim of cleaning it too while cleaning his teeth. He presented to our emergency early in the morning with this strange long foreign body impacted in his esophagus which was removed successfully using a Jackson’s adult rigid oesophagoscope. We believe this to be the first case of such an unusually long foreign body to be reported in the literature.

  1. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  2. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  3. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  4. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  5. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  7. Unusual anatomy of maxillary central incisor with two roots

    Directory of Open Access Journals (Sweden)

    T S Ashwini Shivakumar

    2012-01-01

    Full Text Available Introduction: Knowledge of root canal morphology is essential for successful endodontic therapy. Failure to recognize unusual root canal anatomy may lead to unsuccessful endodontic treatment. Case Report: This case report describes the successful endodontic treatment of the maxillary central incisor with unusual anatomy of two roots and two root canals. A 23-year-old male patient was referred for dental consultation with discoloration of the maxillary right central incisor with periapical lesion, which revealed unusual anatomy of root on radiographic examination, and was confirmed upon exploration. Discussion: As described by Vertucci, the maxillary central incisor presents a single root and single root canal in 100% of the cases. However, few cases of maxillary central incisors with two canals were reported in the literature, most of which were associated with developmental anomalies like fusion, germination or dens invaginatus. Clinician should be aware of the unusual anatomical variations that should be detected by the different diagnostic resources available.

  8. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  9. Interesting bone scans - unusual findings

    International Nuclear Information System (INIS)

    Dobson, M.; Wadhwa, S.S.; Mansberg, R.; Fernandes, V.B.

    1997-01-01

    A 59-year-old female with carcinoma of the colon and known liver metastatic disease was referred for bone scan to evaluate for bone metastases. Although no bone metastases were found, there was abnormal uptake noted in the liver corresponding to a metastatic calcified lesion. The only other findings were of degenerative disease in the cervical spine, right shoulder and small joints of the hands. A 69-year-old male with carcinoma of the prostate and right side low back pain was referred for bone scan. No focal abnormalities to suggest metastatic disease were identified; findings within the cervical spine, lumber spine and knees were presumed secondary to degenerative disease. Intermittent pain persisted and the patient was referred for a repeat bone scan six months later. Previous scan findings of degenerative disease and no metastatic disease were confirmed; however, closer inspection revealed an enlarged right kidney with significant retention of tracer in the pelvicalyceal system suggesting possible obstruction. A Retrograde pyelogram was performed, and no obvious obstruction demonstrated. As bone scan findings were very suggestive of obstruction, a DTPA scan with lasix was performed showing a dilated right collecting system with no functional obstruction. Given the degree of dilation, it is possible that the patient experiences intermittent PUJ obstruction causing his symptoms. A 33-year-old male with insulin dependent diabetes mellitus and viral arthritis was referred for a bone scan. A three phase revealed increased uptake in the region of the knee and leR proximal tibia. Delayed whole body images revealed multiple focal areas of osteoblastic activity in the leR tibia. Abnormal uptake was also seen in the upper third of the leR femur. The remainder of the skeletal survey was normal. X-ray correlation of the leR tibia and femoral findings was undertaken. Combinating unilateral changes on bone scan and X-ray although very suggestive of sclerotic polyostotic

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  12. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  13. An Unusual Case of Rapidly Progressive Hyperbilirubinemia

    Directory of Open Access Journals (Sweden)

    Kimberly M. Thornton

    2013-01-01

    Full Text Available We present an unusual case of hyperbilirubinemia with rapid early progression leading to bilirubin encephalopathy in a term neonate. Despite early recognition and intervention, the total serum bilirubin reached a maximum level of 39 mg/dL at 32 hours of life. Prior to an emergent exchange transfusion, the patient’s diagnostic evaluation was significant for Coombs-negative microangiopathic hemolytic anemia and thrombocytopenia. Further testing revealed a deficiency of ADAMTS13 protein, or von Willebrand factor-cleaving protease, a finding diagnostic of congenital thrombotic thrombocytopenic purpura, or Upshaw-Schulman syndrome. This rare disease is often misdiagnosed, especially in the newborn period.

  14. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  15. An unusual case of refractory wheeze

    Science.gov (United States)

    Ramesh, Venkat; Acharya, Vishak; Pai, Narasimha; Krishnan, Ananda

    2015-01-01

    A 37-year-old man presented with a history of episodic wheeze and breathlessness of 3 years’ duration refractory to treatment. Physical examination revealed diffuse expiratory polyphonic rhonchi while the remainder of the examination including the cardiac examination was reported as normal. Pulmonary function testing revealed mild obstruction with bronchodilator reversibility. The patient was discharged on a 6-month course of antitubercular treatment (ATT) as bronchial brush cytology (obtained via bronchoscopy) was positive for acid-fast bacilli. The patient presented after completing 6 months of ATT with persistent symptoms, a loud S1 and a mid-diastolic murmur at the apex. High-resolution CT of the chest showed bilateral dependent ground glass opacities. An echocardiogram revealed a left atrial myxoma, and normal RV size and pressures. The patient underwent successful surgical removal of the same, and made a complete recovery. Refractory wheeze is a very unusual presentation of a left atrial myxoma. PMID:25733086

  16. An unusual clinical presentation of gingival melanoacanthoma

    Directory of Open Access Journals (Sweden)

    S. P. K. Kennedy Babu

    2013-01-01

    Full Text Available Gingival melanoacanthoma is a rare, benign pigmented lesion characterized clinically by sudden onset and rapid growth of a macular brown black lesion and histologically by acanthosis of superficial epithelium and proliferation of dendritic melanocytes. This article reports a previously undescribed case of pigmented unilateral diffuse gingival enlargement, which on histopathological examination proved to be melanoacanthoma. Intraoral examination revealed pigmented unilateral diffuse gingival enlargement in relation to second and third quadrants buccally, palatally/lingually. Based on these clinical findings, gingivectomy was performed and the excised tissue was sent for biopsy. Microscopic examination revealed acanthotic and parakeratotic surface epithelium with dendritic melanocytes distributed in basal and suprabasal layers of the epithelium. 1 year follow-up recall revealed no recurrence of lesion at the surgical sites. Our patient exhibits an unusual clinical presentation of melanoacanthoma of gingiva. Pigmented gingival overgrowth of recent origin and without any etiologic factors warrants histopathologic examination.

  17. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  18. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  19. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  20. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  1. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  2. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  3. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  4. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  5. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  6. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  7. Sedimentological processes in a scarp-controlled rocky shoreline to upper continental slope environment, as revealed by unusual sedimentary features in the Neogene Coquimbo Formation, north-central Chile

    Science.gov (United States)

    Le Roux, J. P.; Gómez, Carolina; Fenner, Juliane; Middleton, Heather

    2004-03-01

    Exceptionally good outcrops of Miocene to Pliocene deposits in the vicinity of submarine Paleozoic basement scarps at Carrizalillo, north of La Serena, reveal a wealth of sedimentary features not commonly observed. The most proximal facies consist of rock fall and coarse-grained debris flow deposits directly abutting the basement wall from which they originated. Angular basement clasts are mixed with well-rounded cobbles, which probably formed as a basal gravel on a wave-cut platform at the beginning of marine flooding, subsequently accumulated at the scarp edge and were incorporated into the debris when the latter collapsed. The poor sorting, inverse grading, and protruding cobbles and boulders are classical debris flow features, with good clast imbrication indicating a laminar shearing action. A medial facies is represented by secondary channels running parallel to the major scarp about 1 km downslope of the first locality. In the largest channel, megaflutes at the base indicate the passage of highly turbulent, nondepositing flows eroding the soft, silty substrate. In the deepest, central part of the channel, a pebbly coquina shows horizontal and trough cross-stratification, with most of the bivalves oriented convex side up. Meter-scale rip-up clasts of the underlying siltstone are also present, indicating turbulent flow with a density sufficiently high to retard settling. The coquina is interpreted as a detachment deposit resulting from a hydroplaning debris flow along the central part of the channel, where the velocity and rate of pore pressure decay were highest. This deposit is overlain by fining upward, massive to horizontally stratified sandstone very similar in texture and composition to the matrix of the debris flow, suggesting its formation by surface transformation and elutriation of the latter. Along the channel margin, a basal centimeter-scale sandstone layer is virtually unaffected by the megaflute topography and clearly represents a subsequent event

  8. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  9. An unusual case of total ophthalmoplegia

    Directory of Open Access Journals (Sweden)

    Chowdhury Ravindra

    2009-01-01

    Full Text Available An eight-year-old male child presented with drooping of the left eyelid with a history of penetrating injury of hard palate by an iron spoon seven days ago, which had already been removed by the neurosurgeon as the computed tomography scan revealed a spoon in the left posterior ethmoid and sphenoid bone penetrating into the middle cranial fossa. On examination, visual acuity was 20/20 in each eye and left eye showed total ophthalmoplegia. Oral cavity revealed a hole in the left lateral part of the hard palate. We managed the case with tapering dose of systemic prednisolone. The total ophthalmoplegia was markedly improved in one month. Cases of foreign bodies in the orbit with intracranial extension are not unusual, but the path this foreign body traveled through the hard palate without affecting the optic nerve, internal carotid artery or cavernous sinus makes an interesting variation.

  10. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  11. Unusual motions in the Wolf-Rayet nebula NGC 6888

    International Nuclear Information System (INIS)

    Johnson, P.G.; Songsathaporn, R.

    1981-01-01

    A systematic survey of the velocity structure within the Wolf-Rayet ring nebula NGC 6888 has been undertaken by making observations of the [N II] line profiles. They reveal a hitherto undetected and particularly unusual velocity structure with three of the brightest portions of the circumference of this ring exhibiting triple line components. Possible models to explain these observations are discussed. (author)

  12. Embolia cutis medicamentosa: an unusual adverse reaction to terlipressin

    Science.gov (United States)

    Gatos-Gatopoulos, Polychronis; Kostantoudakis, Stephanos; Panayiotides, Ioannis G.; Dimitriadis, George D.; Triantafyllou, Konstantinos

    2017-01-01

    Terlipressin is a synthetic long-acting analog of vasopressin widely used to control variceal bleeding by lowering portal venous pressure. We report an unusual adverse reaction to terlipressin in a 78-year-old patient with esophageal variceal bleeding who developed skin necrosis soon after treatment initiation. Skin biopsy revealed embolia cutis medicamentosa. PMID:29118569

  13. Hepatobiliary fascioliasis: a case with unusual radiological features.

    Science.gov (United States)

    Yeşildağ, Ahmet; Senol, Altuğ; Köroğlu, Mert; Koçkar, Cem; Oyar, Orhan; Işler, Mehmet

    2010-12-01

    We report a case of hepatobiliary fascioliasis presenting with unusual radiological findings that have not been reported previously. Imaging studies revealed hepatic cystic pouches communicating with intrahepatic bile ducts. Snail-like, oval shaped and conglomerated echogenic particles with no acoustic shadowing, suggesting F. hepatica, were detected in these cystic pouches. In addition, secondary sclerosing cholangitis developed after fascioliasis.

  14. Unusual Presentation of Maydl's Hernia

    African Journals Online (AJOL)

    Nikhil NBA, Natarajan K, Mohanty A, et al. An. Unusual Case of Maydl's Hernia. Int J Cur Res Rev. 2013;5(6):22-5. 11. Ganesaratnam M. Maydl's hernia: Report of a Series of Seven Cases and Review of Literature. Brit J Surg. 1985;72:737-8. 12. Weledji EP, Mokake M, Ngowe MN. A Rare. Presentation of Maydl's Hernia.

  15. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  16. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  17. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  18. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  19. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  20. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  1. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  2. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  3. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  4. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  5. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  6. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  7. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  8. Unusual presentation of cutaneous leiomyoma

    Directory of Open Access Journals (Sweden)

    Sapnashree Bhaskar

    2014-01-01

    Full Text Available Herein, we report a case of leiomyoma cutis because of its rarity and unusual presentation. The case presented with a solitary leiomyoma lesion which was painless. However, the adjacent normal appearing area was tender. A biopsy of the lesion as well as of a portion of the adjacent normal appearing area was taken, which confirmed the diagnosis of cutaneous leiomyoma. This may suggest the dormant nature of the disease which has not yet become apparent.

  9. Unusual headaches in the elderly.

    Science.gov (United States)

    Bamford, Cynthia C; Mays, MaryAnn; Tepper, Stewart J

    2011-08-01

    Prevalence of headache lowers with age, and headaches of elderly adults tend to be different than those of the younger population. Secondary headaches, such as headaches associated with vascular disease, head trauma, and neoplasm, are more common. Also, certain headache types tend to be geriatric disorders, such as primary cough headache, hypnic headache, typical aura without headache, exploding head syndrome, and giant cell arteritis. This review provides an overview of some of the major and unusual geriatric headaches, both primary and secondary.

  10. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  11. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  12. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  13. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  14. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  15. Uniportal anatomic combined unusual segmentectomies.

    Science.gov (United States)

    González-Rivas, Diego; Lirio, Francisco; Sesma, Julio

    2017-01-01

    Nowadays, sublobar anatomic resections are gaining momentum as a valid alternative for early stage lung cancer. Despite being technically demanding, anatomic segmentectomies can be performed by uniportal video-assisted thoracic surgery (VATS) approach to combine the benefits of minimally invasiveness with the maximum lung sparing. This procedure can be even more complex if a combined resection of multiple segments from different lobes has to be done. Here we report five cases of combined and unusual segmentectomies done by the same experienced surgeon in high volume institutions to show uniportal VATS is a feasible approach for these complex resections and to share an excellent educational resource.

  16. Unusual osteopathy in a newborn

    Energy Technology Data Exchange (ETDEWEB)

    Jequier, S.; Nogrady, M.B.; Wesenberg, R.L.

    1983-06-01

    A newborn baby presented with hyaline membrane disease, interstitial pneumonia, jaundice, hepatosplenomegaly, and unusual bone manifestations with lytic and sclerotic bone lesions and virtually absent periosteal reaction. He subsequently developed intracranial calcifications and mental retardation. The pneumonia and hepatosplenomegaly resolved. At the time of the delivery, a sibling was suffering from a severe undetermined viral infection. The clinical evolution of the disease and the radiologic findings led us to believe that this patient has a prenatal viral infection. The laboratory tests and the histologic picture of the bone biopsy supported the diagnosis.

  17. Unusual osteopathy in a newborn

    International Nuclear Information System (INIS)

    Jequier, S.; Nogrady, M.B.; Wesenberg, R.L.

    1983-01-01

    A newborn baby presented with hyaline membrane disease, interstitial pneumonia, jaundice, hepatosplenomegaly, and unusual bone manifestations with lytic and sclerotic bone lesions and virtually absent periosteal reaction. He subsequently developed intracranial calcifications and mental retardation. The pneumonia and hepatosplenomegaly resolved. At the time of the delivery, a sibling was suffering from a severe undetermined viral infection. The clinical evolution of the disease and the radiologic findings led us to believe that this patient has a prenatal viral infection. The laboratory tests and the histologic picture of the bone biopsy supported the diagnosis. (orig.)

  18. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  19. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  20. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  1. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  2. Cutaneous sporotrichosis: Unusual clinical presentations

    Directory of Open Access Journals (Sweden)

    Mahajan Vikram

    2010-01-01

    Full Text Available Three unusual clinical forms of sporotrichosis described in this paper will be a primer for the clinicians for an early diagnosis and treatment, especially in its unusual presentations. Case 1, a 52-year-old man, developed sporotrichosis over pre-existing facial nodulo-ulcerative basal cell carcinoma of seven-year duration, due to its contamination perhaps from topical herbal pastes and lymphocutaneous sporotrichosis over right hand/forearm from facial lesion/herbal paste. Case 2, a 25-year-old woman, presented with disseminated systemic-cutaneous, osteoarticular and possibly pleural (effusion sporotrichosis. There was no laboratory evidence of tuberculosis and treatment with anti-tuberculosis drugs (ATT did not benefit. Both these cases were diagnosed by histopathology/culture of S. schenckii from tissue specimens. Case 3, a 20-year-old girl, had multiple intensely pruritic, nodular lesions over/around left knee of two-year duration. She was diagnosed clinically as a case of prurigo nodularis and histologically as cutaneous tuberculosis, albeit, other laboratory investigations and treatment with ATT did not support the diagnosis. All the three patients responded well to saturated solution of potassium iodide (SSKI therapy. A high clinical suspicion is important in early diagnosis and treatment to prevent chronicity and morbidity in these patients. SSKI is fairly safe and effective when itraconazole is not affordable/ available.

  3. Anubhoothi: a psychopathology of unusual sexual experience

    Directory of Open Access Journals (Sweden)

    G Ragesh

    2016-07-01

    Full Text Available The case history and management of a 26 years old adult is reported who presented with an unusual symptom of sexual experience, in the background of symptoms of depression and anxiety; had been given multiple diagnoses at multiple points of time and treated with multiple medications. On establishment of rapport, he revealed details of his unusual experiences, which had been unexplored. When he was about 11 years and ten months, he sat next to a lady; he could perceive a particular experience for the first time in his life. And next time with another lady too he perceived a particular type of smell (“madaka gandha” meaning an intoxicating smell along with the other feelings. He began to have these feelings whenever he was in the vicinity of a female except his mother and sister. The smell reminded him of roses vaguely and was at least ten to 20 times more pleasurable than an orgasm that he got with masturbation. These feelings were more pleasurable than he could ever imagine and happened always with the presence of a female in the vicinity. This was never associated with periods of unresponsiveness or any other history suggestive of seizures. He titled the experience as “anubhoothi”. These experiences occurred on a regular basis for a period of ten months following which there was abrupt cessation of the same, without any intervention. Later he developed all symptoms. A coordinated management plan spearheaded by the multi-disciplinary treatment team could bring down his symptoms as well as make him functional. This case indicates that it is essential to explore abnormalities of experiences to understand the psychopathology and plan management.

  4. Peroneal Arteriovenous Fistula and Pseudoaneurysm: An Unusual Presentation

    Directory of Open Access Journals (Sweden)

    Kevin C. Ching

    2014-01-01

    Full Text Available Peroneal artery arteriovenous fistulas and pseudoaneurysms are extremely rare with the majority of reported cases due to penetrating, orthopedic, or iatrogenic trauma. Failure to diagnose this unusual vascular pathology may lead to massive hemorrhage or limb threatening ischemia. We report an interesting case of a 14-year-old male who presented with acute musculoskeletal pain of his lower extremity. Initial radiographs were negative. Further imaging workup revealed a peroneal arteriovenous fistula with a large pseudoaneurysm. After initial endovascular intervention was unsuccessful, the vessels were surgically ligated in the operating room. Pathology revealed papillary endothelial hyperplasia consistent with an aneurysm and later genetic testing was consistent with Ehlers-Danlos syndrome Type IV. This case illustrates an unusual cause of acute atraumatic musculoskeletal pain and uncommon presentation of Ehlers-Danlos syndrome.

  5. An unusual case of calcineurine inhibitor pain syndrome.

    Science.gov (United States)

    Nickavar, Azar; Mehrazma, Mitra; Hallaji, Farideh

    2014-09-01

    Cyclosporine induced pain syndrome (CIPS) is a newly diagnosed complication of calcineurine inhibitors, mainly observed in solid organ and hematopoetic transplantations. The present case is a male child with steroid resistant nephrotic syndrome on low therapeutic level cyclosporine treatment. He presented with intractable and debilitating leg pain, with no reported history of previous injury or trauma. The pain was reluctant to antimicrobial and sedative treatment. MRI revealed bone marrow and soft tissue edema in the mid shaft of patient's right leg. Inspite of unusual manifestations, CIPS was suggested and cyclosporine discontinued. However, the pain did not improve and was resistant to calcium blocker. Subsequently, core decompression was performed as an unusual treatment of CIPS, revealing normal bone morphology. The pain improved rapidly and the patient was discharged a few days later.

  6. An unusual manifestation of acute appendicitis with left flank pain

    Directory of Open Access Journals (Sweden)

    Roland Talanow, MD, PhD

    2008-08-01

    Full Text Available The author presents a case with an unusual presentation of early appendicitis. The patient presented initially with left sided flank pain. Workup for nephrolithiasis, including non-contrast CT of the abdomen and pelvis was negative for renal stones or hydronephrosis. After discharge, the patient presented one week later in the ED with right lower quadrant pain. Contrast enhanced CT of the abdomen revealed perforated appendicitis.

  7. POEMS syndrome: unusual radiographic, scintigraphic and CT features

    Energy Technology Data Exchange (ETDEWEB)

    Narvaez, J.A.; Majos, C.; Valls, C.; Fernandez-Cabrera, L. [Department of CT and MR Imaging, Ciudad Sanitaria y Universitaria de Bellvitge, Barcelona (Spain); Narvaez, J. [Department of Rheumatology, Hospital Princeps d`Espanya, L`Hospitalet de Llobregat, Barcelona (Spain)

    1998-02-01

    POEMS syndrome is a multisystemic disorder related to a plasma cell dyscrasia. Radiologically, this syndrome is characterized by sclerotic focal bone lesions with a normal radionuclide bone scan. We report a case of POEMS syndrome with an expansile lytic lesion in the sternum showing periosteal reaction and soft tissue mass, which revealed locally increased uptake of radiotracer in bone scintigraphy. These unusual findings and the differential diagnosis are discussed. (orig.) With 3 figs., 8 refs.

  8. Unusual Metastatic Patterns of Invasive Lobular Carcinoma of the Breast

    OpenAIRE

    Sobinsky, Justin D.; Willson, Thomas D.; Podbielski, Francis J.; Connolly, Mark M.

    2013-01-01

    Invasive lobular carcinoma of the breast has similar patterns of metastatic disease when compared to invasive ductal carcinoma; however, lobular carcinoma metastasizes to unusual sites more frequently. We present a 65-year-old female with a history of invasive lobular breast carcinoma (T3N3M0) treated with modified radical mastectomy and aromatase-inhibitor therapy who underwent a surveillance PET scan, which showed possible sigmoid cancer. Colonoscopy with biopsy revealed a 3?cm sigmoid aden...

  9. POEMS syndrome: unusual radiographic, scintigraphic and CT features

    International Nuclear Information System (INIS)

    Narvaez, J.A.; Majos, C.; Valls, C.; Fernandez-Cabrera, L.; Narvaez, J.

    1998-01-01

    POEMS syndrome is a multisystemic disorder related to a plasma cell dyscrasia. Radiologically, this syndrome is characterized by sclerotic focal bone lesions with a normal radionuclide bone scan. We report a case of POEMS syndrome with an expansile lytic lesion in the sternum showing periosteal reaction and soft tissue mass, which revealed locally increased uptake of radiotracer in bone scintigraphy. These unusual findings and the differential diagnosis are discussed. (orig.)

  10. Unusual imaging presentation of spinal glomus tumor: case report

    OpenAIRE

    Kuo, Chao-Hung; Huang, Wen-Cheng; Wu, Jau-Ching

    2017-01-01

    A glomangioma, also known as a glomus tumor, is a benign lesion and had rare occurrence of spine region. In this study, we presented a spinal glomus tumor with an unusual radiological presentation, which is different from osteolytic intraosseous patterns illustrated before. A 26-year-old male with compressive myelopathy caused by epidural intraspinal lesion over T11 level. Radiological presentation revealed reactive sclerotic change over the body and lamina was found on the same level in comp...

  11. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  12. An unusual coexistence of Addison's disease and ...

    African Journals Online (AJOL)

    2013-07-17

    Jul 17, 2013 ... Case Study: An unusual coexistence of Addison's disease and phaeochromocytoma. 164 ... strongly positive. ... Department of Endocrinology and Metabolism, Ondokuz Mayis University Medical School, Samsun, Turkey.

  13. An unusual case of carbon monoxide poisoning.

    Science.gov (United States)

    Auger, P L; Levesque, B; Martel, R; Prud'homme, H; Bellemare, D; Barbeau, C; Lachance, P; Rhainds, M

    1999-01-01

    Carbon monoxide, a gas originating from incomplete combustion of carbon-based fuels, is an important cause of human deaths. In this paper, we describe an unusual carbon monoxide poisoning in a dwelling without obvious sources of combustion gases, for which two adults had to be treated in a hyperbaric chamber. Carbon monoxide readings were taken in the house and in the neighboring homes. Methane gas and nitrogen oxide levels were also monitored in the house air. Soil samples were collected around the house and tested for hydrocarbon residues. The investigation revealed the presence of a pocket of carbon monoxide under the foundation of the house. The first readings revealed carbon monoxide levels of 500 ppm in the basement. The contamination lasted for a week. The investigation indicated that the probable source of contamination was the use of explosives at a nearby rain sewer construction site. The use of explosives in a residential area can constitute a major source of carbon monoxide for the neighboring populations. This must be investigated, and public health authorities, primary-care physicians, governmental authorities, and users and manufacturers of explosives must be made aware of this problem. Images Figure 1 Figure 2 PMID:10379009

  14. An unusual case of carbon monoxide poisoning.

    Science.gov (United States)

    Auger, P L; Levesque, B; Martel, R; Prud'homme, H; Bellemare, D; Barbeau, C; Lachance, P; Rhainds, M

    1999-07-01

    Carbon monoxide, a gas originating from incomplete combustion of carbon-based fuels, is an important cause of human deaths. In this paper, we describe an unusual carbon monoxide poisoning in a dwelling without obvious sources of combustion gases, for which two adults had to be treated in a hyperbaric chamber. Carbon monoxide readings were taken in the house and in the neighboring homes. Methane gas and nitrogen oxide levels were also monitored in the house air. Soil samples were collected around the house and tested for hydrocarbon residues. The investigation revealed the presence of a pocket of carbon monoxide under the foundation of the house. The first readings revealed carbon monoxide levels of 500 ppm in the basement. The contamination lasted for a week. The investigation indicated that the probable source of contamination was the use of explosives at a nearby rain sewer construction site. The use of explosives in a residential area can constitute a major source of carbon monoxide for the neighboring populations. This must be investigated, and public health authorities, primary-care physicians, governmental authorities, and users and manufacturers of explosives must be made aware of this problem.

  15. Unusual clinical manifestations of leptospirosis

    Directory of Open Access Journals (Sweden)

    Bal A

    2005-01-01

    Full Text Available Leptospirosis has protean clinical manifestations. The classical presentation of the disease is an acute biphasic febrile illness with or without jaundice. Unusual clinical manifestations may result from involvement of pulmonary, cardiovascular, neural, gastrointestinal, ocular and other systems. Immunological phenomena secondary to antigenic mimicry may also be an important component of many clinical features and may be responsible for reactive arthritis. Leptospirosis in early pregnancy may lead to fetal loss. There are a few reports of leptospirosis in HIV- infected individuals but no generalisation can be made due to paucity of data. It is important to bear in mind that leptospiral illness may be a significant component in cases of dual infections or in simultaneous infections with more than two pathogens.

  16. Unusual Cause of Knee Locking

    Directory of Open Access Journals (Sweden)

    Gazi Huri

    2013-01-01

    Full Text Available We report a case of partial intrasubstance tear of popliteus tendon as an unusual cause of pseudolocking of the knee. A 13-year-old semiprofessional soccer player applied to our clinic with a locked right knee in spite of the therapy applied (cold pack, NSAID, and immobilization in another institution 20 days after the injury. Significant extension loss was observed in his right knee with 30∘–90∘ ROM. Magnetic resonance imaging (MRI and arthroscopy confirmed the intrasubstance tear of popliteus tendon and synovitis. The ruptured part of the tendon was debrided, and the inflammatory tissue around the tendon, which may lead to pseudolocking, was gently removed with a shaver in order to regain the normal ROM. The patient was discharged with full ROM and weight bearing first day after the surgery. To our knowledge, this is the first case demonstrating intrasubstance tear of popliteus tendon causing pseudolocking of the knee.

  17. A Case of Unusual Clitoromegaly.

    Science.gov (United States)

    Wooi Ch'ng, Tong; Umpaichitra, Vatcharapan

    2018-05-03

    Mild degree of clitoromegaly can be associated with patient with polycystic ovarian syndrome (PCOS). We describe an unusually significant clitoromegaly in a patient with PCOS. An 18-year old non-obese female referred for clitoromegaly. Her genitalia exam showed significant clitoral enlargement with a well-formed glans, clitoris measured at 35 mm for length and 10 mm for width. Pelvic ultrasound showed left ovarian cyst. Testosterone level ranged from 28.8 to 64.1 ng/dl (normal: 8.4-48.1 ng/dl) with normal sex hormone binding globulin. Other ovarian hormones were in acceptable ranges. This case demonstrates the coexistence of significant clitoromegaly, PCOS, and non-functioning ovarian cyst. Copyright © 2018. Published by Elsevier Inc.

  18. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  19. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  20. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  1. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  2. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  3. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  4. Unusual Fears in Children with Autism

    Science.gov (United States)

    Mayes, Susan Dickerson; Calhoun, Susan L.; Aggarwal, Richa; Baker, Courtney; Mathapati, Santosh; Molitoris, Sarah; Mayes, Rebecca D.

    2013-01-01

    Unusual fears have long been recognized as common in autism, but little research exists. In our sample of 1033 children with autism, unusual fears were reported by parents of 421 (41%) of the children, representing 92 different fears. Many additional children had common childhood fears (e.g., dogs, bugs, and the dark). More than half of children…

  5. UNUSUALLY WIDE BINARIES: ARE THEY WIDE OR UNUSUAL?

    International Nuclear Information System (INIS)

    Kraus, Adam L.; Hillenbrand, Lynne A.

    2009-01-01

    We describe an astrometric and spectroscopic campaign to confirm the youth and association of a complete sample of candidate wide companions in Taurus and Upper Sco. Our survey found 15 new binary systems (three in Taurus and 12 in Upper Sco) with separations of 3''-30'' (500-5000 AU) among all of the known members with masses of 2.5-0.012 M sun . The total sample of 49 wide systems in these two regions conforms to only some expectations from field multiplicity surveys. Higher mass stars have a higher frequency of wide binary companions, and there is a marked paucity of wide binary systems near the substellar regime. However, the separation distribution appears to be log-flat, rather than declining as in the field, and the mass ratio distribution is more biased toward similar-mass companions than the initial mass function or the field G-dwarf distribution. The maximum separation also shows no evidence of a limit at ∼ sun . We attribute this result to the post-natal dynamical sculpting that occurs for most field systems; our binary systems will escape to the field intact, but most field stars are formed in denser clusters and undergo significant dynamical evolution. In summary, only wide binary systems with total masses ∼ sun appear to be 'unusually wide'.

  6. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  8. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  9. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  11. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  12. Unusual manifestations of secondary urothelial carcinoma

    Directory of Open Access Journals (Sweden)

    Chaohui Lisa Zhao

    2016-03-01

    Full Text Available High-grade papillary urothelial carcinoma regularly invades the bladder wall, adjacent prostate, seminal vesicles, ureters, vagina, rectum, retroperitoneum, and regional lymph nodes. In advanced stages, it may disseminate to the liver, lungs, and bone marrow. On rare occasions, unusual metastatic foci like skin have been reported. The incidence of urothelial carcinoma has increased with associated rise in variants of urothelial carcinoma and unusual metastatic foci. It is imperative that urologists and pathologists are aware of the unusual variants and unusual metastatic locations to expedite the diagnostic process. Hereby we report an unusual case of secondary involvement of spinal nerve by conventional urothelial carcinoma. Also a second case of rhabdoid variant of urothelial carcinoma showing synchronous involvement of bladder and subcutaneous tissue of upper extremity is presented.

  13. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  14. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  15. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  16. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  17. Rigor mortis in an unusual position: Forensic considerations.

    Science.gov (United States)

    D'Souza, Deepak H; Harish, S; Rajesh, M; Kiran, J

    2011-07-01

    We report a case in which the dead body was found with rigor mortis in an unusual position. The dead body was lying on its back with limbs raised, defying gravity. Direction of the salivary stains on the face was also defying the gravity. We opined that the scene of occurrence of crime is unlikely to be the final place where the dead body was found. The clues were revealing a homicidal offence and an attempt to destroy the evidence. The forensic use of 'rigor mortis in an unusual position' is in furthering the investigations, and the scientific confirmation of two facts - the scene of death (occurrence) is different from the scene of disposal of dead body, and time gap between the two places.

  18. Unusual metastatic localizations of differentiated thyroid carcinoma

    International Nuclear Information System (INIS)

    Ben Rais, N.; Ghfir, I.

    2007-01-01

    Full text: Introduction: The majority of thyroid cancers have a slow evolution, a more often loco-regional extension, and a good forecast. Remote metastases, when they exist, generally touch the osseous skeleton and/or pulmonary tissue. However, unusual metastatic localizations much more exceptional are possible. The authors report through these work five cases of atypical metastasis of differentiated thyroid carcinoma followed in Nuclear Medicine department of Ibn Sina hospital in Rabat under the directives of Professor N Ben Rais. Materials and methods: Our five patients had initially undergone a total thyroidectomy for differentiated thyroid carcinoma histologically confirmed. They had profited 4 weeks after the surgical gesture from a reference isotopic exploration (131 Iodine whole body scan and thyroglobulin dosage). The paraclinic assessment was supplemented by a computed tomography (CT). Results: Revealing symptomatology in the first 69 year old patient was dominated by blindness associated with an elective up-take of radioactive 131-Iodine on the level of hypophyseal gland extending to the sphenoid bone. The second 55 year old patient reported right basithoracic pains resisting to the usual antalgic treatment with a bulky mass driving back the kidney right to the bottom at CT with and important up-take 131-Iodine at whole body scan; a surrenalectomy was thus carried out with conservation of the kidney. The three other patients presented at the clinical examination dermohypodermic nodular lesions of various localizations whose anatomopathologic study had confirmed their thyroid metastatic origin. In the 5 patients the rate of thyroglobulin was considerably high. An activity of 3,7 GBq 131-Iodine was managed with the 5 patients. The evolution was marked, in the short run, at the first patient by a recovery partial of the sight, the disappearance of pain in the second patient and a remarkable reduction of thyroglobulin level for all our patients. Conclusion

  19. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  20. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  1. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  2. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  3. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  4. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  5. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  6. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  7. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  8. Multiple-Site Trimethylation of Ribosomal Protein L11 by the PrmA Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2008-01-01

    Ribosomal protein L11 is a universally conserved component of the large subunit, and plays a significant role during initiation, elongation, and termination of protein synthesis. In Escherichia coli, the lysine methyltransferase PrmA trimethylates the N-terminal a-amino group and the -amino groups of Lys3 and Lys39. Here, we report four PrmA-L11 complex structures in different orientations with respect to the PrmA active site. Two structures capture the L11 N-terminal a-amino group in the active site in a trimethylated postcatalytic state and in a dimethylated state with bound S-adenosyl-L-homocysteine. Two other structures show L11 in a catalytic orientation to modify Lys39 and in a noncatalytic orientation. The comparison of complex structures in different orientations with a minimal substrate recognition complex shows that the binding mode remains conserved in all L11 orientations, and that substrate orientation is brought about by the unusual interdomain flexibility of PrmA.

  9. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  10. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  11. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  13. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  14. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  15. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  16. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  17. Unusual Cancers of the Head and Neck

    Science.gov (United States)

    ... more information). Unusual Cancers of the Head and Neck Nasopharyngeal Cancer See the PDQ summary on Childhood ... of PDQ documents can be used freely as text. It cannot be identified as an NCI PDQ ...

  18. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  19. What limits production of unusual monoenoic fatty acids in transgenic plants?

    Science.gov (United States)

    Suh, Mi Chung; Schultz, David J; Ohlrogge, John B

    2002-08-01

    Unusual monounsaturated fatty acids are major constituents (greater than 80%) in seeds of Coriandrum sativum L. (coriander) and Thunbergia alata Bojer, as well as in glandular trichomes (greater than 80% derived products) of Pelargonium x hortorum (geranium). These diverged fatty acid structures are produced via distinct plastidial acyl-acyl carrier protein (ACP) desaturases. When expressed in Arabidopsis thaliana (L.) Heynh. under strong seed-specific promoters the unusual acyl-ACP desaturases resulted in accumulation of unusual monoene fatty acids at 1-15% of seed fatty acid mass. In this study, we have examined several factors that potentially limit higher production of unusual monoenes in transgenic oilseeds. (i) Immunoblots indicated that the introduced desaturases were expressed at levels equivalent to or higher than the endogenous delta9 18:0-ACP desaturase. However, the level of unusual fatty acid produced in transgenic plants was not correlated with the level of desaturase expression. (ii) The unusual desaturases were expressed in several backgrounds, including antisense 18:0-ACP desaturase plants, in fab1 mutants, and co-expressed with specialized ACP or ferredoxin isoforms. None of these experiments led to high production of expected products. (iii) No evidence was found for degradation of the unusual fatty acids during seed development. (iv) Petroselinic acid added to developing seeds was incorporated into triacylglycerol as readily as oleic acid, suggesting no major barriers to its metabolism by enzymes of glycerolipid assembly. (v) In vitro and in situ assay of acyl-ACP desaturases revealed a large discrepancy of activity when comparing unusual acyl-ACP desaturases with the endogenous delta9 18:0-ACP desaturase. The combined results, coupled with the sensitivity of acyl-ACP desaturase activity to centrifugation and low salt or detergent suggests low production of unusual monoenes in transgenic plants may be due to the lack of, or incorrect assemble of

  20. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  1. Castleman's disease, an unusual presentation

    Directory of Open Access Journals (Sweden)

    Shital Munde

    2015-01-01

    The present report describes a 30-year-old serving male who presented with pain abdomen and on and off episodes ofmelena, found to have peripancreatic lymphadenopathy on CECT abdomen. Ultrasound guided FN AC was done in private hospital revealed reactive lymphadenopathy. Excision biopsy was done in our institute and a diagnosis of Castleman's disease was made.

  2. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  3. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  4. Unusual Metals in Galactic Center Stars

    Science.gov (United States)

    Hensley, Kerry

    2018-03-01

    Far from the galactic suburbs where the Sun resides, a cluster of stars in the nucleus of the Milky Way orbits a supermassive black hole. Can chemical abundance measurements help us understand the formation history of the galactic center nuclear star cluster?Studying Stellar PopulationsMetallicity distributions for stars in the inner two degrees of the Milky Way (blue) and the central parsec (orange). [Do et al. 2018]While many galaxies host nuclear star clusters, most are too distant for us to study in detail; only in the Milky Way can we resolve individual stars within one parsec of a supermassive black hole. The nucleus of our galaxy is an exotic and dangerous place, and its not yet clear how these stars came to be where they are were they siphoned off from other parts of the galaxy, or did they form in place, in an environment rocked by tidal forces?Studying the chemical abundances of stars provides a way to separate distinct stellar populations and discern when and where these stars formed. Previous studies using medium-resolution spectroscopy have revealed that many stars within the central parsec of our galaxy have very high metallicities possibly higher than any other region of the Milky Way. Can high-resolution spectroscopy tell us more about this unusual population of stars?Spectral Lines on DisplayTuan Do (University of California, Los Angeles, Galactic Center Group) and collaborators performed high-resolution spectroscopic observations of two late-type giant starslocated half a parsec from the Milky Ways supermassive black hole.Comparison of the observed spectra of the two galactic center stars (black) with synthetic spectra with low (blue) and high (orange) [Sc/Fe] values. Click to enlarge. [Do et al. 2018]In order to constrain the metallicities of these stars, Do and collaborators compared the observed spectra to a grid of synthetic spectra and used a spectral synthesis technique to determine the abundances of individual elements. They found that

  5. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  6. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  7. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  8. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  9. Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

    Science.gov (United States)

    Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

    2017-05-09

    An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

  10. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  11. Unusual structural transition of antimicrobial VP1 peptide.

    Science.gov (United States)

    Shanmugam, Ganesh; Phambu, Nsoki; Polavarapu, Prasad L

    2011-05-01

    VP1 peptide, an active domain of m-calpain enzyme with antimicrobial activity is found to undergo an unusual conformational transition in trifluoroethanol (TFE) solvent. The nature of, and time dependent variations in, circular dichroism associated with the amide I vibrations, suggest that VP1 undergoes self-aggregation forming anti-parallel β-sheet structure in TFE. Transmission electron micrograph (TEM) images revealed that β-sheet aggregates formed by VP1 possess fibril-like assemblies. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Right adrenal abscess -- an unusual complication of acute apendicitis.

    Science.gov (United States)

    Dimofte, Gabriel; Dubei, Liviu; Lozneanu, Lili-Gabriela; Ursulescu, Corina; Grigora Scedil, Mihai

    2004-09-01

    Acute appendicitis represents one of the most frequent abdominal emergencies encountered in everyday surgical practice. Local infectious complications are not unusual and retroperitoneal abscesses after acute retrocaecal appendicitis have been previously described. The authors present the case of a 22-years-young female patient, admitted for a right iliac fossa abscess, secondary to gangrenous appendicitis. A right adrenal mass 35/40 mm was revealed during preoperative ultrasound evaluation, which evolved in an adrenal abscess that spontaneously drained 10 days after appendectomy and retrocecal drainage. Adrenal abscesses are exceptionally rare, with only a few cases being reported in the literature, but none of these after acute appendicitis.

  13. The structure of an unusual leghemoglobin gene from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1983-01-01

    A clone containing an unusual leghemoglobin (Lb) gene was isolated from a soybean DNA library present in Charon 4A phage. DNA sequence analysis revealed that the isolated Lb gene has three intervening sequences (IVS-1, IVS-2 and IVS-3) located in the same positions as those found in other Lb gene...... is mutated in two regions which seem to be important for transcription. It is, therefore, tentatively suggested that the isolated Lb gene is non-functional, and consequently is an Lb pseudogene. Udgivelsesdato: 1983-null...

  14. Unusual Presentation of Popliteal Cyst on Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Ohishi

    2016-01-01

    Full Text Available Popliteal cyst commonly presents as an ellipsoid mass with uniform low signal intensity on T1-weighted magnetic resonance images and high signal intensity on T2-weighted images. Here, we describe a popliteal cyst with unusual appearance on magnetic resonance imaging, including heterogeneous intermediate signal intensity on T2-weighted images. Arthroscopic cyst decompression revealed that the cyst was filled with necrotic synovial villi, indicative of rheumatoid arthritis. Arthroscopic enlargement of unidirectional valvular slits with synovectomy was useful for the final diagnosis and treatment.

  15. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  17. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  18. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  19. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  20. Myasthenia Gravis: Unusual Presentations and Diagnostic Pitfalls.

    Science.gov (United States)

    Rodolico, Carmelo; Parisi, Daniela; Portaro, Simona; Biasini, Fiammetta; Sinicropi, Stefano; Ciranni, Annamaria; Toscano, Antonio; Messina, Sonia; Musumeci, Olimpia; Vita, Giuseppe; Girlanda, Paolo

    2016-08-30

    Myasthenia gravis (MG) is an autoimmune disorder presenting with fluctuating, fatigable muscle weakness. Initial symptoms classically involve ocular and proximal limb muscles. Rarely, MG may onset with unusual features, so it can be misdiagnosed with other neuromuscular diseases. To describe unusual and atypical presentations of MG in a large cohort of patients, considering and discussing diagnostic difficulties and pitfalls. We report on 21 out of 508 MG patients, coming to our department in the last 27 years and presenting with atypical or unusual features. The diagnosis was achieved performing a careful clinical examination, a proper neurophysiological assessment, the neostigmine test, the AChR and MuSK antibodies assay and chest CT-scan. Patients with atypical/unusual MG onset were the 4.4% of all MG patients population. We describe seven different clinical categories: asymmetric distal upper limbs weakness, foot drop, isolated triceps brachii weakness and foot drop, post exertional axial weakness with dropped head, acute facial dyplegia, limb-girdle MG and MG with sudden lower limbs weakness and recurrent falls. Atypical and unusual presentations may increase the risk to misdiagnose or delay MG diagnosis. Isolated limb-girdle presentation is the most frequent atypical form in our series.

  1. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  2. An Unusual Case of Cirrhosis

    Directory of Open Access Journals (Sweden)

    Ahmad Alkaddour

    2014-01-01

    Full Text Available 49-year-old white female with remote h/o sarcoidosis was referred to GI when her liver was noted to be nodular. Physical examination revealed normal vital signs and no icterus, spider nevi, clubbing, ascites, hepatosplenomegaly, or ankle edema. LFTs, hepatitis serologies, ANA, AMA, ASMA, Ferritin, Ceruloplasmin, and α1-AT, level were unremarkable. Liver biopsy showed cirrhosis. She developed worsening of baseline SOB and was hospitalized. She was eventually diagnosed with constrictive pericarditis. A diagnosis of cardiac cirrhosis was made.

  3. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  5. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  6. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  7. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  8. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  9. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  10. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    International Nuclear Information System (INIS)

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

    2008-01-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

  11. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  12. Unusual MRI findings in grey matter heteropia

    International Nuclear Information System (INIS)

    Soto Ares, G.; Hamon-Kerautret, M.; Leclerc, X.; Pruvo, J.P.; Houlette, C.; Godefroy, O.

    1998-01-01

    We report unusual MRI patterns in patients with grey matter heterotopia. Standard T1- and T2-weighted spin-echo and inversion-recovery sequences were used in 22 patients presenting with seizures or developmental delay. The images were reviewed for signal change surrounding white matter and for atypical size, morphology or topography. We found 10 cases of subependymal heterotopias 11 of focal subcortical heterotopia and of diffuse subcortical heterotopia. On clinical or MRI grounds, 8 cases were considered unusual: 2 of the subependymal type, 2 of focal subcortical heterotopia with white matter abnormalities, 2 of focal subcortical heterotopia with no clinicoradiological correlation 1 of extensive hemispheric subcortical heterotopia and 1 of diffuse subcortical heterotopia confined to the frontal lobe. The classical classification of heterotopia enables easy radiological diagnosis even in cases with unusual patterns. In some cases, heterogeneity and high signal in surrounding white matter can be found. Cortical dysplasia is the most frequent associated malformation. (orig.)

  13. Hyperthyroidism: an unusual case presentation.

    Science.gov (United States)

    Scripture, D L

    1998-02-01

    Hyperthyroidism is the most common disorder of the thyroid. Patients typically present with complaints consistent with a hypermetabolic state, including nervousness, weight loss, heat intolerance, palpitations, irritability, and tremor. This case report reviews a 34-year-old woman who presented with unilateral upper extremity weakness, weight gain, and an episode of atrial fibrillation, the latter coinciding with a 36-hour lack of sleep and excess alcohol and caffeine intake. Although an extensive neurologic evaluation failed to identify any abnormality, the patient's laboratory analysis revealed elevations in thyroxine (T4) and triiodothyronine (T3) levels with unsuppressed thyroid-stimulating hormone levels. Subsequent treatment with the antithyroid drug methimazole (Tapazole) provided complete relief of symptoms. This case report illustrates how health care providers can be diverted to pursue a neurologic etiology when muscle weakness presents as a unilateral symptom. Plausible alternative causes for muscle weakness and other symptoms are presented.

  14. An unusual case of pseudochylothorax

    Directory of Open Access Journals (Sweden)

    M Padma Priya

    2015-01-01

    Full Text Available A 25-year-old male patient presented with right-sided pleuritic chest pain and pain in the ankle. Radiological investigations revealed a right sided pleural effusion, lytic lesion in spine D10 with paravertebral abscess. Pleural fluid analysis showed elevated lactate dehydrogenase, adenosine deaminase, increased triglycerides, cholesterol, and no chylomicrons. Hence, a diagnosis of pseudochylothorax secondary to tuberculosis was made. Pleural fluid was drained by tube thoracostomy, decortication was done to improve the lung function and patient was started on anti-tuberculosis treatment (ATT. Patient improved with ATT. Pseudochylous effusion or chyliform effusions are uncommon. <200 cases has been reported in the international literature. The possibility of tuberculosis has to be considered in diagnosis and treatment of such cases. Here, we present a case of tuberculous pseudochylous effusion.

  15. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    NARCIS (Netherlands)

    Rooijers, K.; Loayza-Puch, F.; Nijtmans, L.G.J.; Agami, R.

    2013-01-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson's disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations

  16. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    NARCIS (Netherlands)

    K. Rooijers (Koos); F. Loayza-Puch (Fabricio); L.G.J. Nijtmans (Leo); R. Agami (Reuven)

    2013-01-01

    textabstractMitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson's disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial

  17. An Unusual Bone Loss Around Implants

    Directory of Open Access Journals (Sweden)

    Amirreza Rokn

    2013-01-01

    Full Text Available AbstractPre-implant disease is an inflammatory process, which can affect the surrounding tissues of a functional Osseointegrated implant that is usually as a result of a disequilibrium between the micro-flora and the body defense system.This case reports a 57 years old male with unusual bone loss around dental implants.This was an unusual case of peri-implantitis which occurred only in the implants on one side of the mouth although they all were unloaded implants.

  18. Unusual causes of obstructive jaundice. Computed tomography

    International Nuclear Information System (INIS)

    Rodriguez, E.; Pombo, F.; Cao, I.; Fernandez, R.; Riba da, M.

    1998-01-01

    The purpose of this study is to present selected computed tomography (CT) images showing unusual causes of obstructive jaundice. We reviewed retrospectively the Ct findings of obstructive jaundice in 227 patients. The most common causes of biliary obstruction were adenocarcinoma of the pancreatic head (n=77) and cholangiocarcinoma (n=65). In 13 cases (5.7%), the etiology of obstructive jaundice was unusual or exceptional: tuberculous adenitis (n=3), obstruction of afferent loop (n=2)signet ring cell adenocarcinoma (n=3); in duodenum, gallbladder and papilla of Water), Mirizzi syndrome (n=1), adenocarcinoma of the hepatic flexure (n=1), choledochal cyst (n=1) and pancreatic lymphoma (n=1). (Author) 13 refs

  19. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  20. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  1. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  2. The rarity of "unusual" [corrected] dispositions of victim bodies: staging and posing.

    Science.gov (United States)

    Keppel, Robert D; Weis, Joseph G

    2004-11-01

    The act of leaving a victim's body in an unusual position is a conscious criminal action by an offender to thwart an investigation, shock the finder and investigators of the crime scene, or give perverted pleasure to the killer. The unusual position concepts of posing and staging a murder victim have been documented thoroughly and have been accepted by the courts as a definable phenomenon. One staging case and one posing case are outlined and reveal characteristics of those homicides. From the Washington State Attorney General's Homicide Investigation and Tracking System's database on murder covering the years 1981-2000 (a total of 5,224 cases), the relative frequency of unusual body dispositions is revealed as a very rare occurrence. Only 1.3% of victims are left in an unusual position, with 0.3% being posed and 0.1% being staged. The characteristics of these types of murders also set them apart: compared to all other murders, in staged murders the victims and killers are, on average, older. All victims and offenders in the staged murders are white, with victims being disproportionately white in murders with any kind of unusual body disposition. Likewise, females stand out as victims when the body is posed, staged, or left in other unusual positions. Whereas posed bodies are more likely to include sexual assault, often in serial murders, there is no evidence of either in the staged cases. Lastly, when a body is left in an unusual position, binding is more likely, as well as the use of more "hands on" means of killing the victim, such as stabbing or cutting weapons, bludgeons, ligatures, or hands and feet.

  3. OROPHARYNGEAL TUBERCULOSIS: AN UNUSUAL PRESENTATION

    Directory of Open Access Journals (Sweden)

    M H Dadgarnia

    2008-12-01

    Full Text Available "nTuberculosis (TB still represents a major public health problem worldwide. The primary form of disease is most often localized to the lung. In a minority of patients, progressive pulmonary disease spreads to other organ systems through self inoculation via infected sputum, blood and lymphatic system, establishing the secondary form of tuberculosis. We present a patient that was referred to us with complaint of ulcerative mouth lesions from 3 months ago. In physical examination multiple erythematous and irregularly ulcerative lesions affecting soft palate area, uvula and anterior tonsillar pillar was noted bilaterally. Punch biopsy was done from several points that revealed chronic granulomatous inflammation. Ziehl-Nielsen staining of cultured specimen demonstrated acid-fast bacilli. Chest X-ray showed apical pulmonary involvement, suggesting tuberculosis infection. Patient was treated with anti-tuberculosis 4 drugs regimen. In the one year follow-up period after complete treatment; patient didn't have any evidence of disease. Oral and oropharyngeal TB lesions are uncommon, it is estimated that only 0.05-5% of total TB cases may present with oral manifestations, but should be an important consideration in the differential diagnosis of lesions that appear in the oral cavity and oropharynx. The secondary form is more frequent and involves mainly the tongue but involvement of pharynx is quite rare condition. Although tuberculosis of oropharynx is relatively rare, with the increasing incidence of tuberculosis, it must be considered in the differential diagnosis of atypical ulcerative lesions of the mouth and oropharynx.

  4. Management of an unusual sciatica.

    Science.gov (United States)

    Bourghli, Anouar; Chaballout, Ahmed; Obeid, Ibrahim; Boissiere, Louis; Vital, Jean-Marc; Khoury, Ghassan

    2016-11-01

    Extraforaminal entrapment of the L5 nerve root is uncommon, and its management can sometimes be very challenging. We present the case of a 57-year-old female, complaining of a sciatica in her left leg, for 3 years, with no response to any kind of conservative treatment. MRI and CT scan revealed the presence of a large L5S1 strictly lateral osteophyte compressing the left L5 root in its extraforaminal path. The patient underwent a left anterior retroperitoneal approach with assistance from a vascular surgeon given the very close relation between the osteophyte and the left common iliac vein, lying just on top of it, osteophyte was removed in one piece with the use of an osteotome after retraction of the vessels. The patient progressively recovered from her left sciatic pain with a satisfactory clinical result at 1 year. Literature is sparse on the treatment of extraforaminal entrapment of the L5 nerve root; the current case shows a successful treatment strategy with the use of an anterior approach for direct vision of the lesion and good control of the vessels.

  5. [Histoplasmosis - an unusual African souvenir].

    Science.gov (United States)

    Raselli, C; Reinhart, W H; Fleisch, F

    2013-02-01

    A 24-year-old woman (student of biology) was part of a study group in Uganda. She developed fever and headache, which was empirically treated as malaria. After she had returned to Switzerland, a chest x-ray showed bilateral miliary nodular infiltrates. In assumption of an atypical pneumonia, she was treated with levofloxacin, although without success. On admission, she was in a bad general condition and was markedly dyspneic. Rales were heard over both lungs. CRP, liver enzymes and LDH were elevated. A lung function test revealed a marked impairment of the diffusion capacity. The chest x-ray showed a progression of the lung infiltrates. The informal medical data exchange among the group members by a virtual social network abbreviated our diagnostic workup substantially, since we heard that histoplasmosis had been assumed in another group member. It turned out that the affected persons had visited a colony of bats living in a cave inside the trunk of a tree. Antibodies against Histoplasma capsulatum were positive. We began a treatment with itraconazole. The condition improved gradually; chest x-ray and lung function normalized after the 8 week treatment. Histoplasmosis with such a severe course is rare in immunocompetent humans, which indicates that the inoculum must have been very high. Soil contaminated with bats guano favours the proliferation of Histoplasma capsulatum. Our case is also an illustration of how the widespread use of electronic media can sometimes facilitate our work. © Georg Thieme Verlag KG Stuttgart · New York.

  6. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  7. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  8. Proteinase 3 carries small unusual carbohydrates and associates with αlpha-defensins

    DEFF Research Database (Denmark)

    Zoega, Morten; Ravnsborg, Tina; Højrup, Peter

    2012-01-01

    with carbohydrates at Asn 102 and 147 carrying unusual small moieties indicating heavy processing. Mass spectrometric analysis and immuno blotting revealed strong association of highly purified PR3 with α-defensins and oligomers hereof. Irreversible inhibition of PR3 by α1-antitrypsin did not affect its association...

  9. Endodontic treatment of an unusual connation of permanent mandibular molars: a case report.

    Science.gov (United States)

    Liu, Shengbo; Fan, Bing; Peng, Bin; Fan, Mingwen; Bian, Zhuan

    2006-10-01

    A 27-year-old patient with an anomalous mandibular molar was referred for endodontic therapy. Clinical and radiographic examination revealed the connation of a second mandibular molar with a third molar. Challenging endodontic therapy was performed in the unusual connated molars. A 2-year recall showed good treatment result.

  10. Trichosporon inkin and Trichosporon mucoides as unusual causes of white piedra of scalp hair.

    Science.gov (United States)

    Tendolkar, Uma; Shinde, Alka; Baveja, Sujata; Dhurat, Rachita; Phiske, Meghana

    2014-01-01

    White piedra of scalp hair is considered a rare entity. We report three cases of this disorder all of whom presented with nodules on the hair. Potassium hydroxide preparations of the hair revealed clustered arthrospores and mature, easily detachable nodules. Cultures grew Trichosporon inkin in 2 patients and Trichosporon mucoides in one patient. Both these fungi are unusual causes of white piedra.

  11. An Unusual Case Report of Erupted Odontoma

    Directory of Open Access Journals (Sweden)

    Dhaval Mehta

    2013-01-01

    Full Text Available Odontomas are the most common of the odontogenic tumors of the jaws, which are benign, slow growing, and nonaggressive. They are usually asymptomatic and found in routine dental radiographic examination. Odontomas are usually associated with tooth eruption disturbances. Eruption of odontoma in oral cavity is rare entity. Here we report a case of an unusual erupted compound odontoma.

  12. 'Unusual' MRI appearance of sphenoid sinus mucocele

    International Nuclear Information System (INIS)

    Ruelle, A.; Pisani, R.; Andrioli, G.

    1991-01-01

    The authors report a case of sphenoid sinus mucocele which exhibited unusual MRI features. However a review of the literature shows that these lesions may present with different MRI appearances probably related to the variability of the cyst content. Further series are needed for a better definition of the MRI behaviour of the lesions. (orig.)

  13. Xanthogranulomatous endometritis: an unusual pathological entity ...

    African Journals Online (AJOL)

    Xanthogranulomatous endometritis is an unusual pathological entity mimicking endometrial carcinoma. This shows sheets of foamy histiocytes alongwith other inflammatory cells. We, hereby, report a case of 45 year multigravida female with irregular menstrual history, clinically diagnosed as carcinoma and ...

  14. Probable Unusual Transmission of Zika Virus

    Centers for Disease Control (CDC) Podcasts

    This podcast discusses a study about the probable unusual transmission of Zika Virus Infection from a scientist to his wife, published in the May 2011 issue of Emerging Infectious Diseases. Dr. Brian Foy, Associate Professor at Colorado State University, shares details of this event.

  15. Unusual presentation of perirenal lung metastases

    International Nuclear Information System (INIS)

    D'Souza, D.L.; Heinze, S.B.; Dowling, R.J.

    2006-01-01

    Lung cancer is not commonly known to metastasise to the perirenal space, with only five such cases previously published. We present an unusual case of perirenal lung metastases manifesting as diffuse perinephric stranding which to our knowledge has not been described before Copyright (2006) Blackwell Publishing Asia Pty Ltd

  16. Several unusual cases of child abuse.

    Science.gov (United States)

    Palmer, H; Weston, J T

    1976-10-01

    All childhood deaths which occurred in New Mexico during 1974 and 1975 were reviewed. Nine fatal instances of abuse were identified representing the entire spectrum of physical abuse: neglect, abuse in a single episode of injury, repetitive abuse, or sexual abuse. Several cases are summarized. These are unusual either in the distribution of pathologic findings or in the problems encountered in court presentation.

  17. Case Report: Unusual computed tomographic features of ...

    African Journals Online (AJOL)

    A case report of a 57-year old woman who presented with signs and symptoms of intracranial mass. Computed tomographic (CT) and clinical features were unusual and suggestive of a parasaggital Meningioma. However an accurate diagnosis of a tuberculoma was made at surgery and histopathological examination.

  18. An unusual case of the Capgras syndrome.

    Science.gov (United States)

    Fialkov, M J; Robins, A H

    1978-04-01

    A variant of the Capgras syndrome is described in a 43-year-old woman who had vitiligo and multinodular goitre. The unusual feature of the case was that the patient not only misidentified members of her own family but also claimed that she herself had been replaced by a double.

  19. Normothermic thyroid storm: an unusual presentation

    Science.gov (United States)

    Sabir, Anas Ahmad; Sada, Kabiru; Yusuf, Bashir O.; Aliyu, Idris

    2016-01-01

    Thyroid storm is a rare life-threatening emergency due to thyrotoxicosis. A 30-year-old female presented with restlessness, tachycardia and vomiting but with normothermia which is an unusual presentation. There is the need for clinicians to be aware of atypical clinical features that can make the diagnosis of thyroid storm difficult. PMID:27540465

  20. salmonella typhi spondyutis: an unusual presentation

    African Journals Online (AJOL)

    It was relieved by lying flat. She had pre- viously been admitted to King Edward VIII Hospital in. May 1969 with a cough, chest and abdominal pain, ... foot and cranium may be the sites of skeletal involvement. Our case shows several unusual features. Sickle-cell anaemia and haemoglobinopathy were absent. Although.

  1. Unusual Cutaneous Manifestation of Tuberous Sclerosis

    Directory of Open Access Journals (Sweden)

    K C Shah

    1980-01-01

    Full Text Available Cutaneous manifestations are found in 60 to 70% cases of tuberous sclerosis and consist of adenoma sebaceum, periungual fibromatas, cafe au lait spots, shagreen patches and white macules. Our patient showed unusual skin manifestations like spotty pigmentation on the chest, back and abdomen and hyperkeratosis palmaris et plantaris.

  2. Unusual magnetoresistance in cubic B20 Fe0.85Co0.15Si chiral magnets

    Science.gov (United States)

    Huang, S. X.; Chen, Fei; Kang, Jian; Zang, Jiadong; Shu, G. J.; Chou, F. C.; Chien, C. L.

    2016-06-01

    The B20 chiral magnets with broken inversion symmetry and C4 rotation symmetry have attracted much attention. The broken inversion symmetry leads to the Dzyaloshinskii-Moriya that gives rise to the helical and Skyrmion states. We report the unusual magnetoresistance (MR) of B20 chiral magnet Fe0.85Co0.15Si that directly reveals the broken C4 rotation symmetry and shows the anisotropic scattering by Skyrmions with respect to the current directions. The intimacy between unusual MR and broken symmetry is well confirmed by theoretically studying an effective Hamiltonian with spin-orbit coupling. The unusual MR serves as a transport signature for the Skyrmion phase.

  3. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  4. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  6. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  7. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  8. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  9. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  10. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  11. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    Science.gov (United States)

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  13. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  14. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  15. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  16. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  17. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  18. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  19. Transparent control of three-body selective destruction of tunneling via unusual states

    International Nuclear Information System (INIS)

    Luo, Yunrong; Tan, Jintao; Hai, Wenhua; Lu, Gengbiao

    2015-01-01

    We study transparent control of quantum tunneling via unusual analytical solutions for three bosons held in a driven double-well. Under high-frequency approximation, we analytically obtain the fine band structure and general non-Floquet state. At some collapse points of the quasi-energy spectra, the latter becomes the unusual special states. Based on the analytical results and their numerical correspondences, we clearly reveal the mechanism of coherent tunneling and suggest a scheme to transparently control the tunneling of three bosons from one well to another. The results can be observed with the current experimental capability (Chen et al 2011 Phys. Rev. Lett. 107 210405) (paper)

  20. Rheological Characterization of Unusual DWPF Slurry Samples

    International Nuclear Information System (INIS)

    Koopman, D. C.

    2005-01-01

    A study was undertaken to identify and clarify examples of unusual rheological behavior in Defense Waste Processing Facility (DWPF) simulant slurry samples. Identification was accomplished by reviewing sludge, Sludge Receipt and Adjustment Tank (SRAT) product, and Slurry Mix Evaporator (SME) product simulant rheological results from the prior year. Clarification of unusual rheological behavior was achieved by developing and implementing new measurement techniques. Development of these new methods is covered in a separate report, WSRC-TR-2004-00334. This report includes a review of recent literature on unusual rheological behavior, followed by a summary of the rheological measurement results obtained on a set of unusual simulant samples. Shifts in rheological behavior of slurries as the wt. % total solids changed have been observed in numerous systems. The main finding of the experimental work was that the various unusual DWPF simulant slurry samples exhibit some degree of time dependent behavior. When a given shear rate is applied to a sample, the apparent viscosity of the slurry changes with time rather than remaining constant. These unusual simulant samples are more rheologically complex than Newtonian liquids or more simple slurries, neither of which shows significant time dependence. The study concludes that the unusual rheological behavior that has been observed is being caused by time dependent rheological properties in the slurries being measured. Most of the changes are due to the effect of time under shear, but SB3 SME products were also changing properties while stored in sample bottles. The most likely source of this shear-related time dependence for sludge is in the simulant preparation. More than a single source of time dependence was inferred for the simulant SME product slurries based on the range of phenomena observed. Rheological property changes were observed on the time-scale of a single measurement (minutes) as well as on a time scale of hours

  1. DISCOVERY OF AN UNUSUALLY RED L-TYPE BROWN DWARF

    International Nuclear Information System (INIS)

    Gizis, John E.; Castro, Philip J.; Faherty, Jacqueline K.; Liu, Michael C.; Aller, Kimberly M.; Shaw, John D.; Vrba, Frederick J.; Harris, Hugh C.; Deacon, Niall R.

    2012-01-01

    We report the discovery of an unusually red brown dwarf found in a search for high proper motion objects using WISE and 2MASS data. WISEP J004701.06+680352.1 is moving at 0.''44 yr –1 and lies relatively close to the Galactic plane (b = 5. 0 2). Near-infrared photometry and spectroscopy reveals that this is one of the reddest (2MASS J – K s 2.55 ± 0.08 mag) field L dwarfs yet detected, making this object an important member of the class of unusually red L dwarfs. We discuss evidence for thick condensate clouds and speculate on the age of the object. Although models by different research groups agree that thick clouds can explain the red spectrum, they predict dramatically different effective temperatures, ranging from 1100 K to 1600 K. This brown dwarf is well suited for additional studies of extremely dusty substellar atmospheres because it is relatively bright (K s = 13.05 ± 0.03 mag), which should also contribute to an improved understanding of young gas-giant planets and the transition between L and T brown dwarfs.

  2. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  3. Emergence of unusual species of enterococci causing infections, South India

    Directory of Open Access Journals (Sweden)

    Rao Sambasiva R

    2005-03-01

    emergence of high-level aminoglycoside and beta-lactam resistance among different species apart from intrinsic vancomycin resistance by some species, while all the species tested were susceptible for linezolid and teicoplanin. Conclusion Our study reveals the emergence of multi-drug resistance among unusual species of enterococci posing a serious therapeutic challenge. Precise identification of enterococci to species level enables us to access the species-specific antimicrobial resistance characteristics, apart from knowing the epidemiological pattern and their clinical significance in human infections.

  4. A solitary bronchial papilloma with unusual endoscopic presentation: case study and literature review

    Directory of Open Access Journals (Sweden)

    Frejeville Marie

    2009-08-01

    Full Text Available Abstract Background Solitary endobronchial papillomas (SEP are rare tumors and most of them are described by case report. A misdiagnosis is common with viral related papillomas. A histopathological classification has recently permitted a major advancement in the understanding of the disease. Case Presentation We report a case of a mixed bronchial papilloma with an unusual endoscopic presentation. The literature was extensively reviewed to ascertain the unusual characteristics of the current case. A 39-year of age male was referred to our institution for the investigation of a slight hemoptysis. Routine examination was normal. A fibroscopy revealed an unusual feature of the right main bronchus. The lesion was a plane, non-bleeding, non-glistering sub-mucosal proliferation. No enhanced coloration was noticed. Biopsies revealed a mixed solitary bronchial papilloma. In situ HPV hybridization was negative. Endoscopic treatment (electrocautery was effective with no relapse. Conclusion This lesion contrasts with the data of the literature where papilloma were described as wart-like lesions or cauliflower tumors, with symptoms generally related to bronchial obstruction. We advise chest physicians to be cautious with unusually small swollen lesions of the bronchi that may reveal a solitary bronchial papilloma. Endoscopic imaging can significantly contribute to the difficult diagnosis of SEP by pulmonary physicians and endoscopists.

  5. Magnetic vortex excitation as spin torque oscillator and its unusual trajectories

    Science.gov (United States)

    Natarajan, Kanimozhi; Muthuraj, Ponsudana; Rajamani, Amuda; Arumugam, Brinda

    2018-05-01

    We report an interesting observation of unusual trajectories of vortex core oscillations in a spin valve pillar. Micromagnetic simulation in the composite free layer spin valve nano-pillar shows magnetic vortex excitation under critical current density. When current density is slightly increased and wave vector is properly tuned, for the first time we observe a star like and square gyration. Surprisingly this star like and square gyration also leads to steady, coherent and sustained oscillations. Moreover, the frequency of gyration is also very high for this unusual trajectories. The power spectral analysis reveals that there is a marked increase in output power and frequency with less distortions. Our investigation explores the possibility of these unusual trajectories to exhibit spin torque oscillations.

  6. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  7. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  8. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  9. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  10. 48 CFR 32.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 32.114 Unusual contract financing. Any contract financing arrangement that deviates from this part is unusual contract financing...

  11. 48 CFR 432.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.114 Unusual contract financing. The HCA is authorized to approve unusual contract financing. The signed determination and finding...

  12. 48 CFR 1332.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 1332.114 Unusual contract financing. The designee authorized to approve unusual contract financing arrangements is set forth in CAM...

  13. An unusual presentation of a glomus tumour.

    LENUS (Irish Health Repository)

    Nugent, N

    2011-02-01

    Glomus tumours are benign, soft tissue tumours, usually of fingertips. Classically they present with severe pain, temperature sensitivity and localised tenderness. The diagnosis is often delayed due to sometimes non-specific symptoms and rarity of the disorder. While usually a clinical diagnosis, imaging may be necessary for diagnosis and localisation. We present a case of glomus tumour of the fingertip with an unusual history.

  14. Unusual imaging characteristics of complicated hydatid disease

    Energy Technology Data Exchange (ETDEWEB)

    Turgut, Ahmet Tuncay [Department of Radiology, Ankara Training and Research Hospital, Ankara (Turkey)]. E-mail: ahmettuncayturgut@yahoo.com; Altin, Levent [Department of Radiology, Numune Training and Research Hospital, Ankara (Turkey); Topcu, Salih [Department of Thoracic Surgery, Faculty of Medicine, Kocaeli University, Izmit (Turkey); Kilicoglu, Buelent [Department of 4th General Surgery, Ankara Training and Research Hospital, Ankara (Turkey); Altinok, Tamer [Department of Thoracic Surgery, Meram Faculty of Medicine, Selcuk University, Konya (Turkey); Kaptanoglu, Erkan [Department of Neurosurgery, Numune Training and Research Hospital, Ankara (Turkey); Karademir, Alp [Department of Radiology, Numune Training and Research Hospital, Ankara (Turkey); Kosar, Ugur [Department of Radiology, Ankara Training and Research Hospital, Ankara (Turkey)

    2007-07-15

    Hydatid disease, a worldwide zoonosis, is caused by the larval stage of the Echinococcus tapeworm. Although the liver and the lungs are the most frequently involved organs in the body, hydatid cysts of other organs are unusual. Radiologically, they usually demonstrate typical imaging findings, but unusual imaging characteristics of complicated cyst of hydatid disease, associated with high morbidity and mortality, are rarely described in the literature. The purpose of this study is to review the general features of hydatidosis and to discuss atypical imaging characteristics of the complicated hydatid disease in the human, with an emphasis on structure and rupture of the cystic lesion as well as ultrasonography (USG), computed tomography (CT), and magnetic resonance imaging (MRI) features of the disease. In our study, the available literature and images of the cases with complicated hydatidosis involving liver, lung, brain, spine and orbit were reviewed retrospectively. In hydatid disease, there are many potential local and systemic complications due to secondary involvement in almost any anatomic location in humans. Radiologically, in addition to the presence of atypical findings such as perifocal edema, non-homogenous contrast enhancement, multiplicity or septations and calcification, various unusual manifestations due to rupture or infection of the cyst have been observed in our cases with complicated hydatid disease. To prevent subsequent acute catastrophic results and the development of recurrences in various organs, it should be kept in mind that complicated hydatid cysts can cause unusual USG, CT, and MRI findings, in addition to typical ones, in endemic areas. Therefore, familiarity with atypical radiological appearances of complicated hydatid disease may be valuable in making a correct diagnosis and treatment.

  15. An Unusual Cause of Rectal Stenosis

    Directory of Open Access Journals (Sweden)

    Maja Gruber

    2016-08-01

    Full Text Available Solitary rectal ulcer syndrome (SRUS is a benign disease that is often misdiagnosed. It is characterized by a combination of symptoms, endoscopic findings and histology. Patients present with constipation, rectal bleeding, mucous discharge, pain and a sensation of incomplete defecation. There are many different manifestations of this disease, with or without rectal prolapse. We report an unusual presentation of SRUS as a circular stenosis in a middle-aged male.

  16. Wasp sting: An unusual fatal outcome

    International Nuclear Information System (INIS)

    George, P.; Mathew, P.; Pawar, B.; Calton, N.

    2008-01-01

    Wasp stings are not uncommon especially in populations living in theproximity of forested area-s all over the world. Local manifestationsfollowing stings are common and unusually life threatening anaphylaxis mayoccur, requiring prompt treatment. Multi organ failure and acute renalfailure following wasp stings are rare and histological evaluation suggestacute tubular necrosis secondary to hemolysis, rhabdomyolysis and directvenom toxicity. A rare complication of a patient following multiple waspstings with disseminated intravascular coagulation, acute renal failure andthrombotic microangiopathy is presented. (author)

  17. Large Penile Mass With Unusual Benign Histopathology

    Directory of Open Access Journals (Sweden)

    Nate Johnson

    2015-09-01

    Full Text Available Pseudoepitheliomatous hyperplasia is an extremely rare condition presenting as a lesion on the glans penis in older men. Physical exam without biopsy cannot differentiate malignant from nonmalignant growth. We report a case of large penile mass in an elderly male with a history of lichen sclerosis, highly suspicious for malignancy. Subsequent surgical removal and biopsy demonstrated pseudoepitheliomatous hyperplasia, an unusual benign histopathologic diagnosis with unclear prognosis. We review the literature and discuss options for treatment and surveillance.

  18. Primary periosteal lymphoma - rare and unusual

    Energy Technology Data Exchange (ETDEWEB)

    Abdelwahab, Ibrahim F. [Coney Island Hospital, Department of Radiology, New York, NY (United States); Hoch, Benjamin [Mount Sinai School of Medicine, CUNY, Department of Pathology, New York, NY (United States); Hermann, George [Mount Sinai School of Medicine, CUNY, Department of Radiology, New York, NY (United States); Bianchi, Stefano [Clinique et Fondation des Grangettes, Geneva (Switzerland); Klein, Michael J. [UAB School of Medicine, Department of Pathology, Birmingham, AL (United States); Springfield, Dempsey S. [Mount Sinai School of Medicine, CUNY, Department of Orthopedics, New York, NY (United States)

    2007-04-15

    We describe a primary periosteal lymphoma that involved only the periosteum without affecting the adjacent medulla or the regional lymph nodes. No other lymphomatous foci were found in either the distant lymph nodes or viscera. This unusual presentation simulates the imaging appearance of surface lesions of bone, namely benign and malignant tumors, and departs from the typical appearance of primary lymphoma of bone. Therefore, this rare type of lymphoma should be considered in the differential diagnosis of surface bone lesions. (orig.)

  19. An unusual presentation of juvenile lupus nephritis

    Directory of Open Access Journals (Sweden)

    Malleshwar Bottu

    2016-01-01

    Full Text Available The incidence of juvenile lupus varies widely ranging between 4 and 250 per 100,000 population. Most common organ involvement in juvenile lupus is kidney. Neurological, cutaneous and hematological involvements are also involved. Skeletal muscle involvement in the form of myositis is rare. Myositis as presenting manifestation in juvenile lupus is also unusual. Herein, we report one such case wherein myositis preceded the onset of lupus nephritis

  20. Unusual imaging characteristics of complicated hydatid disease

    International Nuclear Information System (INIS)

    Turgut, Ahmet Tuncay; Altin, Levent; Topcu, Salih; Kilicoglu, Buelent; Altinok, Tamer; Kaptanoglu, Erkan; Karademir, Alp; Kosar, Ugur

    2007-01-01

    Hydatid disease, a worldwide zoonosis, is caused by the larval stage of the Echinococcus tapeworm. Although the liver and the lungs are the most frequently involved organs in the body, hydatid cysts of other organs are unusual. Radiologically, they usually demonstrate typical imaging findings, but unusual imaging characteristics of complicated cyst of hydatid disease, associated with high morbidity and mortality, are rarely described in the literature. The purpose of this study is to review the general features of hydatidosis and to discuss atypical imaging characteristics of the complicated hydatid disease in the human, with an emphasis on structure and rupture of the cystic lesion as well as ultrasonography (USG), computed tomography (CT), and magnetic resonance imaging (MRI) features of the disease. In our study, the available literature and images of the cases with complicated hydatidosis involving liver, lung, brain, spine and orbit were reviewed retrospectively. In hydatid disease, there are many potential local and systemic complications due to secondary involvement in almost any anatomic location in humans. Radiologically, in addition to the presence of atypical findings such as perifocal edema, non-homogenous contrast enhancement, multiplicity or septations and calcification, various unusual manifestations due to rupture or infection of the cyst have been observed in our cases with complicated hydatid disease. To prevent subsequent acute catastrophic results and the development of recurrences in various organs, it should be kept in mind that complicated hydatid cysts can cause unusual USG, CT, and MRI findings, in addition to typical ones, in endemic areas. Therefore, familiarity with atypical radiological appearances of complicated hydatid disease may be valuable in making a correct diagnosis and treatment

  1. An Unusual Laryngeal Foreign Body in Adult

    Directory of Open Access Journals (Sweden)

    Cire Ndiaye

    2016-01-01

    Full Text Available The accidental aspiration of a foreign body is a frequent domestic accident among children but a rare occurrence in adults. The laryngeal impaction of a coin is an unusual accident; only a few cases have been reported in the literature. Diagnosis is mostly achieved by clinicoradiological examinations. The authors report an uncommon case of laryngeal impaction of a coin in a 21-year-old patient, presenting with dysphonia without dyspnea or stridor. The extraction was performed by endoscopy.

  2. An Unusual Laryngeal Foreign Body in Adult.

    Science.gov (United States)

    Ndiaye, Cire; Regonne, Eric Joel; Ahmed, Houra; Diom, Evelyne Siga; Deguenonvo, Richard Edouard Alain; Mbaye, Aminata; Zemene, Yilkal; Ndiaye, Issa Cheikh

    2016-01-01

    The accidental aspiration of a foreign body is a frequent domestic accident among children but a rare occurrence in adults. The laryngeal impaction of a coin is an unusual accident; only a few cases have been reported in the literature. Diagnosis is mostly achieved by clinicoradiological examinations. The authors report an uncommon case of laryngeal impaction of a coin in a 21-year-old patient, presenting with dysphonia without dyspnea or stridor. The extraction was performed by endoscopy.

  3. An Unusual Laryngeal Foreign Body in Adult

    OpenAIRE

    Ndiaye, Cire; Regonne, Eric Joel; Ahmed, Houra; Diom, Evelyne Siga; Deguenonvo, Richard Edouard Alain; Mbaye, Aminata; Zemene, Yilkal; Ndiaye, Issa Cheikh

    2016-01-01

    The accidental aspiration of a foreign body is a frequent domestic accident among children but a rare occurrence in adults. The laryngeal impaction of a coin is an unusual accident; only a few cases have been reported in the literature. Diagnosis is mostly achieved by clinicoradiological examinations. The authors report an uncommon case of laryngeal impaction of a coin in a 21-year-old patient, presenting with dysphonia without dyspnea or stridor. The extraction was performed by endoscopy.

  4. Unusual intramuscular lipoma of deltoid muscle.

    Science.gov (United States)

    Kapetanakis, Stylianos; Papathanasiou, Jiannis; Dermon, Antonios; Dimitrakopoulou, Alexandra; Ververidis, Athanasios; Chloropoulou, Pelagia; Kazakos, Konstantinos

    2010-01-01

    Lipomas are common soft tissue tumors usually located under the skin. Nevertheless, intramuscular lipomas of deltoid muscle are unusual tumors. We present a case of 74-year-old woman with an intramuscular like clepsydra lipoma of deltoid muscle. The lesion was a palpable soft mass at the lateral side of the humerus. The patient had no previous history of trauma. The main symptom was pain only in abduction and extension. Imaging, pathological findings and surgical excision are discussed.

  5. Unusual variant of Cantrell′s pentalogy?

    Directory of Open Access Journals (Sweden)

    Kumar Basant

    2008-01-01

    Full Text Available A 12-hour-old male infant presented with prolapsed abdominal content through a defect on left side of chest wall with respiratory distress. A thorough clinical examination suggested absence of ectopia cordis, abdominal wall defect, and any bony anomaly. The child expired after 6 hours of admission because of respiratory distress and electrolyte imbalance. Is congenital defect of chest wall associated with diaphragmatic hernia without ectopia cordis and omphalocele, an unusual variant of Cantrell′s pentalogy?

  6. Probable Unusual Transmission of Zika Virus

    Centers for Disease Control (CDC) Podcasts

    2011-05-23

    This podcast discusses a study about the probable unusual transmission of Zika Virus Infection from a scientist to his wife, published in the May 2011 issue of Emerging Infectious Diseases. Dr. Brian Foy, Associate Professor at Colorado State University, shares details of this event.  Created: 5/23/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 5/25/2011.

  7. An unusual cause of anemia and encephalopathy

    Directory of Open Access Journals (Sweden)

    Sanjeev Kumar Sharma

    2015-04-01

    Full Text Available The authors present here an interesting case of recent onset anemia that was associated with an encephalopathy of the unusual cause.Although severe anemia can theoretically result in anemic hypoxia and can then lead to hypoxic encephalopathy, it is not a primary cause of encephalopathy. More frequently anemia can contribute together with other multiple causes of encephalopathy, such as infections, metabolic abnormalities, trauma, hepatic dysfunction, hypertension, toxins.

  8. Unusual causes of mechanical small bowel obstruction

    International Nuclear Information System (INIS)

    Shatnawi, Nawaf J.; Bani-Hani, Kamal E.

    2005-01-01

    We herein report our experience regarding unusual causes of bowel obstruction to increase the awareness of surgeons regarding this disease. From 1991 to 2003, we had experience at the University affiliated hospitals, northern Jordan with 24 patients with small bowel obstruction resulting from unusual causes. We retrospectively reviewed the medical records of these patients with regards to the mode of presentation, cause of obstruction, radiological and operative findings, management and outcome. We recorded 15 patients who underwent previous abdominal surgery. Preoperative diagnosis was correct in only one patient with an internal hernia, but the abdominal CT scan suggested the diagnosis in 5 of the 9 patients who had the scan. The final diagnosis was internal hernias in 11 patients, foreign bodies in 5, ischemic strictures in 3, carcinoid tumors in 2, endometriosis in 2, and metastatic deposit from interstitial bladder carcinoma in one patient. Nine of the 12 patients with recurrent obstruction had either short course or recurrence obstruction during the same hospital admission. W carried out bowel resections in 15 patients (5 resections were due to bowel strangulation). Post operative death occurred in 4 patients. Awareness of these rare causes of intestinal obstruction even in patients with previous abdominal operation might improve the outcome. The tentative diagnosis of adhesion obstruction in patients with unusual obstructive etiology might lead to a higher rate of gangrenous complications. Rigorous preoperative evaluation including careful history and early abdominal CT may show the obstructive cause. (author)

  9. NPP unusual events: data, analysis and application

    International Nuclear Information System (INIS)

    Tolstykh, V.

    1990-01-01

    Subject of the paper are the IAEA cooperative patterns of unusual events data treatment and utilization of the operating safety experience feedback. The Incident Reporting System (IRS) and the Analysis of Safety Significant Event Team (ASSET) are discussed. The IRS methodology in collection, handling, assessment and dissemination of data on NPP unusual events (deviations, incidents and accidents) occurring during operations, surveillance and maintenance is outlined by the reports gathering and issuing practice, the experts assessment procedures and the parameters of the system. After 7 years of existence the IAEA-IRS contains over 1000 reports and receives 1.5-4% of the total information on unusual events. The author considers the reports only as detailed technical 'records' of events requiring assessment. The ASSET approaches implying an in-depth occurrences analysis directed towards level-1 PSA utilization are commented on. The experts evaluated root causes for the reported events and some trends are presented. Generally, internal events due to unexpected paths of water in the nuclear installations, occurrences related to the integrity of the primary heat transport systems, events associated with the engineered safety systems and events involving human factor represent the large groups deserving close attention. Personal recommendations on how to use the events related information use for NPP safety improvement are given. 2 tabs (R.Ts)

  10. Recurring waterbird mortalities and unusual etiologies

    Science.gov (United States)

    Cole, Rebecca A.; Franson, J. Christian; Boere, Gerard C.; Galbraith, Colin A.; Stroud, David A.

    2006-01-01

    Over the last decade, the National Wildlife Health Center of the United States Geological Survey has documented various largescale mortalities of birds caused by infectious and non-infectious disease agents. Some of these mortality events have unusual or unidentified etiologies and have been recurring. While some of the causes of mortalities have been elucidated, others remain in various stages of investigation and identification. Two examples are discussed: 1) Leyogonimus polyoon (Class: Trematoda), not found in the New World until 1999, causes severe enteritis and has killed over 15 000 American Coot Fulica americana in the upper mid-western United States. The geographic range of this parasite within North America is predicted to be limited to the Great Lakes Basin. 2) In the early 1990s, estimates of up to 6% of the North American population of the Eared Grebe Podiceps nigricollis died at Salton Sea, California, with smaller mortalities occurring throughout the 1990s. Birds were observed to have unusual preening behaviour, and to congregate at freshwater drains and move onto land. Suggested etiologies included interactions of contaminants, immuno-suppression, an unusual form of a bacterial disease, and an unknown biotoxin. During studies carried out from 2000 to 2003, Eared Grebe mortality did not approach the level seen in the early 1990s and, although bacteria were identified as minor factors, the principal cause of mortality remains undetermined. The potential population impact of these emerging and novel disease agents is currently unknown.

  11. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  12. Lassomycin, a ribosomally synthesized cyclic peptide, kills mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2.

    Science.gov (United States)

    Gavrish, Ekaterina; Sit, Clarissa S; Cao, Shugeng; Kandror, Olga; Spoering, Amy; Peoples, Aaron; Ling, Losee; Fetterman, Ashley; Hughes, Dallas; Bissell, Anthony; Torrey, Heather; Akopian, Tatos; Mueller, Andreas; Epstein, Slava; Goldberg, Alfred; Clardy, Jon; Lewis, Kim

    2014-04-24

    Languishing antibiotic discovery and flourishing antibiotic resistance have prompted the development of alternative untapped sources for antibiotic discovery, including previously uncultured bacteria. Here, we screen extracts from uncultured species against Mycobacterium tuberculosis and identify lassomycin, an antibiotic that exhibits potent bactericidal activity against both growing and dormant mycobacteria, including drug-resistant forms of M. tuberculosis, but little activity against other bacteria or mammalian cells. Lassomycin is a highly basic, ribosomally encoded cyclic peptide with an unusual structural fold that only partially resembles that of other lasso peptides. We show that lassomycin binds to a highly acidic region of the ClpC1 ATPase complex and markedly stimulates its ATPase activity without stimulating ClpP1P2-catalyzed protein breakdown, which is essential for viability of mycobacteria. This mechanism, uncoupling ATPase from proteolytic activity, accounts for the bactericidal activity of lassomycin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. An Unusual Case of Metastatic Seminoma in a Dog.

    Science.gov (United States)

    Dugat, Danielle R; Medici, Emily L; Rochat, Mark C; Arble, Jason A; Snider, Timothy A

    2015-01-01

    An 8 yr old, reportedly castrated male Boston terrier presented with a history of generalized hyperesthesia and intermittent shifting leg lameness. Physical examination revealed a caudal abdominal mass and bilateral shoulder pain. A complete blood count, serum biochemistry panel, and urinalysis were unremarkable. Thoracic radiographs demonstrated bony proliferation and lysis of the third sternebra, an expansile lesion of the left tenth rib, and lucency in both proximal humeral metaphyses. Abdominal radiographs and ultrasound revealed a soft tissue mass within the caudoventral right abdomen. Ultrasonography also revealed an enlarged lymph node within the right retroperitoneal space. Exploratory laparotomy identified the mass as a retained testicle. A cryptorchidectomy, lymph node biopsy, and bilateral percutaneous core biopsies of the proximal humeri were performed. Histopathologic examination revealed malignant seminoma of the testicle with metastasis to lymph node and bone. Adjuvant chemotherapy was recommended, but it was declined by the owner. All follow-up was lost. This case highlights a unique case for causative hyperesthesia secondary to a novel site of metastasis from malignant seminoma. Metastasis to bone has not been reported in humans or dogs and represents a very unusual and aberrant variant of the normally relatively benign biological behavior of seminoma in the dog.

  14. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  15. Chemistry of plutonium revealed

    International Nuclear Information System (INIS)

    Connick, R.E.

    1992-01-01

    In 1941 one goal of the Manhattan Project was to unravel the chemistry of the synthetic element plutonium as rapidly as possible. In this paper the work carried out at Berkeley from the spring of 1942 to the summer of 1945 is described briefly. The aqueous chemistry of plutonium is quite remarkable. Important insights were obtained from tracer experiments, but the full complexity was not revealed until macroscopic amounts (milligrams) became available. Because processes for separation from fission products were based on aqueous solutions, such solution chemistry was emphasized, particularly precipitation and oxidation-reduction behavior. The latter turned out to be unusually intricate when it was discovered that two more oxidation states existed in aqueous solution than had previously been suspected. Further, an equilibrium was rapidly established among the four aqueous oxidation states, while at the same time any three were not in equilibrium. These and other observations made while doing a crash study of a previously unknown element are reported

  16. Unusual temperature evolution of superconductivity in LiFeAs

    Energy Technology Data Exchange (ETDEWEB)

    Nag, Pranab Kumar; Schlegel, Ronny; Baumann, Danny; Grafe, Hans-Joachim; Beck, Robert [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Wurmehl, Sabine [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Institute for Solid State Physics, TU Dresden (Germany); Buechner, Bernd [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Institute for Solid State Physics, TU Dresden (Germany); Center for Transport and Devices, TU Dresden (Germany); Hess, Christian [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Center for Transport and Devices, TU Dresden (Germany)

    2016-07-01

    We have performed temperature dependent scanning tunneling spectroscopy on an impurity-free surface area of a LiFeAs single crystal. Our data reveal a highly unusual temperature evolution of superconductivity: at T{sub c}{sup *}=18 K a partial superconducting gap opens, as is evidenced by subtle, yet clear features in the tunneling spectra, i.e. particle-hole symmetric coherence peaks and dip-hump structures. At T{sub c}=16 K, these features substantiate dramatically and become characteristic of full superconductivity. Remarkably, this is accompanied by an almost jump-like increase of the gap energy at T{sub c} to about 87% of its low-temperature gap value. The energy of the dip as measured by its distance to the coherence peak remains practically constant in the whole temperature regime T ≤ T{sub c}{sup *}. We compare these findings with established experimental and theoretical results.

  17. Unusual Origin and Rare Presentation of Primary Cardiac Lymphoma

    Science.gov (United States)

    Mohamed, Amir; Cherian, Sanjay; El-Ashmawy, Ahmed; Abdelmoneim, Salah Eldin; Soliman, Maher; Abu-Rayan, Mohamed; Kalangos, Afksendyios

    2011-01-01

    Non-Hodgkin lymphoblastic lymphomas are very uncommon tumors that rarely involve the heart; however, when they do, they typically cause cardiac symptoms. Herein, we describe the case of a young woman who presented with respiratory symptoms. These were caused by a high-grade lymphoblastic lymphoma, which originated in the left inferior pulmonary vein and extended into the left atrium. The tumor was surgically debulked, but it recurred in 1 month, and the patient underwent chemotherapy. Six months later, she had recurrent respiratory symptoms, and echocardiography revealed a persistent mass in the left lower lobar vein. A modified chemotherapy regimen led to complete resolution of the tumor within 2 months. We are unaware of other reports of a primary cardiac non-Hodgkin lymphoblastic lymphoma with this unusual site of origin and rare manifestation of symptoms. PMID:21841872

  18. An Unusual Endoscopic Image of a Submucosal Angiodysplasia

    Directory of Open Access Journals (Sweden)

    Rita Carvalho

    2012-01-01

    Full Text Available Obscure gastrointestinal bleeding is responsible for 2–10% of the cases of digestive bleeding. Angiodysplasia is the most common cause. The authors report a case of a 70-year-old female patient admitted to our Gastrointestinal Intensive Care Unit with a significant digestive bleeding. Standard upper and lower endoscopy showed no abnormalities, and we decided to perform a capsule enteroscopy that revealed a submucosal nodule with active bleeding in the jejunum. An intraoperative enteroscopy confirmed the presence of a small submucosal lesion with a central ulceration, and subsequently a segmental enterectomy was performed. Surprisingly, the histopathological diagnosis was angiodysplasia. The patient remains well after a two-year period of follow-up. We present this case of obscure/overt gastrointestinal bleeding to emphasize the role of capsule and intraoperative enteroscopy in the evaluation of these situations, and because of the unusual endoscopic appearance of the angiodysplasia responsible for the hemorrhage.

  19. An Unusual Cause of Duodenal Obstruction: Persimmon Phytobezoar.

    Science.gov (United States)

    Fan, Shengxian; Wang, Jing; Li, Yousheng

    2016-12-01

    Duodenal phytobezoar, an unusual cause of acute duodenal obstruction, is rarely seen. The most common cause of this type of bezoar is persimmon. It frequently arises from underlying gastrointestinal tract pathologies (gastric surgery, etc.). Here, we report the case of a 66-year-old man who had undergone distal gastrectomy with Billroth I reconstruction for gastric cancer and experienced severe epigastric discomfort, abdominal pain, and vomiting for a few days. The abdominal computed tomography scan showed a large-sized mass in the horizontal portion of the duodenum. On following endoscopic examination, a large phytobezoar was revealed in the duodenum. He was treated with endoscopic fragmentation combined with nasogastric Coca-Cola. The patient tolerated the procedure well and resumed a normal oral diet 3 days later.

  20. Unusual magnetic resonance imaging features in Menkes disease

    International Nuclear Information System (INIS)

    Barnerias, C.; Desguerre, I.; Dulac, O.; Bahi-Buisson, N.; Boddaert, N.; Hertz-Pannier, L.; Boddaert, N.; Guiraud, P.; Hertz-Pannier, L.; Dulac, O.; Bahi-Buisson, N.; Hertz-Pannier, L.; Dulac, O.; Bahi-Buisson, N.; De Lonlay, P.

    2008-01-01

    We present a case of an inherited disorder of copper metabolism, Menkes disease in which MRI studies revealed the coexistence of T2 hyper-signal in the temporal white matter with an increase of apparent diffusion coefficient indicative of vasogenic oedema combined with T2 hyper-signal of the putamen and head of the caudate and decreased apparent diffusion coefficient indicative of cytotoxic oedema. These unusual MRI features emphasize the interest of newly developed techniques in early diagnosis in Menkes disease. The acute cerebral damage might result from the combined effects of acute metabolic stress due to infectious disease and prolonged status epilepticus, acting on a highly susceptible developing brain. Vasogenic oedema in the temporal white matter could be related to prolonged status epilepticus and vascular abnormalities. Cytotoxic oedema of the putamen and head caudate could result from energetic failure. (authors)

  1. Unusual magnetic resonance imaging features in Menkes disease

    Energy Technology Data Exchange (ETDEWEB)

    Barnerias, C; Desguerre, I; Dulac, O; Bahi-Buisson, N [Hop Necker Enfants Malades, AP-HP, Dept Paediat Neurol and Metab Dis, F-75743 Paris 15 (France); Boddaert, N; Hertz-Pannier, L [Hop Necker Enfants Malad, AP-HP, Dept Pediat Radiol, F-75743 Paris (France); Boddaert, N [CEA, Serv Hosp Frederic Joliot, INSERM, U797, F-91406 Orsay (France); Guiraud, P [Univ Grenoble, Serv Biochim, Genet Hop, Grenoble (France); Hertz-Pannier, L; Dulac, O; Bahi-Buisson, N [INSERM, U663, F-75015 Paris (France); Hertz-Pannier, L; Dulac, O; Bahi-Buisson, N [Univ Paris 05, F-75005 Paris (France); De Lonlay, P [Hop Necker Enfants Malades, AP-HP, Dept Paediat Neurol and Metab Dis, F-75743 Paris 15 (France); Hop Necker Enfants Malades, AP HP, Ctr Reference Malad Metab, F-75743 Paris 15 (France)

    2008-07-01

    We present a case of an inherited disorder of copper metabolism, Menkes disease in which MRI studies revealed the coexistence of T2 hyper-signal in the temporal white matter with an increase of apparent diffusion coefficient indicative of vasogenic oedema combined with T2 hyper-signal of the putamen and head of the caudate and decreased apparent diffusion coefficient indicative of cytotoxic oedema. These unusual MRI features emphasize the interest of newly developed techniques in early diagnosis in Menkes disease. The acute cerebral damage might result from the combined effects of acute metabolic stress due to infectious disease and prolonged status epilepticus, acting on a highly susceptible developing brain. Vasogenic oedema in the temporal white matter could be related to prolonged status epilepticus and vascular abnormalities. Cytotoxic oedema of the putamen and head caudate could result from energetic failure. (authors)

  2. Hypophosphatemic osteomalacia: an unusual clinical presentation of multiple myeloma.

    Science.gov (United States)

    Reyskens, M; Sleurs, K; Verresen, L; Janssen, M; van den Bergh, J; van den Berg, J; Geusens, P

    2015-07-01

    An unusual case of a 75-year-old man is presented who had multiple stress fractures due to adult onset hypophosphatemic osteomalacia, which was the result of Fanconi syndrome, with light chain cast proximal tubulopathy due to multiple myeloma. A 75-year-old man presented with diffuse pain and muscle weakness. He had multiple stress fractures, low serum phosphate, decreased renal tubular reabsorption of phosphate, and normal PTH and FGF23, indicating adult onset hypophosphatemic osteomalacia. Phosphate supplements with calcitriol resulted in clinical recovery and healing of stress fractures. Because of proteinuria, a renal biopsy was performed that revealed Fanconi syndrome with light chain cast proximal tubulopathy and light kappa chains were found in serum and urine. A bone biopsy confirmed the diagnosis of multiple myeloma, and treatment with chemotherapy resulted in cytological and clinical recovery.

  3. Secondary structure of the rRNA ITS2 region reveals key evolutionary patterns in acroporid corals.

    Science.gov (United States)

    Coleman, Annette W; van Oppen, Madeleine J H

    2008-10-01

    This study investigates the ribosomal RNA transcript secondary structure in corals as confirmed by compensatory base changes in Isopora/Acropora species. These species are unique versus all other corals in the absence of a eukaryote-wide conserved structural component, the helix III in internal transcriber spacer (ITS) 2, and their variability in the 5.8S-LSU helix basal to ITS2, a helix with pairings identical among all other scleractinian corals. Furthermore, Isopora/Acropora individuals display at least two, and as many as three, ITS sequence isotypes in their genome which appear to be capable of function. From consideration of the conserved elements in ITS2 and flanking regions, it appears that there are three major groups within the IsoporaAcropora lineage: the Isopora + Acropora "longi" group, the large group including Caribbean Acropora + the Acropora "carib" types plus the bulk of the Indo-Pacific Acropora species, and the remaining enigmatic "pseudo" group found in the Pacific. Interbreeding is possible among Caribbean A. palmata and A. cervicornis and among some species of Indo-Pacific Acropora. Recombinant ITS sequences are obvious among these latter, such that morphology (as represented by species name) does not correlate with common ITS sequence. The combination of characters revealed by RNA secondary structure analyses suggests a recent past/current history of interbreeding among the Indo-Pacific Acropora species and a shared ancestry of some of these with the Caribbean Acropora. The unusual absence of helix III of ITS2 of Isopora/Acropora species may have some causative role in the equally unusual instability in the 5.8S-LSU helix basal to ITS2 of this species complex.

  4. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  5. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  6. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  7. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  8. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  9. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  10. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  11. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  12. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  13. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  14. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  15. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  16. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  17. Structure of the Human Mitochondrial Ribosome Studied In Situ by Cryoelectron Tomography.

    Science.gov (United States)

    Englmeier, Robert; Pfeffer, Stefan; Förster, Friedrich

    2017-10-03

    Mitochondria maintain their own genome and its corresponding protein synthesis machine, the mitochondrial ribosome (mitoribosome). Mitoribosomes primarily synthesize highly hydrophobic proteins of the inner mitochondrial membrane. Recent studies revealed the complete structure of the isolated mammalian mitoribosome, but its mode of membrane association remained hypothetical. In this study, we used cryoelectron tomography to visualize human mitoribosomes in isolated mitochondria. The subtomogram average of the membrane-associated human mitoribosome reveals a single major contact site with the inner membrane, mediated by the mitochondria-specific protein mL45. A second rRNA-mediated contact site that is present in yeast is absent in humans, resulting in a more variable association of the human mitoribosome with the inner membrane. Despite extensive structural differences of mammalian and fungal mitoribosomal structure, the principal organization of peptide exit tunnel and the mL45 homolog remains invariant, presumably to align the mitoribosome with the membrane-embedded insertion machinery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  19. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  20. Pasteurella multocida Osteomyelitis: An Unusual Case Presentation

    Directory of Open Access Journals (Sweden)

    Herbert P von Schroeder

    1996-01-01

    Full Text Available A healthy male farm employee developed an unusual infection caused by Pasteurella multocida. Atypical features included the chronic nature of the infection, the development of osteomyelitis of the tibia without direct animal inoculation, and lack of fever and leukocytosis. Radiographic appearance of P multocida osteomyelitis may be the result of osteoclast activation and can be confused with musculoskeletal tumour. P multocida infection requires a high degree of suspicion, and should be considered in cases of farm- or animal-related injuries even if there is no history of direct animal contact.

  1. An Unusual Cause of Precordial Chest Pain

    Directory of Open Access Journals (Sweden)

    Sevket Ozkaya

    2013-01-01

    Full Text Available Extraskeletal chondrosarcoma in anterior mediastinum is very rare. A 45-year-old male patient was admitted to the hospital with precordial chest pain. A large and well-shaped mass in the anterior mediastinum was seen radiologically, and there was a clearly compression of the heart by the mass. The lesion was totally resected, and extraskeletal mediastinal chondrosarcoma was histopathologically diagnosed. We aimed to present and discuss the radiologic, clinic, and histopathologic features of unusual presentation of extraskeletal chondrosarcoma in a case.

  2. Unusual Cases of Hypothenar Hammer Syndrome.

    Science.gov (United States)

    Orrapin, Saranat; Arworn, Supapong; Wisetborisut, Anawat

    2015-01-01

    Hypothenar hammer syndrome (HHS) is a rare occupational disease. The risk group of HHS is patient whose dominate hand used as a hammer. Our study report unusually cases in Chiang Mai University Hospital. 19 year-old basketball player had right ulnar artery aneurysm for two months. After operation, his symptom was relieved and returned to play basketball again. 65 year-old housekeeper had non-dominated hand ulnar artery aneurysm for two years. After operation she still had hand claudication due to poor run-off vessel. HHS is previously state in risk group. But from our report there was a risk in different occupation.

  3. Sporotrichosis in an unusual location - Case report*

    Science.gov (United States)

    Reis, Brisa Dondoni; Cobucci, Fernanda Oliveira; Zacaron, Luciana Helena; D'Acri, Antonio Macedo; Lima, Ricardo Barbosa; Martins, Carlos José

    2015-01-01

    Sporotrichosis is the most common subcutaneous mycosis. It is caused by the dimorphic fungus Sporothrix schenckii, and the infection is usually acquired by traumatic inoculation. We describe a case of sporotrichosis in an uncommon location with an unusual mode of transmission. A 49-year-old female patient who lived in an urban area of Rio de Janeiro presented with involvement of the left ear. No history of contact with soil, plants or animals was elicited. The suspected source of infection was a pair of handmade wooden earrings. The delay in the diagnosis and treatment resulted in higher morbidity, unsightly scarring and loss of ear lobe. PMID:26312682

  4. Unusual Amino Acids in Medicinal Chemistry.

    Science.gov (United States)

    Blaskovich, Mark A T

    2016-12-22

    Unusual amino acids are fundamental building blocks of modern medicinal chemistry. The combination of readily functionalized amine and carboxyl groups attached to a chiral central core along with one or two potentially diverse side chains provides a unique three-dimensional structure with a high degree of functionality. This makes them invaluable as starting materials for syntheses of complex molecules, highly diverse elements for SAR campaigns, integral components of peptidomimetic drugs, and potential drugs on their own. This Perspective highlights the diversity of unnatural amino acid structures found in hit-to-lead and lead optimization campaigns and clinical stage and approved drugs, reflecting their increasingly important role in medicinal chemistry.

  5. Unusual bond paths in organolithium compounds

    International Nuclear Information System (INIS)

    Bachrach, S.M.; Ritchie, J.P.

    1986-01-01

    We have applied the topological method to a number of organolithium compounds. The wavefunctions were determined with GAUSSIAN-82 using 3-21G basis set and fully optimized geometries. Gradient paths were obtained using the RHODER package and critical points were located using EXTREME. These results indicate the unusual nature of organolithium compounds. The strange bond paths arise mainly from the ionic nature of the C-Li interaction. We suggest that the term ''bond path'' may best be suited for covalent bonds. 4 figs., 1 tab

  6. Microfilaria in pleural effusion: An unusual association

    Directory of Open Access Journals (Sweden)

    Rehena Sarkar

    2016-01-01

    Full Text Available Lymphatic filariasis is a major public health problem in tropical countries and India is endemic for it. However, lymphatic filariasis presenting as pleural effusion is an unusual manifestation and finding microfilaria in pleural effusion without any lung pathology is rare. We report a case of pleural effusion without any underlying lung pathology and normal blood picture. Clinical cure occurred after treatment with diethyl-carbamazepine. Filariasis should be kept in view while considering the differential diagnosis of idiopathic pleural effusion, especially in endemic countries.

  7. Odontoameloblastoma: A rare case with unusual presentation

    Directory of Open Access Journals (Sweden)

    Supreet Jain

    2016-01-01

    Full Text Available The odontoameloblastoma (OA, also known as ameloblastic odontoma, is a very rare odontogenic tumor that is similar to ameloblastoma in its locally aggressive behavior. OA includes odontogenic ectomesenchyme in addition to odontogenic epithelium that resembles an ameloblastoma both in structure and in behavior. Its clinical presentation, however, often mimics the more innocuous odontoma, and hence, the recognition of its aggressive nature is commonly only ascertained after its histopathologic diagnosis following enucleation. This paper presents a rare case of OA with unusual clinical and radiological features.

  8. An unusual presentation of testicular tumor

    International Nuclear Information System (INIS)

    Amin, M.U.; Rahan, T.; Haq, A.U.; Aftab, P.

    2006-01-01

    A case of testicular choriocarcinoma is reported in which blood mixed stools and haemoptysis were the presenting manifestations as the patient never told about the testicular swelling to his parents. Orchidectomy was performed but the patient presented again with massive hematemesis due to gastric perforation secondary to gastric metastasis. The size of the testis at diagnosis was approximately 12 x 7cm. This was also unusual as testicular choriocarcinoma presents as a small mass. The patient eventually died of the complications within one month of diagnosis. (author)

  9. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  10. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  11. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  13. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  14. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  15. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  16. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  17. Exposure to unusually high indoor radon levels

    International Nuclear Information System (INIS)

    Rasheed, F.N.

    1993-01-01

    Unusually high indoor radon concentrations were reported in a small village in western Tyrol, Austria. The authors have measured the seasonal course of indoor radon concentrations in 390 houses of this village. 71% of houses in winter and 33% in summer, showed radon values on the ground floor above the Austrian action level of 400 Bq/cm 3 . This proportion results in an unusually high indoor radon exposure of the population. The radon source was an 8,700-year-old rock slide of granite gneiss, the largest of the alpine crystalline rocks. It has a strong emanating power because its rocks are heavily fractured and show a slightly increased uranium content. Previous reports show increased lung cancer mortality, myeloid leukemia, kidney cancer, melanoma, and prostate cancer resulting from indoor radon exposure. However, many studies fail to provide accurate information on indoor radon concentrations, classifying them merely as low, intermediate, and high, or they record only minor increases in indoor radon concentrations. Mortality data for 1970-91 were used to calculate age and sex standardized mortality rates (SMR) for 51 sites of carcinoma. The total population of Tyrol were controls. A significantly higher risk was recorded for lung cancer. The high SMR for lung cancer in female subjects is especially striking. Because the numbers were low for the other cancer sites, these were combined in one group to calculate the SMR. No significant increase in SMR was found for this group

  18. Unusual motions of a vibrating string

    Science.gov (United States)

    Hanson, Roger J.

    2003-10-01

    The actual motions of a sinusoidally driven vibrating string can be very complex due to nonlinear effects resulting from varying tension and longitudinal motion not included in simple linear theory. Commonly observed effects are: generation of motion perpendicular to the driving force, sudden jumps in amplitude, hysteresis, and generation of higher harmonics. In addition, these effects are profoundly influenced by wire asymmetries which in a brass harpsichord wire can cause a small splitting of each natural frequency of free vibration into two closely spaced frequencies (relative separation ~0.2% to 2%), each associated with transverse motion along two orthogonal characteristic wire axes. Some unusual resulting patterns of complex motions of a point on the wire are exhibited on videotape. Examples include: sudden changes of harmonic content, generation of subharmonics, and motion which appears nearly chaotic but which has a pattern period of over 10 s. Another unusual phenomenon due to entirely different causes can occur when a violin string is bowed with a higher than normal force resulting in sounds ranging from about a musical third to a twelfth lower than the sound produced when the string is plucked.

  19. Extensive Air Showers with unusual structure

    Directory of Open Access Journals (Sweden)

    Beznosko Dmitriy

    2017-01-01

    Full Text Available A total of 23500 Extensive Air Showers (EAS with energies above ∼ 1016 eV have been detected during the ∼3500 hours of the Horizon-T (HT detectors system operations before Aug. 2016. Among these EAS, more than a thousand had an unusual spatial and temporary structure that showed pulses with several maxima (modals or modes from several detection points of the HT at the same time. These modes are separated in time from each other starting from tens to thousands of ns. These EAS have been called multi-modal. Analysis shows that the multi-modal EAS that have been detected by Horizon-T have the following properties: 1. Multi-modal EAS have energy above ∼1017 eV. 2. Pulses with several modes are located at large distances from the EAS axis. An overview of the collected data will be provided. General comments about the unusual structure of the multi-modal EAS will be presented.

  20. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  1. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  2. Unusual way of suicide by carbon monoxide. Case Report.

    Science.gov (United States)

    Zelený, Michal; Pivnička, Jan; Šindler, Martin; Kukleta, Pavel

    2015-01-01

    Authors discuss the case of a suicide of a 29-year-old man caused by carbon monoxide (CO) intoxication. What the authors found interesting was the unusual way of committing suicide that required good technical skills and expert knowledge. The level of carboxyhemoglobin (COHb) in the blood of the deceased man was routinely determined by the modified method by Blackmoore (1970), using gas chromatography/thermal conductivity detection. The level of saturation of the hemoglobin by CO in the collected blood sample is determined relatively to the same sample saturated to 100%. In the blood sample of the deceased man the lethal concentration of COHb of 76.5% was determined. Within the following examinations the blood alcohol concentration of 0.05 g.kg(-1) was determined. Further analysis revealed traces of sertraline, its metabolite N-desmethylsertraline, omeprazole and caffeine in the liver tissue, traces of N-desmethylsertraline, ibuprofen and caffeine in urine sample, and only traces of caffeine in the stomach content and blood samples were proved. To commit suicide the man used a sophisticated double container-system equipped with a timer for controlled generation of CO based on the chemical reaction of concentrated sulphuric acid and formic acid. The used timer was set by an electromechanical timer switch that triggered the fatal reaction of the acids while the man was sleeping. The authors discuss an unusual case of suicide by CO intoxication rarely seen in the area of forensic medicine and toxicology that is specific due to its sophisticated way of execution.

  3. Myofibroblastoma: An Unusual Rapidly Growing Benign Tumour in a Male Breast

    International Nuclear Information System (INIS)

    Rafique, A.; Arshad, A.

    2013-01-01

    Myofibroblastoma is an unusual benign tumour of the breast predominantly seen in men in their sixth to seventh decade. The gross appearance is that of a well circumscribed nodule, characteristically small, seldom exceeding 3 cm. We present a case of an unusually large myofibroblastoma, which mimicked a malignant breast tumour. A 40 years old male, known case of tetralogy of Fallot, was operated in infancy in abroad, presented with a rapid enlargement of right breast over 5 - 6 weeks. Examination revealed a firm 10 cm hemispherical lump occupying the whole of the right breast with normal overlying skin. Since core biopsy was inconclusive, a subcutaneous mastectomy was performed to remove the tumour, which weighed 500 gms. Histopathology and immunocytochemistry revealed a mixed classical and collagenised type of myofibroblastoma. The patient is well with no evidence of recurrence. (author)

  4. Cervical Lymph Node Metastasis: Unusual Presentation of Adenoid Cystic Carcinoma - Diagnosed By FNAC

    Directory of Open Access Journals (Sweden)

    Archana Buch

    2015-01-01

    Full Text Available Adenoid cystic carcinoma (ACC is a rare neoplasm that usually arises from minor salivary glands. It is characteristically locally infiltrative, exhibiting perineural invasion, has a tendency for local recurrence and prolonged clinical course. A 60 year old male, chronic smoker presented with swelling of the left cervical lymph node since two months. Examination revealed a solitary firm, non tender, non mobile left cervical swelling measuring 2 x 1 cm. Fine Needle Aspiration Cytology (FNAC was done from the cervical lymph node. The diagnosis of metastatic deposits of ACC was given. Detail examination of the oral cavity revealed a small swelling at the floor of the mouth. Biopsy of the swelling confirmed ACC on histopathological examination. An unusual feature of adenoid cystic carcinoma is the low incidence of metastases to regional lymph nodes. The case is presented to highlight its unusual presentation and utility of FNAC in rapid diagnosis.

  5. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  6. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  7. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  8. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  9. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  10. Unusual multifocal granulomatous disease caused by actinomycetous bacteria in a nestling Derbyan parrot (Psittacula derbiana).

    Science.gov (United States)

    Park, F J; Jaensch, S

    2009-01-01

    A nestling Derbyan parrot (Psittacula derbiana) was presented with unusual subcutaneous swellings of the thigh regions, and poor growth. Histological examination revealed actinomycetous bacteria associated with multifocal systemic granulomas. The clinical and pathological findings of the case are presented, and some relevant aspects of actinomycetous bacterial infections in mammals and birds are discussed. Although granulomatous disease is encountered at times in avian species, the actinomycetous bacteria (Nocardia and Actinomyces spp.) have rarely been reported in association with multifocal granulomatous disease in birds.

  11. An unusual case of Extranodal Rosai-Dorfman Disease manifesting as a bilateral Epibulbar mass.

    OpenAIRE

    Dr. Swati Ravani; Dr. Jaideep Sharma

    2017-01-01

    Purpose: To report an unusual presentation of a 24-year-old man with bilateral epibulbar mass, whose presentation was confirmed histopathologically as Rosai Dorfman disease. Method: We studied a retrospective and interventional case report. Results: A 24-year-old man presented with a mass over both eyes, gradually and, progressively increasing over one year. Visual acuity and intraocular pressures were normal in both eyes. Examination revealed bilateral non tender mobile soft in consistency ...

  12. Endovascular Treatment of Unusual Multiple Aneurysms of the Internal Carotid Artery-Posterior Communicating Artery Complex

    OpenAIRE

    Kubo, Michiya; Kuwayama, Naoya; Hirashima, Yutaka; Ohi, Masayoshi; Takami, Masaaki; Endo, Shunro

    2000-01-01

    A 79-year-old female presented with subarachnoid hemorrhage due to rupture of a rare true posterior communicating artery(PCoA)aneurysm and with poor general condition. Endovascular therapy was performed in the chronic stage. Right carotid angiography just before embolization demonstrated unusual multiple aneurysms of the internal carotid artery(ICA)-PCoA complex. Superselective an-giography and aneurysmography using microcatheter revealed two separate aneurysms arising from the PCoA and the I...

  13. Trichosporon inkin and Trichosporon mucoides as unusual causes of white piedra of scalp hair

    Directory of Open Access Journals (Sweden)

    Uma Tendolkar

    2014-01-01

    Full Text Available White piedra of scalp hair is considered a rare entity. We report three cases of this disorder all of whom presented with nodules on the hair. Potassium hydroxide preparations of the hair revealed clustered arthrospores and mature, easily detachable nodules. Cultures grew Trichosporon inkin in 2 patients and Trichosporon mucoides in one patient. Both these fungi are unusual causes of white piedra.

  14. Temporo-mandibular joint dislocation: an unusual complication of transoesophageal echocardiography.

    Science.gov (United States)

    Anantharam, Brijesh; Chahal, Navtej; Stephens, Nigel; Senior, Roxy

    2010-03-01

    Temporo-mandibular joint (TMJ) dislocation is an unusual complication of transoesophageal echocardiography (TEE). We report a rare case of bilateral TMJ dislocation in an 84-year-old man prior to DC cardioversion (DCCV) for atrial flutter. Shortly after TEE and DCCV, the patient complained of bilateral facial pain. An orthopantomogram revealed bilateral TMJ dislocation. A closed reduction was performed by maxillo-facial surgeons under intravenous anaesthesia. Although very uncommon, the physician should be aware of the complication and its management.

  15. An unusual encapsulated collection of urine (urinoma) in an infant with vesicoureteral reflux

    International Nuclear Information System (INIS)

    Passas, V.; Brountzos, E.; Grilias, D.; Vasilakos, P.

    1987-01-01

    We describe an unusual case of encapsulated collection of urine (urinoma) in a 7-month-old female infant. The clinical diagnosis was urinary tract infection. The retrograde cysto-urethrogram revealed grade III vesicoureteral reflux, which we believe was the cause of the urinoma. The investigation was completed with isotope and ultrasound studies. High pressure reflux was the cause of the urine extravasation in the perirenal space. (orig.)

  16. Pseudomembranous aspergillus bronchitis in a double-lung transplanted patient: unusual radiographic and CT features

    International Nuclear Information System (INIS)

    Ducreux, D.; Chevallier, P.; Raffaelli, C.; Padovani, B.; Perrin, C.; Jourdan, J.; Hofman, P.

    2000-01-01

    Pseudomembranous aspergillus bronchitis is considered as an early form of invasive pulmonary aspergillosis, a well-known airway infection in immunocompromised patients. Radiologic features concerning invasive aspergillosis of the airways have been reported. However, we describe here an unusual feature of invasive aspergillus bronchitis, never reported to date, observed in a double-lung transplanted patient. Chest radiograph and CT revealed significant peribronchial thickening without any parenchymal involvement. (orig.)

  17. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  18. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Radiographic evaluation and unusual bone formations in different genetic patterns in synpolydactyly

    International Nuclear Information System (INIS)

    Yucel, Aylin; Acar, Murat; Kuru, Ilhami; Bozan, M. Eray; Solak, Mustafa

    2005-01-01

    To compare the radiological findings of heterozygous and homozygous subjects with synpolydactyly (SPD) and to discuss their unusual bone formations. Families with hand and foot SPD were examined. Genetic analysis was performed with blood samples and the pedigree was constructed. The affected individuals, especially those with distinctive phenotypic features, were invited to our orthopaedics clinic for further diagnostic studies. All participants underwent detailed clinical and X-ray examinations. Of the invited patients, 16 (five female and 11 male; age range 4-37 years, mean age 10.75 years) were included in our study, and hand and foot radiographs were obtained. All subjects had bilateral hand radiographs (32 hands), and 14 had bilateral foot radiographs (28 feet). Genetic analysis revealed 12 heterozygote (75%) and four (25%) homozygote phenotypes. Among patients enrolled into the study nine (three homozygotes, six heterozygotes) had SPD of both hands and feet bilaterally (tetrasynpolydactyly). Six unusual bone formations were observed in the hands and feet: delta phalanx, delta metacarpal/metatarsal, kissing delta phalanx, true double epiphysis, pseudoepiphysis and cone-shaped epiphysis. There were major differences in radiological and clinical manifestations of homozygote and heterozygote phenotypes. The homozygous SPD presented with very distinctive unusual bone formations. The existence and variety of unusual bones may indicate the severity of penetrance and expressivity of SPD. (orig.)

  20. Condylomata lata on the ankle: an unusual location.

    Science.gov (United States)

    Ikeda, Eri; Goto, Akane; Suzaki, Reiko; Sawada, Mizuki; Dekio, Itaru; Ishizaki, Sumiko; Fujibayashi, Mariko; Takahashi, Hayato; Tanaka, Masaru

    2016-04-01

    A 43-year-old Japanese man presented with reddish nodules on the ankle. The nodules had a yellowish crust and eroded surface. Dermoscopy revealed red to milky-red globules at the periphery and some glomerular vessels in the center and a whitish-pink network, which corresponded to capillary dilatation in the papillary dermis and prominent acanthosis, respectively. These structures were surrounded by a yellowish peripheral structureless area and multiple white, small, round structures in the center, corresponding to the macerated horny layer and keratin plugs. Blood samples were positive for rapid plasma reagin (1:64), Treponema pallidum hemagglutination assay (1:20480), and fluorescent treponemal antibody-absorption (1:1280). A lesional skin biopsy specimen showed irregular acanthosis and papillomatosis. The Warthin-Starry and anti-Treponema pallidum antibody stains on the biopsy specimen revealed many spirochetes in the lower epidermis and the papillary dermis. A diagnosis of secondary syphilis with condylomata lata was made. After one week of treatment with oral benzylpenicillin benzathine hydrate (Bicillin(®) G granules 400,000 units; Banyu Pharmaceutical Co., Ltd, Tokyo, Japan), 1.6 million units (U) daily, the ankle lesions had resolved with a small ulcer and pigmentation. Although syphilis is a relatively common disease, this case study reports an unusual presentation as well as dermoscopy findings.

  1. Karyotypic evolution of ribosomal sites in buffalo subspecies and their crossbreed

    Directory of Open Access Journals (Sweden)

    Tiago Marafiga Degrandi

    2014-06-01

    Full Text Available Domestic buffaloes are divided into two group based on cytogenetic characteristics and habitats: the "river buffaloes" with 2n = 50 and the "swamp buffaloes", 2n = 48. Nevertheless, their hybrids are viable, fertile and identified by a 2n = 49. In order to have a better characterization of these different cytotypes of buffaloes, and considering that NOR-bearing chromosomes are involved in the rearrangements responsible for the karyotypic differences, we applied silver staining (Ag-NOR and performed fluorescent in situ hybridization (FISH experiments using 18S rDNA as probe. Metaphases were obtained through blood lymphocyte culture of 21 individuals, including river, swamp and hybrid cytotypes. Ag-NOR staining revealed active NORs on six chromosome pairs (3p, 4p, 6, 21, 23, 24 in the river buffaloes, whereas the swamp buffaloes presented only five NOR-bearing pairs (4p, 6, 20, 22, 23. The F1 crossbreed had 11 chromosomes with active NORs, indicating expression of both parental chromosomes. FISH analysis confirmed the numerical divergence identified with Ag-NOR. This result is explained by the loss of the NOR located on chromosome 4p in the river buffalo, which is involved in the tandem fusion with chromosome 9 in this subspecies. A comparison with the ancestral cattle karyotype suggests that the NOR found on the 3p of the river buffalo may have originated from a duplication of ribosomal genes, resulting in the formation of new NOR sites in this subspecies.

  2. Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    2013-05-01

    Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

  3. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  4. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  5. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  6. Hypervariability of ribosomal DNA at multiple chromosomal sites in lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Zhuo, L; Reed, K M; Phillips, R B

    1995-06-01

    Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.

  7. Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

    Science.gov (United States)

    Hilu, K W; Johnson, J L

    1992-04-01

    Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

  8. An Unusual Case of Bilateral Granulomatous Mastitis

    Directory of Open Access Journals (Sweden)

    C. A. Pistolese

    2013-01-01

    Full Text Available Idiopathic granulomatous mastitis (IGM is an uncommon benign disorder of the breast. At clinical examination, IGM is characterized by an inflammatory process of the breast, usually unilateral. Possible clinical findings are palpable mass with erythematous skin, pain, sterile abscesses, fistula and nipple retraction. Mammography and ultrasound findings are not specific for IGM. Magnetic resonance imaging (MRI is a useful tool for the differential diagnosis; it is also necessary to delineate the exact extension of the disease and to plan the correct treatment. Final diagnosis is histological. We described an unusual case of IGM with bilateral involvement in a patient with history of pacemaker implantation and IGM typical clinical symptoms. Mammography, ultrasound, and MRI examinations were performed to identify the inflammatory disorder and to plan the correct therapy. Imaging features were correlated with final histological diagnosis of IGM.

  9. Unusual Presentation of Cutaneous Leishmaniasis: Ocular Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Masoud Doroodgar

    2017-01-01

    Full Text Available The leishmaniases are parasitic diseases that are transmitted to humans by infected female sandflies. Cutaneous leishmaniasis (CL is one of 3 main forms of the disease. CL is the most common form of the disease and is endemic in many urban and rural parts of Iran and usually caused by two species of Leishmania: L. major and L. tropica. We report a case of unusual leishmaniasis with 25 lesions on exposed parts of the body and right eyelid involvement (ocular leishmaniasis. The patient was a 75-year-old male farmer referred to health care center in Aran va Bidgol city. The disease was diagnosed by direct smear, culture, and PCR from the lesions. PCR was positive for Leishmania major.

  10. Unusual Wrist Tremor: Unilateral Isometric Tremor?

    Directory of Open Access Journals (Sweden)

    Theresa A. Zesiewicz

    2014-01-01

    Full Text Available Background: Tremors may be difficult to classify.Case Report: An 83‐year‐old male presented with an unusual left wrist tremor. The tremor could be reproducibly elicited by making a fist or carrying a weighted object (e.g., a shopping bag, bottle of water of approximately 1 lb or more, and it intensified with heavier weights. The tremor was difficult to classify, although it shared features with isometric tremor.Discussion: This specific presentation of tremor has not been reported previously. We hope that the detailed description we provide will aid other neurologists who encounter this or similar tremors in their clinics.

  11. Bifocal sclerosing osteosarcoma: unusual presentation and course

    International Nuclear Information System (INIS)

    Abramovici, L.; Steiner, G.C.; Rosenberg, Z.; Kenan, S.

    1998-01-01

    Multifocal osteosarcoma is uncommon. Long-term survival of an incompletely treated case is exceptional. We report an unusual case of bifocal sclerosing osteosarcoma in a 38-year-old women that involved the left ilium and right proximal femur. The femoral lesion was resected. The tumor in the left ilium was not treated. She did not receive chemotherapy and has been free of metastases for 7 years. Recently, growth of the pelvic osteosarcoma has resulted in vascular compression and edema of the lower extremity. The patient's alkaline phosphatase has been elevated throughout. The tumor was HMB-45 positive, which has not been previously reported in osteosarcoma. The pathogenesis of multifocal osteosarcoma is discussed. (orig.)

  12. Unusual presentation of twisted ovarian cyst

    Directory of Open Access Journals (Sweden)

    Vineet V Mishra

    2016-01-01

    Full Text Available Ovarian torsion (also termed as adnexal torsion refers to partial or complete rotation of the ovary and a portion of fallopian tube along its supplying vascular pedicle. It occurs commonly in reproductive age group; more on the right side (60% and often presents with acute lower abdominal pain lasting for few hours and up to 24 h, accounting for 2.7% of acute gynecological conditions. It is one of the devastating conditions, hampering blood supply of ovary which may lead to total necrosis of ovarian tissue and complications, if not diagnosed and managed in time. Hence, we present a case on a twisted ovarian cyst in postmenopausal woman with unusual symptomatology leading to delayed diagnosis and loss of an ovary.

  13. Unusual intraosseous transmigration of impacted tooth

    International Nuclear Information System (INIS)

    Kumar, Santosh; Urala, Arun Srinivas; Kamath, Abhay Taranath; Jayaswal, Priyanka; Valiathan, Ashima

    2012-01-01

    Transmigration of an impacted tooth through the symphyseal suture is a rare and special developmental anomaly of unknown etiology that is unique to the mandibular canine. Maxillary canine transmigration is even rarer. Transmigrated canines are particularly significant due to the aesthetic and functional importance. A maxillary lateral incisor crossing the mid-palatal suture has never been reported in the literature. The aim of this report is to present the first case of simultaneous transmigration of a lateral incisor and canine in the maxilla. The paper also reports four unusual cases of unilateral canine transmigration in the maxilla and mandible and successful eruption of one of the transmigrated mandibular canines following orthodontic traction. Etiology of transmigration and its clinical considerations are also discussed.

  14. Unusual intraosseous transmigration of impacted tooth

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Santosh; Urala, Arun Srinivas; Kamath, Abhay Taranath; Jayaswal, Priyanka; Valiathan, Ashima [Manipal College of Dental Sciences, Manipal (India)

    2012-03-15

    Transmigration of an impacted tooth through the symphyseal suture is a rare and special developmental anomaly of unknown etiology that is unique to the mandibular canine. Maxillary canine transmigration is even rarer. Transmigrated canines are particularly significant due to the aesthetic and functional importance. A maxillary lateral incisor crossing the mid-palatal suture has never been reported in the literature. The aim of this report is to present the first case of simultaneous transmigration of a lateral incisor and canine in the maxilla. The paper also reports four unusual cases of unilateral canine transmigration in the maxilla and mandible and successful eruption of one of the transmigrated mandibular canines following orthodontic traction. Etiology of transmigration and its clinical considerations are also discussed.

  15. Sinking Brain: Unusual Cause of Orthostatic Headache

    Directory of Open Access Journals (Sweden)

    Raina R

    2015-04-01

    Full Text Available We report a case presenting with an orthostatic headache. Brain magnetic resonance imaging (MRI revealed typical pachymeningeal enhancement. CT myelography revealed leakage at the thoracic level. Patient was successfully treated by lumbar epidural blood patch (EBP.

  16. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  17. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    Science.gov (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  18. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  19. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  20. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  1. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  2. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  3. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  4. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  6. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  7. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  8. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  9. Unusual dengue virus 3 epidemic in Nicaragua, 2009.

    Directory of Open Access Journals (Sweden)

    Gamaliel Gutierrez

    2011-11-01

    Full Text Available The four dengue virus serotypes (DENV1-4 cause the most prevalent mosquito-borne viral disease affecting humans worldwide. In 2009, Nicaragua experienced the largest dengue epidemic in over a decade, marked by unusual clinical presentation, as observed in two prospective studies of pediatric dengue in Managua. From August 2009-January 2010, 212 dengue cases were confirmed among 396 study participants at the National Pediatric Reference Hospital. In our parallel community-based cohort study, 170 dengue cases were recorded in 2009-10, compared to 13-65 cases in 2004-9. In both studies, significantly more patients experienced "compensated shock" (poor capillary refill plus cold extremities, tachycardia, tachypnea, and/or weak pulse in 2009-10 than in previous years (42.5% [90/212] vs. 24.7% [82/332] in the hospital study (p<0.001 and 17% [29/170] vs. 2.2% [4/181] in the cohort study (p<0.001. Signs of poor peripheral perfusion presented significantly earlier (1-2 days in 2009-10 than in previous years according to Kaplan-Meier survival analysis. In the hospital study, 19.8% of subjects were transferred to intensive care, compared to 7.1% in previous years - similar to the cohort study. DENV-3 predominated in 2008-9, 2009-10, and 2010-11, and full-length sequencing revealed no major genetic changes from 2008-9 to 2010-11. In 2008-9 and 2010-11, typical dengue was observed; only in 2009-10 was unusual presentation noted. Multivariate analysis revealed only "2009-10" as a significant risk factor for Dengue Fever with Compensated Shock. Interestingly, circulation of pandemic influenza A-H1N1 2009 in Managua was shifted such that it overlapped with the dengue epidemic. We hypothesize that prior influenza A H1N1 2009 infection may have modulated subsequent DENV infection, and initial results of an ongoing study suggest increased risk of shock among children with anti-H1N1-2009 antibodies. This study demonstrates that parameters other than serotype, viral

  10. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  11. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  13. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  14. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  15. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  16. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  17. An unusual oral habit presenting as Dentin Hypersensitivity | Afolabi ...

    African Journals Online (AJOL)

    We present the case of a 30-year-old man with an unusual oral habit- office pin chewing and filing of the front tooth which resulted in dentine hypersensitivity. Clinical relevance: The role of daily oral habits and techniques of cessation were suggested in the management of dentine hypersensitivity. Keywords: Unusual oral ...

  18. Unusual radiological characteristics of teratoid/rhabdoid brain tumor ...

    African Journals Online (AJOL)

    We report a case of atypical teratoid rhabdoid brain tumor for 4 months old male child, who presented with unusual radiological findings, that can be confused with other brain tumors ,so we high light these unusual imaging features to aid in making correct diagnosis. Keywords: atypical teratoid–rhabdoid tumor, brain tumor, ...

  19. An unusual recurrence of pruritic creeping eruption after treatment

    African Journals Online (AJOL)

    abp

    2015-08-13

    Aug 13, 2015 ... However, an unusual recurrence of the disease in a Ghanaian male after standard treatment was observed ... dog or cat hookworm is not an unusual disease. However ... mistaken for fungal infections or inflammatory skin disorders. Indeed .... drug include dizziness, nausea, vomiting and intestinal cramps.

  20. 48 CFR 2832.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Unusual contract financing... Contracting Requirements CONTRACT FINANCING Non-Commercial Item Purchase Financing 2832.114 Unusual contract financing. The HCA, or designee at a level not lower than the BPC, is the official authorized to approve...

  1. 48 CFR 632.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing. 632.114 Section 632.114 Federal Acquisition Regulations System DEPARTMENT OF STATE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 632.114 Unusual contract financing. The...

  2. 48 CFR 2432.114 - Unusual contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Unusual contract financing... DEVELOPMENT GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 2432.114 Unusual contract financing. The Senior Procurement Executive is the agency head for the purpose of...

  3. Oat cell carcinoma of the esophagus: Unusual radiological appearances

    Energy Technology Data Exchange (ETDEWEB)

    Bedi, D.G.; Shaw, M.T.

    1986-08-01

    Primary oat cell carcinoma of the esophagus is a very rare tumour. The radiographic appearance of the three cases described in this paper are unusual because they resemble benign lesions such as leiomyoma, fibrous polyp and candidiasis. It would be interesting to investigate whether such an unusual appearance is common for this neoplasm.

  4. Oat cell carcinoma of the esophagus: Unusual radiological appearances

    International Nuclear Information System (INIS)

    Bedi, D.G.; Shaw, M.T.

    1986-01-01

    Primary oat cell carcinoma of the esophagus is a very rare tumour. The radiographic appearance of the three cases described in this paper are unusual because they resemble benign lesions such as leiomyoma, fibrous polyp and candidiasis. It would be interesting to investigate whether such an unusual appearance is common for this neoplasm. (orig.)

  5. Unusual tumour ablations: report of difficult and interesting cases

    OpenAIRE

    Mauri, Giovanni; Nicosia, Luca; Varano, Gianluca Maria; Shyn, Paul; Sartori, Sergio; Tombesi, Paola; Di Vece, Francesca; Orsi, Franco; Solbiati, Luigi

    2017-01-01

    Image-guided ablations are nowadays applied in the treatment of a wide group of diseases and in different organs and regions, and every day interventional radiologists have to face more difficult and unusual cases of tumour ablation. In the present case review, we report four difficult and unusual cases, reporting some tips and tricks for a successful image-guided treatment.

  6. 48 CFR 235.070 - Indemnification against unusually hazardous risks.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Indemnification against unusually hazardous risks. 235.070 Section 235.070 Federal Acquisition Regulations System DEFENSE... DEVELOPMENT CONTRACTING 235.070 Indemnification against unusually hazardous risks. ...

  7. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  8. Comparative analysis of chromosomal localization of ribosomal and telomeric DNA markers in three species of Pyrgomorphidae grasshoppers

    Directory of Open Access Journals (Sweden)

    Olesya G. Buleu

    2017-09-01

    Full Text Available The karyotypes of three species of Pyrgomorphidae grasshoppers were studied: Zonocerus elegans (Thunberg, 1815, Pyrgomorpha guentheri (Burr, 1899 and Atractomorpha lata (Mochulsky, 1866. Data on karyotypes of P. guentheri and Z. elegans are reported here for the first time. All species have karyotypes consisting of 19 acrocentric chromosomes in males and 20 acrocentric chromosomes in females (2n♂=19, NF=19; 2n♀=20, NF=20 and X0/XX sex determination system. A comparative analysis of the localization of C-heterochromatin, clusters of ribosomal DNA, and telomere repeats revealed inter-species diversity in these cytogenetic markers. These differences indicate that the karyotype divergence in the species studied is not associated with structural chromosome rearrangements, but with the evolution of repeated DNA sequences.

  9. Unusual occurrences in fast breeder test reactor

    International Nuclear Information System (INIS)

    Kapoor, R.P.; Srinivasan, G.; Ellappan, T.R.; Ramalingam, P.V.; Vasudevan, A.T.; Iyer, M.A.K.; Lee, S.M.; Bhoje, S.B.

    2000-01-01

    Fast Breeder Test Reactor (FBTR) is a 40 MWt/13.2 MWe sodium cooled mixed carbide fuelled reactor. Its main aim is to generate experience in the design, construction and operation of fast reactors including sodium systems and to serve as an irradiation facility for the development of fuel and structural materials for future fast reactors. It achieved first criticality in Oct 85 with Mark I core (70% PuC - 30% UC). Steam generator was put in service in Jan 93 and power was raised to 10.5 MWt in Dec 93. Turbine generator was synchronised to the grid in Jul 97. The indigenously developed mixed carbide fuel has achieved a burnup of 44,000 MW-d/t max at a linear heat rating of 320 W/cm max without any fuel clad failure. The commissioning and operation of sodium systems and components have been smooth and performance of major components, viz., sodium pumps, intermediate heat exchangers and once through sodium heated steam generators (SG) have been excellent. There have been three minor incidents of Na/NaK leaks during the past 14 years, which are described in the paper. There have been no incident of a tube leak in SG. However, three incidents of water leaks from water / steam headers have been detailed. The plant has encountered some unusual occurrences, which were critically analysed and remedial measures, in terms of system and procedural modifications, incorporated to prevent recurrence. This paper describes unusual occurrences of fuel handling incident of May 1987, main boiler feed pump seizure in Apr 1992, reactivity transients in Nov 1994 and Apr 1995, and malfunctioning of the core cover plate mechanism in Jul 1995. These incidents have resulted in long plant shutdowns. During the course of investigation, various theoretical and experimental studies were carried out for better understanding of the phenomena and several inspection techniques and tools were developed resulting in enriching the technology of sodium cooled reactors. FBTR has 36 neutronic and process

  10. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1979-01-01

    Mathematics Revealed focuses on the principles, processes, operations, and exercises in mathematics.The book first offers information on whole numbers, fractions, and decimals and percents. Discussions focus on measuring length, percent, decimals, numbers as products, addition and subtraction of fractions, mixed numbers and ratios, division of fractions, addition, subtraction, multiplication, and division. The text then examines positive and negative numbers and powers and computation. Topics include division and averages, multiplication, ratios, and measurements, scientific notation and estim

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  13. An unusual presentation of multiple cavitated lung metastases from colon carcinoma

    Directory of Open Access Journals (Sweden)

    Iannace Alessandro

    2011-05-01

    Full Text Available Abstract Background Consolidation with or without ground-glass opacity is the typical radiologic finding of lung metastases of adenocarcinoma from the gastrointestinal tract. Lung excavated metastases from gastrointestinal carcinoma are very rare. Case presentation The authors describe an unusual presentation of multiple cavitated lung metastases from colon adenocarcinoma and discuss the outcome of a patient. The absence both of symptoms and other disease localizations, the investigations related to different diagnostic hypotheses and the empirical treatments caused a delay in correct diagnosis. Only a transparietal biopsy revealed the neoplastic origin of nodules. Conclusions This report demonstrates that although lung excavated metastases are described in literature, initial failure to reach a diagnosis is common. We would like to alert clinicians and radiologists to the possibility of unusual atypical features of pulmonary metastases from colon adenocarcinoma.

  14. Imaging Findings of an Unusually Located Hydatid Cyst Presented as a Sacrococcygeal Mass

    International Nuclear Information System (INIS)

    Yilmaz, Guliz; Halil Akpinar, Suha

    2015-01-01

    Hydatid disease (HD) is a parasitic infection that is most commonly caused by the larval stage of Echinococcus granulosus. Unusual location for this disease can cause diagnostic and therapeutic problems. We herein report a case of sacrococcygeal HD at an unusual location in a 30-year-old woman. She was evaluated using computed tomography (CT) imaging and magnetic resonance imaging (MRI) after the demonstration of the lucent bone lesion on plain pelvic radiography. There was an expansile lytic mass without contrast enhancement suggesting a cystic mass in the sacrococcygeal region. Medical history revealed that she had undergone surgery for liver HD and the serological test results were diagnostic for HD. In light of this, no surgery was carried out for this cystic mass and she was followed with the diagnosis of sacrococcygeal HD

  15. Unusual inferior dislocation of shoulder: reduction by two-step maneuver: a case report

    Directory of Open Access Journals (Sweden)

    Patro Dilip K

    2009-11-01

    Full Text Available Abstract Dislocation of the shoulder is the commonest of all large joint dislocations. Inferior dislocation constitutes 0.5% of all shoulder dislocations. It characteristically presents with overhead abduction of the arm, the humerus being parallel to the spine of scapula. We present an unusual case of recurrent luxatio erecta in which the arm transformed later into an adducted position resembling the more common anterior shoulder dislocation. Such a case has not been described before in English literature. Closed reduction by the two-step maneuver was successful with a single attempt. MRI revealed posterior labral tear and a Hill-Sachs variant lesion on the superolateral aspect of humeral head. Immobilisation in a chest-arm bandage followed by physiotherapy yielded excellent results. The case is first of its kind; the unusual mechanism, unique radiological findings and alternate method of treatment are discussed.

  16. Unusual Case of Severe Lactic Acidosis in a Liver Transplant Patient

    Directory of Open Access Journals (Sweden)

    Shweta Yemul Golhar

    2017-01-01

    Full Text Available Lactic acidosis is a standard indicator for oxygen debt and some other very significant causes. We describe a case of liver transplant patient presenting with vague abdominal pain and lactic acidosis without any liver dysfunction/failure/ischemia/rejection or sepsis. The imaging studies showed vague bowel edema and normal hepatic perfusion. The patient continued to deteriorate with rising lactic acidosis when a repeat CT abdomen eventually showed signs of lymphomatosis peritonei. Biopsy revealed the unusual diagnosis of posttransplant lymphoproliferative disorder. Immediate discontinuation of immunosuppression and initiation of chemotherapy led to clinical improvement. Our intention of presenting this case is to increase awareness of posttransplant lymphoma and propose lactic acidosis as not only an indicator of liver dysfunction or rejection but also an aid for diagnosis of this unusual but fatal and potentially curable condition.

  17. Incidental discovery of an unusual right atrial membrane in an adult patient

    Directory of Open Access Journals (Sweden)

    Nasrin N Aldawoodi

    2012-01-01

    Full Text Available We describe presence of an unusual right atrial membrane in a 30-year old female with end stage renal disease, hypertension and peripheral vascular disease. The patient was scheduled for midline sternotomy and pericardiotomy and removal of a migrated vascular stent in the right pulmonary artery. An intraoperative transesophageal echocardiogram (TEE revealed an unusual membranous structure with fenestrations that stretched across the right atrium with attachments superiorly at the free wall and inferiorly at the inter-atrial septum. There was no evidence of flow obstruction across the tricuspid valve. Some of the considerations for the likely diagnosis of this structure were a prominent Eustachian valve, persistent Chiari network, aneurysmal inter-atrial septum, an inter-atrial septal cyst or Cor triatriatum dexter (CTD.

  18. Hypercalcemia in children: three cases report with unusual clinical presentations

    Directory of Open Access Journals (Sweden)

    Bruna Barros Garbim

    Full Text Available Abstract Hypercalcemia is a rare condition in childhood; the most common causes are primary hyperparathyroidism, malignancy, prolonged immobilisation, thyrotoxicosis, thiazide diuretic, supplements containing calcium, milk-alkali syndrome, vitamin D intoxication, infections and idiopathic. We present three cases of severe hypercalcemia of unusual causes in children. The first patient had high fever, poor general condition, weight loss and myalgia. Extensive preliminary investigation did not define the etiology, but a review of medical history revealed prolonged contact with pet bird and a positive serology for Chlamydia confirmed the diagnosis of psittacosis. The second patient had generalized lymphadenopathy and hepatosplenomegaly with fever a month ago. Paracoccidioides brasiliensis was identified in myelogram; the patient showed partial improvement with the use of co-trimoxazole, with subsequent emergence of multiple osteolytic lesions. A smear of gastric lavage was positive for Mycobacterium tuberculosis and the patient was treated with rifampicin, isoniazid, ethambutol and pyrazinamide, with improvement of clinical condition. The third patient was treated by hypercalciuria and idiopathic hypomagnesiuria with daily use of cholecalciferol; the patient had a two quilograms of weight loss in the past two months. No cause of hypercalcemia could be detected in laboratory workout. The capsules of cholecalciferol were analyzed and presented an amount of 832,000 IU of vitamin D per capsule. Acute hypercalcemia in childhood may be due to exogenous vitamin D intoxication, as well as infectious causes. The possible causal relationship between psittacosis and occurrence of hypercalcemia alert to the need for detailed investigation of the epidemiological antecedents.

  19. Large, cold, and unusual molecular cloud in Monoceros

    International Nuclear Information System (INIS)

    Maddalena, R.J.; Thaddeus, P.; and Columbia University)

    1985-01-01

    Observations of the J = 1 → 0 rotational transition of CO near the galactic plane in Monoceros (lroughly-equal216 0 ) reveal a molecular cloud with unusually low peak CO temperatures (T/sub R/ -1 ) typical of much warmer clouds. At the assumed distance of 3 kpc, the cloud is large (250 x 100 pc), has a mass of 7-11 x 10 5 M/sub sun/, and is well removed from the galactic midplane (130 pc). Except for a possible H II region, all the signs of star formation usually shown by clouds of comparable mass are missing. The cloud, unlike cloud complexes of similar size, is a single, continuous object that apparently has not been torn apart by star formation. Clouds with such properties are rare in the Galaxy; only one or two similar objects have been found. We discuss the possibility that the cloud is young and not yet forming stars but will evolve into a typical cloud complex once star formation begins

  20. SPIRITS: Uncovering Unusual Infrared Transients with Spitzer

    International Nuclear Information System (INIS)

    Kasliwal, Mansi M.; Jencson, Jacob E.; Tinyanont, Samaporn; Cao, Yi; Cook, David; Bally, John; Masci, Frank; Armus, Lee; Cody, Ann Marie; Bond, Howard E.; Contreras, Carlos; Dykhoff, Devin A.; Amodeo, Samuel; Carlon, Robert L.; Cass, Alexander C.; Corgan, David T.; Faella, Joseph; Boyer, Martha; Cantiello, Matteo; Fox, Ori D.

    2017-01-01

    We present an ongoing, five-year systematic search for extragalactic infrared transients, dubbed SPIRITS—SPitzer InfraRed Intensive Transients Survey. In the first year, using Spitzer /IRAC, we searched 190 nearby galaxies with cadence baselines of one month and six months. We discovered over 1958 variables and 43 transients. Here, we describe the survey design and highlight 14 unusual infrared transients with no optical counterparts to deep limits, which we refer to as SPRITEs (eSPecially Red Intermediate-luminosity Transient Events). SPRITEs are in the infrared luminosity gap between novae and supernovae, with [4.5] absolute magnitudes between −11 and −14 (Vega-mag) and [3.6]–[4.5] colors between 0.3 mag and 1.6 mag. The photometric evolution of SPRITEs is diverse, ranging from <0.1 mag yr −1 to >7 mag yr −1 . SPRITEs occur in star-forming galaxies. We present an in-depth study of one of them, SPIRITS 14ajc in Messier 83, which shows shock-excited molecular hydrogen emission. This shock may have been triggered by the dynamic decay of a non-hierarchical system of massive stars that led to either the formation of a binary or a protostellar merger.

  1. [Granulomatous sporotrichosis: report of two unusual cases].

    Science.gov (United States)

    Ramírez-Soto, Max; Lizárraga-Trujillo, José

    2013-10-01

    Sporotrichosis is a subcutaneous mycosis caused by Sporothrix complex, endemic in Abancay, Peru. Is acquired by traumatic inoculation with plant material. Common clinical presentations are lymphatic cutaneous and fixed cutaneous disease. We report 2 cases of fixed cutaneous sporotrichosis with granulomatous appearance. The first case was a patient of 65 years old with no risk factors and the second case was a 67 year old diabetic patient. Subjects underwent mycological culture with Sabouraud agar, with isolation of Sporothrix schenckii and clinical dignosis of fixed cutaneous sporotrichosis with granulomatous appearance. One patient received oral treatment with saturated solution of potassium iodide (SSKI) with a initial dose of 3 drops tid up to a maximum dose of 40 drops tid. Mycological and clinical cure was achieved after 2 months of treatment. We should consider the unusual clinical presentations of fixed cutaneous sporotrichosis with granulomatous appearance that present morphological and clinical features in diabetic and nondiabetic patients older than 60 years from endemic areas and communicate adequate response to treatment with SSKI in one case.

  2. Unusual radiographic changes of a gout patient

    International Nuclear Information System (INIS)

    Markota, J.

    2004-01-01

    Background. Gout is a metabolic disorder that results in hyperuricemia and accumulation of uric acid crystals (urats) in tissues, especially joint cartilage. The gouty arthritis presents as acute attacks of arthritis leading eventually to chronic gouty arthritis. In 80% of cases it first occurs in the matatarsophalangeal (MTP) joint of the great toe and is more frequent in male population. Case report. We present a case of unusual radiographic changes accompanying gouty arthritis. A 63 year old female complained about swelling of the first MTP joint on the right, right knee, about stiffness of feet and hands' digits and about backache. First symptoms started to appear 30 years ago. In the time of examination radiographs displayed degenerative changes of the majority of presented joints, bilateral sacroiliitis and osseous ankylosis of both insteps. Microscopic examination showed urate crystals in the samples of the synovial fluid aspirated from the knee. The histological findings of the synovial tissue after the synovectomy were also in favour of gouty arthritis. Conclusions. Radiographs are the most important imaging modality in the diagnostic process of gout. However, radiographic differential diagnosis can be difficult, since the findings overlap with other conditions which cause arthritis and osteoarthritis especially in longstanding gout, elderly patients and females. The diagnosis must be often confirmed with the help of laboratory and histological findings. (author)

  3. Lichen amyloidosis in an unusual location.

    Science.gov (United States)

    Jhingan, A; Lee, J S S; Kumarasinghe, S P W

    2007-06-01

    We report lichen amyloidosis occurring on the upper lip and nasolabial folds of a 61-year-old woman from Singapore. She had a past history of systemic lupus erythematosus, which was in remission for three years. There had been no lesions of lupus erythematosus in this area. Clinically, the lesions were skin-coloured, firm papules and our differential diagnoses included trichoepithelioma, papular sarcoid or lupus miliaris disseminatus faciei. Skin biopsy from one of the lesions showed amyloid deposits in the dermis which were Congo red stain positive. These deposits also showed apple green birefringence. Immunohistochemical staining of the amyloid deposits stained positive for cytokeratins (CK) 5 and 6, and negative for CK 14. The kappa and lambda stains were equivocal. Further investigations, including multiple myeloma screen and rectal biopsy, ruled out systemic amyloidosis. There was no other evidence of cutaneous amyloidosis on her limbs or trunk. She refused treatment for her lesions. This case highlights the commonly-seen form of primary localised cutaneous amyloidosis in an unusual location.

  4. SPIRITS: Uncovering Unusual Infrared Transients with Spitzer

    Energy Technology Data Exchange (ETDEWEB)

    Kasliwal, Mansi M.; Jencson, Jacob E.; Tinyanont, Samaporn; Cao, Yi; Cook, David [Division of Physics, Mathematics and Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Bally, John [Center for Astrophysics and Space Astronomy, University of Colorado, 389 UCB, Boulder, CO 80309 (United States); Masci, Frank; Armus, Lee [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Cody, Ann Marie [NASA Ames Research Center, Moffett Field, CA 94035 (United States); Bond, Howard E. [Dept. of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Contreras, Carlos [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Dykhoff, Devin A.; Amodeo, Samuel; Carlon, Robert L.; Cass, Alexander C.; Corgan, David T.; Faella, Joseph [Minnesota Institute for Astrophysics, School of Physics and Astronomy, 116 Church Street, S. E., University of Minnesota, Minneapolis, MN 55455 (United States); Boyer, Martha [NASA Goddard Space Flight Center, MC 665, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Cantiello, Matteo [Center for Computational Astrophysics, Flatiron Institute, 162 Fifth Avenue, New York, NY 10010 (United States); Fox, Ori D. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); and others

    2017-04-20

    We present an ongoing, five-year systematic search for extragalactic infrared transients, dubbed SPIRITS—SPitzer InfraRed Intensive Transients Survey. In the first year, using Spitzer /IRAC, we searched 190 nearby galaxies with cadence baselines of one month and six months. We discovered over 1958 variables and 43 transients. Here, we describe the survey design and highlight 14 unusual infrared transients with no optical counterparts to deep limits, which we refer to as SPRITEs (eSPecially Red Intermediate-luminosity Transient Events). SPRITEs are in the infrared luminosity gap between novae and supernovae, with [4.5] absolute magnitudes between −11 and −14 (Vega-mag) and [3.6]–[4.5] colors between 0.3 mag and 1.6 mag. The photometric evolution of SPRITEs is diverse, ranging from <0.1 mag yr{sup −1} to >7 mag yr{sup −1}. SPRITEs occur in star-forming galaxies. We present an in-depth study of one of them, SPIRITS 14ajc in Messier 83, which shows shock-excited molecular hydrogen emission. This shock may have been triggered by the dynamic decay of a non-hierarchical system of massive stars that led to either the formation of a binary or a protostellar merger.

  5. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  6. Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

    Science.gov (United States)

    Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

    2007-01-01

    Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

  7. Unusual magnetoresistance in cubic B20 Fe0.85Co0.15Si chiral magnets

    International Nuclear Information System (INIS)

    Huang, S X; Chen, Fei; Zang, Jiadong; Chien, C L; Kang, Jian; Shu, G J; Chou, F C

    2016-01-01

    The B20 chiral magnets with broken inversion symmetry and C 4 rotation symmetry have attracted much attention. The broken inversion symmetry leads to the Dzyaloshinskii–Moriya that gives rise to the helical and Skyrmion states. We report the unusual magnetoresistance (MR) of B20 chiral magnet Fe 0.85 Co 0.15 Si that directly reveals the broken C 4 rotation symmetry and shows the anisotropic scattering by Skyrmions with respect to the current directions. The intimacy between unusual MR and broken symmetry is well confirmed by theoretically studying an effective Hamiltonian with spin–orbit coupling. The unusual MR serves as a transport signature for the Skyrmion phase. (paper)

  8. The testis: the unusual, the rare and the bizarre

    International Nuclear Information System (INIS)

    Stewart, V.R.; Sidhu, P.S.

    2007-01-01

    Ultrasound is the preferred technique when imaging the scrotal contents. Although appearances of many of the more common abnormalities present the examiner with no diagnostic difficulty, the more unusual conditions may present a considerable challenge. Many normal variants, unusual and rare abnormalities may be instantly recognized once seen. The current review highlights the more unusual and rare conditions affecting the scrotal contents in order to allow the reader the opportunity to gain knowledge of their existence and to aid future interpretation of the difficult examination

  9. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  10. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  11. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  12. The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication.

    Science.gov (United States)

    Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier

    2017-02-28

    Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting

  13. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  14. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  15. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  16. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  17. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  18. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  19. UNUSUAL MANIFESTATION OF NEUROBORELIOSIS (CASE REPORT).

    Science.gov (United States)

    Beridze, M; Khizanishvili, N; Mdivani, M; Samushia, O; Gogokhia, N

    2017-03-01

    The paper reported the verified case of neuroboreliosis with unusual clinical presentation of Parkinsonism. Study aimed at establishing the significance of a precise differential diagnosis with substantial analysis of the symptoms of several diseases to avoid the false diagnosis and to conduct the opportune and adequate therapeutic management. We described the case of the diagnosed neuroboreliosis with clinical expression of Multiple Sclerosis (MS) and Parkinsonism. A 44 years old man was diagnosed as MS according to the McDonald's Criteria, who within two years developed typical clinical signs of Parkinsonism. Patient investigated neurologically, Brain contrast MRI (1.5 Tesla) was performed; Cerebrospinal fluid was researched for oligoclonal bands. Blood IgM and IgG were researched against Chlamidia pneumonie, Micoplasma pneumonie, Borrelia Burgdorferi, Herpes simplex 1/2, Cytomegalovirus by ELISA method. Clinically the patient expressed amimic face, oligobradikinesia, extrapiramidal rigidity in all limbs, resting tremor in upper limb fingers, horizontal nystagmus. Brain MRI showed multiple gadolinium enhanced demyelization lesions in periventricular and sub-cortical white matter. CSF oligoclonal bands were positive without dysfunction of blood-brain barrier. Blood IgM, IgG detected to be negative against Chlamidia pneumonie, Micoplasma pneumonie, cytomegalovirus, Herpes simplex ½, while the blood IgG was strongly positive against Borrelia burgdorferi, confirmed by followed Western blot test. Patient was stabilized by puls-therapy with 1 gr/intravenous Solumedrol (5 days) along with Rocephin treatment (2 gr /iv) for 21 days followed by long term treatment with Antiparkin (Carbidopa 250 mg, Levodopa 25 mg). MS and even Parkinsonism in suspicious cases should thoroughly be investigated for differentiation from chronic Neuroboreliosis.

  20. An unusual case of refractory wheeze

    OpenAIRE

    Ramesh, Venkat; Acharya, Vishak; Pai, Narasimha; Krishnan, Ananda

    2015-01-01

    A 37-year-old man presented with a history of episodic wheeze and breathlessness of 3?years? duration refractory to treatment. Physical examination revealed diffuse expiratory polyphonic rhonchi while the remainder of the examination including the cardiac examination was reported as normal. Pulmonary function testing revealed mild obstruction with bronchodilator reversibility. The patient was discharged on a 6-month course of antitubercular treatment (ATT) as bronchial brush cytology (obtaine...