WorldWideScience

Sample records for rev response element

  1. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  2. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  3. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  4. A Guide to the Elements, Rev. Edition (by Albert Stwertka)

    Science.gov (United States)

    Berger, Reviewed By Daniel

    1999-12-01

    This edition is identical in format and content to the 1996 edition, now sold as the "library edition", except that the names and information for elements 104-109 have been updated. My earlier review still applies; a page-by-page comparison found this edition identical to the first except as noted in the previous sentence. The major revision has been in size and price. The 50% price reduction is welcome, but the format was not changed when the size was reduced, and the resulting 9-point font puts readers at risk of eyestrain. I would like to correct one of the criticisms in my earlier review There is excellent discussion of the industrial uses of each element, as well as its most common source minerals. The more economically important elements are given extensive discussions, detailing industrial uses of the element and its compounds. However, biological activity is given spotty coverage. There is no mention - under "iron" or elsewhere - of the central biological role of iron in oxygen transport or of magnesium in photosynthesis. When coverage appears it is not bad: the roles of calcium in vertebrate and invertebrate skeletons, of fluorine in reducing tooth decay by changing hydroxyapatite to fluorapatite, and of cobalt in vitamin B12 are discussed. While information on transuranium elements has been updated, there has been no attempt to correct several minor errors in spelling, placement, or even information. On page 14 the 1s subshell appears as part of the L (n = 2) shell, and upon the electrolysis of molten sodium chloride on page 54, "sodium collects atthe cathode, and chloride [sic] at...the anode." On page 73 the etymology of "potash" is still given as "potassium-rich ash" rather than "ash burned down in pots", though it is obvious that the latter is intended. On page 74, a picture caption claims that black powder ("potassium nitrate, wood charcoal, and sulfur") is used in modern, high-powered rifle cartridges. In spite of the mistakes, which are relatively

  5. Permeability computation on a REV with an immersed finite element method

    International Nuclear Information System (INIS)

    Laure, P.; Puaux, G.; Silva, L.; Vincent, M.

    2011-01-01

    An efficient method to compute permeability of fibrous media is presented. An immersed domain approach is used to represent the porous material at its microscopic scale and the flow motion is computed with a stabilized mixed finite element method. Therefore the Stokes equation is solved on the whole domain (including solid part) using a penalty method. The accuracy is controlled by refining the mesh around the solid-fluid interface defined by a level set function. Using homogenisation techniques, the permeability of a representative elementary volume (REV) is computed. The computed permeabilities of regular fibre packings are compared to classical analytical relations found in the bibliography.

  6. Innocuity and immune response to Brucella melitensis Rev.1 vaccine in camels (Camelus dromedarius

    Directory of Open Access Journals (Sweden)

    A. Benkirane

    2014-10-01

    Full Text Available A field trial was conducted in a camel brucellosis-free herd to evaluate antibody response to the Brucella melitensis Rev.1 vaccine in camels and assess shedding of the vaccine strain in milk. Twenty eight camels were divided into four groups according to their age and vaccination route. Groups A (n=3 and B (n=3 consisted of non-pregnant lactating female camels, vaccinated through subcutaneous and conjunctival routes, respectively. Groups C (n=10 consisted of 8-11 months old calves vaccinated through conjunctival route. The rest of the herd (n=12 composed of female and young camels were not vaccinated and were considered as the control group. Each animal from groups A, B and C was given the recommended dose of 2 x 109 colony forming units of Rev.1 vaccine irrespective of age or route of vaccination. Blood samples were collected from all the animals at the time of vaccination and at weekly, bi-weekly and monthly interval until 32 weeks post vaccination and from controls at weeks 8 and 24. The serological tests used were modified Rose Bengal Test, sero-agglutination test, and an indirect Enzyme Linked Immunosorbent Assay. Milk samples were collected from all vaccinated female camels and tested for the presence of Rev.1 vaccine strain. Most vaccinated animals started to show an antibody response at week 2 and remained positive until week 16. By week 20 post-vaccination all animals in the three groups were tested negative for Brucella antibodies. Bacteriological analysis of milk samples did not allow any isolation of Brucella melitensis. All samples were found Brucella negative in PCR analysis. The results of this study indicate that the Rev.1 vaccine induces seroconversion in camels. Rev.1 vaccine strain is not excreted in the milk of camels. These findings are promising as to the safe use of the Rev.1 vaccine in camels.

  7. Specificity of RSG-1.2 peptide binding to RRE-IIB RNA element of HIV-1 over Rev peptide is mainly enthalpic in origin.

    Science.gov (United States)

    Kumar, Santosh; Bose, Debojit; Suryawanshi, Hemant; Sabharwal, Harshana; Mapa, Koyeli; Maiti, Souvik

    2011-01-01

    Rev is an essential HIV-1 regulatory protein which binds to the Rev responsive element (RRE) present within the env gene of HIV-1 RNA genome. This binding facilitates the transport of the RNA to the cytoplasm, which in turn triggers the switch between viral latency and active viral replication. Essential components of this complex have been localized to a minimal arginine rich Rev peptide and stem IIB region of RRE. A synthetic peptide known as RSG-1.2 binds with high binding affinity and specificity to the RRE-IIB than the Rev peptide, however the thermodynamic basis of this specificity has not yet been addressed. The present study aims to probe the thermodynamic origin of this specificity of RSG-1.2 over Rev Peptide for RRE-IIB. The temperature dependent melting studies show that RSG-1.2 binding stabilizes the RRE structure significantly (ΔT(m) = 4.3°C), in contrast to Rev binding. Interestingly the thermodynamic signatures of the binding have also been found to be different for both the peptides. At pH 7.5, RSG-1.2 binds RRE-IIB with a K(a) = 16.2±0.6×10(7) M(-1) where enthalpic change ΔH = -13.9±0.1 kcal/mol is the main driving force with limited unfavorable contribution from entropic change TΔS = -2.8±0.1 kcal/mol. A large part of ΔH may be due to specific stacking between U72 and Arg15. In contrast binding of Rev (K(a) = 3.1±0.4×10(7) M(-1)) is driven mainly by entropy (ΔH = 0 kcal/mol and TΔS = 10.2±0.2 kcal/mol) which arises from major conformational changes in the RNA upon binding.

  8. Sc, Y, La-Lu. Rare earth elements. Vol. A 6a. 8. rev. ed.

    International Nuclear Information System (INIS)

    Ditz, R.; Sarbas, B.; Schubert, P.; Toepper, W.

    1988-01-01

    The present volume 'Rare Earth Elements' A 6a describes origin, mode of occurrence, and behavior of Y and RE elements in the sedimentary and metamorphic cycles, and completes the series of volumes describing cosmo- and geochemistry of these elements. In the chapter 'Sedimentary Cycle', the behavior of Y and RE during the weathering process is first outlined under both marine and terrestrial conditions, including a short compilation for migration and precipitation in surficial weathering and oxidation zones. The main part of the chapter treats, in addition to the mode of occurrence, predominantly the distribution of Y and RE in the different types of sedimentary rocks in relation to genetic processes (comprising physical and/or spatial factors such as geological age of the deposition). A concluding part gives a description of mobilization, migration, and precipitation of Y and RE during the diagenetic transformation of sediments, especially in relation to the various types of ferromanganese concretions. In the chapter 'Metamorphic Cycle', the first, extensive part gives examples of mode of occurrence and behavior of Y and RE during both the contact-metamorphic and prograde and retrograde regional-metamorphic processes affecting sedimentary and igeneous source rocks. The second part briefly describes behaviour of Y and RE during ultrametamorphism of metamorphic rocks, and during metamorphic processes in connection with special types of geologic events (as, e.g., subduction of crustal material into the earth's mantle and impact of extraterrestrial material). (orig.) With 4 figs

  9. The HIV-1 Rev/RRE system is required for HIV-1 5' UTR cis elements to augment encapsidation of heterologous RNA into HIV-1 viral particles

    Directory of Open Access Journals (Sweden)

    Ma Hong

    2011-06-01

    Full Text Available Abstract Background The process of HIV-1 genomic RNA (gRNA encapsidation is governed by a number of viral encoded components, most notably the Gag protein and gRNA cis elements in the canonical packaging signal (ψ. Also implicated in encapsidation are cis determinants in the R, U5, and PBS (primer binding site from the 5' untranslated region (UTR. Although conventionally associated with nuclear export of HIV-1 RNA, there is a burgeoning role for the Rev/RRE in the encapsidation process. Pleiotropic effects exhibited by these cis and trans viral components may confound the ability to examine their independent, and combined, impact on encapsidation of RNA into HIV-1 viral particles in their innate viral context. We systematically reconstructed the HIV-1 packaging system in the context of a heterologous murine leukemia virus (MLV vector RNA to elucidate a mechanism in which the Rev/RRE system is central to achieving efficient and specific encapsidation into HIV-1 viral particles. Results We show for the first time that the Rev/RRE system can augment RNA encapsidation independent of all cis elements from the 5' UTR (R, U5, PBS, and ψ. Incorporation of all the 5' UTR cis elements did not enhance RNA encapsidation in the absence of the Rev/RRE system. In fact, we demonstrate that the Rev/RRE system is required for specific and efficient encapsidation commonly associated with the canonical packaging signal. The mechanism of Rev/RRE-mediated encapsidation is not a general phenomenon, since the combination of the Rev/RRE system and 5' UTR cis elements did not enhance encapsidation into MLV-derived viral particles. Lastly, we show that heterologous MLV RNAs conform to transduction properties commonly associated with HIV-1 viral particles, including in vivo transduction of non-dividing cells (i.e. mouse neurons; however, the cDNA forms are episomes predominantly in the 1-LTR circle form. Conclusions Premised on encapsidation of a heterologous RNA into

  10. The structural basis of gas-responsive transcription by the human nuclear hormone receptor REV-ERBbeta.

    Directory of Open Access Journals (Sweden)

    Keith I Pardee

    2009-02-01

    Full Text Available Heme is a ligand for the human nuclear receptors (NR REV-ERBalpha and REV-ERBbeta, which are transcriptional repressors that play important roles in circadian rhythm, lipid and glucose metabolism, and diseases such as diabetes, atherosclerosis, inflammation, and cancer. Here we show that transcription repression mediated by heme-bound REV-ERBs is reversed by the addition of nitric oxide (NO, and that the heme and NO effects are mediated by the C-terminal ligand-binding domain (LBD. A 1.9 A crystal structure of the REV-ERBbeta LBD, in complex with the oxidized Fe(III form of heme, shows that heme binds in a prototypical NR ligand-binding pocket, where the heme iron is coordinately bound by histidine 568 and cysteine 384. Under reducing conditions, spectroscopic studies of the heme-REV-ERBbeta complex reveal that the Fe(II form of the LBD transitions between penta-coordinated and hexa-coordinated structural states, neither of which possess the Cys384 bond observed in the oxidized state. In addition, the Fe(II LBD is also able to bind either NO or CO, revealing a total of at least six structural states of the protein. The binding of known co-repressors is shown to be highly dependent upon these various liganded states. REV-ERBs are thus highly dynamic receptors that are responsive not only to heme, but also to redox and gas. Taken together, these findings suggest new mechanisms for the systemic coordination of molecular clocks and metabolism. They also raise the possibility for gas-based therapies for the many disorders associated with REV-ERB biological functions.

  11. The Structural Basis of Gas-Responsive Transcription by the Human Nuclear Hormone Receptor REV-ERBβ

    Science.gov (United States)

    Pardee, Keith I; Xu, Xiaohui; Reinking, Jeff; Schuetz, Anja; Dong, Aiping; Liu, Suya; Zhang, Rongguang; Tiefenbach, Jens; Lajoie, Gilles; Plotnikov, Alexander N; Botchkarev, Alexey; Krause, Henry M; Edwards, Aled

    2009-01-01

    Heme is a ligand for the human nuclear receptors (NR) REV-ERBα and REV-ERBβ, which are transcriptional repressors that play important roles in circadian rhythm, lipid and glucose metabolism, and diseases such as diabetes, atherosclerosis, inflammation, and cancer. Here we show that transcription repression mediated by heme-bound REV-ERBs is reversed by the addition of nitric oxide (NO), and that the heme and NO effects are mediated by the C-terminal ligand-binding domain (LBD). A 1.9 Å crystal structure of the REV-ERBβ LBD, in complex with the oxidized Fe(III) form of heme, shows that heme binds in a prototypical NR ligand-binding pocket, where the heme iron is coordinately bound by histidine 568 and cysteine 384. Under reducing conditions, spectroscopic studies of the heme-REV-ERBβ complex reveal that the Fe(II) form of the LBD transitions between penta-coordinated and hexa-coordinated structural states, neither of which possess the Cys384 bond observed in the oxidized state. In addition, the Fe(II) LBD is also able to bind either NO or CO, revealing a total of at least six structural states of the protein. The binding of known co-repressors is shown to be highly dependent upon these various liganded states. REV-ERBs are thus highly dynamic receptors that are responsive not only to heme, but also to redox and gas. Taken together, these findings suggest new mechanisms for the systemic coordination of molecular clocks and metabolism. They also raise the possibility for gas-based therapies for the many disorders associated with REV-ERB biological functions. PMID:19243223

  12. The effects of cynodon dactylon on the immune response of NMRI-MICE after challenge with REV1

    Directory of Open Access Journals (Sweden)

    Behrooz Ilkhanizadeh

    2016-10-01

    Full Text Available Cynodon dactylon is used in Iranian traditional medicine as a healing agent for reducing the complications of diabetes mellitus. We proposed that Cynodon dactylon may perform its effects through moderating humoral and cellular immune responses. We aimed to determine the possible effects of hydroalcholic extract of Cynodon dactylonon humoral and cellular immune responses following the Rev1 challenge in the mouse model. 20 NMRI male mice were randomly grouped in two equal groups and immunized with Rev1[0.1 ml Rev1+0.9 PBS[. Mice in the treatment group orally received 400 mg/kg hydroalcoholic extract of Cynodon dactylon every day from the beginning of the study for 2 weeks. Blood samples were obtained from the animals 5 days after the last injection. Moreover, 48 hr before bleeding time, Rev1[0.1 ml Rev1+0.9 PBS[was injected into the left hind foot pad of mice. The levels of anti-Rev1 antibody and the specific cellular immune responses were measured by microhemagglutination test and footpad thickness, respectively. Moreover, susceptibility of macrophages respiratory burst and proliferation of immune cells were measured in order withNitroblue tetrazolium[NBT] and Microculture Tetrazolium Assay [MTT]. The concentrations of IL-1, TNFα, Il-6, and IL-10 in the serum were determined using commercially available ELISA kits. We found a significant increase in anti-Rev1 antibody levels and simultaneously a significant decrease in the level of cellular immunity[DTH] in the treatment group compared to the control group. Lymphocyte proliferation index in splenocytes was significantly increased in the treatment group. However, the level of respiratory burst in phagocytic population of splenocytes dramatically decreased in the treatment group compared to the control. A significant decrease in IL-6, TNF-α , IL-1 and increaseIl-10 serum levels were also seen in the treatment group. Cynodon dactylon extract could have an anti-inflammatory effect through

  13. A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev

    International Nuclear Information System (INIS)

    Fang Jianhua; Kubota, Satoshi; Yang Bin; Zhou Naiming; Zhang Hui; Godbout, Roseline; Pomerantz, Roger J.

    2004-01-01

    HIV-1 Rev escorts unspliced viral mRNAs out of the nucleus of infected cells, which allows formation of infectious HIV-1 virions. We have identified a putative DEAD box (Asp-Glu-Ala-Asp) RNA helicase, DDX1, as a cellular co-factor of Rev, through yeast and mammalian two-hybrid systems using the N-terminal motif of Rev as 'bait'. DDX1 is not a functional homolog of HIV-1 Rev, but down-regulation of DDX1 resulted in an alternative splicing pattern of Rev-responsive element (RRE)-containing mRNA, and attenuation of Gag p24 antigen production from HLfb rev(-) cells rescued by exogenous Rev. Co-transfection of a DDX1 expression vector with HIV-1 significantly increased viral production. DDX1 binding to Rev, as well as to the RRE, strongly suggest that DDX1 affects Rev function through the Rev-RRE axis. Moreover, down-regulation of DDX1 altered the steady state subcellular distribution of Rev, from nuclear/nucleolar to cytoplasmic dominance. These findings indicate that DDX1 is a critical cellular co-factor for Rev function, which maintains the proper subcellular distribution of this lentiviral regulatory protein. Therefore, alterations in DDX1-Rev interactions could induce HIV-1 persistence and targeting DDX1 may lead to rationally designed and novel anti-HIV-1 strategies and therapeutics

  14. Resposta imunitária à vacinação conjuntival com a estirpe Rev.1 de Brucella melitensis em ovinos e caprinos Serological response of sheep and goats to conjunctival Brucella melitensis Rev.1 vaccine

    Directory of Open Access Journals (Sweden)

    P. Poeta

    2003-04-01

    Full Text Available The live B. melitensis Rev.1 strain is considered the best vaccine available for the prophylaxis of brucellosis in small ruminants, especially when used at the standard dose by the conjunctival route. In the present study a 1´ 10(9 CFU dose for both sheep and goats conjunctivally vaccinated was tested to evaluate the duration of serological responses. Conjunctival vaccination with Rev. 1 performed in adult animals induced a rapid rise in serological titres as measured by Rose Bengal Plate Test (RBPT, Complement Fixation Test (CF and Modified Rose Bengal Plate Test (MRBPT. Titres then decreased and became negative in most animals by four months after vaccination (except MRBPT. The goats responded better to the vaccination than the sheep as one month after vaccination 100% of the goats revealed positive results to RB and RBM and 93.4% to FC test. The RBM was the one that detected more positive animals along the study.

  15. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  16. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  17. IMMUNE RESPONSES OF GOATS (SHAMI BREED TO VACCINATION WITH A FULL, REDUCED AND CONJUNCTIVAL DOSE OF BRUCEVAC (BRUCELLA MELITENSIS REV.1 VACCINE

    Directory of Open Access Journals (Sweden)

    F. ALDOMY, M. ALKHAWALDEH1 AND I. B. YOUNIS

    2009-10-01

    Full Text Available Three groups of Shami goats were randomly vaccinated with Brucevac (Rev. 1 vaccine. Group 1 was vaccinated subcutaneously with a full dose (1.54 x 109 organisms. Group 2 was vaccinated conjunctively with one eye drop (5.2 x 108 organisms, while Group 3 was injected subcutaneously with a reduced dose (7.1 x 105 organisms of vaccine. Blood samples were collected before vaccination, two, four, eight, 15 and 24 weeks post vaccination. All samples were tested through CFT, ELISA, SAT and Rose Bengal plate test. All serological tests used detected a higher percentage of vaccinated female kids with a full dose than they did in other groups vaccinated with a reduced dose or with a conjunctival dose of Rev.1 vaccine. The overall results suggested that 100% of animals vaccinated with a conjunctival dose became positive to CFT at two, four, eight and 15 weeks post vaccination, and then the percentage of seropositive animals declined and became 20% at 24 weeks post inoculation. The conjunctival route of vaccination significantly reduced the intensity and duration of the post vaccination serological response, which makes the use of this vaccine compatible with brucellosis programmes, even when these are based on a test-and–slaughter policy. The overall results showed that Shami goats responded to Rev.1 vaccine in the expected way. The majority of animals were seropositive to the CFT by two weeks after vaccination with higher numbers of seropositive animals in the kids group vaccinated with a full dose of Rev.1 vaccine.

  18. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  19. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  20. Binding and thermodynamics of REV peptide-ctDNA interaction.

    Science.gov (United States)

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically

  1. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  2. Administrative Circulars Rev.

    CERN Multimedia

    2003-01-01

    Administrative Circular N° 19 (Rev. 3) - April 2003 Subsistence indemnity - Other expenses necessarily incurred in the course of duty travelAdministrative Circular N° 25 (Rev. 2) - April 2003 Shift work - Special provisions for the Fire and Rescue Service - These circulars have been revised. Human Resources Division Tel. 74128Copies of these circulars are available in the Divisional Secretariats. In addition, administrative and operational circulars, as well as the lists of those in force, are available for consultation on the Web at: http://humanresources.web.cern.ch/humanresources/internal/admin_services/admincirc/listadmincirc.asp

  3. Sc, Y, La-Lu. Rare earth elements. Vol. A 6a. Y, La, and the lanthanoids. Geochemistry: Sedimentary cycle. Metamorphic cycle. 8. rev. ed

    Energy Technology Data Exchange (ETDEWEB)

    Ditz, R; Sarbas, B; Schubert, P; Toepper, W

    1988-01-01

    The present volume 'Rare Earth Elements' A 6a describes origin, mode of occurrence, and behavior of Y and RE elements in the sedimentary and metamorphic cycles, and completes the series of volumes describing cosmo- and geochemistry of these elements. In the chapter 'Sedimentary Cycle', the behavior of Y and RE during the weathering process is first outlined under both marine and terrestrial conditions, including a short compilation for migration and precipitation in surficial weathering and oxidation zones. The main part of the chapter treats, in addition to the mode of occurrence, predominantly the distribution of Y and RE in the different types of sedimentary rocks in relation to genetic processes (comprising physical and/or spatial factors such as geological age of the deposition). A concluding part gives a description of mobilization, migration, and precipitation of Y and RE during the diagenetic transformation of sediments, especially in relation to the various types of ferromanganese concretions. In the chapter 'Metamorphic Cycle', the first, extensive part gives examples of mode of occurrence and behavior of Y and RE during both the contact-metamorphic and prograde and retrograde regional-metamorphic processes affecting sedimentary and igeneous source rocks. The second part briefly describes behaviour of Y and RE during ultrametamorphism of metamorphic rocks, and during metamorphic processes in connection with special types of geologic events (as, e.g., subduction of crustal material into the earth's mantle and impact of extraterrestrial material). (orig.) With 4 figs.

  4. Persistence of attenuated HIV-1 rev alleles in an epidemiologically linked cohort of long-term survivors infected with nef-deleted virus

    Directory of Open Access Journals (Sweden)

    Wesselingh Steven L

    2007-07-01

    Full Text Available Abstract Background The Sydney blood bank cohort (SBBC of long-term survivors consists of multiple individuals infected with nef-deleted, attenuated strains of human immunodeficiency virus type 1 (HIV-1. Although the cohort members have experienced differing clinical courses and now comprise slow progressors (SP as well as long-term nonprogressors (LTNP, longitudinal analysis of nef/long-terminal repeat (LTR sequences demonstrated convergent nef/LTR sequence evolution in SBBC SP and LTNP. Thus, the in vivo pathogenicity of attenuated HIV-1 strains harboured by SBBC members is dictated by factors other than nef/LTR. Therefore, to determine whether defects in other viral genes contribute to attenuation of these HIV-1 strains, we characterized dominant HIV-1 rev alleles that persisted in 4 SBBC subjects; C18, C64, C98 and D36. Results The ability of Rev derived from D36 and C64 to bind the Rev responsive element (RRE in RNA binding assays was reduced by approximately 90% compared to Rev derived from HIV-1NL4-3, C18 or C98. D36 Rev also had a 50–60% reduction in ability to express Rev-dependent reporter constructs in mammalian cells. In contrast, C64 Rev had only marginally decreased Rev function despite attenuated RRE binding. In D36 and C64, attenuated RRE binding was associated with rare amino acid changes at 3 highly conserved residues; Gln to Pro at position 74 immediately N-terminal to the Rev activation domain, and Val to Leu and Ser to Pro at positions 104 and 106 at the Rev C-terminus, respectively. In D36, reduced Rev function was mapped to an unusual 13 amino acid extension at the Rev C-terminus. Conclusion These findings provide new genetic and mechanistic insights important for Rev function, and suggest that Rev function, not Rev/RRE binding may be rate limiting for HIV-1 replication. In addition, attenuated rev alleles may contribute to viral attenuation and long-term survival of HIV-1 infection in a subset of SBBC members.

  5. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  6. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  7. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  8. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  9. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  10. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  11. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  12. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  14. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  15. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  16. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  17. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  18. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  19. HIV-1 pre-mRNA commitment to Rev mediated export through PSF and Matrin 3

    International Nuclear Information System (INIS)

    Kula, Anna; Gharu, Lavina; Marcello, Alessandro

    2013-01-01

    Human immunodeficiency virus gene expression and replication are regulated at several levels. Incompletely spliced viral RNAs and full-length genomic RNA contain the RRE element and are bound by the viral trans-acting protein Rev to be transported out of the nucleus. Previously we found that the nuclear matrix protein MATR3 was a cofactor of Rev-mediated RNA export. Here we show that the pleiotropic protein PSF binds viral RNA and is associated with MATR3. PSF is involved in the maintenance of a pool of RNA available for Rev activity. However, while Rev and PSF bind the viral pre-mRNA at the site of viral transcription, MATR3 interacts at a subsequent step. We propose that PSF and MATR3 define a novel pathway for RRE-containing HIV-1 RNAs that is hijacked by the viral Rev protein.

  20. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  1. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  2. SSC-K code users manual (rev.1)

    International Nuclear Information System (INIS)

    Kwon, Y. M.; Lee, Y. B.; Chang, W. P.; Hahn, D.

    2002-01-01

    The Supper System Code of KAERI (SSC-K) is a best-estimate system code for analyzing a variety of off-normal or accidents in the heat transport system of a pool type LMR design. It is being developed at Korea Atomic Energy Research Institution (KAERI) on the basis of SSC-L, originally developed at BNL to analyze loop-type LMR transients. SSC-K can handle both designs of loop and pool type LMRs. SSC-K contains detailed mechanistic models of transient thermal, hydraulic, neutronic, and mechanical phenomena to describe the response of the reactor core, coolant, fuel elements, and structures to accident conditions. This report provides a revised User's Manual (rev.1) of the SSC-K computer code, focusing on phenomenological model descriptions for new thermal, hydraulic, neutronic, and mechanical modules. A comprehensive description of the models for pool-type reactor is given in Chapters 2 and 3; the steady-state plant characterization, prior to the initiation of transient is described in Chapter 2 and their transient counterparts are discussed in Chapter 3. Discussions on the intermediate heat exchanger (IHX) and the electromagnetic (EM) pump are described in Chapter 4 and 5, respectively. A model of passive safety decay heat removal system (PSDRS) is discussed in Chapter 6, and models for various reactivity feedback effects are discussed in Chapter 7. In Chapter 8, constitutive laws and correlations required to execute the SSC-K are described. New models developed for SSC-K rev.1 are two dimensional hot pool model in Chapter 9, and long term cooling model in Chapter 10. Finally, a brief description of MINET code adopted to simulate BOP is presented in Chapter 11. Based on test runs for typical LMFBR accident analyses, it was found that the present version of SSC-K would be used for the safety analysis of KALIMER. However, the further validation of SSC-K is required for real applications. It is noted that the user's manual of SSC-K will be revised later with the

  3. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  4. Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function

    Directory of Open Access Journals (Sweden)

    St-Laurent Georges

    2006-11-01

    Full Text Available Abstract Background The HIV Rev protein is known to facilitate export of incompletely spliced and unspliced viral transcripts to the cytoplasm, a necessary step in virus life cycle. The Rev-mediated nucleo-cytoplasmic transport of nascent viral transcripts, dependents on interaction of Rev with the RRE RNA structural element present in the target RNAs. The C-terminal variant of dsRNA-binding nuclear protein 90 (NF90ctv has been shown to markedly attenuate viral replication in stably transduced HIV-1 target cell line. Here we examined a mechanism of interference of viral life cycle involving Rev-NF90ctv interaction. Results Since Rev:RRE complex formations depend on protein:RNA and protein:protein interactions, we investigated whether the expression of NF90ctv might interfere with Rev-mediated export of RRE-containing transcripts. When HeLa cells expressed both NF90ctv and Rev protein, we observed that NF90ctv inhibited the Rev-mediated RNA transport. In particular, three regions of NF90ctv protein are involved in blocking Rev function. Moreover, interaction of NF90ctv with the RRE RNA resulted in the expression of a reporter protein coding sequences linked to the RRE structure. Moreover, Rev influenced the subcellular localization of NF90ctv, and this process is leptomycin B sensitive. Conclusion The dsRNA binding protein, NF90ctv competes with HIV Rev function at two levels, by competitive protein:protein interaction involving Rev binding to specific domains of NF90ctv, as well as by its binding to the RRE-RNA structure. Our results are consistent with a model of Rev-mediated HIV-1 RNA export that envisions Rev-multimerization, a process interrupted by NF90ctv.

  5. Optimized Chemical Probes for REV-ERBα

    OpenAIRE

    Trump, Ryan P.; Bresciani, Stefano; Cooper, Anthony W. J.; Tellam, James P.; Wojno, Justyna; Blaikley, John; Orband-Miller, Lisa A.; Kashatus, Jennifer A.; Dawson, Helen C.; Loudon, Andrew; Ray, David; Grant, Daniel; Farrow, Stuart N.; Willson, Timothy M.; Tomkinson, Nicholas C. O.

    2013-01-01

    REV-ERBα has emerged as an important target for regulation of circadian rhythm and its associated physiology. Herein, we report on the optimization of a series of REV-ERBα agonists based on GSK4112 (1) for potency, selectivity, and bioavailability. Potent REV-ERBα agonists 4, 10, 16, and 23 are detailed for their ability to suppress BMAL and IL-6 expression from human cells while also demonstrating excellent selectivity over LXRα. Amine 4 demonstrated in vivo bioavailability after either IV o...

  6. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  7. Caffeine Abolishes the Ultraviolet-Induced REV3 Translesion Replication Pathway in Mouse Cells

    Directory of Open Access Journals (Sweden)

    Kouichi Yamada

    2011-11-01

    Full Text Available When a replicative DNA polymerase stalls upon encountering a photoproduct on the template strand, it is relieved by other low-processivity polymerase(s, which insert nucleotide(s opposite the lesion. Using an alkaline sucrose density gradient sedimentation technique, we previously classified this process termed UV-induced translesion replication (UV-TLS into two types. In human cancer cells or xeroderma pigmentosum variant (XP-V cells, UV-TLS was inhibited by caffeine or proteasome inhibitors. However, in normal human cells, the process was insensitive to these reagents. Reportedly, in yeast or mammalian cells, REV3 protein (a catalytic subunit of DNA polymerase ζ is predominantly involved in the former type of TLS. Here, we studied UV-TLS in fibroblasts derived from the Rev3-knockout mouse embryo (Rev3KO-MEF. In the wild-type MEF, UV-TLS was slow (similar to that of human cancer cells or XP-V cells, and was abolished by caffeine or MG-262. In 2 cell lines of Rev3KO-MEF (Rev3−/− p53−/−, UV-TLS was not observed. In p53KO-MEF, which is a strict control for Rev3KO-MEF, the UV-TLS response was similar to that of the wild-type. Introduction of the Rev3 expression plasmid into Rev3KO-MEF restored the UV-TLS response in selected stable transformants. In some transformants, viability to UV was the same as that in the wild-type, and the death rate was increased by caffeine. Our findings indicate that REV3 is predominantly involved in UV-TLS in mouse cells, and that the REV3 translesion pathway is suppressed by caffeine or proteasome inhibitors.

  8. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  9. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  10. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  12. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  13. Epistatic participation of REV1 and REV3 in the formation of UV-induced frameshift mutations in cell cycle-arrested yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Heidenreich, Erich [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)]. E-mail: erich.heidenreich@meduniwien.ac.at; Eisler, Herfried [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria); Steinboeck, Ferdinand [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)

    2006-01-29

    Mutations arising in times of cell cycle arrest may provide a selective advantage for unicellular organisms adapting to environmental changes. For multicellular organisms, however, they may pose a serious threat, in that such mutations in somatic cells contribute to carcinogenesis and ageing. The budding yeast Saccharomyces cerevisiae presents a convenient model system for studying the incidence and the mechanisms of stationary-phase mutation in a eukaryotic organism. Having studied the emergence of frameshift mutants after several days of starvation-induced cell cycle arrest, we previously reported that all (potentially error-prone) translesion synthesis (TLS) enzymes identified in S. cerevisiae did not contribute to the basal level of spontaneous stationary-phase mutations. However, we observed that an increased frequency of stationary-phase frameshift mutations, brought about by a defective nucleotide excision repair (NER) pathway or by UV irradiation, was dependent on Rev3p, the catalytic subunit of the TLS polymerase zeta (Pol {zeta}). Employing the same two conditions, we now examined the effect of deletions of the genes coding for polymerase eta (Pol {eta}) (RAD30) and Rev1p (REV1). In a NER-deficient strain background, the increased incidence of stationary-phase mutations was only moderately influenced by a lack of Pol {eta} but completely reduced to wild type level by a knockout of the REV1 gene. UV-induced stationary-phase mutations were abundant in wild type and rad30{delta} strains, but substantially reduced in a rev1{delta} as well as a rev3{delta} strain. The similarity of the rev1{delta} and the rev3{delta} phenotype and an epistatic relationship evident from experiments with a double-deficient strain suggests a participation of Rev1p and Rev3p in the same mutagenic pathway. Based on these results, we propose that the response of cell cycle-arrested cells to an excess of exo- or endogenously induced DNA damage includes a novel replication

  14. Project Execution Plan, Rev. 3

    International Nuclear Information System (INIS)

    IT Corporation, Las Vegas

    2002-01-01

    This plan addresses project activities encompassed by the U.S. Department of Energy's (DOE's), National Nuclear Security Administration Nevada Operations Office, Environmental Restoration Division and conforms to the requirements contained in the Life-Cycle Asset Management, DOE Order 430.1A; The Joint Program Office Policy on Project Management in Support of DOE Order 430.1; Program and Project Management for the Acquisition of Capital Assets, DOE Order 413.3; the Project Execution and Engineering Management Planning Guide, GPG-FM-010; and other applicable Good Practice Guides; and the FY 2001 Integrated Planning, Accountability, and Budgeting System Policy Guidance. The plan also reflects the milestone philosophies of the Federal Facility Agreement and Consent Order, as agreed to by the State of Nevada, the DOE, and the U.S. Department of Defense; and traditional project management philosophies such as the development of life-cycle costs, schedules, and work scope; identification o f roles and responsibilities; and baseline management and controls

  15. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  16. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  17. Rev1 Recruits Ung to Switch Regions and Enhances dU Glycosylation for Immunoglobulin Class Switch DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hong Zan

    2012-11-01

    Full Text Available By diversifying the biological effector functions of antibodies, class switch DNA recombination (CSR plays a critical role in the maturation of the immune response. It is initiated by activation-induced cytidine deaminase (AID-mediated deoxycytosine deamination, yielding deoxyuridine (dU, and dU glycosylation by uracil DNA glycosylase (Ung in antibody switch (S region DNA. Here we showed that the translesion DNA synthesis polymerase Rev1 directly interacted with Ung and targeted in an AID-dependent and Ung-independent fashion the S regions undergoing CSR. Rev1−/− Ung+/+ B cells reduced Ung recruitment to S regions, DNA-dU glycosylation, and CSR. Together with an S region spectrum of mutations similar to that of Rev1+/+ Ung−/− B cells, this suggests that Rev1 operates in the same pathway as Ung, as emphasized by further decreased CSR in Rev1−/− Msh2−/− B cells. Rescue of CSR in Rev1−/− B cells by a catalytically inactive Rev1 mutant shows that the important role of Rev1 in CSR is mediated by Rev1’s scaffolding function, not its enzymatic function.

  18. Pharmacological Targeting the REV-ERBs in Sleep/Wake Regulation

    Science.gov (United States)

    Amador, Ariadna; Huitron-Resendiz, Salvador; Roberts, Amanda J.; Kamenecka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The circadian clock maintains appropriate timing for a wide range of behaviors and physiological processes. Circadian behaviors such as sleep and wakefulness are intrinsically dependent on the precise oscillation of the endogenous molecular machinery that regulates the circadian clock. The identical core clock machinery regulates myriad endocrine and metabolic functions providing a link between sleep and metabolic health. The REV-ERBs (REV-ERBα and REV-ERBβ) are nuclear receptors that are key regulators of the molecular clock and have been successfully targeted using small molecule ligands. Recent studies in mice suggest that REV-ERB-specific synthetic agonists modulate metabolic activity as well as alter sleep architecture, inducing wakefulness during the light period. Therefore, these small molecules represent unique tools to extensively study REV-ERB regulation of sleep and wakefulness. In these studies, our aim was to further investigate the therapeutic potential of targeting the REV-ERBs for regulation of sleep by characterizing efficacy, and optimal dosing time of the REV-ERB agonist SR9009 using electroencephalographic (EEG) recordings. Applying different experimental paradigms in mice, our studies establish that SR9009 does not lose efficacy when administered more than once a day, nor does tolerance develop when administered once a day over a three-day dosing regimen. Moreover, through use of a time response paradigm, we determined that although there is an optimal time for administration of SR9009 in terms of maximal efficacy, there is a 12-hour window in which SR9009 elicited a response. Our studies indicate that the REV-ERBs are potential therapeutic targets for treating sleep problems as those encountered as a consequence of shift work or jet lag. PMID:27603791

  19. Quicklook overview of model changes in Melcor 2.2: Rev 6342 to Rev 9496

    Energy Technology Data Exchange (ETDEWEB)

    Humphries, Larry L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-05-01

    MELCOR 2.2 is a significant official release of the MELCOR code with many new models and model improvements. This report provides the code user with a quick review and characterization of new models added, changes to existing models, the effect of code changes during this code development cycle (rev 6342 to rev 9496), a preview of validation results with this code version. More detailed information is found in the code Subversion logs as well as the User Guide and Reference Manuals.

  20. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  1. Rev-erbα and Rev-erbβ coordinately protect the circadian clock and normal metabolic function

    DEFF Research Database (Denmark)

    Bugge, Anne Skovsø; Feng, Dan; Everett, Logan J

    2012-01-01

    of binding sites across the genome, enriched near metabolic genes. Depletion of both Rev-erbs in liver synergistically derepresses several metabolic genes as well as genes that control the positive limb of the molecular clock. Moreover, deficiency of both Rev-erbs causes marked hepatic steatosis, in contrast......-autonomous clock as well as hepatic lipid metabolism. Mouse embryonic fibroblasts were rendered arrhythmic by depletion of both Rev-erbs. In mouse livers, Rev-erbβ mRNA and protein levels oscillate with a diurnal pattern similar to that of Rev-erbα, and both Rev-erbs are recruited to a remarkably similar set...

  2. Revised Safety Instruction 41 (IS41 REV.)

    CERN Multimedia

    SC Secretariat

    2005-01-01

    Please note that the Revised Safety Instruction No. 41 (IS41 REV.), entitled 'The use of plastic and other non-metallic materials at CERN with respect to fire safety and radiation resistance' is available on the web at the following url: https://edms.cern.ch/document/335806/LAST_RELEASED Paper copies can also be obtained from the SC Unit Secretariat, e-mail: sc.secretariat@cern.ch SC Secretariat

  3. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  4. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  5. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  6. Introducing RevPASH: The Free Webtool Application

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2014-10-01

    Full Text Available RevPASH (Revenue Per Available Seat Hour is an important measure that helps restaurant operators understand how efficiently each seat in a restaurant generates revenue. The RevPASH app is an easy-to-use web-tool that provides an operator with a quick way to input a few relevant numbers and calculate RevPASH.The application has the ability to compare RevPASH over different times, days, weeks, and months.

  7. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  8. The RNA helicase DDX1 is involved in restricted HIV-1 Rev function in human astrocytes

    International Nuclear Information System (INIS)

    Fang Jianhua; Acheampong, Edward; Dave, Rajnish; Wang Fengxiang; Mukhtar, Muhammad; Pomerantz, Roger J.

    2005-01-01

    cytoplasmic, as input of exogenous DDX1 significantly altered both Rev sub-cellular localization from cytoplasmic to nuclear predominance and concomitantly increased HIV-1 viral production in these human astrocytes. We conclude that altered DDX1 expression in human astrocytes is, at least in part, responsible for the unfavorable cellular microenvironment for Rev function in these CNS-based cells. Thus, these data suggest a molecular mechanism(s) for restricted replication in astrocytes as a potential low-level site of residual HIV-1 in vivo

  9. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  10. REV-ERBalpha participates in circadian SREBP signaling and bile acid homeostasis.

    Directory of Open Access Journals (Sweden)

    Gwendal Le Martelot

    2009-09-01

    Full Text Available In mammals, many aspects of behavior and physiology, and in particular cellular metabolism, are coordinated by the circadian timing system. Molecular clocks are thought to rely on negative feedback loops in clock gene expression that engender oscillations in the accumulation of transcriptional regulatory proteins, such as the orphan receptor REV-ERBalpha. Circadian transcription factors then drive daily rhythms in the expression of clock-controlled output genes, for example genes encoding enzymes and regulators of cellular metabolism. To gain insight into clock output functions of REV-ERBalpha, we carried out genome-wide transcriptome profiling experiments with liver RNA from wild-type mice, Rev-erbalpha knock-out mice, or REV-ERBalpha overexpressing mice. On the basis of these genetic loss- and gain-of-function experiments, we concluded that REV-ERBalpha participates in the circadian modulation of sterol regulatory element-binding protein (SREBP activity, and thereby in the daily expression of SREBP target genes involved in cholesterol and lipid metabolism. This control is exerted via the cyclic transcription of Insig2, encoding a trans-membrane protein that sequesters SREBP proteins to the endoplasmic reticulum membranes and thereby interferes with the proteolytic activation of SREBPs in Golgi membranes. REV-ERBalpha also participates in the cyclic expression of cholesterol-7alpha-hydroxylase (CYP7A1, the rate-limiting enzyme in converting cholesterol to bile acids. Our findings suggest that this control acts via the stimulation of LXR nuclear receptors by cyclically produced oxysterols. In conclusion, our study suggests that rhythmic cholesterol and bile acid metabolism is not just driven by alternating feeding-fasting cycles, but also by REV-ERBalpha, a component of the circadian clockwork circuitry.

  11. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  12. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  13. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  14. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  15. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  16. Rev 12 as a theology of history

    OpenAIRE

    Joanna Nowińska

    2009-01-01

    The Biblical writers notice history as the space of God’s rule. He is the director, who comes into contact with human being through signs – events and words, and also He is the history’s perpetuum mobile. Rev 12 specifically reflect nowadays and the previous in the context of the whole world’s vision and mix the reference to facts (lack of the temple, ark, faithful people, horrible experiences, the death danger), places (the temple, a desert), persons (the Child-Ruler, Michael) with the Old T...

  17. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  18. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  19. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  20. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  1. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  2. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  3. Rev 12 as a theology of history

    Directory of Open Access Journals (Sweden)

    Joanna Nowińska

    2009-12-01

    Full Text Available The Biblical writers notice history as the space of God’s rule. He is the director, who comes into contact with human being through signs – events and words, and also He is the history’s perpetuum mobile. Rev 12 specifically reflect nowadays and the previous in the context of the whole world’s vision and mix the reference to facts (lack of the temple, ark, faithful people, horrible experiences, the death danger, places (the temple, a desert, persons (the Child-Ruler, Michael with the Old Testament figurative exposing, a typical one for such a book (the Woman with Child, the heaven, the dragon, enriched with a lot of symbols (a crown, a horn, the moon under feet. God’s interference into World history is presented through lightning, voices, thunder, an earthquake and great hail, that stress His power and supremacy. The biblical writer refers to events, which make place whole the time in the natural- and supernatural space, like: the war between God and evil, persecutions, hiding, God’s care of men.  The specific literary structure of Rev 12, contrary to the other parts of that book, seem to help to put an accent for the fundamental truths for transcendental theology of history of which the most important is the eternal rule of God and only accidental, finished in the time perspective of Satan’s position.

  4. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  5. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  6. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  8. RevSex duplication-induced and sex-related differences in the SOX9 regulatory region chromatin landscape in human fibroblasts.

    Science.gov (United States)

    Lybæk, Helle; de Bruijn, Diederik; den Engelsman-van Dijk, Anke H A; Vanichkina, Darya; Nepal, Chirag; Brendehaug, Atle; Houge, Gunnar

    2014-03-01

    It was recently shown that duplications of the RevSex element, located 0.5 Mb upstream of SOX9, cause XX-disorder of sex development (DSD), and that deletions cause XY-DSD. To explore how a 148 kb RevSex duplication could have turned on gonadal SOX9 expression in the absence of SRY in an XX-male, we examined the chromatin landscape in primary skin fibroblast cultures from the index, his RevSex duplication-carrier father and six controls. The ENCODE project supports the notion that chromatin state maps show overlap between different cell types, i.e., that our study of fibroblasts could be of biological relevance. We examined the SOX9 regulatory region by high-resolution ChIP-on-chip experiments (a kind of "chromatin-CGH") and DNA methylation investigations. The RevSex duplication was associated with chromatin changes predicting better accessibility of the SRY-responsive TESCO enhancer region 14-15 kb upstream of SOX9. Four kb downstream of the TESCO evolutionary conserved region, a peak of the enhancer/promoter-associated H3K4me3 mark was found together with a major dip of the repressive H3K9me3 chromatin mark. Similar differences were also found when three control males were compared with three control females. A marked male/female difference was a more open chromatin signature in males starting ~400 kb upstream of SOX9 and increasing toward the SOX9 promoter. In the RevSex duplication-carrier father, two positions of DNA hypomethylation were also found, one corresponding to the H3K4me3 peak mentioned above. Our results suggest that the RevSex duplication could operate by inducing long-range epigenetic changes. Furthermore, the differences in chromatin state maps between males and females suggest that the Y chromosome or X chromosome dosage may affect chromatin conformation, i.e., that sex-dependent gene regulation may take place by chromatin modification.

  9. Suppression of atherosclerosis by synthetic REV-ERB agonist

    Energy Technology Data Exchange (ETDEWEB)

    Sitaula, Sadichha [Department of Molecular Therapeutics, The Scripps Research Institute, Jupiter, FL 33458 (United States); Billon, Cyrielle [Department of Pharmacological & Physiological Science, Saint Louis University School of Medicine, St. Louis, MO 63104 (United States); Kamenecka, Theodore M.; Solt, Laura A. [Department of Molecular Therapeutics, The Scripps Research Institute, Jupiter, FL 33458 (United States); Burris, Thomas P., E-mail: burristp@slu.edu [Department of Pharmacological & Physiological Science, Saint Louis University School of Medicine, St. Louis, MO 63104 (United States)

    2015-05-08

    The nuclear receptors for heme, REV-ERBα and REV-ERBβ, play important roles in the regulation of metabolism and inflammation. Recently it was demonstrated that reduced REV-ERBα expression in hematopoetic cells in LDL receptor null mice led to increased atherosclerosis. We sought to determine if synthetic REV-ERB agonists that we have developed might have the ability to suppress atherosclerosis in this model. A previously characterized synthetic REV-ERB agonist, SR9009, was used to determine if activation of REV-ERB activity would affect atherosclerosis in LDL receptor deficient mice. Atherosclerotic plaque size was significantly reduced (p < 0.05) in mice administered SR9009 (100 mg/kg) for seven weeks compared to control mice (n = 10 per group). SR9009 treatment of bone marrow-derived mouse macrophages (BMDM) reduced the polarization of BMDMs to proinflammatory M1 macrophage while increasing the polarization of BMDMs to anti-inflammatory M2 macrophages. Our results suggest that pharmacological targeting of REV-ERBs may be a viable therapeutic option for treatment of atherosclerosis. - Highlights: • Synthetic REV-ERB agonist treatment reduced atherosclerosis in a mouse model. • Pharmacological activation of REV-ERB decreased M1 macrophage polarization. • Pharmacological activation of REV-ERB increased M2 macrophage polarization.

  10. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  11. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  12. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  13. Investigations of migratory birds during operation of Horns Rev offshore wind farm. Annual status report 2004

    Energy Technology Data Exchange (ETDEWEB)

    Kjaer Christensen, T.; Hounisen, J.P. [NERI, Dept. of Wildlife Ecology and Biodiversity, Roskilde (Denmark)

    2005-07-01

    The aim of the project is to assess the collision risk between birds and wind turbines at the Horns Rev wind farm. The study focused on describing bird movements in relation to the wind farm and to identify the species-specific behavioural responses towards the wind turbines shown by migrating and staging bird species. The study was based on data from spring 2004. The Horns Rev area lies in a region known to be of importance for substantial water bird migration as well as holding internationally important numbers of several wintering and staging water bird species. (au)

  14. Investigations of migratory birds during operation of Horns Rev offshore wind farm. Annual status report 2004

    International Nuclear Information System (INIS)

    Kjaer Christensen, T.; Hounisen, J.P.

    2005-01-01

    The aim of the project is to assess the collision risk between birds and wind turbines at the Horns Rev wind farm. The study focused on describing bird movements in relation to the wind farm and to identify the species-specific behavioural responses towards the wind turbines shown by migrating and staging bird species. The study was based on data from spring 2004. The Horns Rev area lies in a region known to be of importance for substantial water bird migration as well as holding internationally important numbers of several wintering and staging water bird species. (au)

  15. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  16. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  17. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  18. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  19. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  20. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  2. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  3. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  4. Determining the REV for Fracture Rock Mass Based on Seepage Theory

    Directory of Open Access Journals (Sweden)

    Lili Zhang

    2017-01-01

    Full Text Available Seepage problems of the fractured rock mass have always been a heated topic within hydrogeology and engineering geology. The equivalent porous medium model method is the main method in the study of the seepage of the fractured rock mass and its engineering application. The key to the method is to determine a representative elementary volume (REV. The FractureToKarst software, that is, discrete element software, is a main analysis tool in this paper and developed by a number of authors. According to the standard of rock classification established by ISRM, this paper aims to discuss the existence and the size of REV of fractured rock masses with medium tractility and provide a general method to determine the existence of REV. It can be gleaned from the study that the existence condition of fractured rock mass with medium tractility features average fracture spacing smaller than 0.6 m. If average fracture spacing is larger than 0.6 m, there is no existence of REV. The rationality of the model is verified by a case study. The present research provides a method for the simulation of seepage field in fissured rocks.

  5. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  6. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  7. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  8. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  9. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  10. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  11. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  12. Administrative Circular No. 14 (Rev. 2)

    CERN Document Server

    HR Department

    2007-01-01

    The HR Department wishes to draw the attention of members of the personnel to a number of amendments to Administrative Circular No. 14 (Rev. 2) entitled "Protection of members of the personnel against the financial consequences of illness, accident and disability" which came into force on 1st July 2006 (cf. Weekly Bulletin of 14 and 21 August 2006). Occupational Accident Declaration Form (HS50) https://cern.ch/service-procedures/AdminMan/Forms/HS50E.doc •\tIt must be completed within 10 working days of the date on which the accident occurred (§ 29.2.1), unless the person concerned is materially unable to meet this deadline. • The completed formula must be accompanied by a medical certificate giving details of any bodily injuries resulting from the accident (Annex 1, § 5). The medical certificate must be obtained from the doctor who has been consulted for that purpose. Benefits resulting from illnesses and accidents Medical treatment will cease to be reimbursed under ...

  13. Study on the REV Size of Fractured Rock in the Non-Darcy Flow Based on the Dual-Porosity Model

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    2018-01-01

    Full Text Available For the problem of whether the representative elementary volume (REV obtained in the Darcy flow is also applicable to the case of the non-Darcy flow, the study on the REV size within the non-Darcy flow is proposed tentatively. The concept of the REV in the non-Darcy flow is based on the definition of the REV. According to the determination of the REV in the Darcy flow, the intrinsic permeability k and non-Darcy coefficient β are used simultaneously for the determination of the REV in the non-Darcy flow. The pore pressure cohesive element (PPCE is developed with the subroutine in ABAQUS. Then the simulation method of the Darcy and non-Darcy flow in the fractured rock mass is built using the PPCE. The proposed plan is examined through the comparison with existing research results. It is validated that this technic is efficient and accurate in simulating the Darcy and non-Darcy flow in the fractured rock mass. Combined with fracture networks generated by Monte Carlo Simulation technique, the PPCE is applied to the study on the REV size. Both conditions of the Darcy and non-Darcy flow are simulated for comparison. The simulation results of this model show that the REV of the non-Darcy flow is inconsistent with the REV of the Darcy flow, and the REV of the non-Darcy flow is more significant than the REV of the Darcy flow. The intrinsic permeability k tensors obtained in the Darcy flow and the non-Darcy flow are basically the same.

  14. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  15. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  16. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  17. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  18. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  19. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  20. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  2. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  3. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  4. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  5. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  6. Biallelic inactivation of REV7 is associated with Fanconi anemia.

    Science.gov (United States)

    Bluteau, Dominique; Masliah-Planchon, Julien; Clairmont, Connor; Rousseau, Alix; Ceccaldi, Raphael; Dubois d'Enghien, Catherine; Bluteau, Olivier; Cuccuini, Wendy; Gachet, Stéphanie; Peffault de Latour, Régis; Leblanc, Thierry; Socié, Gérard; Baruchel, André; Stoppa-Lyonnet, Dominique; D'Andrea, Alan D; Soulier, Jean

    2016-09-01

    Fanconi anemia (FA) is a recessive genetic disease characterized by congenital abnormalities, chromosome instability, progressive bone marrow failure (BMF), and a strong predisposition to cancer. Twenty FA genes have been identified, and the FANC proteins they encode cooperate in a common pathway that regulates DNA crosslink repair and replication fork stability. We identified a child with severe BMF who harbored biallelic inactivating mutations of the translesion DNA synthesis (TLS) gene REV7 (also known as MAD2L2), which encodes the mutant REV7 protein REV7-V85E. Patient-derived cells demonstrated an extended FA phenotype, which included increased chromosome breaks and G2/M accumulation upon exposure to DNA crosslinking agents, γH2AX and 53BP1 foci accumulation, and enhanced p53/p21 activation relative to cells derived from healthy patients. Expression of WT REV7 restored normal cellular and functional phenotypes in the patient's cells, and CRISPR/Cas9 inactivation of REV7 in a non-FA human cell line produced an FA phenotype. Finally, silencing Rev7 in primary hematopoietic cells impaired progenitor function, suggesting that the DNA repair defect underlies the development of BMF in FA. Taken together, our genetic and functional analyses identified REV7 as a previously undescribed FA gene, which we term FANCV.

  7. Hard bottom substrate monitoring Horns Rev offshore wind farm. Annual status report 2003

    Energy Technology Data Exchange (ETDEWEB)

    Leonhard, S.B.; Pedersen, John

    2004-05-15

    Elsam and Eltra built the offshore demonstration wind farm at Horns Rev in the North Sea. Elsam is the owner and is responsible for the operation of the wind farm. Eltra is responsible for the connection of the wind farm to the national onshore grid. In the summer months of 2002, Elsam constructed the world's largest offshore wind farm off the Danish west coast. The wind farm is sited 14-20 km into the North Sea, west of Blaevands Huk. The first wind turbine was erected in May 2002 and the last wind turbine tower of a total of 80 was in place by August 2002. The construction work was completed with the last connecting cables sluiced down in September 2002. All the wind turbines were in production by December 2002. The expected impact of the wind farm will primarily be an alternation of habitats due to the introduction of hard bottom substrates as wind turbine towers and scour protections. A continuous development in the epifouling communities will be expected together with an introduction of new or alien species in the area. The indigenous benthic community in the area of Horns Rev can be characterised by infauna species belonging to the Goniadella-Spisula community. This community is typical of sandbanks in the North Sea area, although communities in such areas are very variable and site-specific. Character species used as indicators for environmental changes in the Horns Rev area are the bristle worms Goniadella bobretzkii, Ophelia borealis, Psione remota and Orbinia sertulata and the mussels Goodallia triangularis and Spisula solida. In connection with the implementation of the monitoring programme concerning the ecological impact of the introduction of hard substrate related to the Horns Rev Wind Farm, surveys on hard bottom substrate was conducted in March 2003 and in September 2003. This report describes the first year results of surveys on hard substrate after the completion of the offshore wind farm at Horns Rev. (au)

  8. Analysis of translesion DNA synthesis activity of the human REV1-REV7 complex, which is a key player in radiation-induced mutagenesis

    International Nuclear Information System (INIS)

    Masuda, Y.; Masuda, K.; Kamiya, K.

    2003-01-01

    Full text: Ionizing radiation frequently causes oxidative DNA damage in cells. It has been suggested that functions of the REV1 and REV7 genes are induction of mutations and prevention of cell death caused by ionizing radiation. With yeast Saccharomyces cerevisiae, results from a variety of investigations have demonstrated that the REV genes play a major role in induction of mutations through replication processes which directly copy the damaged DNA template during DNA replication. However, in higher eucaryotes, functions of homologues are poorly understood and appear somewhat different from the yeast case. It has been suggested that human REV1 interacts with human REV7, this being specific to higher eucaryotes. Here we show that purified human REV1 and REV7 proteins form a heterodimer in solution, which is stable through intensive purification steps. Results from biochemical analysis of the transferase reactions of the REV1-REV7 complex demonstrated, in contrast to the case of yeast Rev3 whose polymerase activity is stimulated by assembly with yeast Rev7, that human REV7 did not influence the stability, substrate specificity or kinetic parameters of the transferase reactions of REV1 protein. A possible molecular role of the REV7 subunit may be to help assembly of the REV1 protein to a large complex containing REV3 and/or other DNA polymerases in higher eucaryotes

  9. Analysis of the influence of subcellular localization of the HIV Rev protein on Rev-dependent gene expression by multi-fluorescence live-cell imaging

    International Nuclear Information System (INIS)

    Wolff, Horst; Hadian, Kamyar; Ziegler, Manja; Weierich, Claudia; Kramer-Hammerle, Susanne; Kleinschmidt, Andrea; Erfle, Volker; Brack-Werner, Ruth

    2006-01-01

    The human immunodeficiency virus Rev protein is a post-transcriptional activator of HIV gene expression. Rev is a nucleocytoplasmic shuttle protein that displays characteristic nuclear/nucleolar subcellular localization in various cell lines. Cytoplasmic localization of Rev occurs under various conditions disrupting Rev function. The goal of this study was to investigate the relationship between localization of Rev and its functional activity in living cells. A triple-fluorescent imaging assay, called AQ-FIND, was established for automatic quantitative evaluation of nucleocytoplasmic distribution of fluorescently tagged proteins. This assay was used to screen 500 rev genes generated by error-prone PCR for Rev mutants with different localization phenotypes. Activities of the Rev mutants were determined with a second quantitative, dual-fluorescent reporter assay. In HeLa cells, the majority of nuclear Rev mutants had activities similar to wild-type Rev. The activities of Rev mutants with abnormal cytoplasmic localization ranged from moderately impaired to nonfunctional. There was no linear correlation between subcellular distribution and levels of Rev activity. In astrocytes, nuclear Rev mutants showed similar impaired activities as the cytoplasmic wild-type Rev. Our data suggest that steady-state subcellular localization is not a primary regulator of Rev activity but may change as a secondary consequence of altered Rev function. The methodologies described here have potential for studying the significance of subcellular localization for functions of other regulatory factors

  10. Wave power plant at Horns Rev. Screening[Denmark]; Boelgekraftanlaeg ved Horns Rev. Screening

    Energy Technology Data Exchange (ETDEWEB)

    Soerensen, Hans C.; Nielsen, Kim; Steenstrup, P.R.; Friis-Madsen, E.; Wigant, L.

    2005-12-15

    The objective for the analysis has been to establish data for the sea at Horns Rev wind farm in the North Sea in order to assess the opportunity for using the site as test site for demonstration of wave energy devices exemplified by three different devices under development in Denmark. For comparison alternative sites like Hanstholm, Samsoe and Nissum Bredning are also assessed as well as the test centre EMEC at the Orkney Islands and the proposed test site Wave Hub at the north coast of Cornwall. The analysis shows that it is possible without major technical problems to connect 2-4 MW power generated by 3 different wave energy devices (AquaBuOY, Wave Star Energy and Wave Dragon) to the wind farm at Horns Rev (www.hornsrev.dk). The expenses for connection and regulation within the wind farm is about 200,000 DKK (30,00 EURO). On top of this comes the cost for individual sub sea cable connection to the wave devices, pull in of the sub sea cable through the existing J-tube in turbine T04 and the necessary regulation/control system in the individual wave devices to avoid damaging the power system in case of too high production. The analysis of the co-production of wind and wave power is dealt with in a separate report which shows that over a time period of half to one hour the time variation for wind generated electricity is 3 times as large as for wave energy generated power based on the actual measurement at Horns Rev. Further on the analysis shows that the wave generated power is more predictable than wind energy generated power as the power from the waves first is present about 2 hours after the wind is acting and last for 3 to 6 hours after the wind dies out; 6 to 12 hours with wind from west. The time is off course strongly depending of the direction of the wind i.e. the fetch. As this special report has a more general scope than the analysis as such it is reported in English (Annex Report II). The analysis shows that it is up to the individual device developer

  11. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  12. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  13. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  14. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  15. Administrative Circular N° 26 (Rev.  5) - November 2004

    CERN Multimedia

    Human Resources Department

    2004-01-01

    Procedure governing the career evolution of staff members The introduction of an electronic individual appraisal report form via EDH for the MAPS exercise entails some modifications to Administrative Circular N° 26 (Rev. 4). The revised version (Rev. 5) is available in departmental secretariats as well as on the Web at the following address: http://cern.ch/hr-web/internal/admin_services/admincirc/listadmincirc.asp Human Resources Department Tel. 74128

  16. Altered Sleep Homeostasis in Rev-erbα Knockout Mice.

    Science.gov (United States)

    Mang, Géraldine M; La Spada, Francesco; Emmenegger, Yann; Chappuis, Sylvie; Ripperger, Jürgen A; Albrecht, Urs; Franken, Paul

    2016-03-01

    The nuclear receptor REV-ERBα is a potent, constitutive transcriptional repressor critical for the regulation of key circadian and metabolic genes. Recently, REV-ERBα's involvement in learning, neurogenesis, mood, and dopamine turnover was demonstrated suggesting a specific role in central nervous system functioning. We have previously shown that the brain expression of several core clock genes, including Rev-erbα, is modulated by sleep loss. We here test the consequences of a loss of REV-ERBα on the homeostatic regulation of sleep. EEG/EMG signals were recorded in Rev-erbα knockout (KO) mice and their wild type (WT) littermates during baseline, sleep deprivation, and recovery. Cortical gene expression measurements after sleep deprivation were contrasted to baseline. Although baseline sleep/wake duration was remarkably similar, KO mice showed an advance of the sleep/wake distribution relative to the light-dark cycle. After sleep onset in baseline and after sleep deprivation, both EEG delta power (1-4 Hz) and sleep consolidation were reduced in KO mice indicating a slower increase of homeostatic sleep need during wakefulness. This slower increase might relate to the smaller increase in theta and gamma power observed in the waking EEG prior to sleep onset under both conditions. Indeed, the increased theta activity during wakefulness predicted delta power in subsequent NREM sleep. Lack of Rev-erbα increased Bmal1, Npas2, Clock, and Fabp7 expression, confirming the direct regulation of these genes by REV-ERBα also in the brain. Our results add further proof to the notion that clock genes are involved in sleep homeostasis. Because accumulating evidence directly links REV-ERBα to dopamine signaling the altered homeostatic regulation of sleep reported here are discussed in that context. © 2016 Associated Professional Sleep Societies, LLC.

  17. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  18. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  19. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  20. Reference Model 2: "Rev 0" Rotor Design

    Energy Technology Data Exchange (ETDEWEB)

    Barone, Matthew F. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Berg, Jonathan Charles [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Griffith, Daniel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2011-12-01

    The preliminary design for a three-bladed cross-flow rotor for a reference marine hydrokinetic turbine is presented. A rotor performance design code is described, along with modifications to the code to allow prediction of blade support strut drag as well as interference between two counter-rotating rotors. The rotor is designed to operate in a reference site corresponding to a riverine environment. Basic rotor performance and rigid-body loads calculations are performed to size the rotor elements and select the operating speed range. The preliminary design is verified with a simple finite element model that provides estimates of bending stresses during operation. A concept for joining the blades and support struts is developed and analyzed with a separate finite element analysis. Rotor mass, production costs, and annual energy capture are estimated in order to allow calculations of system cost-of-energy. Evaluation Only. Created with Aspose.Pdf.Kit. Copyright 2002-2011 Aspose Pty Ltd Evaluation Only. Created with Aspose.Pdf.Kit. Copyright 2002-2011 Aspose Pty Ltd

  1. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  2. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  3. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  4. Guidance and considerations for implementation of INFCIRC/225/Rev.3, the physical protection of nuclear material

    International Nuclear Information System (INIS)

    1997-09-01

    The Physical Protection of Nuclear Material, INFCIRC/225/Rev.3, provides recommendations for the physical protection of nuclear material against theft in use, storage and transport, whether national or international and whether peaceful or military, and contains provisions relating to the sabotage of nuclear material or facilities. The recommendations contained in INFCIRC/225/Rev.3 detail the elements that should be included in a State's system of physical protection. It also recognizes the adverse health and safety consequences arising from the theft of nuclear material and the sabotage of nuclear material or facilities. Most industrial and developing countries use these recommendations to some extent in the establishment and operation of their physical protection systems. Although INFCIRC/225/Rev.3 provides recommendations for protecting materials and facilities from theft or sabotage, it does not provide in-depth details for these recommendations. In June 1996, the IAEA convened a consultants meeting to consider this matter. This report is the result of continuing discussions and drafts over a period of nine months. The intent of this guidance is to provide a broader basis for relevant State organizations to prescribe appropriate requirements for the use of nuclear materials which are compatible with accepted international practice

  5. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  6. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  8. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  9. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  10. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  11. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  12. Determination of Geometrical REVs Based on Volumetric Fracture Intensity and Statistical Tests

    Directory of Open Access Journals (Sweden)

    Ying Liu

    2018-05-01

    Full Text Available This paper presents a method to estimate a representative element volume (REV of a fractured rock mass based on the volumetric fracture intensity P32 and statistical tests. A 150 m × 80 m × 50 m 3D fracture network model was generated based on field data collected at the Maji dam site by using the rectangular window sampling method. The volumetric fracture intensity P32 of each cube was calculated by varying the cube location in the generated 3D fracture network model and varying the cube side length from 1 to 20 m, and the distribution of the P32 values was described. The size effect and spatial effect of the fractured rock mass were studied; the P32 values from the same cube sizes and different locations were significantly different, and the fluctuation in P32 values clearly decreases as the cube side length increases. In this paper, a new method that comprehensively considers the anisotropy of rock masses, simplicity of calculation and differences between different methods was proposed to estimate the geometrical REV size. The geometrical REV size of the fractured rock mass was determined based on the volumetric fracture intensity P32 and two statistical test methods, namely, the likelihood ratio test and the Wald–Wolfowitz runs test. The results of the two statistical tests were substantially different; critical cube sizes of 13 m and 12 m were estimated by the Wald–Wolfowitz runs test and the likelihood ratio test, respectively. Because the different test methods emphasize different considerations and impact factors, considering a result that these two tests accept, the larger cube size, 13 m, was selected as the geometrical REV size of the fractured rock mass at the Maji dam site in China.

  13. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  14. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  15. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  16. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  17. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  18. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  19. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  20. Hard bottom substrate monitoring Horns Rev offshore wind farm. Annual status report. 2004

    Energy Technology Data Exchange (ETDEWEB)

    Leonhard, S.B.; Pedersen, John

    2005-05-15

    Elsam and Eltra have built the offshore demonstration wind farm at Horns Rev in the North Sea. Elsam is the owner and is responsible for the operation of the wind farm. Eltra is responsible for the connection of the wind farm to the national onshore grid. In the summer months of 2002, Elsam constructed the world's largest offshore wind farm at the Danish west coast. The wind farm is located 14-20 km into the North Sea, west of Blaevands Huk. The first wind turbine foundation was in place in March 2002 and the last mono-pile was in place in August 2002 for a total of 80. The construction work was completed with the last connecting cables sluiced down in September 2002. All the wind turbines were in production in December 2002. The expected impact from the wind farm will primarily be an alternation of habitats due to the introduction of hard bottom substrates as wind mono-piles and scour protections. A continuous development in the epifouling communities will be expected together with an introduction of new or alien species in the area. The indigenous benthic community in the area of Horn Rev can be characterised by infauna species belonging to the Goniadella-Spisula community. This community is typical of sandbanks in the North Sea area, although communities in such areas are very variable and site specific. Character species used as indicators for environmental changes in the Horns Rev area are the bristle worms Goniadella bobretzkii, Ophelia borealis, Psione remota and Orbinia sertulata and the mussels Goodallia triangularis and Spisula solida. In connection with the implementation of the monitoring programme concerning the ecological impact of the introduction of hard substrate related to the Horns Rev Wind Farm, surveys on hard bottom substrates were initialised in March 2003 with monitoring conducted in September 2003 and March and September 2004. This report describes the results from surveys on hard substrates in 2004. (au)

  1. Hard bottom substrate monitoring Horns Rev offshore wind farm. Annual status report. 2004

    Energy Technology Data Exchange (ETDEWEB)

    Leonhard, S B; Pedersen, John

    2005-05-15

    Elsam and Eltra have built the offshore demonstration wind farm at Horns Rev in the North Sea. Elsam is the owner and is responsible for the operation of the wind farm. Eltra is responsible for the connection of the wind farm to the national onshore grid. In the summer months of 2002, Elsam constructed the world's largest offshore wind farm at the Danish west coast. The wind farm is located 14-20 km into the North Sea, west of Blaevands Huk. The first wind turbine foundation was in place in March 2002 and the last mono-pile was in place in August 2002 for a total of 80. The construction work was completed with the last connecting cables sluiced down in September 2002. All the wind turbines were in production in December 2002. The expected impact from the wind farm will primarily be an alternation of habitats due to the introduction of hard bottom substrates as wind mono-piles and scour protections. A continuous development in the epifouling communities will be expected together with an introduction of new or alien species in the area. The indigenous benthic community in the area of Horn Rev can be characterised by infauna species belonging to the Goniadella-Spisula community. This community is typical of sandbanks in the North Sea area, although communities in such areas are very variable and site specific. Character species used as indicators for environmental changes in the Horns Rev area are the bristle worms Goniadella bobretzkii, Ophelia borealis, Psione remota and Orbinia sertulata and the mussels Goodallia triangularis and Spisula solida. In connection with the implementation of the monitoring programme concerning the ecological impact of the introduction of hard substrate related to the Horns Rev Wind Farm, surveys on hard bottom substrates were initialised in March 2003 with monitoring conducted in September 2003 and March and September 2004. This report describes the results from surveys on hard substrates in 2004. (au)

  2. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  3. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  4. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  5. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  6. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  7. 2014 SRNL LDRD Annual Report, Rev. 0

    Energy Technology Data Exchange (ETDEWEB)

    Mcwhorter, S. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-03-15

    Laboratory Directed Research and Development is a congressionally authorized program that provides the ‘innovation inspiration’ from which many of the Laboratory’s multi-discipline advancements are made in both science and engineering technology. The program is the backbone for insuring that scientific, technical and engineering capabilities can meet current and future needs. It is an important tool in reducing the probability of technological surprise by allowing laboratory technical staff room to innovate and keep abreast of scientific breakthroughs. Drawing from the synergism among the EM and NNSA missions, and work from other federal agencies ensures that LDRD is the key element in maintaining the vitality of SRNL’s technical programs. The LDRD program aims to position the Laboratory for new business in clean energy, national security, nuclear materials management and environmental stewardship by leveraging the unique capabilities of the Laboratory to yield foundational scientific research in core business areas, while aligning with SRS strategic initiatives and maintaining a vision for ultimate DOE applications.

  8. Occupational safety manual. 4. rev. ed.

    International Nuclear Information System (INIS)

    Skiba, R.

    1979-01-01

    With the rapid technical development and increasing life expectancy, protection against occupational hazards has become a central economic and social problem. Consultants and others responsible for occupational safety should not only be interested in their work but also have sufficient basic knowledge. The complex subject is presented in a simplified and easily comprehensible manner, with particular regard to the practical side. The book is at the same time a textbook for basic training and a reference manual for the working practice. (orig./HP) [de

  9. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  10. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  11. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  12. Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: novel insights into the regulation of Rev nuclear import.

    LENUS (Irish Health Repository)

    Gu, Lili

    2011-01-01

    The HIV-1 regulatory protein Rev, which is essential for viral replication, mediates the nuclear export of unspliced viral transcripts. Rev nuclear function requires active nucleocytoplasmic shuttling, and Rev nuclear import is mediated by the recognition of its Nuclear Localisation Signal (NLS) by multiple import factors, which include transportin and importin β. However, it remains unclear which nuclear import pathway(s) predominate in vivo, and the cellular environment that modulates Rev nucleocytoplasmic shuttling remains to be characterised.

  13. Administrative Circular No. 26 (Rev. 9) – Recognition of Merit

    CERN Multimedia

    2012-01-01

    Administrative Circular No. 26 (Rev. 9) entitled "Recognition of Merit”, approved by the Director-General following discussion in the Standing Concertation Committee meeting on 27 September 2011 is available on the intranet site of the Human Resources Department: https://cern.ch/hr-docs/admincirc/admincirc.asp The circular was above all revised in order to integrate the new CERN Competency Model into the annual procedure of performance appraisal. It cancels and replaces Administrative Circular No. 26 (Rev. 8) entitled "Recognition of merit” of September 2008. Department Head Office HR Department

  14. Administrative Circular No. 26 (Rev. 7) – May 2007

    CERN Multimedia

    HR Department

    2007-01-01

    Recognition of Merit of Staff Members Administrative Circular No. 26 (Rev. 7) is now available on the intranet site of the Human Resources Department. This circular cancels and replaces Administrative Circular No. 26 (Rev. 6) - Procedures governing the career development of staff members. Copies will shortly be available in Departmental secretariats. If you require any additional information on the new staff-member merit assessment and recognition system, you may consult the FAQ, which has been available on the Human Resources Department intranet site since February 2007. Human Resources Department Tel. 78003

  15. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  16. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  17. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  18. Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element.

    Science.gov (United States)

    Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

    2013-12-01

    A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar 'Daisy' carries both defective genes, whereas a spontaneous deep-colored mutant 'Daisy-VPR' lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar '06-LA' and a deep-colored cultivar 'Spectrum' produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the 'Spectrum' parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century.

  19. Project Execution Plan,Rev. 3; FINAL

    International Nuclear Information System (INIS)

    IT Corporation, Las Vegas

    2002-01-01

    This plan addresses project activities encompassed by the U.S. Department of Energy's (DOE's), National Nuclear Security Administration Nevada Operations Office, Environmental Restoration Division and conforms to the requirements contained in the Life-Cycle Asset Management, DOE Order 430.1A; The Joint Program Office Policy on Project Management in Support of DOE Order 430.1; Program and Project Management for the Acquisition of Capital Assets, DOE Order 413.3; the Project Execution and Engineering Management Planning Guide, GPG-FM-010; and other applicable Good Practice Guides; and the FY 2001 Integrated Planning, Accountability, and Budgeting System Policy Guidance. The plan also reflects the milestone philosophies of the Federal Facility Agreement and Consent Order, as agreed to by the State of Nevada, the DOE, and the U.S. Department of Defense; and traditional project management philosophies such as the development of life-cycle costs, schedules, and work scope; identification o f roles and responsibilities; and baseline management and controls

  20. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  1. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  2. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  3. Transport of radioactive materials. 2. rev. ed.

    International Nuclear Information System (INIS)

    Vogt, H.W.; Falkhof, W.; Heibach, K.; Ungermann, N.; Hungenberg, H.

    1991-01-01

    With the last changes in the Ordinance Concerning the Transport of Hazardous Goods two regulations which are important for the carrying trade were introduced: 1. The conveyer must train the driver. He must only employ reliable drivers. 2. The driver must participate in a training course (as of July 1, 1991). These obligations, which already existed in the past in regard to the transport of nuclear fuel, have been extended to include the transport of other radioactive materials. In part I the book deals with basic training courses for parcelled goods, and part II goes into the special knowledge which is required of drivers of radioactive materials. The parts consist of the following sections: 1. General regulations, 2, Responsibility when transporting hazardous goods, 3. General danger features, 4. Information on dangers and their designation, 5. The vehicle's equipment and carrying out the transport, 6. Measures for avoiding accidents. At the end of each section the participant in the course finds a series of questions which pertain to the subject matter just treated so that he can test his own learning performance. So as to make things easier for the trainee, the corect answers are listed in the appendix. As a supplementary section on radioactive materials, part II offers additional detailed explanations by experts in the field on the features of radioactive materials and the dangers they pose. In the margin - next to the instructory text - the key words are given so that the right place in the text of the instruction manual can be readily found. These key words are compiled in the appendix to form an index. (orig./HP) [de

  4. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  5. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  6. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  7. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  8. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  9. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  10. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  11. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  12. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  13. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  14. Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear import.

    LENUS (Irish Health Repository)

    Gu, Lili

    2011-03-14

    Abstract Background The HIV-1 regulatory protein Rev, which is essential for viral replication, mediates the nuclear export of unspliced viral transcripts. Rev nuclear function requires active nucleocytoplasmic shuttling, and Rev nuclear import is mediated by the recognition of its Nuclear Localisation Signal (NLS) by multiple import factors, which include transportin and importin β. However, it remains unclear which nuclear import pathway(s) predominate in vivo, and the cellular environment that modulates Rev nucleocytoplasmic shuttling remains to be characterised. Results In our study, we have identified the cellular protein HIC (Human I-mfa domain-Containing protein) as a novel interactor of HIV-1 Rev. We demonstrate that HIC selectively interferes with Rev NLS interaction with importin β and impedes its nuclear import and function, but does not affect Rev nuclear import mediated by transportin. Hence, the molecular determinants mediating Rev-NLS recognition by importin β and transportin appear to be distinct. Furthermore, we have employed HIC and M9 M, a peptide specifically designed to inhibit the transportin-mediated nuclear import pathway, to characterise Rev nuclear import pathways within different cellular environments. Remarkably, we could show that in 293T, HeLa, COS7, Jurkat, U937, THP-1 and CEM cells, Rev nuclear import is cell type specific and alternatively mediated by transportin or importin β, in a mutually exclusive fashion. Conclusions Rev cytoplasmic sequestration by HIC may represent a novel mechanism for the control of Rev function. These studies highlight that the multivalent nature of the Rev NLS for different import receptors enables Rev to adapt its nuclear trafficking strategy.

  15. Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear import

    Directory of Open Access Journals (Sweden)

    Sheehy Noreen

    2011-03-01

    Full Text Available Abstract Background The HIV-1 regulatory protein Rev, which is essential for viral replication, mediates the nuclear export of unspliced viral transcripts. Rev nuclear function requires active nucleocytoplasmic shuttling, and Rev nuclear import is mediated by the recognition of its Nuclear Localisation Signal (NLS by multiple import factors, which include transportin and importin β. However, it remains unclear which nuclear import pathway(s predominate in vivo, and the cellular environment that modulates Rev nucleocytoplasmic shuttling remains to be characterised. Results In our study, we have identified the cellular protein HIC (Human I-mfa domain-Containing protein as a novel interactor of HIV-1 Rev. We demonstrate that HIC selectively interferes with Rev NLS interaction with importin β and impedes its nuclear import and function, but does not affect Rev nuclear import mediated by transportin. Hence, the molecular determinants mediating Rev-NLS recognition by importin β and transportin appear to be distinct. Furthermore, we have employed HIC and M9 M, a peptide specifically designed to inhibit the transportin-mediated nuclear import pathway, to characterise Rev nuclear import pathways within different cellular environments. Remarkably, we could show that in 293T, HeLa, COS7, Jurkat, U937, THP-1 and CEM cells, Rev nuclear import is cell type specific and alternatively mediated by transportin or importin β, in a mutually exclusive fashion. Conclusions Rev cytoplasmic sequestration by HIC may represent a novel mechanism for the control of Rev function. These studies highlight that the multivalent nature of the Rev NLS for different import receptors enables Rev to adapt its nuclear trafficking strategy.

  16. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  17. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  19. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  20. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  1. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  2. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  3. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  4. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  5. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  6. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  7. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Novel engineered HIV-1 East African Clade-A gp160 plasmid construct induces strong humoral and cell-mediated immune responses in vivo

    International Nuclear Information System (INIS)

    Muthumani, Karuppiah; Zhang Donghui; Dayes, Nathanael S.; Hwang, Daniel S.; Calarota, Sandra A.; Choo, Andrew Y.; Boyer, Jean D.; Weiner, David B.

    2003-01-01

    HIV-1 sequences are highly diverse due to the inaccuracy of the viral reverse transcriptase. This diversity has been studied and used to categorize HIV isolates into subtypes or clades, which are geographically distinct. To develop effective vaccines against HIV-1, immunogens representing different subtypes may be important for induction of cross-protective immunity, but little data exist describing and comparing the immunogenicity induced by different subtype-based vaccines. This issue is further complicated by poor expression of HIV structural antigens due to rev dependence. One costly approach is to codon optimize each subtype construct to be examined. Interestingly, cis-acting transcriptional elements (CTE) can also by pass rev restriction by a rev independent export pathway. We reasoned that rev+CTE constructs might have advantages for such expression studies. A subtype A envelope sequence from a viral isolate from east Africa was cloned into a eukaryotic expression vector under the control of the CMV-IE promoter. The utility of inclusion of the Mason-Pfizer monkey virus (MPV)-CTE with/without rev for driving envelope expression and immunogenicity was examined. Expression of envelope (gp120) was confirmed by immunoblot analysis and by pseudotype virus infectivity assays. The presence of rev and the CTE together increased envelope expression and viral infection. Furthermore the CTE+rev construct was significantly more immunogenic then CTE alone vector. Isotype analysis and cytokine profiles showed strong Th1 response in plasmid-immunized mice, which also demonstrated the superior nature of the rev+CTE construct. These responses were of similar or greater magnitude to a codon-optimized construct. The resulting cellular immune responses were highly cross-reactive with a HIV-1 envelope subtype B antigen. This study suggests a simple strategy for improving the expression and immunogenicity of HIV subtype-specific envelope antigens as plasmid or vector

  9. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  10. Operational circular No. 1 (Rev. 1) – Operational circulars

    CERN Multimedia

    HR Department

    2011-01-01

    Operational Circular No. 1 (Rev. 1) is applicable to members of the personnel and other persons concerned. Operational Circular No. 1 (Rev. 1) entitled "Operational circulars", approved following discussion at the Standing Concertation Committee meeting on 4 May 2011, is available on the intranet site of the Human Resources Department: https://hr-docs.web.cern.ch/hr-docs/opcirc/opcirc.asp It cancels and replaces Operational Circular No. 1 entitled "Operational Circulars” of December 1996. This new version clarifies, in particular, that operational circulars do not necessarily arise from the Staff Rules and Regulations, and the functional titles have been updated to bring them into line with the current CERN organigram. Department Head Office  

  11. Administrative Circular No. 26 (Rev.10) - Recognition of merit

    CERN Multimedia

    2014-01-01

    Administrative Circular No. 26 (Rev. 10) entitled “Recognition of Merit”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 5 December 2013 and entering into force on 1 January 2014, is available on the intranet site of the Human Resources Department (see here).   This circular is applicable to staff members. It cancels and replaces Administrative Circular No. 26 (Rev. 9) entitled “Recognition of Merit” of December 2011. The circular was revised in order to take into account the work performed in the framework of an elective mandate during the exercise of merit recognition of staff members. In addition, the circular was revised to provide that, in the case of staff members on special leave for professional reasons for a period equal to or longer than half a year, it will no longer be possible to grant an exceptional advancement. Department Head Office HR Department

  12. Administrative Circular No. 23 (Rev. 4) - Special working hours

    CERN Document Server

    Department Head Office - HR Department

    2016-01-01

    Administrative Circular No. 23 (Rev. 4) entitled "Special working hours", approved by the Director-General following discussion in the Standing Concertation Committee meeting on 22 March 2016, will be available on 1st September 2016 via the following link: https://cds.cern.ch/record/2208539.   This revised circular cancels and replaces Administrative Circular No. 23 (Rev. 3) also entitled "Special working hours" of January 2013. This document contains modifications to reflect the new career structure and ensuring the provision consistent with practice that compensation or remuneration of special working hours performed remotely is possible only in case of emergency.   This circular will enter into force on 1st September 2016.

  13. Meteorological explanation of wake clouds at Horns Rev wind farm

    Energy Technology Data Exchange (ETDEWEB)

    Emeis, S. [Karlsruhe Institute of Technology (Germany). Inst. for Meteorology and Climate Research

    2010-08-15

    The occurrence of wake clouds at Horns Rev wind farm is explained as mixing fog. Mixing fog forms when two nearly saturated air masses with different temperature are mixed. Due to the non-linearity of the dependence of the saturation water vapour pressure on temperature, the mixed air mass is over-saturated and condensation sets in. On the day in February 2008, when the wake clouds were observed at Horns Rev, cold and very humid air was advected from the nearby land over the warmer North Sea and led to the formation of a shallow layer with sea smoke or fog close above the sea surface. The turbines mixed a much deeper layer and thus provoked the formation of cloud trails in the wakes of the turbines. (orig.)

  14. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  15. ENDF/B-5 Fission Products Library. Rev. 2

    International Nuclear Information System (INIS)

    Schwerer, O.; Pronyaev, V.G.; Lemmel, H.D.

    1984-07-01

    This document summarizes contents and documentation of the 1984 version of the Fission Products Nuclear Data File of the ENDF/B-5 Library (Rev. 2) maintained by the National Nuclear Data Center (NNDC) at the Brookhaven National Laboratory, USA. This file contains numerical neutron reaction data and decay data for 877 fission product nuclides. The entire file or selective retrievals from it can be obtained on magnetic tape from the IAEA Nuclear Data Section. (author)

  16. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  18. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  19. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  20. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  1. Nuclear Export Signal Masking Regulates HIV-1 Rev Trafficking and Viral RNA Nuclear Export.

    Science.gov (United States)

    Behrens, Ryan T; Aligeti, Mounavya; Pocock, Ginger M; Higgins, Christina A; Sherer, Nathan M

    2017-02-01

    HIV-1's Rev protein forms a homo-oligomeric adaptor complex linking viral RNAs to the cellular CRM1/Ran-GTP nuclear export machinery through the activity of Rev's prototypical leucine-rich nuclear export signal (NES). In this study, we used a functional fluorescently tagged Rev fusion protein as a platform to study the effects of modulating Rev NES identity, number, position, or strength on Rev subcellular trafficking, viral RNA nuclear export, and infectious virion production. We found that Rev activity was remarkably tolerant of diverse NES sequences, including supraphysiological NES (SNES) peptides that otherwise arrest CRM1 transport complexes at nuclear pores. Rev's ability to tolerate a SNES was both position and multimerization dependent, an observation consistent with a model wherein Rev self-association acts to transiently mask the NES peptide(s), thereby biasing Rev's trafficking into the nucleus. Combined imaging and functional assays also indicated that NES masking underpins Rev's well-known tendency to accumulate at the nucleolus, as well as Rev's capacity to activate optimal levels of late viral gene expression. We propose that Rev multimerization and NES masking regulates Rev's trafficking to and retention within the nucleus even prior to RNA binding. HIV-1 infects more than 34 million people worldwide causing >1 million deaths per year. Infectious virion production is activated by the essential viral Rev protein that mediates nuclear export of intron-bearing late-stage viral mRNAs. Rev's shuttling into and out of the nucleus is regulated by the antagonistic activities of both a peptide-encoded N-terminal nuclear localization signal and C-terminal nuclear export signal (NES). How Rev and related viral proteins balance strong import and export activities in order to achieve optimal levels of viral gene expression is incompletely understood. We provide evidence that multimerization provides a mechanism by which Rev transiently masks its NES peptide

  2. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  3. Administrative Circulars No. 12 A (Rev. 2) - "Education fees” and No. 12 B (Rev. 2) - “Education fees and language courses”

    CERN Multimedia

    2013-01-01

    Administrative Circulars No. 12 A (Rev. 2) entitled “Education fees” and No. 12 B (Rev. 2) entitled “Education fees and language courses”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 27 June 2013 and entering into force on 1 August 2013, are available on the intranet site of the Human Resources Department (see here).   Administrative Circular No. 12 A (Rev. 2) is applicable to Staff Members (except former “Local Staff Members”) recruited before 1st January 2007. Administrative Circular No. 12 B (Rev. 2) is applicable to Staff Members recruited on or after 1st January 2007, to Fellows, to Scientific Associates, to Guest Professors and to former “Local Staff” recruited before 1st January 2007. They cancel and replace Administrative Circulars No. 12 A (Rev. 1/Corr.) entitled "Education fees” and No. 12 B (Rev. 1/Corr.) entitled “Edu...

  4. Mutational definition of functional domains within the Rev homolog encoded by human endogenous retrovirus K.

    Science.gov (United States)

    Bogerd, H P; Wiegand, H L; Yang, J; Cullen, B R

    2000-10-01

    Nuclear export of the incompletely spliced mRNAs encoded by several complex retroviruses, including human immunodeficiency virus type 1 (HIV-1), is dependent on a virally encoded adapter protein, termed Rev in HIV-1, that directly binds both to a cis-acting viral RNA target site and to the cellular Crm1 export factor. Human endogenous retrovirus K, a family of ancient endogenous retroviruses that is not related to the exogenous retrovirus HIV-1, was recently shown to also encode a Crm1-dependent nuclear RNA export factor, termed K-Rev. Although HIV-1 Rev and K-Rev display little sequence identity, they share the ability not only to bind to Crm1 and to RNA but also to form homomultimers and shuttle between nucleus and cytoplasm. We have used mutational analysis to identify sequences in the 105-amino-acid K-Rev protein required for each of these distinct biological activities. While mutations in K-Rev that inactivate any one of these properties also blocked K-Rev-dependent nuclear RNA export, several K-Rev mutants were comparable to wild type when assayed for any of these individual activities yet nevertheless defective for RNA export. Although several nonfunctional K-Rev mutants acted as dominant negative inhibitors of K-Rev-, but not HIV-1 Rev-, dependent RNA export, these were not defined by their inability to bind to Crm1, as is seen with HIV-1 Rev. In total, this analysis suggests a functional architecture for K-Rev that is similar to, but distinct from, that described for HIV-1 Rev and raises the possibility that viral RNA export mediated by the approximately 25 million-year-old K-Rev protein may require an additional cellular cofactor that is not required for HIV-1 Rev function.

  5. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  6. UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

    Science.gov (United States)

    Lawrence, C W; O'Brien, T; Bond, J

    1984-01-01

    The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

  7. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  8. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  9. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  10. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  11. Sampling and estimation techniques for the implementation of new classification systems: the change-over from NACE Rev. 1.1 to NACE Rev. 2 in business surveys

    Directory of Open Access Journals (Sweden)

    Jan van den Brakel

    2010-09-01

    Full Text Available This paper describes some of the methodological problems encountered with the change-over from the NACE Rev. 1.1 to the NACE Rev. 2 in business statistics. Different sampling and estimation strategies are proposed to produce reliable figures for the domains under both classifications simultaneously. Furthermore several methods are described that can be used to reconstruct time series for the domains under the NACE Rev. 2.

  12. Repository Surface Design Engineering Files Report Rev 00 ICN 1

    International Nuclear Information System (INIS)

    2001-01-01

    The objective of the Repository Surface Design Engineering Files Report Supplement [herein known as the Engineering Files (EF)] is to provide the surface design data needed by the Environmental Impact Statement (EIS) contractor to prepare the EIS and evaluate options and alternatives. This document is based on the Repository Surface Design Engineering Files Report, Revision 03 (CRWMS M and O 1999f) (EF Rev 03). Where facility and system designs have been changed for the Site Recommendation (SR) effort they are described in this report. EIS information provided in this report includes the following: (1) Description of program phases; there are no changes that impact this report. (2) A description of the major design requirements and assumptions that drive the surface facilities reference design is provided herein (Section 2.2), including the surface design resulting from recommendations regarding Enhanced Design Alternative (EDA) II, as discussed in the License Application Design Section Report (CRWMS M and O 1999d), and changes to the waste stream. See Section 2, Table 2-2, for the SR waste stream. (3) The major design requirements and assumptions that drive the surface facilities reference design are by reference to EF Rev 03; there are no changes that impact this report. (4) Description of the reference design concept and existing site conditions is by reference to EF Rev 03 (including Table 4-1, which is not included in this supplement); there are no changes that impact this report. (5) Description of alternative design cases is by reference to EF Rev 03; there are no changes that impact this report. (6) Description of optional inventory modules is by reference to EF Rev 03; there are no changes that impact this report. (7) Tabular summary level engineering values (i.e., staffing, wastes, emissions, resources, and land use) for the reference design and the alternative design cases that address construction, emplacement operations, caretaker operations, and

  13. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  14. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  15. Alternative Fuels Data Center: New Hampshire Fleet Revs up With Natural Gas

    Science.gov (United States)

    New Hampshire Fleet Revs up With Natural Gas to someone by E-mail Share Alternative Fuels Data Center: New Hampshire Fleet Revs up With Natural Gas on Facebook Tweet about Alternative Fuels Data Center: New Hampshire Fleet Revs up With Natural Gas on Twitter Bookmark Alternative Fuels Data Center

  16. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  17. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  18. Technical reports retrieval system(rev. 1) in the field of nuclear energy

    International Nuclear Information System (INIS)

    Choi, S.D.; Lee, Y.K.; Yim, S.H.

    1983-01-01

    TRRS(rev. 1), on-line Technical Reports Retrieval System, a set of computer programs, was designed and developed to provide fast and efficient access to computer-based information files. This system was foucused upon its application to the retrival of technical reports collected in KAERI, and developed not only to meet the requirements of researchers sitting at terminal but to accomodate its sufficiently general logic to other computer systems. The retrival program language is FORTRAN IV Plus. The users can search the whole files using next eleven TRRS(rev. 1) commands, HELP, SEARCH, LOOK, COMBINE, EXPAND, SELECT, REVIEW, RESTART, TYPE, PRINT, and END. The special features of this system are as follows. First, the SEARCH command can process full and truncation (truncation mark is %), and can combine such truncated terms using Boolean operators, and (*), and and-not (.). Second, COMBINE command can combine set numbers with year(s), language(s) and a substring of titles. Third, after EXPAND command, either full or truncated term, SELECT command brings same result of SEARCH command. Finally, real time response is very short, real time response is very short, usually within a second or less. (Author)

  19. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  20. RNA helicase MOV10 functions as a co-factor of HIV-1 Rev to facilitate Rev/RRE-dependent nuclear export of viral mRNAs

    International Nuclear Information System (INIS)

    Huang, Feng; Zhang, Junsong; Zhang, Yijun; Geng, Guannan; Liang, Juanran; Li, Yingniang; Chen, Jingliang; Liu, Chao; Zhang, Hui

    2015-01-01

    Human immunodeficiency virus type 1 (HIV-1) exploits multiple host factors during its replication. The REV/RRE-dependent nuclear export of unspliced/partially spliced viral transcripts needs the assistance of host proteins. Recent studies have shown that MOV10 overexpression inhibited HIV-1 replication at various steps. However, the endogenous MOV10 was required in certain step(s) of HIV-1 replication. In this report, we found that MOV10 potently enhances the nuclear export of viral mRNAs and subsequently increases the expression of Gag protein and other late products through affecting the Rev/RRE axis. The co-immunoprecipitation analysis indicated that MOV10 interacts with Rev in an RNA-independent manner. The DEAG-box of MOV10 was required for the enhancement of Rev/RRE-dependent nuclear export and the DEAG-box mutant showed a dominant-negative activity. Our data propose that HIV-1 utilizes the anti-viral factor MOV10 to function as a co-factor of Rev and demonstrate the complicated effects of MOV10 on HIV-1 life cycle. - Highlights: • MOV10 can function as a co-factor of HIV-1 Rev. • MOV10 facilitates Rev/RRE-dependent transport of viral mRNAs. • MOV10 interacts with Rev in an RNA-independent manner. • The DEAG-box of MOV10 is required for the enhancement of Rev/RRE-dependent export.

  1. RNA helicase MOV10 functions as a co-factor of HIV-1 Rev to facilitate Rev/RRE-dependent nuclear export of viral mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Feng; Zhang, Junsong; Zhang, Yijun; Geng, Guannan; Liang, Juanran; Li, Yingniang; Chen, Jingliang [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China); Key Laboratory of Tropical Disease Control of Ministry of Education, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China); Liu, Chao, E-mail: liuchao9@mail.sysu.edu.cn [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China); Key Laboratory of Tropical Disease Control of Ministry of Education, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China); Zhang, Hui [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China); Key Laboratory of Tropical Disease Control of Ministry of Education, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080 (China)

    2015-12-15

    Human immunodeficiency virus type 1 (HIV-1) exploits multiple host factors during its replication. The REV/RRE-dependent nuclear export of unspliced/partially spliced viral transcripts needs the assistance of host proteins. Recent studies have shown that MOV10 overexpression inhibited HIV-1 replication at various steps. However, the endogenous MOV10 was required in certain step(s) of HIV-1 replication. In this report, we found that MOV10 potently enhances the nuclear export of viral mRNAs and subsequently increases the expression of Gag protein and other late products through affecting the Rev/RRE axis. The co-immunoprecipitation analysis indicated that MOV10 interacts with Rev in an RNA-independent manner. The DEAG-box of MOV10 was required for the enhancement of Rev/RRE-dependent nuclear export and the DEAG-box mutant showed a dominant-negative activity. Our data propose that HIV-1 utilizes the anti-viral factor MOV10 to function as a co-factor of Rev and demonstrate the complicated effects of MOV10 on HIV-1 life cycle. - Highlights: • MOV10 can function as a co-factor of HIV-1 Rev. • MOV10 facilitates Rev/RRE-dependent transport of viral mRNAs. • MOV10 interacts with Rev in an RNA-independent manner. • The DEAG-box of MOV10 is required for the enhancement of Rev/RRE-dependent export.

  2. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  3. Effect of a three-month football training program on trace element ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... physical exercise and trace element metabolism (Marrella et al., 1993; McDonald ..... induced stress and immune function. Exerc Immunol Rev. ... aerobic exercise upon the trace element levels in blood. Neuro. Endocrinol.

  4. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  5. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  6. Numerical modelling of powder caking at REV scale by using DEM

    Science.gov (United States)

    Guessasma, Mohamed; Silva Tavares, Homayra; Afrassiabian, Zahra; Saleh, Khashayar

    2017-06-01

    This work deals with numerical simulation of powder caking process caused by capillary condensation phenomenon. Caking consists in unwanted agglomeration of powder particles. This process is often irreversible and not easy to predict. To reproduce mechanism involved by caking phenomenon we have used the Discrete Elements Method (DEM). In the present work, we mainly focus on the role of capillary condensation and subsequent liquid bridge formation within a granular medium exposed to fluctuations of ambient relative humidity. Such bridges cause an attractive force between particles, leading to the formation of a cake with intrinsic physicochemical and mechanical properties. By considering a Representative Elementary Volume (REV), the DEM is then performed by means of a MULTICOR-3D software tacking into account the properties of the cake (degree of saturation) in order to establish relationships between the microscopic parameters and the macroscopic behaviour (tensile strength).

  7. Numerical modelling of powder caking at REV scale by using DEM

    Directory of Open Access Journals (Sweden)

    Guessasma Mohamed

    2017-01-01

    Full Text Available This work deals with numerical simulation of powder caking process caused by capillary condensation phenomenon. Caking consists in unwanted agglomeration of powder particles. This process is often irreversible and not easy to predict. To reproduce mechanism involved by caking phenomenon we have used the Discrete Elements Method (DEM. In the present work, we mainly focus on the role of capillary condensation and subsequent liquid bridge formation within a granular medium exposed to fluctuations of ambient relative humidity. Such bridges cause an attractive force between particles, leading to the formation of a cake with intrinsic physicochemical and mechanical properties. By considering a Representative Elementary Volume (REV, the DEM is then performed by means of a MULTICOR-3D software tacking into account the properties of the cake (degree of saturation in order to establish relationships between the microscopic parameters and the macroscopic behaviour (tensile strength.

  8. Operational Circular No.2 (Rev. 2) - Conditions of access to the fenced parts of the CERN site

    CERN Multimedia

    2014-01-01

    Operational Circular No. 2 (Rev. 2) entitled “Conditions of access to the fenced parts of the CERN site” and its “implementation measures”, approved by the Director-General following discussion at the Standing Concertation Committee meeting on 20 May 2014 and entering into force on 1 September 2014, are available on the intranet site of the Human Resources Department (see here).   This circular is applicable to members of the personnel and other persons concerned. It cancels and replaces Operational Circular No. 2 (Rev. 1) entitled “Conditions of access to the fenced parts of the CERN site”, of April 1998. In particular, the revised circular provides for the possibility of mandating a person responsible for the proper implementation of the circular, specifies the rules relating to vehicles allowed on the site and the respective responsibilities of their owners, and relaxes certain administrative formalities in case of loss, theft or di...

  9. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  10. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  11. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  12. Wind Farm Wake: The Horns Rev Photo Case

    DEFF Research Database (Denmark)

    Hasager, Charlotte Bay; Rasmussen, Leif; Peña, Alfredo

    2013-01-01

    The aim of the paper is to examine the nowadays well-known wind farm wake photographs taken on 12 February 2008 at the offshore Horns Rev 1 wind farm. The meteorological conditions are described from observations from several satellite sensors quantifying clouds, surface wind vectors and sea surf...... in the wake regions with relatively high axial velocities and high turbulent kinetic energy. The wind speed is near cut-in and most turbines produce very little power. The rotational pattern of spiraling bands produces the large-scale structure of the wake fog....

  13. Mapping the binding interface between an HIV-1 inhibiting intrabody and the viral protein Rev.

    Directory of Open Access Journals (Sweden)

    Thomas Vercruysse

    Full Text Available HIV-1 Rev is the key protein in the nucleocytoplasmic export and expression of the late viral mRNAs. An important aspect for its function is its ability to multimerize on these mRNAs. We have recently identified a llama single-domain antibody (Nb190 as the first inhibitor targeting the Rev multimerization function in cells. This nanobody is a potent intracellular antibody that efficiently inhibits HIV-1 viral production. In order to gain insight into the Nb190-Rev interaction interface, we performed mutational and docking studies to map the interface between the nanobody paratope and the Rev epitope. Alanine mutants of the hyper-variable domains of Nb190 and the Rev multimerization domains were evaluated in different assays measuring Nb190-Rev interaction or viral production. Seven residues within Nb190 and five Rev residues are demonstrated to be crucial for epitope recognition. These experimental data were used to perform docking experiments and map the Nb190-Rev structural interface. This Nb190-Rev interaction model can guide further studies of the Nb190 effect on HIV-1 Rev function and could serve as starting point for the rational development of smaller entities binding to the Nb190 epitope, aimed at interfering with protein-protein interactions of the Rev N-terminal domain.

  14. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  15. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  16. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  17. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  18. High amplitude phase resetting in rev-erbalpha/per1 double mutant mice.

    Directory of Open Access Journals (Sweden)

    Corinne Jud

    Full Text Available Over time, organisms developed various strategies to adapt to their environment. Circadian clocks are thought to have evolved to adjust to the predictable rhythms of the light-dark cycle caused by the rotation of the Earth around its own axis. The rhythms these clocks generate persist even in the absence of environmental cues with a period of about 24 hours. To tick in time, they continuously synchronize themselves to the prevailing photoperiod by appropriate phase shifts. In this study, we disrupted two molecular components of the mammalian circadian oscillator, Rev-Erbalpha and Period1 (Per1. We found that mice lacking these genes displayed robust circadian rhythms with significantly shorter periods under constant darkness conditions. Strikingly, they showed high amplitude resetting in response to a brief light pulse at the end of their subjective night phase, which is rare in mammals. Surprisingly, Cry1, a clock component not inducible by light in mammals, became slightly inducible in these mice. Taken together, Rev-Erbalpha and Per1 may be part of a mechanism preventing drastic phase shifts in mammals.

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  20. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  1. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  2. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  3. Publication Of Administrative Circulars: No. 4 (Rev. 4) – Unemployment Insurance Scheme No. 30 (Rev. 2) – Financial Benefits on Taking Up Appointment and on Termination of Contract

    CERN Multimedia

    HR Department

    2008-01-01

    Administrative Circular No. 4 (Rev. 4) – Unemployment insurance scheme Administrative Circular No. 4 (Rev. 4) – "Unemployment insurance scheme", approved following discussion in the Standing Concertation Committee meetings of 28 August 2007 and 27 February 2008, is now available on the intranet site of the Human Resources Department. It cancels and replaces Administrative Circular No. 4 (Rev. 3) – "Unemployment insurance" of October 1993. Copies will shortly be available in Departmental secretariats. Human Resources Department Tel. 78003 Administrative Circular No. 30 (Rev. 2) – Financial benefits on taking up appointment and termination of contract Administrative Circular No. 30 (Rev. 2) – "Financial benefits on taking up appointment and termination of contract", approved following discussion in the Standing Concertation Committee meetings of 28 August 2007 and 27 February 2008, is now available on the intranet site of the Human Resources De...

  4. Publication Of Administrative Circulars: No. 4 (Rev. 4) – Unemployment Insurance Scheme No. 30 (Rev. 2) – Financial Benefits on Taking Up Appointment and on Termination of Contract

    CERN Document Server

    HR Department

    2008-01-01

    Administrative Circular No. 4 (Rev. 4) – Unemployment insurance scheme Administrative Circular No. 4 (Rev. 4) – "Unemployment insurance scheme", approved following discussion at the Standing Concertation Committee meetings of 28 August 2007 and 27 February 2008, is now available on the intranet site of the Human Resources Department. It cancels and replaces Administrative Circular No. 4 (Rev. 3) – "Unemployment insurance" of October 1993. Copies will shortly be available in Departmental secretariats. Human Resources Department Tel. 78003 Administrative Circular No. 30 (Rev. 2) – Financial benefits on taking up appointment and termination of contract Administrative Circular No. 30 (Rev. 2) – "Financial benefits on taking up appointment and termination of contract", approved following discussion at the Standing Concertation Committee meetings of 28 August 2007 and 27 February 2008, is now available on the intranet site of the Human Resources De...

  5. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  6. 12MW Horns Rev experiment[Wind farm

    Energy Technology Data Exchange (ETDEWEB)

    Hasager, C.B.; Pena, A; Mikkelsen, T.; Courtney, M.; Antoniou, I.; Gryning, S.-E.; Hansen, P. [Risoe National Lab., DTU, Wind Energy Dept. (Denmark); Soerensen, P.B. [DONG Energy (Denmark)

    2007-10-15

    The 12MW project with the full title '12 MW wind turbines: the scientific basis for their operation at 70 to 270 m height offshore' has the goal to experimentally investigate the wind and turbulence characteristics between 70 and 270 m above sea level and thereby establish the scientific basis relevant for the next generation of huge 12 MW wind turbines operating offshore. The report describes the experimental campaign at the Horns Rev offshore wind farm at which observations from Doppler Laser LIDAR and SODAR were collected from 3 May to 24 October 2006. The challenges for mounting and operating the instruments on the transformer platform at Horns Rev were overcome by a close collaboration between DONG energy and Risoe National Laboratory DTU. The site is presented. In particular, three tall offshore meteorological masts, up to 70 m tall, provided a useful source of meteorological data for comparison to the remotely sensed wind and turbulence observations. The comparison showed high correlation. The LIDAR and SODAR wind and turbulence observations were collected far beyond the height of the masts (up to 160 m above sea level) and the extended profiles were compared to the logarithmic wind profile. Further studies on this part of the work are on-going. Technical detail on LIDAR and SODAR are provided as well as theoretical work on turbulence and atmospheric boundary layer flow. Selected results from the experimental campaign are reported. (au)

  7. Wind Farm Wake: The 2016 Horns Rev Photo Case

    Directory of Open Access Journals (Sweden)

    Charlotte Bay Hasager

    2017-03-01

    Full Text Available Offshore wind farm wakes were observed and photographed in foggy conditions at Horns Rev 2 on 25 January 2016 at 12:45 UTC. These new images show highly contrasting conditions regarding the wind speed, turbulence intensity, atmospheric stability, weather conditions and wind farm wake development as compared to the Horns Rev 1 photographs from 12 February 2008. The paper examines the atmospheric conditions from satellite images, radiosondes, lidar and wind turbine data and compares the observations to results from atmospheric meso-scale modelling and large eddy simulation. Key findings are that a humid and warm air mass was advected from the southwest over cold sea and the dew-point temperature was such that cold-water advection fog formed in a shallow layer. The flow was stably stratified and the freestream wind speed was 13 m/s at hub height, which means that most turbines produced at or near rated power. The wind direction was southwesterly and long, narrow wakes persisted several rotor diameters downwind of the wind turbines. Eventually mixing of warm air from aloft dispersed the fog in the far wake region of the wind farm.

  8. rev piyasaları ve vergilendirilmesi

    OpenAIRE

    İşler, İsmail; Utku, Mehmet

    2015-01-01

    rev piyasaları kavramı, vadeli işlem sözleşmeleri (forward, futures), opsiyon sözleşmeleri, swap sözleşmeleri ve aracı kuruluş varantları işlemlerinin tamamını içermektedir. Bu tür işlemler vadeli işlemlerdir. Vadeli işlemlerin ortak özelliği, ilerideki bir tarihte teslimatı yapılmak üzere herhangi bir malın veya finansal aracın, bugünden alım satımının yapılmasıdır. Bu çalışmada türev araçların tanımları ve vergilendirilmeleri örneklerle açıklanacaktır. The term derivatives market invol...

  9. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  10. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  11. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  12. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  13. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  14. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  15. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  16. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  17. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  18. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  19. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  20. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  1. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  2. Introduction into thermodynamics. From elements to technical applications. 13. rev. and enl. ed.

    International Nuclear Information System (INIS)

    Cerbe, G.; Hoffmann, H.J.

    2002-01-01

    This textbook has been proved for more than 30 years and has been regularly revised and updated. Thus, recent developments in energy conversion and environmental protection have constantly been taken into account. Tabulated values and standards reflect the current state of things. The book's basic concept was maintained without change from the first to the twelfth edition: leading over from well-founded thermodynamic theory to technical applications, closeness to practice because of many examples with solutions and tasks with solution results, the opportunity for self-study with 130 examples, 135 tasks and 175 control questions with answers, and high usability because of many tables and direct-information diagrams. The 13th edition was actualised and enhanced by combined-cycle power plants and fuel cells. (orig./GL) [de

  3. Introduction into thermodynamics. From elements to technical applications. 12. rev. ed.

    International Nuclear Information System (INIS)

    Cerbe, G.; Hoffmann, H.J.

    1999-01-01

    This textbook has been proved for more than 30 years and has been regularly revised and updated. Thus, recent developments in energy conversion and environmental protection have constantly been taken into account. Tabulated values and standards reflect the current state of things. The book's basic concept was maintained without change from the first to the twelfth edition: leading over from well-founded thermodynamic theory to technical applications, closeness to practice because of many examples with solutions and tasks with solution results, the opportunity for self-study with 124 examples, 132 tasks and 170 control questions with answers, and high usability because of many tables and direct-information diagrams. (orig.) [de

  4. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  5. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  6. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  7. Visual and radar observations of birds in relation to collision risk at the Horns Rev offshore wind farm. Annual status report 2003

    Energy Technology Data Exchange (ETDEWEB)

    Kjaer Christensen, T.; Hounisen, J.P.; Clausager, I.; Krag Petersen, I.

    2004-07-01

    The aim of the project is to assess the collision risk between birds and wind turbines at the Horns Rev wind farm. In 2003 the studies focused on describing bird movements in relation to the wind farm and to identify the species-specific behavioural responses towards the wind turbines shown by migrating and staging species. The Horns Rev area lies in a region known to be important for substantial water bird migration as well as holding internationally important numbers of several wintering and staging water bird species. (au)

  8. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  9. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  10. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  11. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  12. Applications of the INFCIRC225/rev5 to the national physical protection regime

    International Nuclear Information System (INIS)

    Kim, Jae Gwang

    2011-01-01

    The IAEA's first effort for playing a key role in physical protection of nuclear material and facilities resulted in the publication of 'Recommendations for the physical protection of nuclear material' in 1972. These recommendations were revised by a group of experts in co-operation with the IAEA Secretariat and the revised version was published in 1975 in INFCIRC/225. The document was subsequently revised in 1977(rev.1), 1989(rev.2), in 1993(rev.3) and 1998(rev4). The Physical Protection regime in ROK has been established on the basis of INFCIRC225 rev4 since 2004 IAEA recently published The INFCIRC 225 rev5 through the 2 years expert consultations. The publication recommended 12 nuclear security fundamentals and requirements of physical protection of nuclear material and nuclear facility to the member states. This paper suggests the several applications to the national physical protection system from the 12 fundamentals and the requirements

  13. Evaluation of vaccination strategies against infection with feline immunodeficiency virus (FIV) based on recombinant viral vectors expressing FIV Rev and OrfA

    NARCIS (Netherlands)

    Huisman, W.; Schrauwen, E.J.A.; Tijhaar, E.; Süzer, Y.; Pas, S.D.; Amerongen, van G.; Sutter, G.; Rimmelzwaan, G.F.; Osterhaus, A.D.M.E.

    2008-01-01

    In recent years it has become clear that cell-mediated immunity is playing a role in the control of lentivirus infections. In particular, cytotoxic T lymphocyte responses have been associated with improved outcome of infection, especially those directed against the regulatory proteins like Rev and

  14. Publication of administrative circular No. 26 (Rev. 8) – Recognition of merit

    CERN Multimedia

    HR Department

    2008-01-01

    Administrative Circular No. 26 (Rev. 8) – Recognition of merit Administrative Circular No. 26 (Rev. 8) – "Recognition of merit", approved by the Standing Concertation Committee at its meeting on 3 September 2008, is now available on the intranet site of the Human Resources Department. It cancels and replaces Administrative Circular No. 26 (Rev. 7) – "Recognition of merit of staff members" of May 2007. Paper copies will shortly be available in Departmental secretariats. Human Resources Department Tel. 78003

  15. Publication of administrative circular No. 26 (Rev. 8) – Recognition of merit

    CERN Multimedia

    HR Department

    2008-01-01

    Administrative Circular No. 26 (Rev. 8) – Recognition of merit Administrative Circular No. 26 (Rev. 8) – "Recognition of merit", approved by the Standing Concertation Committee meeting on 3 September 2008, is now available on the intranet site of the Human Resources Department. It cancels and replaces Administrative Circular No. 26 (Rev. 7) – "Recognition of merit of staff members" of May 2007. Paper copies will shortly be available in Departmental secretariats. Human Resources Department Tel. 78003

  16. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  17. REV7, a new gene concerned with UV mutagenesis in yeast

    International Nuclear Information System (INIS)

    Lawrence, C.W.; Das, G.; Christensen, R.B.

    1985-01-01

    Three allelic mutations of a new yeast gene, which we have named REV7, have been isolated by testing 313 methyl methane sulfonate sensitive mutants for UV-induced reversion of a lys2 allele. Rev7 mutants are markedly deficient with respect to UV-induced reversion of lys2, are slightly sensitive to UV and appear to be in the RAD6 epistasis group for UV survival. Rev7-1, which is probably an amber mutation, does not appear to affect sporulation in homozygous diploids. The REV7 gene is located about 12 cM distal to HIS5 on chromosome IX. (orig.)

  18. REV7, a new gene concerned with UV mutagenesis in yeast

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence, C.W.; Das, G.; Christensen, R.B.

    1985-06-26

    Three allelic mutations of a new yeast gene, which we have named REV7, have been isolated by testing 313 methyl methane sulfonate sensitive mutants for UV-induced reversion of a lys2 allele. REV7 mutants are markedly deficient with respect to UV-induced reversion of lys2, are slightly sensitive to UV and appear to be in the RAD6 epistasis group for UV survival. Rev7-1, which is probably an amber mutation, does not appear to affect sporulation in homozygous diploids. The REV7 gene is located about 12 cM distal to HIS5 on chromosome IX.

  19. An analysis of international situation concerning nuclear security. Focused on the revision to INFCIRC/225/Rev.5

    International Nuclear Information System (INIS)

    Inamura, Tomoaki; Tanabe, Tomoyuki

    2011-01-01

    Since the September 11 attacks in 2001, counterterrorism measures have become not just domestic issues but critical issues that need international cooperation. Various nuclear security measures are in place as part of international counterterrorism measures. This report looks at the trend of international nuclear security measures to get implications for Japan, focusing on INFCIRC/225/Rev.5, an international guideline for physical protection of nuclear materials and nuclear facilities drawn up by IAEA. The observations of this report are as follows: 1) While legally binding nuclear security measures such as multilateral treaties and United Nations Security Council Resolutions impose minimum requirements on individual countries, the approaches led by IAEA or individual countries or private associations aim at more detailed consideration or information sharing to further improve nuclear security. 2) INFCIRC/225/Rev.5 comprises new concepts such as risk-based physical protection and nuclear security culture, as well as extended range of threats such as insiders or stand-off attacks and broader scope of measures to response. Japan should consider incorporation of INFCIRC/225/Rev.5 to its national laws and regulations putting in mind that it may have heavy influence and that Japan pledged to role leadership about nuclear security to international society. (author)

  20. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  1. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  2. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  3. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  4. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  5. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  6. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  7. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  8. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  9. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  11. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  12. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  13. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  14. Molecular interaction between K-Ras and H-REV107 in the Ras signaling pathway.

    Science.gov (United States)

    Han, Chang Woo; Jeong, Mi Suk; Jang, Se Bok

    2017-09-16

    Ras proteins are small GTPases that serve as master moderators of a large number of signaling pathways involved in various cellular processes. Activating mutations in Ras are found in about one-third of cancers. H-REV107, a K-Ras binding protein, plays an important role in determining K-Ras function. H-REV107 is a member of the HREV107 family of class II tumor suppressor genes and a growth inhibitory Ras target gene that suppresses cellular growth, differentiation, and apoptosis. Expression of H-REV107 was strongly reduced in about 50% of human carcinoma cell lines. However, the specific molecular mechanism by which H-REV107 inhibits Ras is still unknown. In the present study, we suggest that H-REV107 forms a strong complex with activating oncogenic mutation Q61H K-Ras from various biochemical binding assays and modeled structures. In addition, the interaction sites between K-Ras and H-REV107 were predicted based on homology modeling. Here, we found that some structure-based mutants of the K-Ras disrupted the complex formation with H-REV107. Finally, a novel molecular mechanism describing K-Ras and H-REV107 binding is suggested and insights into new K-Ras effector target drugs are provided. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. RevManHAL: towards automatic text generation in systematic reviews.

    Science.gov (United States)

    Torres Torres, Mercedes; Adams, Clive E

    2017-02-09

    Systematic reviews are a key part of healthcare evaluation. They involve important painstaking but repetitive work. A major producer of systematic reviews, the Cochrane Collaboration, employs Review Manager (RevMan) programme-a software which assists reviewers and produces XML-structured files. This paper describes an add-on programme (RevManHAL) which helps auto-generate the abstract, results and discussion sections of RevMan-generated reviews in multiple languages. The paper also describes future developments for RevManHAL. RevManHAL was created in Java using NetBeans by a programmer working full time for 2 months. The resulting open-source programme uses editable phrase banks to envelop text/numbers from within the prepared RevMan file in formatted readable text of a chosen language. In this way, considerable parts of the review's 'abstract', 'results' and 'discussion' sections are created and a phrase added to 'acknowledgements'. RevManHAL's output needs to be checked by reviewers, but already, from our experience within the Cochrane Schizophrenia Group (200 maintained reviews, 900 reviewers), RevManHAL has saved much time which is better employed thinking about the meaning of the data rather than restating them. Many more functions will become possible as review writing becomes increasingly automated.

  16. Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. IV. Influence of DNA replication and excision repair on REV2 dependent UV-mutagenesis and repair

    Energy Technology Data Exchange (ETDEWEB)

    Siede, W.; Eckardt, F.

    1986-01-01

    A double mutant being thermoconditionally defective in mutation induction as well as in repair of pre-lethal UV-induced DNA damage (rev2ts) and deficient in excision repair (rad3-2) was studied in temperature-shift experiments. The influence of inhibitors of DNA replication (hydroxyurea, aphidicolin) was determined. Additionally, an analysis of the dose-response pattern of mutation induction (mutation kinetics) at several ochre alleles was carried out. It was concluded that the UV-inducible REV2 dependent mutagenic repair process is not induced in excision-deficient cells. In excision-deficient cells, REV2 dependent mutation fixation is slow and mostly post-replicative though not dependent on DNA replication. The REV2 mediated mutagenic process could be separated from the repair function.

  17. Wind Farm Wake: The Horns Rev Photo Case

    Directory of Open Access Journals (Sweden)

    Pierre-Elouan Réthoré

    2013-02-01

    Full Text Available The aim of the paper is to examine the nowadays well-known wind farm wake photographs taken on 12 February 2008 at the offshore Horns Rev 1 wind farm. The meteorological conditions are described from observations from several satellite sensors quantifying clouds, surface wind vectors and sea surface temperature as well as ground-based information at and near the wind farm, including Supervisory Control and Data Acquisition (SCADA data. The SCADA data reveal that the case of fog formation occurred 12 February 2008 on the 10:10 UTC. The fog formation is due to very special atmospheric conditions where a layer of cold humid air above a warmer sea surface re-condensates to fog in the wake of the turbines. The process is fed by warm humid air up-drafted from below in the counter-rotating swirl generated by the clock-wise rotating rotors. The condensation appears to take place primarily in the wake regions with relatively high axial velocities and high turbulent kinetic energy. The wind speed is near cut-in and most turbines produce very little power. The rotational pattern of spiraling bands produces the large-scale structure of the wake fog.

  18. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Mining the Human Complexome Database Identifies RBM14 as an XPO1-Associated Protein Involved in HIV-1 Rev Function

    OpenAIRE

    Budhiraja, Sona; Liu, Hongbing; Couturier, Jacob; Malovannaya, Anna; Qin, Jun; Lewis, Dorothy E.; Rice, Andrew P.

    2015-01-01

    By recruiting the host protein XPO1 (CRM1), the HIV-1 Rev protein mediates the nuclear export of incompletely spliced viral transcripts. We mined data from the recently described human nuclear complexome to identify a host protein, RBM14, which associates with XPO1 and Rev and is involved in Rev function. Using a Rev-dependent p24 reporter plasmid, we found that RBM14 depletion decreased Rev activity and Rev-mediated enhancement of the cytoplasmic levels of unspliced viral transcripts. RBM14 ...

  20. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  1. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  2. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  3. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  5. Guidance and considerations for the implementation of INFCIRC/225/Rev.4, the physical protection of nuclear material and nuclear facilities

    International Nuclear Information System (INIS)

    2000-05-01

    This publication is intended to provide guidance and considerations for a State's competent authority to better understand and prescribe appropriate requirements, consistent with INFCIRC/225/Rev.4 for the protection of nuclear material and nuclear facilities which are compatible with accepted international practice. This report, together with a more detailed report, Handbook on the Physical Protection of Nuclear Material and Facilities, which addresses to the licencee or designer of physical protection systems who has specific implementation and compliance responsibilities, should be used in conjunction to each other to provide better and comprehensive guidance on physical protection

  6. Guidance and considerations for the implementation of INFCIRC/225/Rev.4, the physical protection of nuclear material and nuclear facilities

    International Nuclear Information System (INIS)

    2002-05-01

    This publication is intended to provide guidance and considerations for a State's competent authority to better understand and prescribe appropriate requirements, consistent with INFCIRC/225/Rev.4 for the protection of nuclear material and nuclear facilities which are compatible with accepted international practice. This report, together with a more detailed report, Handbook on the Physical Protection of Nuclear Material and Facilities, which addresses to the licensee or designer of physical protection systems who has specific implementation and compliance responsibilities, should be used in conjunction to each other to provide better and comprehensive guidance on physical protection

  7. Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M. [The University of Queensland, Institute for Molecular Bioscience, St. Lucia, Qld 4072 (Australia); Cleasby, Mark E. [Diabetes and Obesity Research Program, Garvan Institute of Medical Research, St. Vincent' s Hospital, 384 Victoria Street, Darlinghurst, Sydney, NSW 2010 (Australia); Millard, Susan; Leong, Gary M. [The University of Queensland, Institute for Molecular Bioscience, St. Lucia, Qld 4072 (Australia); Cooney, Gregory J. [Diabetes and Obesity Research Program, Garvan Institute of Medical Research, St. Vincent' s Hospital, 384 Victoria Street, Darlinghurst, Sydney, NSW 2010 (Australia); Muscat, George E.O., E-mail: g.muscat@imb.uq.edu.au [The University of Queensland, Institute for Molecular Bioscience, St. Lucia, Qld 4072 (Australia)

    2009-10-30

    The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, a previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.

  8. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  9. TEN YEARS OF THE NORTHEASTERN NURSING NETWORK JOURNAL - REV RENE: A DREAM COME TRUE

    Directory of Open Access Journals (Sweden)

    Inacia Sátiro Xavier de Franca

    2011-01-01

    Full Text Available Objetivou-se analisar a memória histórica da Rev Rene ao longo de uma década de sua existência destacando a sua organização, a produção científica e as conquistas alcançadas no concernente a sua indexação nas bases de dados. Estudo fenomenológico cujos dados foram coletados por meio de um formulário, submetidos a associações livres e interpretados em consonância com “A poética do espaço”. Os núcleos foram: Universidade Federal do Ceará (UFC — A casa da Rev Rene; A Rev Rene — ninho — um espaço aberto aos pesquisadores da Saúde e áreas afins; Poética das gavetas do cofre e dos armários — o capital científico da Rev Rene à disposição dos leitores; A Rev Rene — concha — uma homologia poética; A Rev Rene é redonda — Metas e ações para a projeção no cenário nacional e internacional. A Rev Rene transpôs a dimensão do sonho e consolidou-se como um lócus de ciência.

  10. Rev-Erb co-regulates muscle regeneration via tethered interaction with the NF-Y cistrome

    Directory of Open Access Journals (Sweden)

    Ryan D. Welch

    2017-07-01

    Conclusions: Disrupting Rev-Erb activity in injured muscle accelerates regenerative muscle repair/differentiation through transcriptional de-repression of myogenic programs. Rev-Erb, therefore, may be a potent therapeutic target for a myriad of muscular disorders.

  11. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  12. Rev1, Rev3, or Rev7 siRNA Abolishes Ultraviolet Light-Induced Translesion Replication in HeLa Cells: A Comprehensive Study Using Alkaline Sucrose Density Gradient Sedimentation

    Directory of Open Access Journals (Sweden)

    Jun Takezawa

    2010-01-01

    Full Text Available When a replicative DNA polymerase stalls upon encountering a lesion on the template strand, it is relieved by other low-processivity polymerase(s, which insert nucleotide(s opposite the lesion, extend by a few nucleotides, and dissociate from the 3′-OH. The replicative polymerase then resumes DNA synthesis. This process, termed translesion replication (TLS or replicative bypass, may involve at least five different polymerases in mammals, although the participating polymerases and their roles have not been entirely characterized. Using siRNAs originally designed and an alkaline sucrose density gradient sedimentation technique, we verified the involvement of several polymerases in ultraviolet (UV light-induced TLS in HeLa cells. First, siRNAs to Rev3 or Rev7 largely abolished UV-TLS, suggesting that these 2 gene products, which comprise Polζ, play a main role in mutagenic TLS. Second, Rev1-targeted siRNA also abrogated UV-TLS, indicating that Rev1 is also indispensable to mutagenic TLS. Third, Polη-targeted siRNA also prevented TLS to a greater extent than our expectations. Forth, although siRNA to Polι had no detectable effect, that to Polκ delayed UV-TLS. To our knowledge, this is the first study reporting apparent evidence for the participation of Polκ in UV-TLS.

  13. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  14. Stable isotope geochemistry. 3. rev. and enl. ed.

    International Nuclear Information System (INIS)

    Hoefs, J.

    1987-01-01

    Stable Isotope Geochemistry is an authoritative book comprising theoretical and experimental principles; surveying important fractionation mechanisms affecting the most important elements; discussing the natural variations of geologically important reservoirs. This updated 3rd edition, with a completely rewritten and extended main part, contains two new chapters on stable isotope composition of mantle material and on changes of the ocean during the geological past. (orig.)

  15. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  16. A numerical-statistical approach to determining the representative elementary volume (REV of cement paste for measuring diffusivity

    Directory of Open Access Journals (Sweden)

    Zhang, M. Z.

    2010-12-01

    Full Text Available Concrete diffusivity is a function of its microstructure on many scales, ranging from nanometres to millimetres. Multi-scale techniques are therefore needed to model this parameter. Representative elementary volume (REV, in conjunction with the homogenization principle, is one of the most common multi-scale approaches. This study aimed to establish a procedure for establishing the REV required to determine cement paste diffusivity based on a three-step, numerical-statistical approach. First, several series of 3D cement paste microstructures were generated with HYMOSTRUC3D, a cement hydration and microstructure model, for different volumes of cement paste and w/c ratios ranging from 0.30 to 0.60. Second, the finite element method was used to simulate the diffusion of tritiated water through these microstructures. Effective cement paste diffusivity values for different REVs were obtained by applying Fick’s law. Finally, statistical analysis was used to find the fluctuation in effective diffusivity with cement paste volume, from which the REV was then determined. The conclusion drawn was that the REV for measuring diffusivity in cement paste is 100x100x100 μm3.

    La difusividad del hormigón depende de su microestructura a numerosas escalas, desde nanómetros hasta milímetros, por lo que se precisa de técnicas multiescala para representar este parámetro. Junto con el principio de homogeneización, uno de los métodos multiescala más habituales es el volumen elemental representativo (VER. El objeto de este estudio era establecer un procedimiento que permitiera determinar el VER necesario para calcular la difusividad de la pasta de cemento, basándose en un método numéricoestadístico que consta de tres etapas. Primero, se crearon varias series de microestructuras de pasta de cemento en 3D con HYMOSTRUC3D, un programa que permite crear un modelo de la hidratación y microestructura del cemento. Luego se empleó el método de

  17. Teede REV-2 otsustas börsile minna / Gea Velthut-Sokka

    Index Scriptorium Estoniae

    Velthut-Sokka, Gea, 1977-

    2004-01-01

    Eelmise aasta edukaima ehitusfirma Teede REV-2 ja tema suurinvestori Alta Kapital esindajad põhjendavad börsile mineku otsust. Tabelid ja diagrammid: Veerandi aktsiate omanikuvahetus börsilemineku peaprooviks

  18. REV ÜRÜNLERİN MUHASEBELEŞTİRİLMESİ

    OpenAIRE

    YURT, Eda

    2009-01-01

    Eda, Yurt, Türev Ürünlerin Muhasebelestirilmesi, Tezsiz Yüksek Lisans Dönem Projesi,Danısman: Doç. Dr. Kadir Gürdal, 58 s.BİTİRME PROJESİ ÖZETİProje finansal araçlar olarak türev ürünlerin muhasebelestirilmesine iliskinstandartların incelenmesini amaçlamaktadır. Öncelikle finansal risk tanımlanmıstır.Daha sonra türev piyasaların tarihi anlatılmıs ve islem gördükleri piyasalara göresınıflandırılmıstır. Bu temel açıklamalar sonrasında türev ürünler için UluslararasıMuhasebe Standartları incelen...

  19. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  20. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  1. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  2. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  3. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  4. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  5. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  6. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  7. Infauna monitoring Horns Rev offshore wind farm. Annual state report 2004

    Energy Technology Data Exchange (ETDEWEB)

    Bech, M.; Frederiksen, R.; Pedersen, John; Leonhard, S.B.

    2005-04-15

    A total of 40 species were identified from the surveys in the Horns Rev area in September 2004 while 42 species were identified in 2003 and 47 species in September 2001. The decline in the number of species occurred both inside the wind farm and reference areas, which indicates that the decline could be a combination of changes in sediment characteristics and natural variation rather than an effect from the establishment of the wind farm. More species were not associated with the hard substrate at the turbine sites in 2004 compared to 2003, while in 2001, more species were associated with fine-grained sand. The median sediment grain size increased from 2001 to 2003 to 2004, which suggests that the velocity of the current increased, but modelling calculations on current speed predicted a 2% reduction in the wind farm area and up to a 15% reduction very close to the scour protection. These results agreed with the grain sizes found at the stations 5, 25 and 100 metres from the scour protection. At most stations, the medium grain size was 5 metres lower from the scour protection compared with the station 100 metres from the scour protection, which indicates that the velocity of the current was lower close to the scour protection. No significant impact on the infauna in the wind farm area was detectable concerning distance-related effects. Though general reductions in the population size of some of the character species in the surveyed areas might be related to changes in the sediment structure, the infauna community at Horns Rev showed no obvious sign of stress response as a consequence of possible impact from construction and operating activities. New species were observed in 2003 and 2004 and some of these might be a result of sediment characteristics, less predation or natural variation. The recording of other species might be a result of the introduction of hard bottom habitants in the wind farm area. The density of the most abundant bivalves and bristle worms was

  8. Infauna monitoring Horns Rev offshore wind farm. Annual status report 2004

    International Nuclear Information System (INIS)

    Bech, M.; Frederiksen, R.; Pedersen, John; Leonhard, S.B.

    2005-04-01

    A total of 40 species were identified from the surveys in the Horns Rev area in September 2004 while 42 species were identified in 2003 and 47 species in September 2001. The decline in the number of species occurred both inside the wind farm and reference areas, which indicates that the decline could be a combination of changes in sediment characteristics and natural variation rather than an effect from the establishment of the wind farm. More species were not associated with the hard substrate at the turbine sites in 2004 compared to 2003, while in 2001, more species were associated with fine-grained sand. The median sediment grain size increased from 2001 to 2003 to 2004, which suggests that the velocity of the current increased, but modelling calculations on current speed predicted a 2% reduction in the wind farm area and up to a 15% reduction very close to the scour protection. These results agreed with the grain sizes found at the stations 5, 25 and 100 metres from the scour protection. At most stations, the medium grain size was 5 metres lower from the scour protection compared with the station 100 metres from the scour protection, which indicates that the velocity of the current was lower close to the scour protection. No significant impact on the infauna in the wind farm area was detectable concerning distance-related effects. Though general reductions in the population size of some of the character species in the surveyed areas might be related to changes in the sediment structure, the infauna community at Horns Rev showed no obvious sign of stress response as a consequence of possible impact from construction and operating activities. New species were observed in 2003 and 2004 and some of these might be a result of sediment characteristics, less predation or natural variation. The recording of other species might be a result of the introduction of hard bottom habitants in the wind farm area. The density of the most abundant bivalves and bristle worms was

  9. Offshore wind farms in the local environment - an examination at Horns Rev Offshore Wind Farm. Background report; Havvindmoeller i lokalomraadet - en undersoegelse ved Horns Rev Havmoellepark. Baggrundsrapport

    Energy Technology Data Exchange (ETDEWEB)

    Kuehn, Susanne

    2005-07-01

    Horns Rev Offshore Wind Farm was built in 2002. A presentation is made of a sociological, qualitative survey on the local community's reception of the offshore wind farm. The survey aims at identifying attitudes towards the farm before and after the construction, with a view to identifying possible changes in attitudes, and explain the reasons for these (ml)

  10. Nullbasic, a potent anti-HIV tat mutant, induces CRM1-dependent disruption of HIV rev trafficking.

    Directory of Open Access Journals (Sweden)

    Min-Hsuan Lin

    Full Text Available Nullbasic, a mutant of the HIV-1 Tat protein, has anti-HIV-1 activity through mechanisms that include inhibition of Rev function and redistribution of the HIV-1 Rev protein from the nucleolus to the nucleoplasm and cytoplasm. Here we investigate the mechanism of this effect for the first time, establishing that redistribution of Rev by Nullbasic is not due to direct interaction between the two proteins. Rather, Nullbasic affects subcellular localization of cellular proteins that regulate Rev trafficking. In particular, Nullbasic induced redistribution of exportin 1 (CRM1, nucleophosmin (B23 and nucleolin (C23 from the nucleolus to the nucleus when Rev was coexpressed, but never in its absence. Inhibition of the Rev:CRM1 interaction by leptomycin B or a non-interacting RevM10 mutant completely blocked redistribution of Rev by Nullbasic. Finally, Nullbasic did not inhibit importin β- or transportin 1-mediated nuclear import, suggesting that cytoplasmic accumulation of Rev was due to increased export by CRM1. Overall, our data support the conclusion that CRM1-dependent subcellular redistribution of Rev from the nucleolus by Nullbasic is not through general perturbation of either nuclear import or export. Rather, Nullbasic appears to interact with and disrupt specific components of a Rev trafficking complex required for its nucleocytoplasmic shuttling and, in particular, its nucleolar accumulation.

  11. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  12. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  13. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  14. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  15. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  16. Why did the experts go wrong? 3. rev. ed.

    International Nuclear Information System (INIS)

    Karcev, V.P.; Chazanovskij, P.M.

    1990-01-01

    The accidents which happened in the recent past (the Challenger explosion, the Chernobyl reactor accident, the Admiral Nachimow-Piotr Wassew collision and the Zeebrugge ferry accident) show that an insufficient human rather than an insufficient technical reliability is responsible for the grave accidents and catastrophes which haunt the high-technology age. Catastrophes cannot be avoided unless exaggerated euphoric or anti-technology views are replaced by responsible human action based on the latest scientific and technical knowledge. (orig./BBR) [de

  17. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  18. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  19. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  20. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  1. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  2. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  3. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  4. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  5. B23/nucleophosmin interacts with bovine immunodeficiency virus Rev protein and facilitates viral replication.

    Science.gov (United States)

    Passos-Castilho, Ana Maria; Marchand, Claude; Archambault, Denis

    2018-02-01

    The bovine immunodeficiency virus (BIV) Rev shuttling protein contains nuclear/nucleolar localization signals and nuclear import/export mechanisms that are novel among lentivirus Rev proteins. Several viral proteins localize to the nucleolus, which may play a role in processes that are essential to the outcome of viral replication. Although BIV Rev localizes to the nucleoli of transfected/infected cells and colocalizes with one of its major proteins, nucleophosmin (NPM1, also known as B23), the role of the nucleolus and B23 in BIV replication remains to be determined. Here, we demonstrate for the first time that BIV Rev interacts with nucleolar phosphoprotein B23 in cells. Using small interfering RNA (siRNA) technology, we show that depletion of B23 expression inhibits virus production by BIV-infected cells, indicating that B23 plays an important role in BIV replication. The interaction between Rev and B23 may represent a potential new target for the development of antiviral drugs against lentiviruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. SEM-REV: A sea test site for Marine Energy Converter

    International Nuclear Information System (INIS)

    Berhault, Christian; Le Crom, Izan; Le Bihan, Gerard

    2015-01-01

    Thanks to a main funding of Region des Pays de la Loire, the sea test site SEM-REV has been developed by Ecole Centrale de Nantes since 2007 to test both Wave Energy Converters and Floating Wind Turbine in real sea conditions. The sea test site is equipped with a set of oceanographic sensors and with an electric cable of 8 MW, connected to the French grid. The project is located close to Le Croisic, Western coast of France. SEM-REV is one of the main test facilities operated by Ecole Centrale de Nantes to support MRE technologies development. After presenting the initial motivations of the SEM-REV development, the paper describes, in parts 1 and 2, the complete administrative and technical processes that were followed to reach SEM-REV commissioning in 2014. The third part is focused on the exploitation process, including technical and contractual specifications imposed to the MRE developers for installation, tests and decommissioning phases. Some words are given also on the R and D projects using the SEM-REV in-situ monitoring system: prediction of environmental conditions, bio-fooling, acoustic impact. Even if operational phase is not started, expected extensions of the tests site are listed. (authors)

  7. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  8. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  9. The Chernobyl reactor accident and its consequences. 3. rev. ed.

    International Nuclear Information System (INIS)

    1987-01-01

    The report presents a comprehensive survey of measured data explaining the radiation exposure in the Land Hessen, and a chronological survey of the decisions and measures taken by the Hessian regional government in response to the Chernobyl reactor accident. The measures for instance included selection of appropriate measuring methods and sites, checking of various environmental material, waste disposal surveillance, and dose assessments, and a range of monitoring programmes. (PW) [de

  10. Active Diagnosis of Navy Machinery Rev 2.0

    Science.gov (United States)

    2016-10-01

    electrical distribution and potable water supply systems. Because of these dependencies, ship auxiliary system failures can cause combat load failure...buildup generally causes a pipe to disconnect from a junction, causing water to leak . This limits the faults that are testable, since many of the faults...pipes, junctions, pumps, flow meters, thermal loads, check valve, and water tank. Each agent is responsible for maintaining its constraints locally

  11. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  12. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  13. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  14. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  15. Oak Ridge National Laboratory Waste Management Plan. Rev. 1

    Energy Technology Data Exchange (ETDEWEB)

    None

    1991-12-01

    The goal of the Oak Ridge National Laboratory (ORNL) Waste Management Program is the protection of workers, the public, and the environment. A vital aspect of this goal is to comply with all applicable state, federal, and DOE requirements. Waste management requirements for DOE radioactive wastes are detailed in DOE Order 5820.2A, and the ORNL Waste Management Program encompasses all elements of this order. The requirements of this DOE order and other appropriate DOE orders, along with applicable Tennessee Department of Environment and Conservation (TDEC) and US Environmental Protection Agency (EPA) rules and regulations, provide the principal source of regulatory guidance for waste management operations at ORNL. The objective of the Oak Ridge National Laboratory Waste Management Plan is to compile and to consolidate information annually on how the ORNL Waste Management is to compile and to consolidate information annually on how the ORNL Waste Management Program is conducted, which waste management facilities are being used to manage wastes, what forces are acting to change current waste management systems, what activities are planned for the forthcoming fiscal year (FY), and how all of the activities are documented.

  16. Verification of failure avoidance concepts in R6 Rev3

    International Nuclear Information System (INIS)

    Milne, I.; Knee, N.

    1988-09-01

    The first part of this Report outlines how recent developments in fracture mechanics have led to a more accurate interpretation of the two-criteria approach to defect assessment. The implementation of these developments into Revision 3 of the Central Electricity Generating Board code of practice for the assessment of the defect tolerance of structures (R6) is described. One of the key elements of the revised version is the recommendation that the failure assessment line should be derived from the actual tensile stress/strain properties of the material. The second part of the Report addresses the validation of the method, which is a crucial step on the way to obtaining acceptance of R6 by, in particular, the regulatory bodies. The range of structures used to validate the procedure is illustrated by two examples. The use of conservative data and assumptions is fundamental to the R6 philosophy, which means that the procedure should not be used as a predictive tool. In the second example the importance of making these conservative assumptions is clearly illustrated. (author)

  17. Residues from waste incineration. Final report. Rev. ed.

    Energy Technology Data Exchange (ETDEWEB)

    Astrup, T.; Juul Pedersen, A.; Hyks, J.; Frandsen, F.J.

    2010-04-15

    The overall objective of the project was to improve the understanding of the formation and characteristics of residues from waste incineration. This was done focusing on the importance of the waste input and the operational conditions of the furnace. Data and results obtained from the project have been discussed in this report according to the following three overall parts: i) mass flows and element distribution, ii) flue gas/particle partitioning and corrosion/deposition aspects, and iii) residue leaching. This has been done with the intent of structuring the discussion while tacitly acknowledging that these aspects are interrelated and cannot be separated. Overall, it was found that the waste input composition had significant impact of the characteristics of the generated residues. A similar correlation between operational conditions and residue characteristics could not be observed. Consequently, the project recommend that optimization of residue quality should focus on controlling the waste input composition. The project results showed that including specific waste materials (and thereby also excluding the same materials) may have significant effects on the residue composition, residue leaching, aerosol and deposit formation.It is specifically recommended to minimize Cl in the input waste. Based on the project results, it was found that a significant potential for optimization of waste incineration exist. (Author)

  18. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  19. Ultraviolet-induced reversion of cyc1 alleles in radiation-sensitive strains of yeast. III. rev 3 mutant strains

    International Nuclear Information System (INIS)

    Lawrence, C.W.; Crhistensen, R.B.

    1979-01-01

    The role of rev3 gene function in uv-induced mutagenesis in the yeast Saccharomyces cerevisiae has been examined by determining the reversion of 12 well-defined cyc1 mutations in diploid strains homozygous for the rev3-1 or rev3-3 allale. The 12 cyc1 alleles include one ochre, one amber, four initiation, two proline missense, and four frameshift mutations. We find that the rev3 mutations reduce the frequency of UV-induced reversion of all of the cyc1 alleles, though different classes of alleles respond to a different extent. These results imply that the rev3 gene function is required for the production of a wide variety of mutational events, though probably not all, and show that each of the three rev loci have different mutational phenotypes. Such diverse phenotypes are not predicted by the unitary model for bacterial mutagenes, suggesting that this is at best an incomplete description of eukaryotic mutagenesis

  20. Interactions of the tropical oceans. Rev.ed.

    International Nuclear Information System (INIS)

    Latif, M.; Barnett, T.P.

    1994-01-01

    We have investigated the interactions of the tropical oceans on interannual time scales by conducting a series of uncoupled atmospheric and oceanic general circulation experiments and hybrid coupled model simulations. Our results illustrate the key role of the El Nino/Southern Oscillation (ENSO) phenomenon in generating interannual variability in all three tropical ocean basins. Sea surface temperature (SST) anomalies in the tropical Pacific force via a changed atmospheric circulation SST anomalies of the same sign in the Indian Ocean and SST anomalies of the opposite sign in the Atlantic. However, although air-sea interactions in the Indian and Atlantic Oceans are much weaker than those in the Pacific, they contribute significantly to the variability in these two regions. The role of these air-sea interactions is mainly that of an amplifyer by which the ENSO induced signals are enhanced in ocean and atmosphere. This process is particularly important in the tropical Atlantic region. We investigated also whether ENSO is part of a zonally propagating ''wave'' which travels around the globe with a time scale of several years. Consistent with observations, the upper ocean heat content in the various numerical simulations seems to propagate slowly around the globe. SST anomalies in the Pacific Ocean introduce a global atmospheric response which in turn forces variations in the other tropical oceans. Since the different oceans exhibit different response characteristics to low-frequency wind changes, the individual tropical ocean responses can add up coincidentally to look like a global wave, and that appears to be the situation. In particular, no evidence is found that the Indian Ocean can significantly affect the ENSO cycle in the Pacific. Finally, the potential for climate forecasts in the Indian and Atlantic Oceans appears to be enhanced if one includes, in a coupled way, remote influences from the Pacific. (orig.)

  1. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  2. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  3. HRensembleHR. High resolution ensemble for Horns Rev. Final project report; Offshore wind power

    Energy Technology Data Exchange (ETDEWEB)

    2010-03-15

    The wind farm output of an offshore-farm such as Horns Rev changes between nearly constant output to highly variable power output. A balance responsible will therefore benefit from knowing the variability of a wind farm in advance. Some understanding of the observed variability and the corresponding forecast error on offshore wind farms had been gathered in the past few years, while a large fraction (about 60%) of the error still lacked understanding and required further intense research. This was the outset at the beginning of the HREnsemble project. Results from the wave study, variability study, ocean coupling, findings from the sensitivity experiments, the iEnKF short-term forecast and finally the demonstration phase have given significant synergy. The most basic research result in the project is that the two empirical mode decomposition approaches, Hilbert-Huang and later the Ensemble Empirical Mode Decomposition (EEMD). Both approaches confirmed that significant variability exists in offshore conditions. It was found that the variability of the short time-scales (24 minutes) are either not explicitly visible in the grid-scale of the NWP models or in the best case significantly smoothed out in all of the tested model configurations. If we interpret 2/3 of the variability due to vertical waves not present in the mean flow and 1/3 of the variability due to meso-scale weather, then the model results and EEMD are consistent. We can however not verify this theory. At present we do not know if EEMD counts neither the events correct nor whether the ensemble forecast suppresses variability. The existence of variability above the time-scale related to friction between ocean waves and air can in fact explain some of the inconsistent results published in the literature and set a question mark behind the correctness of the calculation of friction in wave, ocean and weather modelling. (LN)

  4. Unprecedented NES non-antagonistic inhibitor for nuclear export of Rev from Sida cordifolia.

    Science.gov (United States)

    Tamura, Satoru; Kaneko, Masafumi; Shiomi, Atsushi; Yang, Guang-Ming; Yamaura, Toshiaki; Murakami, Nobutoshi

    2010-03-15

    Bioassay-guided separation from the MeOH extract of the South American medicinal plant Sida cordifolia resulted in isolation of (10E,12Z)-9-hydroxyoctadeca-10,12-dienoic acid (1) as an unprecedented NES non-antagonistic inhibitor for nuclear export of Rev. This mechanism of action was established by competitive experiment by the biotinylated probe derived from leptomycin B, the known NES antagonistic inhibitor. Additionally, structure-activity relationship analysis by use of the synthesized analogs clarified cooperation of several functionalities in the Rev-export inhibitory activity of 1. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Administrative Circular No. 22B (Rev. 2) - Compensation for hours of long-term shift work

    CERN Multimedia

    Department Head Office - HR Department

    2016-01-01

    Administrative Circular No. 22B (Rev. 2) entitled "Compensation for hours of long-term shift work",  approved by the Director-General following discussion in the Standing Concertation Committee meeting on 22 March 2016, will be available on 1st September 2016 via the following link: https://cds.cern.ch/record/2208538.   This revised circular cancels and replaces Administrative Circular No. 22B (Rev. 1) also entitled "Compensation for hours of long-term shift work" of March 2011. This document contains minor changes to reflect the new career structure. This circular will enter into force on 1st September 2016.

  6. Administrative Circular No. 13 (Rev. 4) - Guarantees for representatives of the personnel

    CERN Multimedia

    Department Head Office - HR Department

    2016-01-01

    Administrative Circular No. 13 (Rev. 4) entitled "Guarantees for representatives of the personnel", approved by the Director-General following discussion in the Standing Concertation Committee meeting on 22 March 2016, will be available on 1st September 2016 via the following link: https://cds.cern.ch/record/2208527.   This revised circular cancels and replaces Administrative Circular No. 13 (Rev. 3) also entitled "Guarantees for representatives of the personnel" of January 2014. This document contains a single change to reflect the terminology under the new career structure: the term "career path" is replaced by "grade". This circular will enter into force on 1st September 2016.

  7. Empirical investigation of wind farm blockage effects in Horn Rev 1 offshore wind farm

    DEFF Research Database (Denmark)

    Mitraszewski, Karol; Hansen, Kurt Schaldemose; Nygaard, Nicolai

    We present an empirical study of wind farm blockage effects based on Horns Rev 1 SCADA data. The mean inflow non-uniformities in wind speed are analyzed by calculating the mean power outputs of turbines located along the outer edges of the farm for different wind directions, wind speeds and stabi......We present an empirical study of wind farm blockage effects based on Horns Rev 1 SCADA data. The mean inflow non-uniformities in wind speed are analyzed by calculating the mean power outputs of turbines located along the outer edges of the farm for different wind directions, wind speeds...

  8. RevTrans: multiple alignment of coding DNA from aligned amino acid sequences

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Pedersen, Anders Gorm

    2003-01-01

    The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...

  9. Administrative Circular No. 11 (Rev. 4) - Categories of members of the personnel

    CERN Multimedia

    HR Department

    2016-01-01

    Administrative Circular No. 11 (Rev. 4) entitled "Categories of members of the personnel", approved by the Director-General following discussion in the Standing Concertation Committee meeting on 29 April 2016, will be available on 1 August 2016 via this following link.    This revised circular cancels and replaces the Administrative Circular No. 11 (Rev. 3) also entitled "Categories of members of the personnel" of September 2014. The main changes concern the status of apprentices and their transfer from the category of employed members of personnel to associated members of personnel. This circular will enter into force on 1 August 2016. Department Head Office

  10. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  11. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    OpenAIRE

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  12. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Directory of Open Access Journals (Sweden)

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  13. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    International Nuclear Information System (INIS)

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  14. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Directory of Open Access Journals (Sweden)

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  15. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Science.gov (United States)

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  16. Radiation protection training courses for physicians. 5. rev. ed.

    International Nuclear Information System (INIS)

    Stieve, F.E.

    1994-01-01

    The material for the basic course has been reviewed and updated in response to the 1987 amendment of the X-ray Ordinance and the 1989 amendment of the Radiation Protection Ordinance, and also takes into account the related directives and recommendations, including the ICRP recommendations published in 1990. The main subjects covered by the basic course are: (1) Fundamentals of radiation physics. (2) Fundamentals of radiobiology, genetic effects. (3) Basic principles of radiation protection. (4) Principles and concepts of dosimetry. (5) Natural and man-made radiation exposure. (6) Radiation accident management. (7) International and national legislation and sub-ordinate legislation. (8) Quality assurance and quality testing. (9) Tasks of the radiological safety officer. (10) Exercises and new units and quantities. (HP) [de

  17. License Application Design Selection Report, REV 01. August 1999

    International Nuclear Information System (INIS)

    Hastings, C.R.

    1999-01-01

    In December 1998, the U.S. Department of Energy (DOE) published the ''Viability Assessment of a Repository at Yucca Mountain'' (DOE 1998b). The Viability Assessment described a preliminary design of a potential repository at Yucca Mountain, Nevada, for disposal of spent nuclear fuel and high-level radioactive waste, and assessed the probable behavior of that repository design in the Yucca Mountain geologic setting. The report concluded that 'Yucca Mountain remains a promising site for a geologic repository and that work should proceed to support a decision in 2001 on whether to recommend the site to the President for development as a repository'. It also concluded that 'uncertainties remain about key natural processes, the preliminary design, and how the site and design would interact'. Recognizing that the design that was evaluated will be refined before a license application could be submitted, the Viability Aassesment notes that 'DOE is evaluating several design options and alternatives that could reduce existing uncertainty and improve the performance of the repository system'. During the preparation of the Viability Assessment, DOE asked the contractor for the Civilian Radioactive Waste Management Program to study alternative design concepts for a potential geologic repository for high-level radioactive waste at Yucca Mountain. The License Application Design Selection (LADS) project was initiated to conduct that study. The goal of the project was to develop and evaluate a diverse range of conceptual repository designs that work well in concert with the Yucca Mountain site and to recommend an initial design concept for the possible Site Recommendation and License Apllication. This report presents the results of the LADS project. The design process consisted of two phases. In Phase I, a series of basic design concepts (design alternatives) and components (design features) were analyzed for their potential value as elements of a repository design. In Phase II

  18. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  19. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Science.gov (United States)

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  20. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  1. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    Science.gov (United States)

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation. © 2017 Pocock et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  2. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Science.gov (United States)

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  3. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  4. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  5. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  6. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  7. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  8. Techniques for nuclear and particle physics experiments. 2. rev. ed.

    International Nuclear Information System (INIS)

    Leo, W.R.

    1992-01-01

    This book is an outgrowth of an advanced laboratory course in experimental nuclear and particle physics the author gave to physics majors at the University of Geneva during the years 1978- 1983. The course was offered to third and fourth year students, the latter of which had, at this point in their studies, chosen to specialize in experimental nuclear or particle physics. This implied that they would go on to do a 'diplome' thesis with one of the high- or intermediate-energy research groups in the physics department. The format of the course was such that the students were required to concentrate on only one experiment during the trimester, rather than perform a series of experiments as is more typical of a traditional course of this type. Their tasks thus included planning the experiment, learning the relevant techniques, setting up and troubleshooting the measuring apparatus, calibration, data-taking and analysis, as well as responsibility for maintaining their equipment, i.e., tasks resembling those in a real experiment. This more intensive involvement provided the students with a better understanding of the experimental problems encountered in a professional experiment and helped instill a certain independence and confidence which would prepare them for entry into a research group in the department. Teaching assistants were presented to help the students during the trimester and a series of weekly lectures was also given on various topics in experimental nuclear and particle physics. This included general information on detectors, nuclear electronics, statistics, the interaction of radiation in matter, etc., and a good deal of practical information for actually doing experiments. (orig.) With 254 figs

  9. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  10. Metabolism and apoptotic properties of elevated ceramide in HT29(rev) cells

    NARCIS (Netherlands)

    Veldman, R J; Klappe, K; Hoekstra, D; Kok, J W

    1998-01-01

    Ceramide (Cer) has been implicated in the regulation of apoptosis. In this study, we elevated cellular Cer levels in human colon-carcinoma (HT29(rev)) cells by incubating the cells in the presence of bacterial sphingomyelinase (bSMase) or, alternatively, in the presence of C2-Cer, a short-chain

  11. Material Trends ( From M.Imada, A. Fujimori, and Y. Tokura, Rev ...

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Material Trends ( From M.Imada, A. Fujimori, and Y. Tokura, Rev. Mod. Phys. 70, 1039 (1998) ). Differences due to changes in cation radius causing bending of Mn-O-Mn bonds. Extreme sensitivity to small changes.

  12. 48 CFR 53.301-18 - SF 18 (Rev. 6/95), Request for Quotations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false SF 18 (Rev. 6/95), Request for Quotations. 53.301-18 Section 53.301-18 Federal Acquisition Regulations System FEDERAL ACQUISITION... for Quotations. EC01MY91.002 [60 FR 34763, July 3, 1995] ...

  13. Identification of Small Molecule Translesion Synthesis Inhibitors That Target the Rev1-CT/RIR Protein-Protein Interaction.

    Science.gov (United States)

    Sail, Vibhavari; Rizzo, Alessandro A; Chatterjee, Nimrat; Dash, Radha C; Ozen, Zuleyha; Walker, Graham C; Korzhnev, Dmitry M; Hadden, M Kyle

    2017-07-21

    Translesion synthesis (TLS) is an important mechanism through which proliferating cells tolerate DNA damage during replication. The mutagenic Rev1/Polζ-dependent branch of TLS helps cancer cells survive first-line genotoxic chemotherapy and introduces mutations that can contribute to the acquired resistance so often observed with standard anticancer regimens. As such, inhibition of Rev1/Polζ-dependent TLS has recently emerged as a strategy to enhance the efficacy of first-line chemotherapy and reduce the acquisition of chemoresistance by decreasing tumor mutation rate. The TLS DNA polymerase Rev1 serves as an integral scaffolding protein that mediates the assembly of the active multiprotein TLS complexes. Protein-protein interactions (PPIs) between the C-terminal domain of Rev1 (Rev1-CT) and the Rev1-interacting region (RIR) of other TLS DNA polymerases play an essential role in regulating TLS activity. To probe whether disrupting the Rev1-CT/RIR PPI is a valid approach for developing a new class of targeted anticancer agents, we designed a fluorescence polarization-based assay that was utilized in a pilot screen for small molecule inhibitors of this PPI. Two small molecule scaffolds that disrupt this interaction were identified, and secondary validation assays confirmed that compound 5 binds to Rev1-CT at the RIR interface. Finally, survival and mutagenesis assays in mouse embryonic fibroblasts and human fibrosarcoma HT1080 cells treated with cisplatin and ultraviolet light indicate that these compounds inhibit mutagenic Rev1/Polζ-dependent TLS in cells, validating the Rev1-CT/RIR PPI for future anticancer drug discovery and identifying the first small molecule inhibitors of TLS that target Rev1-CT.

  14. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Energy Technology Data Exchange (ETDEWEB)

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  15. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    International Nuclear Information System (INIS)

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  16. Molecular typing of Brucella melitensis endemic strains and differentiation from the vaccine strain Rev-1.

    Science.gov (United States)

    Noutsios, Georgios T; Papi, Rigini M; Ekateriniadou, Loukia V; Minas, Anastasios; Kyriakidis, Dimitrios A

    2012-03-01

    In the present study forty-four Greek endemic strains of Br. melitensis and three reference strains were genotyped by Multi locus Variable Number Tandem Repeat (ML-VNTR) analysis based on an eight-base pair tandem repeat sequence that was revealed in eight loci of Br. melitensis genome. The forty-four strains were discriminated from the vaccine strain Rev-1 by Restriction Fragment Length Polymorphism (RFLP) and Denaturant Gradient Gel Electrophoresis (DGGE). The ML-VNTR analysis revealed that endemic, reference and vaccine strains are genetically closely related, while most of the loci tested (1, 2, 4, 5 and 7) are highly polymorphic with Hunter-Gaston Genetic Diversity Index (HGDI) values in the range of 0.939 to 0.775. Analysis of ML-VNTRs loci stability through in vitro passages proved that loci 1 and 5 are non stable. Therefore, vaccine strain can be discriminated from endemic strains by allele's clusters of loci 2, 4, 6 and 7. RFLP and DGGE were also employed to analyse omp2 gene and reveled different patterns among Rev-1 and endemic strains. In RFLP, Rev-1 revealed three fragments (282, 238 and 44 bp), while endemic strains two fragments (238 and 44 bp). As for DGGE, the electrophoretic mobility of Rev-1 is different from the endemic strains due to heterologous binding of DNA chains of omp2a and omp2b gene. Overall, our data show clearly that it is feasible to genotype endemic strains of Br. melitensis and differentiate them from vaccine strain Rev-1 with ML-VNTR, RFLP and DGGE techniques. These tools can be used for conventional investigations in brucellosis outbreaks.

  17. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Science.gov (United States)

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Offshore wind farms in the local community - a survey at Horns Rev wind farm. Background report; Havvindmoeller i lokalomraedet - en undersoegelse ved Horns Rev havmoellepark. Baggrundsrapport

    Energy Technology Data Exchange (ETDEWEB)

    Kuehn, S.

    2005-07-15

    This report is part of a socio-economic project about offshore wind farms' influence on the local community. The project is part of the monitoring programme in connection with the establishment of the offshore wind farms at Horns Rev and Nysted. The socio-economic project consists of a sociological and an environment-economic project. This report is part of the sociological project which has the purpose of identifying attitudes towards the wind farm before and after the erection with a view to identify possible changes in opinions and reasons for these changes. (BA)

  19. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Directory of Open Access Journals (Sweden)

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  20. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  2. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  3. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  4. MicroRNA-340 inhibits the proliferation and promotes the apoptosis of colon cancer cells by modulating REV3L

    Science.gov (United States)

    Arivazhagan, Roshini; Lee, Jaesuk; Bayarsaikhan, Delger; Kwak, Peter; Son, Myeongjoo; Byun, Kyunghee; Salekdeh, Ghasem Hosseini; Lee, Bonghee

    2018-01-01

    DNA Directed Polymerase Zeta Catalytic Subunit (REV3L) has recently emerged as an important oncogene. Although the expressions of REV3L are similar in normal and cancer cells, several mutations in REV3L have been shown to play important roles in cancer. These mutations cause proteins misfolding and mislocalization, which in turn alters their interactions and biological functions. miRNAs play important regulatory roles during the progression and metastasis of several human cancers. This study was undertaken to determine how changes in the location and interactions of REV3L regulate colon cancer progression. REV3L protein mislocalization confirmed from the immunostaining results and the known interactions of REV3L was found to be broken as seen from the PLA assay results. The mislocalized REV3L might interact with new proteins partners in the cytoplasm which in turn may play role in regulating colon cancer progression. hsa-miR-340 (miR-340), a microRNA down-regulated in colon cancer, was used to bind to and downregulate REV3L, and found to control the proliferation and induce the apoptosis of colon cancer cells (HCT-116 and DLD-1) via the MAPK pathway. Furthermore, this down-regulation of REV3L also diminished colon cancer cell migration, and down-regulated MMP-2 and MMP-9. Combined treatment of colon cancer cells with miR-340 and 5-FU enhanced the inhibitory effects of 5-FU. In addition, in vivo experiments conducted on nude mice revealed tumor sizes were smaller in a HCT-116-miR-340 injected group than in a HCT-116-pCMV injected group. Our findings suggest mutations in REV3L causes protein mislocalization to the cytoplasm, breaking its interaction and is believed to form new protein interactions in cytoplasm contributing to colon cancer progression. Accordingly, microRNA-340 appears to be a good candidate for colon cancer therapy. PMID:29435169

  5. Identification of Brucella melitensis Rev.1 vaccine-strain genetic markers: Towards understanding the molecular mechanism behind virulence attenuation.

    Science.gov (United States)

    Issa, Mohammad Nouh; Ashhab, Yaqoub

    2016-09-22

    Brucella melitensis Rev.1 is an avirulent strain that is widely used as a live vaccine to control brucellosis in small ruminants. Although an assembled draft version of Rev.1 genome has been available since 2009, this genome has not been investigated to characterize this important vaccine. In the present work, we used the draft genome of Rev.1 to perform a thorough genomic comparison and sequence analysis to identify and characterize the panel of its unique genetic markers. The draft genome of Rev.1 was compared with genome sequences of 36 different Brucella melitensis strains from the Brucella project of the Broad Institute of MIT and Harvard. The comparative analyses revealed 32 genetic alterations (30 SNPs, 1 single-bp insertion and 1 single-bp deletion) that are exclusively present in the Rev.1 genome. In silico analyses showed that 9 out of the 17 non-synonymous mutations are deleterious. Three ABC transporters are among the disrupted genes that can be linked to virulence attenuation. Out of the 32 mutations, 11 Rev.1 specific markers were selected to test their potential to discriminate Rev.1 using a bi-directional allele-specific PCR assay. Six markers were able to distinguish between Rev.1 and a set of control strains. We succeeded in identifying a panel of 32 genome-specific markers of the B. melitensis Rev.1 vaccine strain. Extensive in silico analysis showed that a considerable number of these mutations could severely affect the function of the associated genes. In addition, some of the discovered markers were able to discriminate Rev.1 strain from a group of control strains using practical PCR tests that can be applied in resource-limited settings. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Science.gov (United States)

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  7. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  8. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    Directory of Open Access Journals (Sweden)

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  9. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  10. Administrative Cicular No. 31 (Rev. 2) - International indemnity and non-resident allowance

    CERN Multimedia

    Department Head Office - HR Department

    2016-01-01

    Administrative Circular No. 31 (Rev. 2) entitled "International indemnity and non-resident allowance", approved by the Director-General following discussion in the Standing Concertation Committee meeting on 23 June 2016, will be available on 1st September 2016 via the following link: https://cds.cern.ch/record/2208547.   This revised circular cancels and replaces Administrative Circular No. 31 (Rev. 1) also entitled "International indemnity and non-resident allowance" of October 2007. The main changes reflect the decision taken in the framework of the five-yearly review to extend eligibility for international indemnity to all staff members, as well to introduce a distinction between current staff members and those recruited as from 1st September 2016. For the latter, the international indemnity will be calculated as a percentage of the minimum salary of the grade into which they are recruited; the amount granted to the former will not change, and is now expressed ...

  11. Administrative Circular No. 11 (Rev. 3) - Categories of members of the personnel

    CERN Multimedia

    2014-01-01

    Administrative Circular No. 11 (Rev. 3) entitled “Categories of members of the personnel”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 3 July 2014 and entering into force on 1 September 2014, is available on the intranet site of the Human Resources Department.   This circular is applicable to all members of the personnel. It cancels and replaces Administrative Circular No. 11 (Rev. 2) entitled “Categories of members of the personnel” of January 2013. The circular was revised in order to include a minor adjustment of the determination of required period of break in the payment of subsistence allowance to certain categories of associated members of the personnel (taking account of possible technical means of control). Furthermore, the possibility of traineeships of long duration was restricted to cases in which the traineeship is awarded pursuant to an agreement between CERN and a...

  12. Administrative Circular No. 13 (Rev. 3) - Guarantees for representatives of the personnel

    CERN Multimedia

    2014-01-01

    Administrative Circular No. 13 (Rev. 3) entitled “Guarantees for representatives of the personnel”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 5 December 2013 and entering into force on 1 January 2014, is available on the intranet site of the Human Resources Department (see here).   This circular is applicable to all members of the personnel. It cancels and replaces Administrative Circular No. 13 (Rev. 2) entitled “Guarantees for members of the personnel holding representative office” of November 1992. The circular was revised in order to adapt the time given to the representatives of the personnel to perform their elective mandate and to ensure more transparency in their activities, by indicating, inter alia, the percentage of time worked in the framework of their mandate, as well as the training, activities and ensuing results. Department Head Office HR Department

  13. Administrative circular n°23 (Rev. 3) – Special working hours

    CERN Multimedia

    2013-01-01

    Administrative Circular No. 23 (Rev. 3) entitled “Special working hours”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 11 October 2012 and entering into force on 1 January 2013, is available on the intranet site of the Human Resources Department.   This circular is applicable to staff members and fellows. It cancels and replaces Administrative Circular No. 23 (Rev. 2) entitled “Special working hours” of December 2008. Paragraph 6 a) of Annex II of this circular was revised following the modification of Article III 1.04 of the Staff Regulations approved by Council on 14 December 2012. The modification serves to adapt the minimum rest time to the fact that, in case of rapidly alternating shifts, a maximum of seven consecutive shifts may be performed. Department Head Office HR Department

  14. Administrative circular n°11 (REV. 2) – Categories of members of the personnel

    CERN Multimedia

    2012-01-01

    Administrative Circular No. 11 (Rev. 2) entitled “Categories of members of the personnel”, approved by the Director-General following discussion at the Standing Concertation Committee meeting of 11 May 2012 and entering into force on 1 January 2013, is available on the intranet site of the Human Resources Department. This circular is applicable to all members of the personnel. It cancels and replaces Administrative Circular No. 11 (Rev. 1) entitled “Categories of members of the personnel” of January 1997 as regards all contracts of members of the personnel issued on or after 1 January 2013. The circular was revised in order to take into account developments since the last revision of the categories of personnel in 1997 as well as the needs of the Organization and collaborating institutes. In particular, it introduces a new system for distinguishing categories of associated members of the personnel, namely with regard to the purpo...

  15. Administrative circular No. 20 (Rev. 2) – Use of private vehicules for journeys on official duty

    CERN Multimedia

    HR Department

    2011-01-01

    Administrative Circular No. 20 (Rev. 2) entitled "Use of private vehicles for journeys on official duty", adopted following discussion in the Standing Concertation Committee meeting of 21 September 2010 and entering into force on 1 January 2011, is available on the intranet site of the Human Resources Department: http://cern.ch/hr-docs/admincirc/admincirc.asp It cancels and replaces Administrative Circular No. 20 (Rev. 1) entitled "Use of private vehicles on official duty" of April 1993. This new version introduces, in particular, the payment of a kilometer allowance in case of emergency during standby duty or when on call and a simplified calculation of the allowance for journeys between sites. This circular also clarifies the type of permitted private vehicles. Department Head Office  

  16. Effects on birds of an offshore wind park at Horns Rev: Environmental impact assessment

    Energy Technology Data Exchange (ETDEWEB)

    Noer, H.; Kjaer Christensen, T.; Clausager, I.; Krag Petersen, I. [DMU, Dept. of Coastal Zone Ecology (Denmark)

    2000-07-01

    This report presents the technical background to the ornithological environmental impact assessment for the construction of an offshore windpark at Horns Rev, 14 km west-south-west of Blaevandshuk, Denmark. Construction of the park is planned to commence in 2001. The park will consist of c. 80 wind turbines, each of at least 1.8 MW, and cover an area of 27.5 km{sup 2} (including the 200 m exclusion zone around the park). (au)

  17. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Losers, Food, and Sex. Clerical Masculinity in the BBC Sitcom Rev.

    Directory of Open Access Journals (Sweden)

    Alexander Ornella

    2016-11-01

    Full Text Available Clerical masculinities, much like their lay/secular counterparts, often appear unchang¬ing because they are the products of naturalization processes. Clerical masculinities, however, are far from stable, for they live and breathe the dynamics of both their socio-religious context and their secular “others”. The BBC sitcom Rev. (BBC2, UK 2010–2014 is a refreshing take on the everyday life and problems of a vicar in the Church of England trying to avoid stereotypes that often come with clerical roles. Rev. (2010–2014 can be interpreted as an attempt to explore the negotiation processes of masculinity within an institution that is involved in the “production” of religion and gender roles. It shows that being a man in an institutional setting is as much a perfor¬mance as it is a more or less successful negotiation of other people’s expectations and one’s own worldview. In particular, the main male clerical characters in Rev. (2010– 2014 inhabit a position of power but all have their flaws. They can best be understood as losers whose clash with masculine systems renders them more human.

  19. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Science.gov (United States)

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  20. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Directory of Open Access Journals (Sweden)

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  1. Radiological emergency response - a functional approach

    International Nuclear Information System (INIS)

    Chowdhury, P.

    1998-01-01

    The state of Louisiana's radiological emergency response programme is based on the federal guidance 'Criteria for Preparation and Evaluation of Radiological Emergency Response Plans and Preparedness in Support of Nuclear Power Plants' (NUREG-0654, FEMA-REP-1 Rev. 1). Over the past 14 years, the planning and implementation of response capabilities became more organized and efficient; the training programme has strengthened considerably; co-ordination with all participating agencies has assumed a more co-operative role, and as a result, a fairly well integrated response planning has evolved. Recently, a more 'functional' approach is being adopted to maximize the programme's efficiency not only for nuclear power plant emergency response, but radiological emergency response as a whole. First, several broad-based 'components' are identified; clusters of 'nodes' are generated for each component; these 'nodes' may be divided into 'sub-nodes' which will contain some 'attributes'; 'relational bonds' among the 'attributes' will exist. When executed, the process begins and continues with the 'nodes' assuming a functional and dynamic role based on the nature and characteristics of the 'attributes'. The typical response based on stand-alone elements is thus eliminated, the overlapping of functions is avoided, and a well structured and efficient organization is produced, that is essential for today's complex nature of emergency response. (author)

  2. Transplutonium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  3. Status report of seabird surveys at Horns Rev, 2000-2001

    International Nuclear Information System (INIS)

    Kjaer Christensen, T.; Clausager, I.; Krag Petersen, I.

    2002-01-01

    The present report presents the results of three bird surveys conducted in the Horns Rev area during the second half of 2001. Due to poor weather conditions in December 2001, the last survey was, however, performed on 7 January 2002. The surveys are part of the base-line investigations of birds performed in relation to the proposed construction of an offshore wind farm at Horns Rev in the Danish part of the North Sea ca 14 km southwest of Blaevandshuk. The results of the surveys during August 2001 - January 2002 are presented together with the results obtained during the period August 2000 - April 2001, and are also compared to results obtained during the period August 1999 - April 2000. Based on the distribution of the most abundant bird species recorded during 16 aerial surveys performed during August 1999 - January 2002, there were no indications that the wind farm area was of any particular importance to the birds' exploitation of the Horns Rev area. Fish-eating species like divers, gannet, terns, auks and gulls generally showed scattered and variable distributions, mainly occurring in the areas north and south of Horns Rev, and with low numbers on the reef proper and within the planned wind farm area. The distribution of benthic foraging species, eider and common Scoter, showed that they mainly exploited the coastal parts of the area off Blaevandshuk and Skallingen, although common scoter was found in relatively high numbers on the southeast slopes of the Horns Rev and within the wind farm area in the April 2001 survey. Common scoters occurred in very high numbers in January 2002. This was probably related to increased immigration of birds from the inner Danish waters during a cold period in late December 2001. Preference analyses of bird exploitation of the Horns Rev area showed that if the birds completely avoid the wind farm area after erection of the wind turbines, this will affect less than 1% of the various species, except divers where 1.58% will be

  4. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Directory of Open Access Journals (Sweden)

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  5. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  6. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  7. Effects of tire inclination (turning traffic and dynamic loading on the pavement stress–strain responses using 3-D finite element modeling

    Directory of Open Access Journals (Sweden)

    Xiaodi Hu

    2017-07-01

    Full Text Available In this study, ABAQUS finite element (FE modeling in three-dimensional (3-D loading mode was utilized to analytically investigate and quantify the effects of tire inclination and dynamic loading on the stress–strain responses of a pavement structure under varying loading and environmental conditions. The input variables for modeling consisted of actual laboratory and field data obtained from an in-service highway US 59 and included the in-situ pavement structure, material properties (i.e., modulus and shear strength, traffic, and climatic (i.e., temperature data. Computational modeling and sensitivity analyses were conducted through variation of the following two input variables with a focus on the top surfacing hot-mix asphalt (HMA layer: a tire inclination angle to simulate turning traffic, and, b dynamic loading to simulate accelerating, steady rolling, and decelerating (braking traffic. The generated maximum shear stress and vertical strain responses were then analyzed and correlated to the HMA material strength and the actual measured/observed field rutting performance data. The corresponding results indicated that inclined tires (simulating turning traffic and decelerating (braking vehicles induced the most severe shear stresses and vertical strains on the pavement structure in terms of magnitude (i.e., increased; exceeding the HMA material strength in some cases. Thus, for pavement design and structural analysis purposes, the following critical highway areas that may be subjected to extreme stresses and strains due to turning and stopping (braking traffic, particularly in high temperature environments, should be given more attention with respect to material strength characterization to mitigate potential shear/rutting failures: intersections, junctions; urban stop–go sections, and curves. Keywords: 3-D FE stress–strain modeling, Rutting, Shear deformation, Shear stress, Vertical strains

  8. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  9. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Science.gov (United States)

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  10. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Science.gov (United States)

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  11. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Directory of Open Access Journals (Sweden)

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  12. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Science.gov (United States)

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Directory of Open Access Journals (Sweden)

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  14. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Directory of Open Access Journals (Sweden)

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  15. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Science.gov (United States)

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  16. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Science.gov (United States)

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  17. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Science.gov (United States)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  18. Investigation on the Cyclic Response of Superelastic Shape Memory Alloy (SMA Slit Damper Devices Simulated by Quasi-Static Finite Element (FE Analyses

    Directory of Open Access Journals (Sweden)

    Jong Wan Hu

    2014-02-01

    Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.

  19. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Directory of Open Access Journals (Sweden)

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  20. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Science.gov (United States)

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  1. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Science.gov (United States)

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  2. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Science.gov (United States)

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  3. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  4. DC Brushless Motor Control Design and Preliminary Testing for Independent 4-Wheel Drive Rev-11 Robotic Platform

    Directory of Open Access Journals (Sweden)

    Roni Permana Saputra

    2012-03-01

    Full Text Available This paper discusses the design of control system for brushless DC motor using microcontroller ATMega 16 that will be applied to an independent 4-wheel drive Mobile Robot LIPI version 2 (REV-11. The control system consists of two parts which are brushless DC motor control module and supervisory control module that coordinates the desired command to the motor control module. To control the REV-11 platform, supervisory control transmit the reference data of speed and direction of motor to control the speed and direction of each actuator on the platform REV-11. From the test results it is concluded that the designed control system work properly to coordinate and control the speed and direction of motion of the actuator motor REV-11 platform. 

  5. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  6. Guidance and considerations for the implementation of INFCIRC/225/Rev.4, the physical protection of nuclear material and nuclear facilities; Orientaciones y sugerencias para la aplicacion del documento INFCIRC/225/Rev.4, proteccion fisica de los materiales y las instalaciones nucleares

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-05-01

    This publication is intended to provide guidance and considerations for a State's competent authority to better understand and prescribe appropriate requirements, consistent with INFCIRC/225/Rev.4 for the protection of nuclear material and nuclear facilities which are compatible with accepted international practice. This report, together with a more detailed report, Handbook on the Physical Protection of Nuclear Material and Facilities, which addresses to the licensee or designer of physical protection systems who has specific implementation and compliance responsibilities, should be used in conjunction to each other to provide better and comprehensive guidance on physical protection.

  7. Horns Rev offshore wind farm. Environmental impact assessment of sea bottom and marine biology

    Energy Technology Data Exchange (ETDEWEB)

    Leonhard, S.B.

    2000-03-15

    An Environmental Impact Assessment (EIA) of a planned 150 MW offshore wind farm at Horns Rev has been carried out for the marine biology and sea bottom in the area, and includes vegetation and benthic fauna. The study forms part of a total EIA of the planned offshore wind farm. This EIA study has been drawn up in accordance with the guidelines laid down by the Ministry of Environment and Energy in the publication, 'Guidelines for preparation of EIAstudies for offshore wind farms. Horns Rev is situated off Blaevands Huk, which is Denmark's most westerly point. It is a shallow reef with water depths between 2 and 9 metres and is primarily composed of sand, gravel and pebbles. The area designated for the wind farm lies directly south of Horns Rev and is dominated by sand with a median particle size of 0.3 mm. Along the edges, towards areas of greater depth, the particle size increases. There are areas of fine sand in the deepest area, and in isolated pockets within the proposed wind farm site. The sediment is characterised by a very low (<1%) organic matter content. On the basis of the expected impact from the establishment of the wind farm, it is not deemed necessary to carry out special programmes during the construction phase for monitoring of the environmental-biological conditions. A monitoring and control programme is recommended during the production phase in order to follow the copper concentration in bivalves, or alternatively to initiate recovery or elimination of the copper-laden waste. A control programme is recommended during the production phase in order to follow the establishment and succession of the fouling community on the wind turbine foundations and scour-protecting revetments. (BA)

  8. Horns Rev offshore wind farm. Environmental impact assessment of sea bottom and marine biology

    Energy Technology Data Exchange (ETDEWEB)

    Leonhard, S B

    2000-03-15

    An Environmental Impact Assessment (EIA) of a planned 150 MW offshore wind farm at Horns Rev has been carried out for the marine biology and sea bottom in the area, and includes vegetation and benthic fauna. The study forms part of a total EIA of the planned offshore wind farm. This EIA study has been drawn up in accordance with the guidelines laid down by the Ministry of Environment and Energy in the publication, 'Guidelines for preparation of EIAstudies for offshore wind farms. Horns Rev is situated off Blaevands Huk, which is Denmark's most westerly point. It is a shallow reef with water depths between 2 and 9 metres and is primarily composed of sand, gravel and pebbles. The area designated for the wind farm lies directly south of Horns Rev and is dominated by sand with a median particle size of 0.3 mm. Along the edges, towards areas of greater depth, the particle size increases. There are areas of fine sand in the deepest area, and in isolated pockets within the proposed wind farm site. The sediment is characterised by a very low (<1%) organic matter content. On the basis of the expected impact from the establishment of the wind farm, it is not deemed necessary to carry out special programmes during the construction phase for monitoring of the environmental-biological conditions. A monitoring and control programme is recommended during the production phase in order to follow the copper concentration in bivalves, or alternatively to initiate recovery or elimination of the copper-laden waste. A control programme is recommended during the production phase in order to follow the establishment and succession of the fouling community on the wind turbine foundations and scour-protecting revetments. (BA)

  9. Bird numbers and distributions in the Horns Rev offshore wind farm area. Annual status report 2004

    Energy Technology Data Exchange (ETDEWEB)

    Krag Petersen, I.

    2005-07-01

    This report presents data from four aerial surveys of birds in the Horns Rev wind farm area in 2004. Three surveys from the winter and spring of 2004 are thoroughly reported here. The fourth survey of 9 September 2004 is reported in general terms, but not included in presentations of distribution and effect analyses of the wind farm. Data from this survey will be thoroughly dealt with in a future report. Including the four surveys of 2004, a total of 29 surveys have been performed in that area since August 1999. (au)

  10. Pilot power based rate control in CDMA 2000 1x EV-DO Rev-A

    Institute of Scientific and Technical Information of China (English)

    LIU Xiao-feng; GU Jian; YANG Hong-wen

    2008-01-01

    This article proposes a new algorithm to improvethe rate control efficiency of enhanced reverse link mediumaccess control (RLMAC) in the code division multiple access(CDMA) lx EV-DO release A(Rev. A) system. The newalgorithm brings reverse access terminal (AT) pilot power tothe RLMAC rate control procedure and makes it easier for alow pilot power user to increase its data rate when the systemis slightly loaded and harder to decrease its date rate when thesystem is heavily loaded. Numerical results of system levelsimulations show that the new algorithm can bring highersystem throughput, lower AT transmission power, and lowersystem load.

  11. Simulaton of the Avedøreværket Unit 1 Cogeneration Plant with DNA

    DEFF Research Database (Denmark)

    Elmegaard, Brian; Houbak, Niels

    2003-01-01

    The simulator contest proposed for the ECOS 2003 conference has been solved using the DNA energy system simulator. The contest concerns the steam process of the Avedøreværket Unit 1 (AVV1) power plant. The plant is a 250 MWCHP plant with a maximum district heat production of 330 MJ/s. The plant has...... a net electric efficiency of 42% and a maximum energy utilization of 92%. In this paper it is demonstrated, that the DNA model of AVV1 can calculate the whole flow sheet balance at any load point, i.e., any possible combination of power production and district heat production. The paper also contains...

  12. A novel, mouse mammary tumor virus encoded protein with Rev-like properties

    International Nuclear Information System (INIS)

    Indik, Stanislav; Guenzburg, Walter H.; Salmons, Brian; Rouault, Francoise

    2005-01-01

    We have identified a novel, multiple spliced, subgenomic mRNA species in MMTV producing cells of different origin containing an open reading frame encoding a 39-kDa Rev-like protein, Rem (regulator of expression of MMTV). An EGFP-Rem fusion protein is shown to be predominantly in the nucleolus. Further leptomycin B inhibits the nuclear export of nonspliced MMTV transcripts, implicating Rem in nuclear export by the Crm1 pathway in MMTV. Rem is thus reminiscent of the Rec protein from the related endogenous human retrovirus, HERV-K

  13. Fundamental study on REV based on crack tensor at the Mizunami Underground Research Laboratory

    International Nuclear Information System (INIS)

    Tanno, Takeo; Sato, Toshinori; Sanada, Hiroyuki; Hikima, Ryoichi; Kumasaka, Hiroo; Tada, Hiroyuki

    2013-01-01

    The crack tensor model which is a kind of equivalent continuum model has been studied in rock mechanical investigation in the MIU. The fractured rock mass is modeled as the elastic continuum model with this crack tensor. In this study, this crack tensor based on the geological observation in the MIU project was calculated, and Representative Elementary Volume (REV) in the ventilation shaft and -300 m access/research gallery was studied based on the relative error of this crack tensor. As a result, the convergence of the relative error was faster in the -300 m access/research gallery than in the ventilation shaft. (author)

  14. Structure and expression of two nuclear receptor genes in marsupials: insights into the evolution of the antisense overlap between the α-thyroid hormone receptor and Rev-erbα

    Directory of Open Access Journals (Sweden)

    Brown M Scott

    2010-12-01

    Full Text Available Abstract Background Alternative processing of α-thyroid hormone receptor (TRα, NR1A1 mRNAs gives rise to two functionally antagonistic nuclear receptors: TRα1, the α-type receptor, and TRα2, a non-hormone binding variant that is found only in mammals. TRα2 shares an unusual antisense coding overlap with mRNA for Rev-erbα (NR1D1, another nuclear receptor protein. In this study we examine the structure and expression of these genes in the gray short-tailed opossum, Monodelphis domestica, in comparison with that of eutherian mammals and three other marsupial species, Didelphis virginiana, Potorous tridactylus and Macropus eugenii, in order to understand the evolution and regulatory role of this antisense overlap. Results The sequence, expression and genomic organization of mRNAs encoding TRα1 and Rev-erbα are very similar in the opossum and eutherian mammals. However, the sequence corresponding to the TRα2 coding region appears truncated by almost 100 amino acids. While expression of TRα1 and Rev-erbα was readily detected in all tissues of M. domestica ages 0 days to 18 weeks, TRα2 mRNA was not detected in any tissue or stage examined. These results contrast with the widespread and abundant expression of TRα2 in rodents and other eutherian mammals. To examine requirements for alternative splicing of TRα mRNAs, a series of chimeric minigenes was constructed. Results show that the opossum TRα2-specific 5' splice site sequence is fully competent for splicing but the sequence homologous to the TRα2 3' splice site is not, even though the marsupial sequences are remarkably similar to core splice site elements in rat. Conclusions Our results strongly suggest that the variant nuclear receptor isoform, TRα2, is not expressed in marsupials and that the antisense overlap between TRα and Rev-erbα thus is unique to eutherian mammals. Further investigation of the TRα and Rev-erbα genes in marsupial and eutherian species promises to yield

  15. Structure and expression of two nuclear receptor genes in marsupials: insights into the evolution of the antisense overlap between the α-thyroid hormone receptor and Rev-erbα

    Science.gov (United States)

    2010-01-01

    Background Alternative processing of α-thyroid hormone receptor (TRα, NR1A1) mRNAs gives rise to two functionally antagonistic nuclear receptors: TRα1, the α-type receptor, and TRα2, a non-hormone binding variant that is found only in mammals. TRα2 shares an unusual antisense coding overlap with mRNA for Rev-erbα (NR1D1), another nuclear receptor protein. In this study we examine the structure and expression of these genes in the gray short-tailed opossum, Monodelphis domestica, in comparison with that of eutherian mammals and three other marsupial species, Didelphis virginiana, Potorous tridactylus and Macropus eugenii, in order to understand the evolution and regulatory role of this antisense overlap. Results The sequence, expression and genomic organization of mRNAs encoding TRα1 and Rev-erbα are very similar in the opossum and eutherian mammals. However, the sequence corresponding to the TRα2 coding region appears truncated by almost 100 amino acids. While expression of TRα1 and Rev-erbα was readily detected in all tissues of M. domestica ages 0 days to 18 weeks, TRα2 mRNA was not detected in any tissue or stage examined. These results contrast with the widespread and abundant expression of TRα2 in rodents and other eutherian mammals. To examine requirements for alternative splicing of TRα mRNAs, a series of chimeric minigenes was constructed. Results show that the opossum TRα2-specific 5' splice site sequence is fully competent for splicing but the sequence homologous to the TRα2 3' splice site is not, even though the marsupial sequences are remarkably similar to core splice site elements in rat. Conclusions Our results strongly suggest that the variant nuclear receptor isoform, TRα2, is not expressed in marsupials and that the antisense overlap between TRα and Rev-erbα thus is unique to eutherian mammals. Further investigation of the TRα and Rev-erbα genes in marsupial and eutherian species promises to yield additional insight into the

  16. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  17. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Science.gov (United States)

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  18. Fuel element

    International Nuclear Information System (INIS)

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  19. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  20. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Science.gov (United States)

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  1. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Science.gov (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  2. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Science.gov (United States)

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, inc