WorldWideScience

Sample records for responsive nanochannel g-quadruplex

  1. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  2. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  3. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  4. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  5. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  6. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  7. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  9. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  10. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  11. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  13. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Science.gov (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  14. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  15. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  16. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  17. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  18. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  19. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  20. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  1. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  2. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Transient response of nonideal ion-selective microchannel-nanochannel devices

    Science.gov (United States)

    Leibowitz, Neta; Schiffbauer, Jarrod; Park, Sinwook; Yossifon, Gilad

    2018-04-01

    We report evidence of variation in ion selectivity of a fabricated microchannel-nanochannel device resulting in the appearance of a distinct local maximum in the overlimiting chronopotentiometric response. In this system consisting of shallow microchannels joined by a nanochannel, viscous shear at the microchannel walls suppresses the electro-osmotic instability and prevents any associated contribution to the nonmonotonic response. Thus, this response is primarily electrodiffusive. Numerical simulations indicate that concentration polarization develops not only within the microchannel but also within the nanochannel itself, with a local voltage maximum in the chronopotentiometric response correlated with interfacial depletion and having the classic i-2 Sands time dependence. Furthermore, the occurrence of the local maxima is correlated with the change in selectivity due to internal concentration polarization. Understanding the transient nonideal permselective response is essential for obtaining fundamental insight and for optimizing efficient operation of practical fabricated nanofluidic and membrane devices.

  4. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  5. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  6. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  8. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  10. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  11. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  12. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  14. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  16. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  17. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  18. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  19. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  20. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  1. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  2. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  3. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  4. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  5. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  6. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  7. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  8. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  9. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  10. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  11. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  12. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  13. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  14. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  16. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  17. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  18. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  19. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  20. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  1. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  3. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  4. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  6. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  8. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  9. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  12. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  14. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  15. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  18. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  19. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  20. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  2. Ultra-high optical responsivity of semiconducting asymmetric nano-channel diodes for photon detection

    Science.gov (United States)

    Akbas, Y.; Plecenik, T.; Durina, P.; Plecenik, A.; Jukna, A.; Wicks, G.; Sobolewski, Roman

    2017-05-01

    The asymmetric nano-channel diode (ANCD) is the 2-dimensional electron gas (2DEG) semiconductor nanodevice that, unlike a conventional diode, relies on the device nanostructure and field-controlled transport in a ballistic nanometerwidth channel instead of barriers to develop its asymmetric, diode-like current-voltage (I-V) characteristics. We focus on ANCD optoelectronic properties, and demonstrate that the devices can act as very sensitive, single-photon-level, visiblelight photodetectors. Our test structures consist of 2-μm-long and 230-nm-wide channels and were fabricated using electron-beam lithography on a GaAs/AlGaAs heterostructure with a 2DEG layer, followed by reactive ion etching. The I-V curves were collected by measuring the transport current under the voltage-source biasing condition, both in the dark and under light illumination. The experiments were conducted inside a cryostat, in a temperature range from 300 K to 78 K. As an optical excitation, we used a 800-nm-wavelength, generated by a commercial Ti:sapphire laser operated either at a quasi-continuous-wave mode or as a source of 100-fs-wide pulses. The impact of the light illumination was very clear, and at low temperatures we observed a significant photocurrent Iph 0.25 μA at temperature 78 K for the incident optical power as low as 1 nW, with a limited dark-current background. The magnitude of the device optical responsivity increased linearly with the decrease of the optical power, reaching for 1-nW optical excitation the value as high as 400 A/W at room temperature and >800 A/W at 78K. The physics of the photoresponse gain mechanism in the ANCD arises from a vast disparity between the sub-picosecond transit time of photo-excited electrons travelling in the 2DEG nanochannel and the up to microsecond lifetime of photo-excited holes pushed towards the device substrate.

  3. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  4. Thermodynamics, electrostatics, and ionic current in nanochannels grafted with pH-responsive end-charged polyelectrolyte brushes.

    Science.gov (United States)

    Chen, Guang; Das, Siddhartha

    2017-03-01

    In this paper, we study the thermodynamics, electrostatics, and an external electric field driven ionic current in a pH-responsive, end-charged polyelectrolyte (PE) brush grafted nanochannel. By employing a mean field theory, we unravel a highly nonintuitive interplay of pH and electrolyte salt concentration in dictating the height of the end-charged PE brush. Larger pH or weak hydrogen ion concentration leads to maximum ionization of the charge-producing group-as a consequence, the resulting the electric double layer (EDL) energy get maximized causing a maximum deviation of the brush height from the value (d 0 ) of the uncharged brush. This deviation may result in enhancement or lowering of the brush height as compared to d 0 depending on whether the PE end locates lower or higher than h/2 (h is the nanochannel half height) and the salt concentration. Subsequently, we use this combined PE-brush-configuration-EDL-electrostatics framework to compute the ionic current in the nanochannel. We witness that the ionic current for smaller pH is much larger despite the corresponding magnitude of the EDL electrostatic potential being much smaller-this stems from the presence of a much larger concentration of H+ ions at small pH and the fact that H+ ions have very large mobilities. In fact, this ionic current shows a steep variation with pH that can be useful in exploring new designs for applications involving quantification and characterization of ionic current in PE-brush-grafted nanochannels. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  8. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  9. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  10. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  12. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  13. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  14. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  15. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  16. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  17. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  18. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  19. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  20. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  1. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  2. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  4. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  5. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  6. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  7. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  9. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  11. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  12. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  13. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  14. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  15. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  16. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  17. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  18. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  19. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  1. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  2. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  3. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  5. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  6. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  7. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  8. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  9. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  10. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  11. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  14. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  16. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  17. Nanochannels Photoelectrochemical Biosensor.

    Science.gov (United States)

    Zhang, Nan; Ruan, Yi-Fan; Zhang, Li-Bin; Zhao, Wei-Wei; Xu, Jing-Juan; Chen, Hong-Yuan

    2018-02-06

    Nanochannels have brought new opportunities for biosensor development. Herein, we present the novel concept of a nanochannels photoelectrochemical (PEC) biosensor based on the integration of a unique Cu x O-nanopyramid-islands (NPIs) photocathode, an anodic aluminum oxide (AAO) membrane, and alkaline phosphatase (ALP) catalytic chemistry. The Cu x O-NPIs photocathode possesses good performance, and further assembly with AAO yields a designed architecture composed of vertically aligned, highly ordered nanoarrays on top of the Cu x O-NPIs film. After biocatalytic precipitation (BCP) was stimulated within the channels, the biosensor was used for the successful detection of ALP activity. This study has not only provided a novel paradigm for an unconventional nanochannels PEC biosensor, which can be used for general bioanalytical purposes, but also indicated that the new concept of nanochannel-semiconductor heterostructures is a step toward innovative biomedical applications.

  18. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  19. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  20. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  2. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  3. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  4. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  5. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  7. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  8. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  9. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  10. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  11. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  12. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  13. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  15. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  16. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  17. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  19. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  20. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  1. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  4. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  5. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  6. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  7. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  8. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  9. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  10. DNA nanochannels [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Dianming Wang

    2017-04-01

    Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.

  11. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  13. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  14. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  16. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  17. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  18. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  19. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    DEFF Research Database (Denmark)

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I

    2014-01-01

    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  20. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  1. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  4. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Slip flow in graphene nanochannels

    DEFF Research Database (Denmark)

    . Kannam, Sridhar; Billy, Todd; Hansen, Jesper Schmidt

    2011-01-01

    We investigate the hydrodynamic boundary condition for simple nanofluidic systems such as argon and methane flowing in graphene nanochannels using equilibrium molecular dynamics simulations (EMD) in conjunction with our recently proposed method [J. S. Hansen, B. D. Todd, and P. J. Daivis, Phys. Rev....... E 84, 016313 (2011)10.1103/PhysRevE.84.016313]. We first calculate the fluid-graphene interfacial friction coefficient, from which we can predict the slip length and the average velocity of the first fluid layer close to the wall (referred to as the slip velocity). Using direct nonequilibrium...

  8. From nanochannel-induced proton conduction enhancement to a nanochannel-based fuel cell.

    Science.gov (United States)

    Liu, Shaorong; Pu, Qiaosheng; Gao, Lin; Korzeniewski, Carol; Matzke, Carolyn

    2005-07-01

    The apparent proton conductivity inside a nanochannel can be enhanced by orders of magnitude due to the electric double layer overlap. A nanochannel filled with an acidic solution is thus a micro super proton conductor, and an array of such nanochannels forms an excellent proton conductive membrane. Taking advantage of this effect, a new class of proton exchange membrane is developed for micro fuel cell applications.

  9. Bioinspired smart asymmetric nanochannel membranes.

    Science.gov (United States)

    Zhang, Zhen; Wen, Liping; Jiang, Lei

    2018-01-22

    Bioinspired smart asymmetric nanochannel membranes (BSANM) have been explored extensively to achieve the delicate ionic transport functions comparable to those of living organisms. The abiotic system exhibits superior stability and robustness, allowing for promising applications in many fields. In view of the abundance of research concerning BSANM in the past decade, herein, we present a systematic overview of the development of the state-of-the-art BSANM system. The discussion is focused on the construction methodologies based on raw materials with diverse dimensions (i.e. 0D, 1D, 2D, and bulk). A generic strategy for the design and construction of the BSANM system is proposed first and put into context with recent developments from homogeneous to heterogeneous nanochannel membranes. Then, the basic properties of the BSANM are introduced including selectivity, gating, and rectification, which are associated with the particular chemical and physical structures. Moreover, we summarized the practical applications of BSANM in energy conversion, biochemical sensing and other areas. In the end, some personal opinions on the future development of the BSANM are briefly illustrated. This review covers most of the related literature reported since 2010 and is intended to build up a broad and deep knowledge base that can provide a solid information source for the scientific community.

  10. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  11. Electrophoresis in nanochannels: brief review and speculation

    Directory of Open Access Journals (Sweden)

    Santiago Juan G

    2006-11-01

    Full Text Available Abstract The relevant physical phenomena that dominate electrophoretic transport of ions and macromolecules within long, thin nanochannels are reviewed, and a few papers relevant to the discussion are cited. Sample ion transport through nanochannels is largely a function of their interaction with electric double layer. For small ions, this coupling includes the net effect of the external applied field, the internal field of the double layer, and the non-uniform velocity of the liquid. Adsorption/desorption kinetics and the effects of surface roughness may also be important in nanochannel electrophoresis. For macromolecules, the resulting motion is more complex as there is further coupling via steric interactions and perhaps polarization effects. These complex interactions and coupled physics represent a valuable opportunity for novel electrophoretic and chromatographic separations.

  12. 1-D nanochannels fabricated in polyimide

    NARCIS (Netherlands)

    Eijkel, Jan C.T.; Bomer, Johan G.; Tas, Niels Roelof; van den Berg, Albert

    2004-01-01

    A simple method using spin-deposition and sacrificial layer etching is used to fabricate all-polyimide nanochannels (100 and 500 nm channel height). Channels are characterized using spontaneous capillary filling with water, ethanol and isopropanol, and with electroosmotic flow. The channels can be

  13. Pressure calculations in nanochannel gas flows

    NARCIS (Netherlands)

    Kim, J.H.; Frijns, A.J.H.; Nedea, S.V.; Steenhoven, van A.A.; Frijns, A.J.H.; Valougeorgis, D.; Colin, S.; Baldas, L.

    2012-01-01

    In this research, pressure driven flow within a nanochannel is studied for argon in rarefied gas states. A Molecular Dynamics simulation is used to resolve the density and stress variations. Normal stress calculations are based on Irving-Kirkwood method, which divides the stress tensor into its

  14. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  16. Capillarity Induced Negative Pressure of Water Plugs in Nanochannels

    NARCIS (Netherlands)

    Tas, Niels Roelof; Mela, P.; Kramer, Tobias; Berenschot, Johan W.; van den Berg, Albert

    2003-01-01

    We have found evidence that water plugs in hydrophilic nanochannels can be at significant negative pressure due to tensile capillary forces. The negative pressure of water plugs in nanochannels induces bending of the thin channel capping layer, which results in a visible curvature of the liquid

  17. Nanochannel Electroporation as a Platform for Living Cell Interrogation in Acute Myeloid Leukemia.

    Science.gov (United States)

    Zhao, Xi; Huang, Xiaomeng; Wang, Xinmei; Wu, Yun; Eisfeld, Ann-Kathrin; Schwind, Sebastian; Gallego-Perez, Daniel; Boukany, Pouyan E; Marcucci, Guido I; Lee, Ly James

    2015-12-01

    A living cell interrogation platform based on nanochannel electroporation is demonstrated with analysis of RNAs in single cells. This minimally invasive process is based on individual cells and allows both multi-target analysis and stimulus-response analysis by sequential deliveries. The unique platform possesses a great potential to the comprehensive and lysis-free nucleic acid analysis on rare or hard-to-transfect cells.

  18. Cathodoluminescence study of anodic nanochannel alumina

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Q.X. [Department of Electrical and Electronic Engineering, Saga University, Honjo-1, Saga, 840-8502 (Japan)]. E-mail: guoq@cc.saga-u.ac.jp; Hachiya, Y. [Department of Electrical and Electronic Engineering, Saga University, Honjo-1, Saga, 840-8502 (Japan); Tanaka, T. [Department of Electrical and Electronic Engineering, Saga University, Honjo-1, Saga, 840-8502 (Japan); Nishio, M. [Department of Electrical and Electronic Engineering, Saga University, Honjo-1, Saga, 840-8502 (Japan); Ogawa, H. [Department of Electrical and Electronic Engineering, Saga University, Honjo-1, Saga, 840-8502 (Japan)

    2006-07-15

    Nanochannel alumina (NCA) templates with highly ordered pore arrays were prepared by anodizing pure aluminum foil in acid solutions. Cathodoluminescence measurements reveal that a blue emission band appears at around 2.8 eV and its energy position depends on measurement temperature and pore size of NCA. The shift of the blue emission band energy with temperature is ascribed to the variations of electron-phonon interactions. X-ray absorption near-edge fine structure results show that the blue emission band shift with pore size is due to the local environment change of atoms in NCA.

  19. Electrokinetic motion of a rectangular nanoparticle in a nanochannel

    Energy Technology Data Exchange (ETDEWEB)

    Movahed, Saeid; Li Dongqing, E-mail: dongqing@mme.uwaterloo.ca [University of Waterloo, Department of Mechanical and Mechatronics Engineering (Canada)

    2012-08-15

    This article presents a theoretical study of electrokinetic motion of a negatively charged cubic nanoparticle in a three-dimensional nanochannel with a circular cross-section. Effects of the electrophoretic and the hydrodynamic forces on the nanoparticle motion are examined. Because of the large applied electric field over the nanochannel, the impact of the Brownian force is negligible in comparison with the electrophoretic and the hydrodynamic forces. The conventional theories of electrokinetics such as the Poisson-Boltzmann equation and the Helmholtz-Smoluchowski slip velocity approach are no longer applicable in the small nanochannels. In this study, and at each time step, first, a set of highly coupled partial differential equations including the Poisson-Nernst-Plank equation, the Navier-Stokes equations, and the continuity equation was solved to find the electric potential, ionic concentration field, and the flow field around the nanoparticle. Then, the electrophoretic and hydrodynamic forces acting on the negatively charged nanoparticle were determined. Following that, the Newton second law was utilized to find the velocity of the nanoparticle. Using this model, effects of surface electric charge of the nanochannel, bulk ionic concentration, the size of the nanoparticle, and the radius of the nanochannel on the nanoparticle motion were investigated. Increasing the bulk ionic concentration or the surface charge of the nanochannel will increase the electroosmotic flow, and hence affect the particle's motion. It was also shown that, unlike microchannels with thin EDL, the change in nanochannel size will change the EDL field and the ionic concentration field in the nanochannel, affecting the particle's motion. If the nanochannel size is fixed, a larger particle will move faster than a smaller particle under the same conditions.

  20. Electrokinetic motion of a rectangular nanoparticle in a nanochannel

    International Nuclear Information System (INIS)

    Movahed, Saeid; Li Dongqing

    2012-01-01

    This article presents a theoretical study of electrokinetic motion of a negatively charged cubic nanoparticle in a three-dimensional nanochannel with a circular cross-section. Effects of the electrophoretic and the hydrodynamic forces on the nanoparticle motion are examined. Because of the large applied electric field over the nanochannel, the impact of the Brownian force is negligible in comparison with the electrophoretic and the hydrodynamic forces. The conventional theories of electrokinetics such as the Poisson–Boltzmann equation and the Helmholtz–Smoluchowski slip velocity approach are no longer applicable in the small nanochannels. In this study, and at each time step, first, a set of highly coupled partial differential equations including the Poisson–Nernst–Plank equation, the Navier–Stokes equations, and the continuity equation was solved to find the electric potential, ionic concentration field, and the flow field around the nanoparticle. Then, the electrophoretic and hydrodynamic forces acting on the negatively charged nanoparticle were determined. Following that, the Newton second law was utilized to find the velocity of the nanoparticle. Using this model, effects of surface electric charge of the nanochannel, bulk ionic concentration, the size of the nanoparticle, and the radius of the nanochannel on the nanoparticle motion were investigated. Increasing the bulk ionic concentration or the surface charge of the nanochannel will increase the electroosmotic flow, and hence affect the particle’s motion. It was also shown that, unlike microchannels with thin EDL, the change in nanochannel size will change the EDL field and the ionic concentration field in the nanochannel, affecting the particle’s motion. If the nanochannel size is fixed, a larger particle will move faster than a smaller particle under the same conditions.

  1. Diffusion transport of nanoparticles at nanochannel boundaries

    International Nuclear Information System (INIS)

    Mahadevan, T. S.; Milosevic, M.; Kojic, M.; Hussain, F.; Kojic, N.; Serda, R.; Ferrari, M.; Ziemys, A.

    2013-01-01

    The manipulation of matter at the nanoscale has unleashed a great potential for engineering biomedical drug carriers, but the transport of nanoparticles (NPs) under nanoscale confinement is still poorly understood. Using colloidal physics to describe NP interactions, we have computationally studied the passive transport of NPs using experimentally relevant conditions from bulk into a nanochannel of 60–90 nm height. NP size, channel height, and the Debye length are comparable so that changes in nanoscale dimensions may induce substantial changes in NP transport kinetics. We show that subtle changes in nanochannel dimensions may alter the energy barrier by about six orders of magnitude resulting in different NP penetration depths and diffusion mechanisms: ballistic, first-order and quasi zero-order transport regimes. The analysis of NP diffusion by continuum methods reveals that apparent diffusivity is reduced by decreasing channel size. The continuum finite element (FE) numerical method reproduced the colloidal model results only when surface interactions were accounted for. These results give a new insight into NP passive transport at the boundaries of nanoconfined domains, and have implications on the design of nanoscale fluidics and NP systems for biomedical and engineering applications.

  2. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  3. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  4. Atomic force microscopy-based repeated machining theory for nanochannels on silicon oxide surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Z.Q., E-mail: wangzhiqian@sia.cn [State Key Laboratory of Robotics, Shenyang Institute of Automation, CAS, Shenyang 110016 (China); Graduate University of the Chinese Academy of Sciences, Beijing 100049 (China); Jiao, N.D. [State Key Laboratory of Robotics, Shenyang Institute of Automation, CAS, Shenyang 110016 (China); Tung, S. [Department of Mechanical Engineering, University of Arkansas, Fayetteville, AR 72701 (United States); Dong, Z.L. [State Key Laboratory of Robotics, Shenyang Institute of Automation, CAS, Shenyang 110016 (China)

    2011-02-01

    The atomic force microscopy (AFM)-based repeated nanomachining of nanochannels on silicon oxide surfaces is investigated both theoretically and experimentally. The relationships of the initial nanochannel depth vs. final nanochannel depth at a normal force are systematically studied. Using the derived theory and simulation results, the final nanochannel depth can be predicted easily. Meanwhile, if a nanochannel with an expected depth needs to be machined, a right normal force can be selected simply and easily in order to decrease the wear of the AFM tip. The theoretical analysis and simulation results can be effectively used for AFM-based fabrication of nanochannels.

  5. Sustained Administration of Hormones Exploiting Nanoconfined Diffusion through Nanochannel Membranes

    Directory of Open Access Journals (Sweden)

    Thomas Geninatti

    2015-08-01

    Full Text Available Implantable devices may provide a superior means for hormone delivery through maintaining serum levels within target therapeutic windows. Zero-order administration has been shown to reach an equilibrium with metabolic clearance, resulting in a constant serum concentration and bioavailability of released hormones. By exploiting surface-to-molecule interaction within nanochannel membranes, it is possible to achieve a long-term, constant diffusive release of agents from implantable reservoirs. In this study, we sought to demonstrate the controlled release of model hormones from a novel nanochannel system. We investigated the delivery of hormones through our nanochannel membrane over a period of 40 days. Levothyroxine, osteocalcin and testosterone were selected as representative hormones based on their different molecular properties and structures. The release mechanisms and transport behaviors of these hormones within 3, 5 and 40 nm channels were characterized. Results further supported the suitability of the nanochannels for sustained administration from implantable platforms.

  6. Proton-conductive nanochannel membrane for fuel-cell applications.

    Science.gov (United States)

    Oleksandrov, Sergiy; Lee, Jeong-Woo; Jang, Joo-Hee; Haam, Seungjoo; Chung, Chan-Hwa

    2009-02-01

    Novel design of proton conductive membrane for direct methanol fuel cells is based on proton conductivity of nanochannels, which is acquired due to the electric double layer overlap. Proton conductivity and methanol permeability of an array of nanochannels were studied. Anodic aluminum oxide with pore diameter of 20 nm was used as nanochannel matrix. Channel surfaces of an AAO template were functionalized with sulfonic groups to increase proton conductivity of nanochannels. This was done in two steps; at first -SH groups were attached to walls of nanochannels using (3-Mercaptopropyl)-trimethyloxysilane and then they were converted to -SO3H groups using hydrogen peroxide. Treatment steps were analyzed by Fourier Transform Infrared spectroscopy and X-ray Photoelectron Spectroscopy. Proton conductivity and methanol permeability were measured. The data show methanol permeability of membrane to be an order of magnitude lower, than that measured of Nafion. Ion conductivity of functionalized AAO membrane was measured by an impedance analyzer at frequencies ranging from 1 Hz to 100 kHz and voltage 50 mV to be 0.15 Scm(-1). Measured ion conductivity of Nafion membrane was 0.05 Scm(-1). Obtained data show better results in comparison with commonly used commercial available proton conductive membrane Nafion, thus making nanochannel membrane very promising for use in fuel cell applications.

  7. Preparations of an inorganic-framework proton exchange nanochannel membrane

    Science.gov (United States)

    Yan, X. H.; Jiang, H. R.; Zhao, G.; Zeng, L.; Zhao, T. S.

    2016-09-01

    In this work, a proton exchange membrane composed of straight and aligned proton conducting nanochannels is developed. Preparation of the membrane involves the surface sol-gel method assisted with a through-hole anodic aluminum oxide (AAO) template to form the framework of the PEM nanochannels. A monomolecular layer (SO3Hsbnd (CH2)3sbnd Sisbnd (OCH3)3) is subsequently added onto the inner surfaces of the nanochannels to shape a proton-conducting pathway. Straight nanochannels exhibit long range order morphology, contributing to a substantial improvement in the proton mobility and subsequently proton conductivity. In addition, the nanochannel size can be altered by changing the surface sol-gel condition, allowing control of the active species/charge carrier selectivity via pore size exclusion. The proton conductivity of the nanochannel membrane is reported as high as 11.3 mS cm-1 at 70 °C with a low activation energy of 0.21 eV (20.4 kJ mol-1). First-principle calculations reveal that the activation energy for proton transfer is impressively low (0.06 eV and 0.07 eV) with the assistance of water molecules.

  8. Porous Anodic Aluminum Oxide with Serrated Nanochannels

    Science.gov (United States)

    Li, Dongdong; Zhao, Liang; Lu, Jia G.

    2010-03-01

    Self-assembled nanoporous anodic aluminum oxide (AAO) membrane with straight channels has long been an important tool in synthesizing highly ordered and vertically aligned quasi-1D nanostructures for various applications. Recently shape-selective nanomaterials have been achieved using AAO as a template. It is envisioned that nanowires with multi-branches will significantly increase the active functional sites for applications as sensors, catalysts, chemical cells, etc. Here AAO membranes with serrated nanochannels have been successfully fabricated via a two-step annodization method. The serrated channels with periodic intervals are aligned at an angle of ˜25^circ along the stem channels. The formation of the serrated channels is attributed to the evolution of oxygen gas bubbles and the resulted plastic deformation in oxide membrane. In order to reveal the inside channel structure, Platinum are electrodeposited into the AAO template. The as-synthesized serrated Pt nanowires demonstrate a superior electrocatalytic activity. This is attributed to the enhanced electric field strength around serrated tips as shown in the electric field simulation by COMOSL. Moreover, hierarchical serrated/straight hybrid structures can be constructed using this simple and novel self assembly technique.

  9. Resolving Overlimiting Current Mechanisms in Microchannel-Nanochannel Interface Devices

    Science.gov (United States)

    Yossifon, Gilad; Leibowitz, Neta; Liel, Uri; Schiffbauer, Jarrod; Park, Sinwook

    2015-11-01

    We present results demonstrating the space charge-mediated transition between classical, diffusion-limited current and surface-conduction dominant over-limiting currents in a shallow micro-nanochannel device. The extended space charge layer develops at the depleted micro-nanochannel entrance at high current and is correlated with a distinctive maximum in the dc resistance. Experimental results for a shallow surface-conduction dominated system are compared with theoretical models, allowing estimates of the effective surface charge at high voltage to be obtained. Further, we extend the study to microchannels of moderate to large depths where the role of various electro-convection mechanisms becomes dominant. In particular, electro-osmotic of the second kind and electro-osmotic instability (EOI) which competes each other at geometrically heterogeneous (e.g. undulated nanoslot interface, array of nanoslots) nanoslot devices. Also, these effects are also shown to be strongly modulated by the non-ideal permselectivity of the nanochannel.

  10. DNA confinement in nanochannels: physics and biological applications

    DEFF Research Database (Denmark)

    Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H

    2012-01-01

    in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...

  11. Fabrication and interfacing of nanochannel devices for single-molecule studies

    International Nuclear Information System (INIS)

    Hoang, H T; Berenschot, J W; De Boer, M J; Tas, N R; Haneveld, J; Elwenspoek, M C; Segers-Nolten, I M

    2009-01-01

    Nanochannel devices have been fabricated using standard micromachining techniques such as optical lithography, deposition and etching. 1D nanochannels with thin glass capping and through-wafer inlet/outlet ports were constructed. 2D nanochannels have been made transparent by oxidation of polysilicon channel wall for optical detection and these fragile channels were successfully connected to macro inlet ports. The interfacing from the macro world to the nanochannels was especially designed for optical observation of filling liquid inside nanochannels using an inverted microscope. Toward single-molecule studies, individual quantum dots were visualized in 150 nm height 1D nanochannels. The potential of 2D nanochannels for single-molecule studies was shown from a filling experiment with a fluorescent dye solution

  12. A light-powered bio-capacitor with nanochannel modulation.

    Science.gov (United States)

    Rao, Siyuan; Lu, Shanfu; Guo, Zhibin; Li, Yuan; Chen, Deliang; Xiang, Yan

    2014-09-03

    An artificial bio-capacitor system is established, consisting of the proton-pump protein proteorhodopsin and a modified alumina nanochannel, inspired by the capacitor-like behavior of plasma membranes realized through the cooperation of ion-pump and ion-channel proteins. Capacitor-like features of this simplified system are realized and identified, and the photocurrent duration time can be modulated by nanochannel modification to obtain favorable square-wave currents. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Concentration Polarization in Translocation of DNA through Nanopores and Nanochannels

    NARCIS (Netherlands)

    Das, S.; Dubsky, P.; van den Berg, Albert; Eijkel, Jan C.T.

    2012-01-01

    In this Letter we provide a theory to show that high-field electrokinetic translocation of DNA through nanopores or nanochannels causes large transient variations of the ionic concentrations in front and at the back of the DNA due to concentration polarization (CP). The CP causes strong local

  14. Field-effect pH Control in Nanochannels

    NARCIS (Netherlands)

    Veenhuis, R.B.H.; van der Wouden, E.J.; van Nieuwkasteele, Jan William; van den Berg, Albert; Eijkel, Jan C.T.; Kim, Tae Song; Lee, Yoon-Sik; Chung, Taek-Dong; Jeon, Noo Li; Lee, Sang-Hoon; Suh, Kaph-Yang; Choo, Jaebum; Kim, Yong-Kweon

    2009-01-01

    We demonstrate a novel capacitive method to change the pH in nanochannels. The device employs metal electrodes outside an insulating channel wall to change the electrical double layer potential by the field effect (‘voltage gating’). We demonstrate that this potential change is accompanied by a

  15. Effect of interfacial layer on water flow in nanochannels: Lattice Boltzmann simulations

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Yakang [State Key Laboratory of Heavy Oil Processing, China University of Petroleum, Qingdao, Shandong 266580 (China); College of Science, China University of Petroleum, Qingdao 266580, Shandong (China); Liu, Xuefeng, E-mail: liuxf@upc.edu.cn [College of Science, China University of Petroleum, Qingdao 266580, Shandong (China); Liu, Zilong [College of Science, China University of Petroleum, Qingdao 266580, Shandong (China); Lu, Shuangfang [Institute of Unconventional Oil & Gas and New Energy, China University of Petroleum, Qingdao 266580, Shandong (China); Xue, Qingzhong, E-mail: xueqingzhong@tsinghua.org.cn [State Key Laboratory of Heavy Oil Processing, China University of Petroleum, Qingdao, Shandong 266580 (China); College of Science, China University of Petroleum, Qingdao 266580, Shandong (China); National Production Equipment Research Center, Dongying 257064, Shandong (China)

    2016-04-15

    A novel interfacial model was proposed to understand water flow mechanism in nanochannels. Based on our pore-throat nanochannel model, the effect of interfacial layer on water flow in nanochannels was quantitatively studied using Lattice Boltzmann method (LBM). It is found that both the permeability of nanochannel and water velocity in the nanochannel dramatically decrease with increasing the thickness of interfacial layer. The permeability of nanochannel with pore radius of 10 nm decreases by about three orders of magnitude when the thickness of interfacial layer is changed from 0 nm to 3 nm gradually. Furthermore, it has been demonstrated that the cross-section shape has a great effect on the water flow inside nanochannel and the effect of interfacial layer on the permeability of nanochannel has a close relationship with cross-section shape when the pore size is smaller than 12 nm. Besides, both pore-throat ratio and throat length can greatly affect water flow in nanochannels, and the influence of interfacial layer on water flow in nanochannels becomes more evident with increasing pore-throat ratio and throat length. Our theoretical results provide a simple and effective method to study the flow phenomena in nano-porous media, particularly to quantitatively study the interfacial layer effect in nano-porous media.

  16. Structure and band gap determination of irradiation-induced amorphous nano-channels in LiNbO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Sachan, R., E-mail: sachanr@ornl.gov; Pakarinen, O. H.; Chisholm, M. F. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Liu, P. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); School of Physics, State Key Laboratory of Crystal Materials and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Shandong University, Jinan 250100 (China); Patel, M. K. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Zhang, Y. [Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Wang, X. L. [School of Physics, State Key Laboratory of Crystal Materials and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Shandong University, Jinan 250100 (China); Weber, W. J. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, Tennessee 37996 (United States); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

    2015-04-07

    The irradiation of lithium niobate with swift heavy ions results in the creation of amorphous nano-sized channels along the incident ion path. These nano-channels are on the order of a hundred microns in length and could be useful for photonic applications. However, there are two major challenges in these nano-channels characterization: (i) it is difficult to investigate the structural characteristics of these nano-channels due to their very long length and (ii) the analytical electron microscopic analysis of individual ion track is complicated due to electron beam sensitive nature of lithium niobate. Here, we report the first high resolution microscopic characterization of these amorphous nano-channels, widely known as ion-tracks, by direct imaging them at different depths in the material, and subsequently correlating the key characteristics with electronic energy loss of ions. Energetic Kr ions ({sup 84}Kr{sup 22} with 1.98 GeV energy) are used to irradiate single crystal lithium niobate with a fluence of 2 × 10{sup 10} ions/cm{sup 2}, which results in the formation of individual ion tracks with a penetration depth of ∼180 μm. Along the ion path, electron energy loss of the ions, which is responsible for creating the ion tracks, increases with depth under these conditions in LiNbO{sub 3}, resulting in increases in track diameter of a factor of ∼2 with depth. This diameter increase with electronic energy loss is consistent with predictions of the inelastic thermal spike model. We also show a new method to measure the band gap in individual ion track by using electron energy-loss spectroscopy.

  17. Numerical study of power generation by reverse electrodialysis in ion-selective nanochannels

    International Nuclear Information System (INIS)

    Kim, Dong Kwon

    2011-01-01

    In this article, ion-selective nanochannels are numerically studied to investigate the power generation capability of a concentration gradient in conjunction with reverse electrodialysis. The generation of power from the nanochannel when it is placed between two reservoirs containing sodium chloride solutions with different concentrations is investigated. The current-potential characteristics of the nanochannel were calculated by solving the Poisson equation and the Nernst-Planck equation. The effects of engineering parameters on the power generation density are investigated

  18. Numerical study of power generation by reverse electrodialysis in ion-selective nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Kwon [Ajou University, Suwon (Korea, Republic of)

    2011-01-15

    In this article, ion-selective nanochannels are numerically studied to investigate the power generation capability of a concentration gradient in conjunction with reverse electrodialysis. The generation of power from the nanochannel when it is placed between two reservoirs containing sodium chloride solutions with different concentrations is investigated. The current-potential characteristics of the nanochannel were calculated by solving the Poisson equation and the Nernst-Planck equation. The effects of engineering parameters on the power generation density are investigated.

  19. Fabrication of hydrogel-coated single conical nanochannels exhibiting controllable ion rectification characteristics.

    Science.gov (United States)

    Wang, Linlin; Zhang, Huacheng; Yang, Zhe; Zhou, Jianjun; Wen, Liping; Li, Lin; Jiang, Lei

    2015-03-07

    Heterogeneous nanochannel materials that endow new functionalities different to the intrinsic properties of two original nanoporous materials have wide potential applications in nanofluidics, energy conversion, and biosensors. Herein, we report novel, interesting hydrogel-composited nanochannel devices with regulatable ion rectification characteristics. The heterogeneous nanochannel devices were constructed by selectively coating the tip side, base side, or both sides of a single conical nanochannel membrane with thin agar hydrogel layers. The tunable ion current rectification of the nanochannels in the three different coating states was systematically demonstrated by current-voltage (I-V) curves. The asymmetric ionic transport property of the conical nanochannel was further strengthened in the tip-coating state and weakened in the base-coating state, whereas the conical nanochannel showed nearly symmetric ionic transport in the dual-coating state. Repeated experiments presented insight into the good stability and reversibility of the three coating states of the hydrogel-nanochannel-integrated systems. This work, as an example, may provide a new strategy to further design and develop multifunctional gel-nanochannel heterogeneous smart porous nanomaterials.

  20. Electricity resonance-induced fast transport of water through nanochannels.

    Science.gov (United States)

    Kou, Jianlong; Lu, Hangjun; Wu, Fengmin; Fan, Jintu; Yao, Jun

    2014-09-10

    We performed molecular dynamics simulations to study water permeation through a single-walled carbon nanotube with electrical interference. It was found that the water net flux across the nanochannel is greatly affected by the external electrical interference, with the maximal net flux occurred at an electrical interference frequency of 16670 GHz being about nine times as high as the net flux at the low or high frequency range of (80,000 GHz). The above phenomena can be attributed to the breakage of hydrogen bonds as the electrical interference frequency approaches to the inherent resonant frequency of hydrogen bonds. The new mechanism of regulating water flux across nanochannels revealed in this study provides an insight into the water transportation through biological water channels and has tremendous potential in the design of high-flux nanofluidic systems.

  1. Experimental investigation of flow and slip transition in nanochannels

    Science.gov (United States)

    Li, Zhigang; Li, Long; Mo, Jingwen

    2014-11-01

    Flow slip in nanochannels is sought in many applications, such as sea water desalination and molecular separation, because it can enhance fluid transport, which is essential in nanofluidic systems. Previous findings about the slip length for simple fluids at the nanoscale appear to be controversial. Some experiments and simulations showed that the slip length is independent of shear rate, which agrees with the prediction of classic slip theories. However, there is increasing work showing that slip length is shear rate dependent. In this work, we experimentally investigate the Poiseuille flows in nanochannels. It is found that the flow rate undergoes a transition between two linear regimes as the shear rate is varied. The transition indicates that the non-slip boundary condition is valid at low shear rate. When the shear rate is larger than a critical value, slip takes place and the slip length increases linearly with increasing shear rate before approaching a constant value. The results reported in this work can help advance the understanding of flow slip in nanochannels. This work was supported by the Research Grants Council of the Hong Kong Special Administrative Region under Grant Nos. 615710 and 615312. J. Mo was partially supported by the Postgraduate Scholarship through the Energy Program at HKUST.

  2. Drag reduction in silica nanochannels induced by graphitic wall coatings

    Science.gov (United States)

    Wagemann, Enrique; Walther, J. H.; Zambrano, Harvey A.

    2017-11-01

    Transport of water in hydrophilic nanopores is of significant technological and scientific interest. Water flow through hydrophilic nanochannels is known to experience enormous hydraulic resistance. Therefore, drag reduction is essential for the development of highly efficient nanofluidic devices. In this work, we propose the use of graphitic materials as wall coatings in hydrophilic silica nanopores. Specifically, by conducting atomistic simulations, we investigate the flow inside slit and cylindrical silica channels with walls coated with graphene (GE) layers and carbon nanotubes (CNTs), respectively. We develop realistic force fields to simulate the systems of interest and systematically, compare flow rates in coated and uncoated nanochannels under different pressure gradients. Moreover, we assess the effect that GE and CNT translucencies to wettability have on water hydrodynamics in the nanochannels. The influence of channel size is investigated by systematically varying channel heights and nanopore diameters. In particular, we present the computed water density and velocity profiles, volumetric flow rates, slip lengths and flow enhancements, to clearly demonstrate the drag reduction capabilities of graphitic wall coatings. We wish to thank partial funding from CRHIAM Conicyt/ Fondap Project 15130015 and computational support from DTU and NLHPC (Chile).

  3. Applicability of Donnan equilibrium theory at nanochannel-reservoir interfaces.

    Science.gov (United States)

    Tian, Huanhuan; Zhang, Li; Wang, Moran

    2015-08-15

    Understanding ionic transport in nanochannels has attracted broad attention from various areas in energy and environmental fields. In most pervious research, Donnan equilibrium has been applied widely to nanofluidic systems to obtain ionic concentration and electrical potential at channel-reservoir interfaces; however, as well known that Donnan equilibrium is derived from classical thermodynamic theories with equilibrium assumptions. Therefore the applicability of the Donnan equilibrium may be questionable when the transport at nanochannel-reservoir interface is strongly non-equilibrium. In this work, the Poisson-Nernst-Planck model for ion transport is numerically solved to obtain the exact distributions of ionic concentration and electrical potential. The numerical results are quantitatively compared with the Donnan equilibrium predictions. The applicability of Donnan equilibrium is therefore justified by changing channel length, reservoir ionic concentration, surface charge density and channel height. The results indicate that the Donnan equilibrium is not applicable for short nanochannels, large concentration difference and wide openings. A non-dimensional parameter, Q factor, is proposed to measure the non-equilibrium extent and the relation between Q and the working conditions is studied in detail. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Concerted orientation induced unidirectional water transport through nanochannels.

    Science.gov (United States)

    Wan, Rongzheng; Lu, Hangjun; Li, Jinyuan; Bao, Jingdong; Hu, Jun; Fang, Haiping

    2009-11-14

    The dynamics of water inside nanochannels is of great importance for biological activities as well as for the design of molecular sensors, devices, and machines, particularly for sea water desalination. When confined in specially sized nanochannels, water molecules form a single-file structure with concerted dipole orientations, which collectively flip between the directions along and against the nanotube axis. In this paper, by using molecular dynamics simulations, we observed a net flux along the dipole-orientation without any application of an external electric field or external pressure difference during the time period of the particular concerted dipole orientations of the molecules along or against the nanotube axis. We found that this unique special-directional water transportation resulted from the asymmetric potential of water-water interaction along the nanochannel, which originated from the concerted dipole orientation of the water molecules that breaks the symmetry of water orientation distribution along the channel within a finite time period. This finding suggests a new mechanism for achieving high-flux water transportation, which may be useful for nanotechnology and biological applications.

  5. Static and Dynamic Properties of DNA Confined in Nanochannels

    Science.gov (United States)

    Gupta, Damini

    Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain

  6. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  7. Morphological evolution of porous nanostructures grown from a single isolated anodic alumina nanochannel

    Science.gov (United States)

    Chen, Shih-Yung; Chang, Hsuan-Hao; Lai, Ming-Yu; Liu, Chih-Yi; Wang, Yuh-Lin

    2011-09-01

    Porous anodic aluminum oxide (AAO) membranes have been widely used as templates for growing nanomaterials because of their ordered nanochannel arrays with high aspect ratio and uniform pore diameter. However, the intrinsic growth behavior of an individual AAO nanochannel has never been carefully studied for the lack of a means to fabricate a single isolated anodic alumina nanochannel (SIAAN). In this study, we develop a lithographic method for fabricating a SIAAN, which grows into a porous hemispherical structure with its pores exhibiting fascinating morphological evolution during anodization. We also discover that the mechanical stress affects the growth rate and pore morphology of AAO porous structures. This study helps reveal the growth mechanism of arrayed AAO nanochannels grown on a flat aluminum surface and provides insights to help pave the way to altering the geometry of nanochannels on AAO templates for the fabrication of advanced nanocomposite materials.

  8. Morphological evolution of porous nanostructures grown from a single isolated anodic alumina nanochannel

    International Nuclear Information System (INIS)

    Chen, Shih-Yung; Wang, Yuh-Lin; Chang, Hsuan-Hao; Lai, Ming-Yu; Liu, Chih-Yi

    2011-01-01

    Porous anodic aluminum oxide (AAO) membranes have been widely used as templates for growing nanomaterials because of their ordered nanochannel arrays with high aspect ratio and uniform pore diameter. However, the intrinsic growth behavior of an individual AAO nanochannel has never been carefully studied for the lack of a means to fabricate a single isolated anodic alumina nanochannel (SIAAN). In this study, we develop a lithographic method for fabricating a SIAAN, which grows into a porous hemispherical structure with its pores exhibiting fascinating morphological evolution during anodization. We also discover that the mechanical stress affects the growth rate and pore morphology of AAO porous structures. This study helps reveal the growth mechanism of arrayed AAO nanochannels grown on a flat aluminum surface and provides insights to help pave the way to altering the geometry of nanochannels on AAO templates for the fabrication of advanced nanocomposite materials.

  9. Electrochemically replicated smooth aluminum foils for anodic alumina nanochannel arrays

    International Nuclear Information System (INIS)

    Biring, Sajal; Tsai, K-T; Sur, Ujjal Kumar; Wang, Y-L

    2008-01-01

    A fast electrochemical replication technique has been developed to fabricate large-scale ultra-smooth aluminum foils by exploiting readily available large-scale smooth silicon wafers as the masters. Since the adhesion of aluminum on silicon depends on the time of surface pretreatment in water, it is possible to either detach the replicated aluminum from the silicon master without damaging the replicated aluminum and master or integrate the aluminum film to the silicon substrate. Replicated ultra-smooth aluminum foils are used for the growth of both self-organized and lithographically guided long-range ordered arrays of anodic alumina nanochannels without any polishing pretreatment

  10. Electrokinetic energy conversion efficiency of viscoelastic fluids in a polyelectrolyte-grafted nanochannel.

    Science.gov (United States)

    Jian, Yongjun; Li, Fengqin; Liu, Yongbo; Chang, Long; Liu, Quansheng; Yang, Liangui

    2017-08-01

    In order to conduct extensive investigation of energy harvesting capabilities of nanofluidic devices, we provide analytical solutions for streaming potential and electrokinetic energy conversion (EKEC) efficiency through taking the combined consequences of soft nanochannel, a rigid nanochannel whose surface is covered by charged polyelectrolyte layer, and viscoelastic rheology into account. The viscoelasticity of the fluid is considered by employing the Maxwell constitutive model when the forcing frequency of an oscillatory driving pressure flow matches with the inverse of the relaxation time scale of a typical viscoelastic fluid. We compare the streaming potential and EKEC efficiency with those of a rigid nanochannel, having zeta potential equal to the electrostatic potential at the solid-polyelectrolyte interface of the soft nanochannels. Within the present selected parameter ranges, it is shown that the different peaks of maximal streaming potential and EKEC efficiency for the rigid nanochannel are larger than those for the soft nanochannel when forcing frequencies of the driving pressure gradient are close to resonating frequencies. However, more enhanced streaming potential and EKEC efficiency for a soft nanochannel can be found in most of the regions away from these resonant frequencies. Moreover, the influence of several dimensionless parameters on EKEC efficiency is discussed in detail. Finally, within the given parametric regions, the maximum efficiency at some resonant frequency obtained in present analysis is about 25%. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Confinement effect of protonation/deprotonation of carboxylic group modified in nanochannel

    International Nuclear Information System (INIS)

    Gao, Hong-Li; Zhang, Hui; Li, Cheng-Yong; Xia, Xing-Hua

    2013-01-01

    Protonation and deprotonation processes are the key step of acid–base reaction and occur in many biological processes. Study on the deprotonation process of molecules and/or functional groups in confined conditions would help us understand the acid–base theory and confinement effect of biomolecules. In this paper, we use a recently established approach to the study of protonation and deprotonation processes of functional groups in porous anodic alumina array nanochannels by measuring the flux of electrochemical active probes (ferricyanide ions) using an Au film electrochemical detector sputtered at the end of nanochannels. The protonation and deprotonation processes of surface functional groups in nanochannels will change the surface charges and in turn modulate the transportation of charged electroactive probes through nanochannels. The titration curve for the deprotonation of carboxylic groups in nanochannel confined conditions is obtained by measuring the current signal of ferricyanide probe flowing through an carboxylic-anchored PAA nanochannels array at different solution pH. Results show that the deprotonation of carboxylic group in nanochannel occurs in one step with a pK 1/2 = 6.2. The present method provides an effective tool to study the deprotonation processes of various functional groups and biomolecules under confined conditions

  12. Microstructure and hardness evolution of nanochannel W films irradiated by helium at high temperature

    Science.gov (United States)

    Qin, Wenjing; Wang, Yongqiang; Tang, Ming; Ren, Feng; Fu, Qiang; Cai, Guangxu; Dong, Lan; Hu, Lulu; Wei, Guo; Jiang, Changzhong

    2018-04-01

    Plasma facing materials (PFMs) face one of the most serious challenges in fusion reactors, including unprecedented harsh environment such as 14.1 MeV neutron and transmutation gas irradiation at high temperature. Tungsten (W) is considered to be one of the most promising PFM, however, virtually insolubility of helium (He) in W causes new material issues such as He bubbles and W "fuzz" microstructure. In our previous studies, we presented a new strategy using nanochannel structure designed in the W film to increase the releasing of He atoms and thus to minimize the He nucleation and "fuzz" formation behavior. In this work, we report the further study on the diffusion of He atoms in the nanochannel W films irradiated at a high temperature of 600 °C. More specifically, the temperature influences on the formation and growth of He bubbles, the lattice swelling, and the mechanical properties of the nanochannel W films were investigated. Compared with the bulk W, the nanochannel W films possessed smaller bubble size and lower bubble areal density, indicating that noticeable amounts of He atoms have been released out along the nanochannels during the high temperature irradiations. Thus, with lower He concentration in the nanochannel W films, the formation of the bubble superlattice is delayed, which suppresses the lattice swelling and reduces hardening. These aspects indicate the nanochannel W films have better radiation resistance even at high temperature irradiations.

  13. Production of selective membranes using plasma deposited nanochanneled thin films

    Directory of Open Access Journals (Sweden)

    Rodrigo Amorim Motta Carvalho

    2006-12-01

    Full Text Available The hydrolization of thin films obtained by tetraethoxysilane plasma polymerization results in the formation of a nanochanneled silicone like structure that could be useful for the production of selective membranes. Therefore, the aim of this work is to test the permeation properties of hydrolyzed thin films. The films were tested for: 1 permeation of polar organic compounds and/or water in gaseous phase and 2 permeation of salt in liquid phase. The efficiency of permeation was tested using a quartz crystal microbalance (QCM technique in gas phase and conductimetric analysis (CA in liquid phase. The substrates used were: silicon for characterization of the deposited films, piezoelectric quartz crystals for tests of selective membranes and cellophane paper for tests of permeation. QCM analysis showed that the nanochannels allow the adsorption and/or permeation of polar organic compounds, such as acetone and 2-propanol, and water. CA showed that the films allow salt permeation after an inhibition time needed for hydrolysis of the organic radicals within the film. Due to their characteristics, the films can be used for grains protection against microorganism proliferation during storage without preventing germination.

  14. Molecular Dynamics Simulation of Binary Fluid in a Nanochannel

    International Nuclear Information System (INIS)

    Mullick, Shanta; Ahluwalia, P. K.; Pathania, Y.

    2011-01-01

    This paper presents the results from a molecular dynamics simulation of binary fluid (mixture of argon and krypton) in the nanochannel flow. The computational software LAMMPS is used for carrying out the molecular dynamics simulations. Binary fluids of argon and krypton with varying concentration of atom species were taken for two densities 0.65 and 0.45. The fluid flow takes place between two parallel plates and is bounded by horizontal walls in one direction and periodic boundary conditions are imposed in the other two directions. To drive the flow, a constant force is applied in one direction. Each fluid atom interacts with other fluid atoms and wall atoms through Week-Chandler-Anderson (WCA) potential. The velocity profile has been looked at for three nanochannel widths i.e for 12σ, 14σ and 16σ and also for the different concentration of two species. The velocity profile of the binary fluid predicted by the simulations agrees with the quadratic shape of the analytical solution of a Poiseuille flow in continuum theory.

  15. Light-Induced Local Heating for Thermophoretic Manipulation of DNA in Polymer Micro- and Nanochannels

    DEFF Research Database (Denmark)

    Thamdrup, Lasse Højlund; Larsen, Niels Bent; Kristensen, Anders

    2010-01-01

    We present a method for making polymer chips with a narrow-band near-infrared absorber layer that enables light-induced local heating of liquids inside fluidic micro- and nanochannels fabricated by thermal imprint in polymethyl methacrylate. We have characterized the resulting liquid temperature...... profiles in microchannels using the temperature dependent fluorescence of the complex [Ru(bpy)3]2+. We demonstrate thermophoretic manipulation of individual YOYO-1 stained T4 DNA molecules inside micro- and nanochannels....

  16. Toward the Physical Basis of Complex Systems: Dielectric Analysis of Porous Silicon Nanochannels in the Electrical Double Layer Length Range

    Directory of Open Access Journals (Sweden)

    Radu Mircea Ciuceanu

    2011-01-01

    Full Text Available Dielectric analysis (DEA shows changes in the properties of
    a materials as a response to the application on it of a time dependent electric field. Dielectric measurements are extremely sensitive to small changes in materials properties, that molecular relaxation, dipole changes, local motions that involve the reorientation of dipoles, and so can be observed by DEA. Electrical double layer (EDL, consists in a shielding layer that is naturally created within the liquid near a charged surface. The thickness of the EDL is given by the characteristic Debye length what grows less with the ionic strength defined by half summ products of concentration with square of charge for all solvent
    ions (co-ions, counterions, charged molecules. The typical length scale for the Debye length is on the order of 1 nm, depending on the ionic contents in the solvent; thus, the EDL becomes significant for nano-capillaries that nanochannels. The electrokinetic e®ects in the nanochannels depend essentialy on the distribution of charged species in EDL, described by the Poisson-Boltzmann equation those solutions require the solvent dielectric permittivity. In this work we propose a model for solvent low-frequency permittivity and a DEA profile taking into account both the porous silicon electrode and aqueous solvent properties in the Debye length range.

  17. Surface Effect on Oil Transportation in Nanochannel: a Molecular Dynamics Study.

    Science.gov (United States)

    Zheng, Haixia; Du, Yonggang; Xue, Qingzhong; Zhu, Lei; Li, Xiaofang; Lu, Shuangfang; Jin, Yakang

    2017-12-01

    In this work, we investigate the dynamics mechanism of oil transportation in nanochannel using molecular dynamics simulations. It is demonstrated that the interaction between oil molecules and nanochannel has a great effect on the transportation properties of oil in nanochannel. Because of different interactions between oil molecules and channel, the center of mass (COM) displacement of oil in a 6-nm channel is over 30 times larger than that in a 2-nm channel, and the diffusion coefficient of oil molecules at the center of a 6-nm channel is almost two times more than that near the channel surface. Besides, it is found that polarity of oil molecules has the effect on impeding oil transportation, because the electrostatic interaction between polar oil molecules and channel is far larger than that between nonpolar oil molecules and channel. In addition, channel component is found to play an important role in oil transportation in nanochannel, for example, the COM displacement of oil in gold channel is very few due to great interaction between oil and gold substrate. It is also found that nano-sized roughness of channel surface greatly influences the speed and flow pattern of oil. Our findings would contribute to revealing the mechanism of oil transportation in nanochannels and therefore are very important for design of oil extraction in nanochannels.

  18. Helium retention in krypton ion pre-irradiated nanochannel W film

    Science.gov (United States)

    Qin, Wenjing; Ren, Feng; Zhang, Jian; Dong, Xiaonan; Feng, Yongjin; Wang, Hui; Tang, Jun; Cai, Guangxu; Wang, Yongqiang; Jiang, Changzhong

    2018-02-01

    Nanochannel tungsten (W) film is a promising candidate as an alternative to bulk W for use in fusion applications. In previous work it has been shown to have good radiation resistance under helium (He) irradiation. To further understand the influence of the irradiation-induced displacement cascade damage on helium retention behaviour in a fusion environment, in this work, nanochannel W film and bulk W were pre-irradiated by 800 keV Kr2+ ions to the fluence of 2.6  ×  1015 ions cm-2 and subsequently irradiated by 40 keV He+ ions to the fluence of 5  ×  1017 ions cm-2. The Kr2+ ion pre-irradiation greatly increases helium retention in the form of small clusters and retards the formation of large clusters. It can effectively inhibit surface helium blistering under high temperature annealing. Compared with bulk W, no cracks were found in the nanochannel W film post-irradiated by He+ ions at high fluence. The release of helium from the nanochannel W film is more than one order of magnitude higher than that of bulk W whether they are irradiated by single He+ ions or sequentially irradiated by Kr2+ and He+ ions. Moreover, swelling of the bulk W is more serious than that of the nanochannel film. Therefore, nanochannel W film has a higher radiation tolerance performance in the synergistic irradiation.

  19. Electroosmotic Flow in Mixed Polymer Brush-Grafted Nanochannels

    Directory of Open Access Journals (Sweden)

    Qianqian Cao

    2016-12-01

    Full Text Available Mixed polymer brush-grafted nanochannels—where two distinct species of polymers are alternately grafted on the inner surface of nanochannels—are an interesting class of nanostructured hybrid materials. By using a coarse-grained molecular dynamics simulation method, we are able to simulate the electrokinetic transport dynamics of the fluid in such nanochannels as well as the conformational behaviors of the mixed polymer brush. We find that (1 the brush adopts vertically-layered and longitudinally-separated structures due to the coupling of electroosmotic flow (EOF and applied electric field; (2 the solvent quality affects the brush conformations and the transport properties of the EOF; (3 the EOF flux non-monotonically depends on the grafting density, although the EOF velocity in the central region of the channel monotonically depends on the grafting density.

  20. Effect of air on water capillary flow in silica nanochannels

    DEFF Research Database (Denmark)

    Zambrano, Harvey; Walther, Jens Honore; Oyarzua, Elton

    2013-01-01

    , with the fabrication of microsystems integrated by nanochannels, a thorough understanding of the transport of fluids in nanoconfinement is required for a successful operation of the functional parts of such devices. In this work, Molecular Dynamics simulations are conducted to study the spontaneous imbibition of water...... in sub 10 nm silica channels. The capillary filling speed is computed in channels subjected to different air pressures. In order to describe the interactions between the species, an effective force field is developed, which is calibrated by reproducing the water contact angle. The results show...... that the capillary filling speed qualitatively follows the classical Washburn model, however, quantitatively it is lower than expected. Furthermore, it is observed that the deviations increase as air pressure is higher. We attribute the deviations to amounts of air trapped at the silica-water interface which leads...

  1. Electrokinetics of nanochannels and porous membranes with dynamic surface charges

    DEFF Research Database (Denmark)

    Andersen, Mathias Bækbo

    . Notably, we find that the conductance minimum is mainly caused by hydronium ions, and in our case almost exclusively due to carbonic acid generated from the dissolution of CO2 from the atmosphere. We carry out delicate experiments and measure the conductance of silica nanochannels as a function...... and consider strong out-of-equilibrium transport across the membrane. Our model predicts large pH variations in the electrodialysis system that in turn lowers the ion-selectivity of the membrane by protonation reactions. This opens up for significant over-limiting current. We use our model to investigate...... procedure that requires much attention to the comparability between the conditions in the model and in the experiment. Finally, we make a small digression and study induced-charge electro-osmosis (ICEO) and the validity of common EO slip formulae as a function of a finite Debye screening length...

  2. DNA barcoding via counterstaining with AT/GC sensitive ligands in injection-molded all-polymer nanochannel devices

    DEFF Research Database (Denmark)

    Østergaard, Peter Friis; Matteucci, Marco; Reisner, Walter

    2013-01-01

    Nanochannel technology, coupled with a suitable DNA labeling chemistry, is a powerful approach for performing high-throughput single-molecule mapping of genomes. Yet so far nanochannel technology has remained inaccessible to the broader research community due to high fabrication cost and/or requi......Nanochannel technology, coupled with a suitable DNA labeling chemistry, is a powerful approach for performing high-throughput single-molecule mapping of genomes. Yet so far nanochannel technology has remained inaccessible to the broader research community due to high fabrication cost and...... AT and GC variation along DNA sequences....

  3. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  4. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  5. Effects of water-channel attractions on single-file water permeation through nanochannels

    International Nuclear Information System (INIS)

    Xu, Yousheng; Zheng, Youqu; Tian, Xingling; Lv, Mei; He, Bing; Deng, Maolin; Xiu, Peng; Tu, Yusong

    2016-01-01

    Single-file transportation of water across narrow nanochannels such as carbon nanotubes has attracted much attention in recent years. Such permeation can be greatly affected by the water-channel interactions; despite some progress, this issue has not been fully explored. Herein we use molecular dynamics simulations to investigate the effects of water-channel attractions on occupancy, translational (transportation) and orientational dynamics of water inside narrow single-walled carbon nanotubes (SWNTs). We use SWNTs as the model nanochannels and change the strength of water-nanotube attractions to mimic the changes in the hydrophobicity/polarity of the nanochannel. We investigate the dependence of water occupancy inside SWNTs on the water-channel attraction and identify the corresponding threshold values for drying states, wetting-drying transition states, and stably wetting states. As the strength of water-channel attractions increases, water flow increases rapidly first, and then decreases gradually; the maximal flow occurs in the case where the nanochannel is predominately filled with the 1D water wire but with a small fraction of ‘empty states’, indicating that appropriate empty-filling (drying-wetting) switching can promote water permeation. This maximal flow is unexpected, since in traditional view, the stable and tight hydrogen-bonding network of the water wire is the prerequisite for high permeability of water. The underlying mechanism is discussed from an energetic perspective. In addition, the effect of water-channel attractions on reorientational dynamics of the water wire is studied, and a negative correlation between the flipping frequency of water wire and the water-channel attraction is observed. The underlying mechanism is interpreted in term of the axial total dipole moment of inner water molecules. This work would help to better understand the effects of water-channel attractions on wetting properties of narrow nanochannels, and on single

  6. Hydronium-dominated ion transport in carbon-dioxide-saturated electrolytes at low salt concentrations in nanochannels

    DEFF Research Database (Denmark)

    Pennathur, Sumita; Kristensen, Jesper; Crumrine, Andrew

    2011-01-01

    the surface reaction equilibrium constant for silica/hydronium reactions. The model describes our experimental data with aqueous potassium chloride solutions in 165-nm-high silica nanochannels well, and furthermore, by comparing model predictions with measurements in bulk and in nanochannels with hydrochloric...

  7. Polymer chain alignment and transistor properties of nanochannel-templated poly(3-hexylthiophene) nanowires

    Science.gov (United States)

    Oh, Seungjun; Hayakawa, Ryoma; Pan, Chengjun; Sugiyasu, Kazunori; Wakayama, Yutaka

    2016-08-01

    Nanowires of semiconducting poly(3-hexylthiophene) (P3HT) were produced by a nanochannel-template technique. Polymer chain alignment in P3HT nanowires was investigated as a function of nanochannel widths (W) and polymer chain lengths (L). We found that the ratio between chain length and channel width (L/W) was a key parameter as regards promoting polymer chain alignment. Clear dichroism was observed in polarized ultraviolet-visible (UV-Vis) absorption spectra only at a ratio of approximately L/W = 2, indicating that the L/W ratio must be optimized to achieve uniaxial chain alignment in the nanochannel direction. We speculate that an appropriate L/W ratio is effective in confining the geometries and conformations of polymer chains. This discussion was supported by theoretical simulations based on molecular dynamics. That is, the geometry of the polymer chains, including the distance and tilting angles of the chains in relation to the nanochannel surface, was dominant in determining the longitudinal alignment along the nanochannels. Thus prepared highly aligned polymer nanowire is advantageous for electrical carrier transport and has great potential for improving the device performance of field-effect transistors. In fact, a one-order improvement in carrier mobility was observed in a P3HT nanowire transistor.

  8. Electrokinetic Analysis of Energy Harvest from Natural Salt Gradients in Nanochannels.

    Science.gov (United States)

    He, Yuhui; Huang, Zhuo; Chen, Bowei; Tsutsui, Makusu; Shui Miao, Xiang; Taniguchi, Masateru

    2017-10-13

    The Gibbs free energy released during the mixing of river and sea water has been illustrated as a promising source of clean and renewable energy. Reverse electrodialysis (RED) is one major strategy to gain electrical power from this natural salinity, and recently by utilizing nanochannels a novel mode of this approach has shown improved power density and energy converting efficiency. In this work, we carry out an electrokinetic analysis of the work extracted from RED in the nanochannels. First, we outline the exclusion potential effect induced by the inhomogeneous distribution of extra-counterions along the channel axis. This effect is unique in nanochannel RED and how to optimize it for energy harvesting is the central topic of this work. We then discuss two important indexes of performance, which are the output power density and the energy converting efficiency, and their dependence on the nanochannel parameters such as channel material and geometry. In order to yield maximized output electrical power, we propose a device design by stepwise usage of the saline bias, and the lengths of the nanochannels are optimized to achieve the best trade-off between the input thermal power and the energy converting efficiency.

  9. Ultra-high-aspect-orthogonal and tunable three dimensional polymeric nanochannel stack array for BioMEMS applications

    Science.gov (United States)

    Heo, Joonseong; Kwon, Hyukjin J.; Jeon, Hyungkook; Kim, Bumjoo; Kim, Sung Jae; Lim, Geunbae

    2014-07-01

    Nanofabrication technologies have been a strong advocator for new scientific fundamentals that have never been described by traditional theory, and have played a seed role in ground-breaking nano-engineering applications. In this study, we fabricated ultra-high-aspect (~106 with O(100) nm nanochannel opening and O(100) mm length) orthogonal nanochannel array using only polymeric materials. Vertically aligned nanochannel arrays in parallel can be stacked to form a dense nano-structure. Due to the flexibility and stretchability of the material, one can tune the size and shape of the nanochannel using elongation and even roll the stack array to form a radial-uniformly distributed nanochannel array. The roll can be cut at discretionary lengths for incorporation with a micro/nanofluidic device. As examples, we demonstrated ion concentration polarization with the device for Ohmic-limiting/overlimiting current-voltage characteristics and preconcentrated charged species. The density of the nanochannel array was lower than conventional nanoporous membranes, such as anodic aluminum oxide membranes (AAO). However, accurate controllability over the nanochannel array dimensions enabled multiplexed one microstructure-on-one nanostructure interfacing for valuable biological/biomedical microelectromechanical system (BioMEMS) platforms, such as nano-electroporation.Nanofabrication technologies have been a strong advocator for new scientific fundamentals that have never been described by traditional theory, and have played a seed role in ground-breaking nano-engineering applications. In this study, we fabricated ultra-high-aspect (~106 with O(100) nm nanochannel opening and O(100) mm length) orthogonal nanochannel array using only polymeric materials. Vertically aligned nanochannel arrays in parallel can be stacked to form a dense nano-structure. Due to the flexibility and stretchability of the material, one can tune the size and shape of the nanochannel using elongation and even

  10. Microstructural evolution of nanochannel CrN films under ion irradiation at elevated temperature and post-irradiation annealing

    Science.gov (United States)

    Tang, Jun; Hong, Mengqing; Wang, Yongqiang; Qin, Wenjing; Ren, Feng; Dong, Lan; Wang, Hui; Hu, Lulu; Cai, Guangxu; Jiang, Changzhong

    2018-03-01

    High-performance radiation tolerance materials are crucial for the success of future advanced nuclear reactors. In this paper, we present a further investigation that the "vein-like" nanochannel films can enhance radiation tolerance under ion irradiation at high temperature and post-irradiation annealing. The chromium nitride (CrN) nanochannel films with different nanochannel densities and the compact CrN film are chosen as a model system for these studies. Microstructural evolution of these films were investigated using Transmission Electron Microscopy (TEM), Scanning Electron Microscopy (SEM), Elastic Recoil Detection (ERD) and Grazing Incidence X-ray Diffraction (GIXRD). Under the high fluence He+ ion irradiation at 500 °C, small He bubbles with low bubble densities are observed in the irradiated nanochannel CrN films, while the aligned large He bubbles, blistering and texture reconstruction are found in the irradiated compact CrN film. For the heavy Ar2+ ion irradiation at 500 °C, the microstructure of the nanochannel CrN RT film is more stable than that of the compact CrN film due to the effective releasing of defects via the nanochannel structure. Under the He+ ion irradiation and subsequent annealing, compared with the compact film, the nanochannel films have excellent performance for the suppression of He bubble growth and possess the strong microstructural stability. Basing on the analysis on the sizes and number densities of bubbles as well as the concentrations of He retained in the nanochannel CrN films and the compact CrN film under different experimental conditions, potential mechanism for the enhanced radiation tolerance are discussed. Nanochannels play a crucial role on the release of He/defects under ion irradiation. We conclude that the tailored "vein-like" nanochannel structure may be used as advanced radiation tolerance materials for future nuclear reactors.

  11. Fabrication of nanochannels on polyimide films using dynamic plowing lithography

    Science.gov (United States)

    Stoica, Iuliana; Barzic, Andreea Irina; Hulubei, Camelia

    2017-12-01

    Three distinct polyimide films were analyzed from the point of view of their morphology in order to determine if their surface features can be adapted for applications where surface anisotropy is mandatory. Channels of nanometric dimensions were created on surface of the specimens by using a less common atomic force microscopy (AFM) method, namely Dynamic Plowing Lithography (DPL). The changes generated by DPL procedure were monitored through the surface texture and other functional parameters, denoting the surface orientation degree and also bearing and fluid retention properties. The results revealed that in the same nanolithography conditions, the diamine and dianhydride moieties have affected the characteristics of the nanochannels. This was explained based on the aliphatic/aromatic nature of the monomers and the backbone flexibility. The reported data are of great importance in designing custom nanostructures with enhanced anisotropy on surface of polyimide films for liquid crystal orientation or guided cell growth purposes. At the end, to track the effect of the nanolithography process on the tip sharpness, degradation and contamination, the blind tip reconstruction was performed on AFM probe, before and after lithography experiments, using TGT1 test grating AFM image.

  12. Compressing a confined DNA: from nano-channel to nano-cavity

    Science.gov (United States)

    Sakaue, Takahiro

    2018-06-01

    We analyze the behavior of a semiflexible polymer confined in nanochannel under compression in axial direction. Key to our discussion is the identification of two length scales; the correlation length ξ of concentration fluctuation and what we call the segregation length . These length scales, while degenerate in uncompressed state in nanochannel, generally split as upon compression, and the way they compete with the system size during the compression determines the crossover from quasi-1D nanochannel to quasi-0D nanocavity behaviors. For a flexible polymer, the story becomes very simple, which corresponds to a special limit of our description, but a much richer behavior is expected for a semiflexible polymer relevant to DNA in confined spaces. We also briefly discuss the dynamical properties of the compressed polymer.

  13. Nanoimprinted polymer chips for light induced local heating of liquids in micro- and nanochannels

    DEFF Research Database (Denmark)

    Thamdrup, Lasse Højlund; Pedersen, Jonas Nyvold; Flyvbjerg, Henrik

    2010-01-01

    A nanoimprinted polymer chip with a thin near-infrared absorber layer that enables light-induced local heating (LILH) of liquids inside micro- and nanochannels is presented. An infrared laser spot and corresponding hot-spot could be scanned across the device. Large temperature gradients yield...... a 785 nm laser diode was focused from the backside of the chip to a spot diameter down to 5 ..m in the absorber layer, yielding a localized heating (Gaussian profile) and large temperature gradients in the liquid in the nanochannels. A laser power of 38 mW yielded a temperature of 40°C in the center...

  14. Stretching DNA in polymer nanochannels fabricated by thermal imprint in PMMA

    DEFF Research Database (Denmark)

    Thamdrup, Lasse Højlund; Klukowska, A.; Kristensen, Anders

    2008-01-01

    . The stamp is compatible with molecular vapor deposition ( MVD), used for applying a durable chlorosilane based antistiction coating, and allows for imprint up to a temperature of 270 degrees C. The extension of YOYO-1 stained T4 GT7 bacteriophage DNA inside the PMMA nanochannels has been experimentally...

  15. Fabrication of fluidic devices with 30 nm nanochannels by direct imprinting

    DEFF Research Database (Denmark)

    Cuesta, Irene Fernandez; Palmarelli, Anna Laura; Liang, Xiaogan

    2011-01-01

    In this work, we propose an innovative approach to the fabrication of a complete micro/nano fluidic system, based on direct nanoimprint lithography. The fabricated device consists of nanochannels connected to U-shaped microchannels by triangular tapered inlets, and has four large reservoirs for l...

  16. Multifunctional Core-Shell and Nano-channel Design for Nano-sized Thermo-sensor

    Science.gov (United States)

    2015-04-01

    based on the filling of metals into a nanochannel design. Particularly, different metal alloys with tunable metlingpoints were used to created...nanowires in nanopores of anodic aluminium oxide by mechanical pressure injection. These nanowires inside AAO channels can behave as effective thermal

  17. Streaming current and wall dissolution over 48h in silica nanochannels

    DEFF Research Database (Denmark)

    Andersen, Mathias Bækbo; Bruus, Henrik; Bardhan, Jaydeep P.

    2011-01-01

    We present theoretical and experimental studies of the streaming current induced by a pressure-driven flow in long, straight, electrolyte-filled nanochannels. The theoretical work builds on our recent one-dimensional model of electro-osmotic and capillary flow, which self-consistently treats both...

  18. Lithography-free centimeter-long nanochannel fabrication method using an electrospun nanofiber array

    International Nuclear Information System (INIS)

    Park, Suk Hee; Shin, Hyun-Jun; Lee, Sangyoup; Kim, Yong-Hwan; Yang, Dong-Yol; Lee, Jong-Chul

    2012-01-01

    Novel cost-effective methods for polymeric and metallic nanochannel fabrication have been demonstrated using an electrospun nanofiber array. Like other electrospun nanofiber-based nanofabrication methods, our system also showed high throughput as well as cost-effective performances. Unlike other systems, however, our fabrication scheme provides a pseudo-parallel nanofiber array a few centimeters long at a speed of several tens of fibers per second based on our unique inclined-gap fiber collecting system. Pseudo-parallel nanofiber arrays were used either directly for the PDMS molding process or for the metal lift-off process followed by the SiO 2 deposition process to produce the nanochannel array. While the PDMS molding process was a simple fabrication based on one-step casting, the metal lift-off process followed by SiO 2 deposition allowed finetuning on height and width of nanogrooves down to subhundred nanometers from a few micrometers. Nanogrooves were covered either with cover glass or with PDMS slab and nanochannel connectivity was investigated with a fluorescent dye. Also, nanochannel arrays were used to investigate mobility and conformations of λ-DNA. (paper)

  19. Slip divergence of water flow in graphene nanochannels: the role of chirality

    DEFF Research Database (Denmark)

    Wagemann, Enrique; Oyarzua, Elton; Walther, Jens Honore

    2017-01-01

    Graphene has attracted considerable attention due to its characteristics as a 2D material and its fascinating properties, providing a potential building block for nanofabrication. In nanochannels the solid-liquid interface plays a non-negligible role in determining the fluid dynamics. Therefore, ...

  20. Microspectroscopic analysis of green fluorescent proteins infiltrated into mesoporous silica nanochannels

    NARCIS (Netherlands)

    Ma, Yujie; Rajendran, Prayanka; Blum, Christian; Cesa, Yanina; Gartmann, Nando; Brühwiler, Dominik; Subramaniam, Vinod

    2011-01-01

    The infiltration of enhanced green fluorescent protein (EGFP) into nanochannels of different diameters in mesoporous silica particles was studied in detail by fluorescence microspectroscopy at room temperature. Silica particles from the MCM-41, ASNCs and SBA-15 families possessing nanometer-sized

  1. Selective and lithography-independent fabrication of 20 nm nano-gap electrodes and nano-channels for nanoelectrofluidics applications

    International Nuclear Information System (INIS)

    Zhang, J Y; Wang, X F; Wang, X D; Fan, Z C; Li, Y; Ji, An; Yang, F H

    2010-01-01

    A new method has been developed to selectively fabricate nano-gap electrodes and nano-channels by conventional lithography. Based on a sacrificial spacer process, we have successfully obtained sub-100-nm nano-gap electrodes and nano-channels and further reduced the dimensions to 20 nm by shrinking the sacrificial spacer size. Our method shows good selectivity between nano-gap electrodes and nano-channels due to different sacrificial spacer etch conditions. There is no length limit for the nano-gap electrode and the nano-channel. The method reported in this paper also allows for wafer scale fabrication, high throughput, low cost, and good compatibility with modern semiconductor technology.

  2. Effect of the meniscus contact angle during early regimes of spontaneous imbibition in nanochannels

    DEFF Research Database (Denmark)

    Karna, Nabin Kumar; Oyarzua, Elton; Walther, Jens Honore

    2016-01-01

    study, large scale atomistic simulations are conducted to investigate capillary imbibition of water in slit silica nanochannels with heights between 4 and 18 nm. We find that the meniscus contact angle remains constant during the inertial regime and its value depends on the height of the channel. We...... also find that the meniscus velocity computed at the channel entrance is related to the particular value of the meniscus contact angle. Moreover, during the subsequent visco-inertial regime, as the influence of viscosity increases, the meniscus contact angle is found to be time dependent for all...... the channels under study. Furthermore, we propose an expression for the time evolution of the dynamic contact angle in nanochannels which, when incorporated into Bosanquet's equation, satisfactorily explains the initial capillary rise....

  3. Molecular dynamic simulation of Copper and Platinum nanoparticles Poiseuille flow in a nanochannels

    Science.gov (United States)

    Toghraie, Davood; Mokhtari, Majid; Afrand, Masoud

    2016-10-01

    In this paper, simulation of Poiseuille flow within nanochannel containing Copper and Platinum particles has been performed using molecular dynamic (MD). In this simulation LAMMPS code is used to simulate three-dimensional Poiseuille flow. The atomic interaction is governed by the modified Lennard-Jones potential. To study the wall effects on the surface tension and density profile, we placed two solid walls, one at the bottom boundary and the other at the top boundary. For solid-liquid interactions, the modified Lennard-Jones potential function was used. Velocity profiles and distribution of temperature and density have been obtained, and agglutination of nanoparticles has been discussed. It has also shown that with more particles, less time is required for the particles to fuse or agglutinate. Also, we can conclude that the agglutination time in nanochannel with Copper particles is faster that in Platinum nanoparticles. Finally, it is demonstrated that using nanoparticles raises thermal conduction in the channel.

  4. Perspectives on continuum flow models for force-driven nano-channel liquid flows

    Science.gov (United States)

    Beskok, Ali; Ghorbanian, Jafar; Celebi, Alper

    2017-11-01

    A phenomenological continuum model is developed using systematic molecular dynamics (MD) simulations of force-driven liquid argon flows confined in gold nano-channels at a fixed thermodynamic state. Well known density layering near the walls leads to the definition of an effective channel height and a density deficit parameter. While the former defines the slip-plane, the latter parameter relates channel averaged density with the desired thermodynamic state value. Definitions of these new parameters require a single MD simulation performed for a specific liquid-solid pair at the desired thermodynamic state and used for calibration of model parameters. Combined with our observations of constant slip-length and kinematic viscosity, the model accurately predicts the velocity distribution and volumetric and mass flow rates for force-driven liquid flows in different height nano-channels. Model is verified for liquid argon flow at distinct thermodynamic states and using various argon-gold interaction strengths. Further verification is performed for water flow in silica and gold nano-channels, exhibiting slip lengths of 1.2 nm and 15.5 nm, respectively. Excellent agreements between the model and the MD simulations are reported for channel heights as small as 3 nm for various liquid-solid pairs.

  5. Self-organized titanium oxide nano-channels for resistive memory application

    Energy Technology Data Exchange (ETDEWEB)

    Barman, A.; Saini, C. P.; Dhar, S.; Kanjilal, A., E-mail: aloke.kanjilal@snu.edu.in [Department of Physics, School of Natural Sciences, Shiv Nadar University, NH-91, Tehsil Dadri, Gautam Buddha Nagar, Uttar Pradesh 201 314 (India); Sarkar, P. [Department of Physics, National Institute of Technology, Silchar, Assam 788 010 (India); Satpati, B.; Bhattacharyya, S. R. [Surface Physics and Material Science Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Kabiraj, D.; Kanjilal, D. [Inter-University Accelerator Centre, Aruna Asaf Ali Marg, New Delhi 110 067 (India)

    2015-12-14

    Towards developing next generation scalable TiO{sub 2}-based resistive switching (RS) memory devices, the efficacy of 50 keV Ar{sup +}-ion irradiation to achieve self-organized nano-channel based structures at a threshold fluence of 5 × 10{sup 16} ions/cm{sup 2} at ambient temperature is presented. Although x-ray diffraction results suggest the amorphization of as-grown TiO{sub 2} layers, detailed transmission electron microscopy study reveals fluence-dependent evolution of voids and eventual formation of self-organized nano-channels between them. Moreover, gradual increase of TiO/Ti{sub 2}O{sub 3} in the near surface region, as monitored by x-ray photoelectron spectroscopy, establishes the upsurge in oxygen deficient centers. The impact of structural and chemical modification on local RS behavior has also been investigated by current-voltage measurements in conductive atomic force microscopy, while memory application is manifested by fabricating Pt/TiO{sub 2}/Pt/Ti/SiO{sub 2}/Si devices. Finally, the underlying mechanism of our experimental results has been analyzed and discussed in the light of oxygen vacancy migration through nano-channels.

  6. Molecular dynamic simulation of Ar-Kr mixture across a rough walled nanochannel: Velocity and temperature profiles

    International Nuclear Information System (INIS)

    Pooja,; Ahluwalia, P. K.; Pathania, Y.

    2015-01-01

    This paper presents the results from a molecular dynamics simulation of mixture of argon and krypton in the Poiseuille flow across a rough walled nanochannel. The roughness effect on liquid nanoflows has recently drawn attention The computational software used for carrying out the molecular dynamics simulations is LAMMPS. The fluid flow takes place between two parallel plates and is bounded by horizontal rough walls in one direction and periodic boundary conditions are imposed in the other two directions. Each fluid atom interacts with other fluid atoms and wall atoms through Leenard-Jones (LJ) potential with a cut off distance of 5.0. To derive the flow a constant force is applied whose value is varied from 0.1 to 0.3 and velocity profiles and temperature profiles are noted for these values of forces. The velocity profile and temperature profiles are also looked at different channel widths of nanochannel and at different densities of mixture. The velocity profile and temperature profile of rough walled nanochannel are compared with that of smooth walled nanochannel and it is concluded that mean velocity increases with increase in channel width, force applied and decrease in density also with introduction of roughness in the walls of nanochannel mean velocity again increases and results also agree with the analytical solution of a Poiseuille flow

  7. Parallel array of nanochannels grafted with polymer-brushes-stabilized Au nanoparticles for flow-through catalysis.

    Science.gov (United States)

    Liu, Jianxi; Ma, Shuanhong; Wei, Qiangbing; Jia, Lei; Yu, Bo; Wang, Daoai; Zhou, Feng

    2013-12-07

    Smart systems on the nanometer scale for continuous flow-through reaction present fascinating advantages in heterogeneous catalysis, in which a parallel array of straight nanochannels offers a platform with high surface area for assembling and stabilizing metallic nanoparticles working as catalysts. Herein we demonstrate a method for finely modifying the nanoporous anodic aluminum oxide (AAO), and further integration of nanoreactors. By using atomic transfer radical polymerization (ATRP), polymer brushes were successfully grafted on the inner wall of the nanochannels of the AAO membrane, followed by exchanging counter ions with a precursor for nanoparticles (NPs), and used as the template for deposition of well-defined Au NPs. The membrane was used as a functional nanochannel for novel flow-through catalysis. High catalytic performance and instantaneous separation of products from the reaction system was achieved in reduction of 4-nitrophenol.

  8. Parallel array of nanochannels grafted with polymer-brushes-stabilized Au nanoparticles for flow-through catalysis

    Science.gov (United States)

    Liu, Jianxi; Ma, Shuanhong; Wei, Qiangbing; Jia, Lei; Yu, Bo; Wang, Daoai; Zhou, Feng

    2013-11-01

    Smart systems on the nanometer scale for continuous flow-through reaction present fascinating advantages in heterogeneous catalysis, in which a parallel array of straight nanochannels offers a platform with high surface area for assembling and stabilizing metallic nanoparticles working as catalysts. Herein we demonstrate a method for finely modifying the nanoporous anodic aluminum oxide (AAO), and further integration of nanoreactors. By using atomic transfer radical polymerization (ATRP), polymer brushes were successfully grafted on the inner wall of the nanochannels of the AAO membrane, followed by exchanging counter ions with a precursor for nanoparticles (NPs), and used as the template for deposition of well-defined Au NPs. The membrane was used as a functional nanochannel for novel flow-through catalysis. High catalytic performance and instantaneous separation of products from the reaction system was achieved in reduction of 4-nitrophenol.

  9. Crystal orientation of PEO confined within the nanorod templated by AAO nanochannels.

    Science.gov (United States)

    Liu, Chien-Liang; Chen, Hsin-Lung

    2018-06-18

    The orientation of poly(ethylene oxide) (PEO) crystallites developed in the nanochannels of anodic aluminum oxide (AAO) membrane has been investigated. PEO was filled homogeneously into the nanochannels in the melt state, and the crystallization confined within the PEO nanorod thus formed was allowed to take place subsequently at different temperatures. The effects of PEO molecular weight (MPEO), crystallization temperature (Tc) and AAO channel diameter (DAAO) on the crystal orientation attained in the nanorod were revealed by 2-D wide angle X-ray scattering (WAXS) patterns. In the nanochannels with DAAO = 23 nm, the crystallites formed from PEO with the lowest MPEO (= 3400 g mol-1) were found to adopt a predominantly perpendicular orientation with the crystalline stems aligning normal to the channel axis irrespective of Tc (ranging from -40 to 20 °C). Increasing MPEO or decreasing Tc tended to induce the development of the tilt orientation characterized by the tilt of the (120) plane by 45° from the channel axis. In the case of the highest MPEO (= 95 000 g mol-1) studied, both perpendicular and tilt orientations coexisted irrespective of Tc. Coexistent orientation was always observed in the channels with a larger diameter (DAAO = 89 nm) irrespective of MPEO and Tc. Compared with the previous results of the crystal orientation attained in nanotubes templated by the preferential wetting of the channel walls by PEO, the window of the perpendicular crystal orientation in the nanorod was much narrower due to its weaker confinement effect imposed on the crystal growth than that set by the nanotube.

  10. Science of Water Leaks: Validated Theory for Moisture Flow in Microchannels and Nanochannels.

    Science.gov (United States)

    Lei, Wenwen; Fong, Nicole; Yin, Yongbai; Svehla, Martin; McKenzie, David R

    2015-10-27

    Water is ubiquitous; the science of its transport in micro- and nanochannels has applications in electronics, medicine, filtration, packaging, and earth and planetary science. Validated theory for water vapor and two-phase water flows is a "missing link"; completing it enables us to define and quantify flow in a set of four standard leak configurations with dimensions from the nanoscale to the microscale. Here we report the first measurements of water vapor flow rates through four silica microchannels as a function of humidity, including under conditions when air is present as a background gas. An important finding is that the tangential momentum accommodation coefficient (TMAC) is strongly modified by surface layers of adsorbed water molecules, in agreement with previous work on the TMAC for nitrogen molecules impacting a silica surface in the presence of moisture. We measure enhanced flow rates for two-phase flows in silica microchannels driven by capillary filling. For the measurement of flows in nanochannels we use heavy water mass spectrometry. We construct the theory for the flow rates of the dominant modes of water transport through each of the four standard configurations and benchmark it against our new measurements in silica and against previously reported measurements for nanochannels in carbon nanotubes, carbon nanopipes, and porous alumina. The findings show that all behavior can be described by the four standard leak configurations and that measurements of leak behavior made using other molecules, such as helium, are not reliable. Single-phase water vapor flow is overestimated by a helium measurement, while two-phase flows are greatly underestimated for channels larger than 100 nm or for all channels when boundary slip applies, to an extent that depends on the slip length for the liquid-phase flows.

  11. Effect of meniscus constact angle during early regimes of spontaneous capillarity in nanochannels

    DEFF Research Database (Denmark)

    Karna, N.K.; Oyarzua, Elton; Walther, Jens Honore

    2016-01-01

    4 and 18 nm. We alsofind that the meniscus contact angle remains constant during the inertial regime and its value depends upon the height of the channel. We also find that the meniscus velocity computed at the channel entrance is related to the particular value of themeniscus contact angle....... Moreover, after the inertial regime, the meniscus contactangle is found to be time dependent for all the channels under study. We propose an expression for the time evolution of the dynamic contact angle in nanochannels which, when incorporated in Bosanquets equation, satisfactorily explains the initial...

  12. High Current Ionic Diode Using Homogeneously Charged Asymmetric Nanochannel Network Membrane.

    Science.gov (United States)

    Choi, Eunpyo; Wang, Cong; Chang, Gyu Tae; Park, Jungyul

    2016-04-13

    A high current ionic diode is achieved using an asymmetric nanochannel network membrane (NCNM) constructed by soft lithography and in situ self-assembly of nanoparticles with uniform surface charge. The asymmetric NCNM exhibits high rectified currents without losing a rectification ratio because of its ionic selectivity gradient and differentiated electrical conductance. Asymmetric ionic transport is analyzed with diode-like I-V curves and visualized via fluorescent dyes, which is closely correlated with ionic selectivity and ion distribution according to variation of NCNM geometries.

  13. Analysis of single quantum-dot mobility inside 1D nanochannel devices

    Science.gov (United States)

    Hoang, H. T.; Segers-Nolten, I. M.; Tas, N. R.; van Honschoten, J. W.; Subramaniam, V.; Elwenspoek, M. C.

    2011-07-01

    We visualized individual quantum dots using a combination of a confining nanochannel and an ultra-sensitive microscope system, equipped with a high numerical aperture lens and a highly sensitive camera. The diffusion coefficients of the confined quantum dots were determined from the experimentally recorded trajectories according to the classical diffusion theory for Brownian motion in two dimensions. The calculated diffusion coefficients were three times smaller than those in bulk solution. These observations confirm and extend the results of Eichmann et al (2008 Langmuir 24 714-21) to smaller particle diameters and more narrow confinement. A detailed analysis shows that the observed reduction in mobility cannot be explained by conventional hydrodynamic theory.

  14. Analysis of single quantum-dot mobility inside 1D nanochannel devices

    International Nuclear Information System (INIS)

    Hoang, H T; Tas, N R; Van Honschoten, J W; Elwenspoek, M C; Segers-Nolten, I M; Subramaniam, V

    2011-01-01

    We visualized individual quantum dots using a combination of a confining nanochannel and an ultra-sensitive microscope system, equipped with a high numerical aperture lens and a highly sensitive camera. The diffusion coefficients of the confined quantum dots were determined from the experimentally recorded trajectories according to the classical diffusion theory for Brownian motion in two dimensions. The calculated diffusion coefficients were three times smaller than those in bulk solution. These observations confirm and extend the results of Eichmann et al (2008 Langmuir 24 714-21) to smaller particle diameters and more narrow confinement. A detailed analysis shows that the observed reduction in mobility cannot be explained by conventional hydrodynamic theory.

  15. Hydronium-dominated ion transport in carbon-dioxide-saturated electrolytes at low salt concentrations in nanochannels

    DEFF Research Database (Denmark)

    Lund Jensen, Kristian; Kristensen, Jesper Toft; Crumrine, Andrew Michael

    2011-01-01

    the nanochannel conductance at low salt concentrations and identify a conductance minimum before saturation at a value independent of salt concentration in the dilute limit. Via the Poisson-Boltzmann equation, our model self-consistently couples chemical-equilibrium dissociation models of the silica wall...

  16. Hybrid method coupling molecular dynamics and Monte Carlo simulations to study the properties of gases in microchannels and nanochannels

    NARCIS (Netherlands)

    Nedea, S.V.; Frijns, A.J.H.; Steenhoven, van A.A.; Markvoort, Albert. J.; Hilbers, P.A.J.

    2005-01-01

    We combine molecular dynamics (MD) and Monte Carlo (MC) simulations to study the properties of gas molecules confined between two hard walls of a microchannel or nanochannel. The coupling between MD and MC simulations is introduced by performing MD near the boundaries for accuracy and MC in the bulk

  17. A novel 2D silicon nano-mold fabrication technique for linear nanochannels over a 4 inch diameter substrate

    Science.gov (United States)

    Yin, Zhifu; Qi, Liping; Zou, Helin; Sun, Lei

    2016-01-01

    A novel low-cost 2D silicon nano-mold fabrication technique was developed based on Cu inclined-deposition and Ar+ (argon ion) etching. With this technique, sub-100 nm 2D (two dimensional) nano-channels can be etched economically over the whole area of a 4 inch n-type  silicon wafer. The fabricating process consists of only 4 steps, UV (Ultraviolet) lithography, inclined Cu deposition, Ar+ sputter etching, and photoresist & Cu removing. During this nano-mold fabrication process, we investigated the influence of the deposition angle on the width of the nano-channels and the effect of Ar+ etching time on their depth. Post-etching measurements showed the accuracy of the nanochannels over the whole area: the variation in width is 10%, in depth it is 11%. However, post-etching measurements also showed the accuracy of the nanochannels between chips: the variation in width is 2%, in depth it is 5%. With this newly developed technology, low-cost and large scale 2D nano-molds can be fabricated, which allows commercial manufacturing of nano-components over large areas. PMID:26752559

  18. Small-angle X-ray scattering investigations of biomolecular confinement, loading, and release from liquid-crystalline nanochannel assemblies

    Czech Academy of Sciences Publication Activity Database

    Angelova, A.; Angelov, Borislav; Garamus, V. M.; Couvreur, P.; Lesieur, S.

    2012-01-01

    Roč. 3, č. 3 (2012), s. 445-457 ISSN 1948-7185 Institutional research plan: CEZ:AV0Z40500505 Keywords : nanochannels * biomolecular nanostructures * SAXS Subject RIV: CD - Macromolecular Chemistry Impact factor: 6.585, year: 2012

  19. Effect of the meniscus contact angle during early regimes of spontaneous imbibition in nanochannels.

    Science.gov (United States)

    Karna, Nabin Kumar; Oyarzua, Elton; Walther, Jens H; Zambrano, Harvey A

    2016-11-30

    Nanoscale capillarity has been extensively investigated; nevertheless, many fundamental questions remain open. In spontaneous imbibition, the classical Lucas-Washburn equation predicts a singularity as the fluid enters the channel consisting of an anomalous infinite velocity of the capillary meniscus. Bosanquet's equation overcomes this problem by taking into account fluid inertia predicting an initial imbibition regime with constant velocity. Nevertheless, the initial constant velocity as predicted by Bosanquet's equation is much greater than those observed experimentally. In the present study, large scale atomistic simulations are conducted to investigate capillary imbibition of water in slit silica nanochannels with heights between 4 and 18 nm. We find that the meniscus contact angle remains constant during the inertial regime and its value depends on the height of the channel. We also find that the meniscus velocity computed at the channel entrance is related to the particular value of the meniscus contact angle. Moreover, during the subsequent visco-inertial regime, as the influence of viscosity increases, the meniscus contact angle is found to be time dependent for all the channels under study. Furthermore, we propose an expression for the time evolution of the dynamic contact angle in nanochannels which, when incorporated into Bosanquet's equation, satisfactorily explains the initial capillary rise.

  20. Molecular Dynamics and Monte Carlo simulations resolve apparent diffusion rate differences for proteins confined in nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, J.W., E-mail: tringe2@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Ileri, N. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Levie, H.W. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Stroeve, P.; Ustach, V.; Faller, R. [Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Renaud, P. [Swiss Federal Institute of Technology, Lausanne, (EPFL) (Switzerland)

    2015-08-18

    Highlights: • WGA proteins in nanochannels modeled by Molecular Dynamics and Monte Carlo. • Protein surface coverage characterized by atomic force microscopy. • Models indicate transport characteristics depend strongly on surface coverage. • Results resolve of a four orders of magnitude difference in diffusion coefficient values. - Abstract: We use Molecular Dynamics and Monte Carlo simulations to examine molecular transport phenomena in nanochannels, explaining four orders of magnitude difference in wheat germ agglutinin (WGA) protein diffusion rates observed by fluorescence correlation spectroscopy (FCS) and by direct imaging of fluorescently-labeled proteins. We first use the ESPResSo Molecular Dynamics code to estimate the surface transport distance for neutral and charged proteins. We then employ a Monte Carlo model to calculate the paths of protein molecules on surfaces and in the bulk liquid transport medium. Our results show that the transport characteristics depend strongly on the degree of molecular surface coverage. Atomic force microscope characterization of surfaces exposed to WGA proteins for 1000 s show large protein aggregates consistent with the predicted coverage. These calculations and experiments provide useful insight into the details of molecular motion in confined geometries.

  1. Robotic UV-Vis apparatus for long-term characterization of drug release from nanochannels

    International Nuclear Information System (INIS)

    Geninatti, T; Grattoni, A; Small, E

    2014-01-01

    Reliable monitoring of the kinetics of molecular release from drug delivery devices is crucial for their therapeutic success. Commercially available UV-Vis spectrophotometers provide reliable quantification of analyte concentrations directly correlated to the absorbance of fluids. However, they are not suitable for long-term measurements requiring high frequency of sampling from a large number of replicates and continuous fluid mixing, all of which are necessary for evaluation of drug delivery devices. To address this need, we developed a novel robotic apparatus serially connected to a commercial UV-Vis spectrophotometer. The robotic apparatus enables us to automatically and reliably acquire long-term data for up to 48 samples with high frequency of measurements and independent magnetic stirring. We equipped the robotic apparatus with independent connectors that allowed us to apply an electric potential to each sample for electrokinetic studies. The apparatus repeatability and accuracy was demonstrated in comparison to a commercial UV-Vis spectrophotometer. The system was successfully employed to characterize the diffusion kinetics of acetone and doxorubicin through nanochannel membranes (nDS) designed for long-term drug delivery. Dendritic fullerene 1 was used to show that the robotic apparatus routes the electric potential to nanochannel membranes enabling us to investigate the actively controlled release of molecules. Our results demonstrate that the robotic apparatus could widely broaden the range of applications of UV-Vis spectrophotometry, especially in the case of large sample processing and for long-term diffusive and electrokinetic studies in drug delivery. (technical design note)

  2. A novel vertical fan-out platform based on an array of curved anodic alumina nanochannels

    International Nuclear Information System (INIS)

    Liu, Chih-Yi; Lai, Ming-Yu; Tsai, Kun-Tong; Chang, Hsuan-Hao; Wang, Yuh-Lin; He, Jr-Hau; Shiue, Jessie

    2013-01-01

    Focused ion beam lithography and a two-step anodization have been combined to fabricate a vertical fan-out platform containing an array of unique probes. Each probe comprises three anodic alumina nanochannels with a fan-out arrangement. The lithography is used to pattern an aluminum sheet with a custom-designed array of triangular ‘cells’ whose apexes are composed of nanoholes. The nanoholes grow into straight nanochannels under proper voltage in the first-step anodization. The second step uses a doubled voltage to induce lateral repulsion among the nanochannels’ growth fronts originating in the same cell. Therefore, the fronts fan out. The repulsion roots in the inter-front distance being shorter than the naturally favoured length, which increases with anodization voltage. The fan-out evolution continues until the growth fronts originating in all the cells evolve into a close-packed two-dimensional hexagonal lattice whose spacing is identical to the favoured one. The chemical and physical mechanisms behind the fan-out fabrication are discussed. This novel fan-out platform facilitates probing and handling of many signals from different areas on a sample’s surface and is therefore promising for applications in detection and manipulation at the nanoscale level. (paper)

  3. Ultraporous films with uniform nanochannels by block copolymer micelles assembly

    KAUST Repository

    Nunes, Suzana Pereira

    2010-10-12

    Films with high pore density and regularity that are easy to manufacture by conventional large-scale technology are key components aimed for fabrication of new generations of magnetic arrays for storage media, medical scaffolds, and artificial membranes. However, potential manufacture strategies like the self-assembly of block copolymers, which lead to amazing regular patterns, could be hardly reproduced up to now using commercially feasible methods. Here we report a unique production method of nanoporous films based on the self-assembly of copper(II) ion-polystyrene-b-poly(4-vinylpyridine) complexes and nonsolvent induced phase separation. Extremely high pore densities and uniformity were achieved. Water fluxes of 890 L m-2 h-1 bar-1 were obtained, which are at least 1 order of magnitude higher than those of commercially available membranes with comparable pore size. The pores are also stimuli (pH)-responsive. © 2010 American Chemical Society.

  4. Eavesdropping on spin waves inside the domain-wall nanochannel via three-magnon processes

    Science.gov (United States)

    Zhang, Beining; Wang, Zhenyu; Cao, Yunshan; Yan, Peng; Wang, X. R.

    2018-03-01

    One recent breakthrough in the field of magnonics is the experimental realization of reconfigurable spin-wave nanochannels formed by a magnetic domain wall with a width of 10-100 nm [Wagner et al., Nat. Nano. 11, 432 (2016), 10.1038/nnano.2015.339]. This remarkable progress enables an energy-efficient spin-wave propagation with a well-defined wave vector along its propagating path inside the wall. In the mentioned experiment, a microfocus Brillouin light scattering spectroscopy was taken in a line-scans manner to measure the frequency of the bounded spin wave. Due to their localization nature, the confined spin waves can hardly be detected from outside the wall channel, which guarantees the information security to some extent. In this work, we theoretically propose a scheme to detect/eavesdrop on the spin waves inside the domain-wall nanochannel via nonlinear three-magnon processes. We send a spin wave (ωi,ki) in one magnetic domain to interact with the bounded mode (ωb,kb) in the wall, where kb is parallel with the domain-wall channel defined as the z ̂ axis. Two kinds of three-magnon processes, i.e., confluence and splitting, are expected to occur. The confluence process is conventional: conservation of energy and momentum parallel with the wall indicates a transmitted wave in the opposite domain with ω (k ) =ωi+ωb and (ki+kb-k ) .z ̂=0 , while the momentum perpendicular to the domain wall is not necessary to be conserved due to the nonuniform internal field near the wall. We predict a stimulated three-magnon splitting (or "magnon laser") effect: the presence of a bound magnon propagating along the domain wall channel assists the splitting of the incident wave into two modes, one is ω1=ωb,k1=kb identical to the bound mode in the channel, and the other one is ω2=ωi-ωb with (ki-kb-k2) .z ̂=0 propagating in the opposite magnetic domain. Micromagnetic simulations confirm our theoretical analysis. These results demonstrate that one is able to uniquely

  5. Temperature effects on the electrohydrodynamic and electrokinetic behaviour of ion-selective nanochannels

    International Nuclear Information System (INIS)

    Wood, Jeffery A; Benneker, Anne M; Lammertink, Rob G H

    2016-01-01

    A non-isothermal formulation of the Poisson–Nernst–Planck with Navier–Stokes equations is used to study the influence of heating effects in the form of Joule heating and viscous dissipation and imposed temperature gradients on a microchannel/nanochannel system. The system is solved numerically under various cases in order to determine the influence of temperature-related effects on ion-selectivity, flux and fluid flow profiles, as well as coupling between these phenomena. It is demonstrated that for a larger reservoir system, the effects of Joule heating and viscous dissipation only become relevant for higher salt concentrations and electric field strengths than are compatible with ion-selectivity due to Debye layer overlap. More interestingly, it is shown that using different temperature reservoirs can have a strong influence on ion-selectivity, as well as the induced electrohydrodynamic flows. (paper)

  6. A numerical model for simulating electroosmotic micro- and nanochannel flows under non-Boltzmann equilibrium

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyoungjin; Kwak, Ho Sang [School of Mechanical Engineering, Kumoh National Institute of Technology, 1 Yangho, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Song, Tae-Ho, E-mail: kimkj@kumoh.ac.kr, E-mail: hskwak@kumoh.ac.kr, E-mail: thsong@kaist.ac.kr [Department of Mechanical, Aerospace and Systems Engineering, Korea Advanced Institute of Science and Technology, 373-1 Guseong, Yuseong, Daejeon 305-701 (Korea, Republic of)

    2011-08-15

    This paper describes a numerical model for simulating electroosmotic flows (EOFs) under non-Boltzmann equilibrium in a micro- and nanochannel. The transport of ionic species is represented by employing the Nernst-Planck equation. Modeling issues related to numerical difficulties are discussed, which include the handling of boundary conditions based on surface charge density, the associated treatment of electric potential and the evasion of nonlinearity due to the electric body force. The EOF in the entrance region of a straight channel is examined. The numerical results show that the present model is useful for the prediction of the EOFs requiring a fine resolution of the electric double layer under either the Boltzmann equilibrium or non-equilibrium. Based on the numerical results, the correlation between the surface charge density and the zeta potential is investigated.

  7. Electric Field-Controlled Ion Transport In TiO2 Nanochannel.

    Science.gov (United States)

    Li, Dan; Jing, Wenheng; Li, Shuaiqiang; Shen, Hao; Xing, Weihong

    2015-06-03

    On the basis of biological ion channels, we constructed TiO2 membranes with rigid channels of 2.3 nm to mimic biomembranes with flexible channels; an external electric field was employed to regulate ion transport in the confined channels at a high ionic strength in the absence of electrical double layer overlap. Results show that transport rates for both Na+ and Mg2+ were decreased irrespective of the direction of the electric field. Furthermore, a voltage-gated selective ion channel was formed, the Mg2+ channel closed at -2 V, and a reversed relative electric field gradient was at the same order of the concentration gradient, whereas the Na+ with smaller Stokes radius and lower valence was less sensitive to the electric field and thus preferentially occupied and passed the channel. Thus, when an external electric field is applied, membranes with larger nanochannels have promising applications in selective separation of mixture salts at a high concentration.

  8. Distribution of distances between DNA barcode labels in nanochannels close to the persistence length

    Science.gov (United States)

    Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.

    2015-02-01

    We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.

  9. Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology

    DEFF Research Database (Denmark)

    Cao, Hongzhi; Hastie, Alex R.; Cao, Dandan

    2014-01-01

    mutations; however, none of the current detection methods are comprehensive, and currently available methodologies are incapable of providing sufficient resolution and unambiguous information across complex regions in the human genome. To address these challenges, we applied a high-throughput, cost......-effective genome mapping technology to comprehensively discover genome-wide SVs and characterize complex regions of the YH genome using long single molecules (>150 kb) in a global fashion. RESULTS: Utilizing nanochannel-based genome mapping technology, we obtained 708 insertions/deletions and 17 inversions larger...... fosmid data. Of the remaining 270 SVs, 260 are insertions and 213 overlap known SVs in the Database of Genomic Variants. Overall, 609 out of 666 (90%) variants were supported by experimental orthogonal methods or historical evidence in public databases. At the same time, genome mapping also provides...

  10. The Electrochemical Stability in NaCl Solution of Nanotubes and Nanochannels Elaborated on a New Ti-20Zr-5Ta-2Ag Alloy

    Directory of Open Access Journals (Sweden)

    Claudiu Constantin Manole

    2015-01-01

    Full Text Available Nanotubular and nanochannels structures were fabricated via anodizing on a new alloy Ti-20Zr-8Ta-2Ag. A continuous coating of connected tubes/channels can be observed in the SEM micrographs forming tubular structures with diameters in hundreds of nm, as well as smaller tubes, with diameters in tens of nm. In the case of nanochannels structure, the diameters are smaller and wall thicknesses significantly thinner than in nanotubes. Wettability measurements indicate a decrease of contact angles in both cases of nanotubes and nanochannels, but the increase of hydrophilic character is more significant in the case of nanochannels. The Tafel procedure and electrochemical impedance spectroscopy tests performed in NaCl 0.9% solution indicate a better stability for the nanostructured surfaces compared to untreated alloy, the surface with nanochannels offering higher corrosion resistance. Spectral UV-VIS determination has confirmed Ag metallic presence, opening the door for applications not only in tissue engineering but for water splitting and the photoreduction of CO2 as well.

  11. Voltage-Controlled Reconfigurable Spin-Wave Nanochannels and Logic Devices

    Science.gov (United States)

    Rana, Bivas; Otani, YoshiChika

    2018-01-01

    Propagating spin waves (SWs) promise to be a potential information carrier in future spintronics devices with lower power consumption. Here, we propose reconfigurable nanochannels (NCs) generated by voltage-controlled magnetic anisotropy (VCMA) in an ultrathin ferromagnetic waveguide for SW propagation. Numerical micromagnetic simulations are performed to demonstrate the confinement of magnetostatic forward volumelike spin waves in NCs by VCMA. We demonstrate that the NCs, with a width down to a few tens of a nanometer, can be configured either into a straight or curved structure on an extended SW waveguide. The key advantage is that either a single NC or any combination of a number of NCs can be easily configured by VCMA for simultaneous propagation of SWs either with the same or different wave vectors according to our needs. Furthermore, we demonstrate the logic operation of a voltage-controlled magnonic xnor and universal nand gate and propose a voltage-controlled reconfigurable SW switch for the development of a multiplexer and demultiplexer. We find that the NCs and logic devices can even be functioning in the absence of the external-bias magnetic field. These results are a step towards the development of all-voltage-controlled magnonic devices with an ultralow power consumption.

  12. Effect of hydrodynamic slippage on electro-osmotic flow in zeta potential patterned nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Datta, S; Choudhary, J N, E-mail: subhra-datta@iitd.ac.in [Department of Mechanical Engineering, Indian Institute of Technology Delhi, Hauz Khas, New Delhi 110016 (India)

    2013-10-01

    The effect of hydrodynamic slippage on the electro-osmotic flow in a nanochannel with thick electrical double layers whose wall surface potential has a periodic axial variation is studied. The equations of Stokes flow are solved exactly with the help of the Navier slip boundary condition and the Debye-Huckel linearization of the equation governing the potential of the electrical double layer. Each periodic cell of the flow field consists of four counter-rotating vortices. The cross-channel profile of the axial velocity at the center of the cell exhibits three extrema and a reversed velocity zone near the channel axis of symmetry. The size of the extrema and that of the reversed velocity zone increases with increase in the degree of slippage. In the limit when the wavelength of axial variation in surface potential is much larger than the channel width, the flow characteristics are interpreted in terms of the lubrication approximation. In the limit when the electrical double layer is much thinner than the channel height, the effect of slip is modeled by a Helmholtz-Smoluchowski apparent slip boundary condition that depends on the pattern wavelength. (paper)

  13. Non-Gaussian Distribution of DNA Barcode Extension In Nanochannels Using High-throughput Imaging

    Science.gov (United States)

    Sheats, Julian; Reinhart, Wesley; Reifenberger, Jeff; Gupta, Damini; Muralidhar, Abhiram; Cao, Han; Dorfman, Kevin

    2015-03-01

    We present experimental data for the extension of internal segments of highly confined DNA using a high-­throughput experimental setup. Barcode­-labeled E. coli genomic DNA molecules were imaged at a high areal density in square nanochannels with sizes ranging from 40 nm to 51 nm in width. Over 25,000 molecules were used to obtain more than 1,000,000 measurements for genomic distances between 2,500 bp and 100,000 bp. The distribution of extensions has positive excess kurtosis and is skew­ left due to weak backfolding in the channel. As a result, the two Odijk theories for the chain extension and variance bracket the experimental data. We compared to predictions of a harmonic approximation for the confinement free energy and show that it produces a substantial error in the variance. These results suggest an inherent error associated with any statistical analysis of barcoded DNA that relies on harmonic models for chain extension. Present address: Department of Chemical and Biological Engineering, Princeton University.

  14. Fabrication of self-enclosed nanochannels based on capillary-pressure balance mechanism

    Science.gov (United States)

    Kou, Yu; Sang, Aixia; Li, Xin; Wang, Xudi

    2017-10-01

    Polymer-based micro/nano fluidic devices are becoming increasingly important to biological applications and fluidic control. In this paper, we propose a self-enclosure method for the fabrication of large-area nanochannels without external force by using a capillary-pressure balance mechanism. The melt polymer coated on the nanogrooves fills into the trenches inevitably and the air in the trenches is not excluded but compressed, which leads to an equilibrium state between pressure of the trapped air and capillary force of melt polymer eventually, resulting in the channels’ formation. A pressure balance model was proposed to elucidate the unique self-sealing phenomenon and the criteria for the design and construction of sealed channels was discussed. According to the bonding mechanism investigated using the volume of fluid (VOF) simulation and experiments, we can control the dimension of sealed channels by varying the baking condition. This fabrication technique has great potential for low-cost and mass production of polymeric-based micro/nano fluidic devices.

  15. Knotting dynamics of DNA chains of different length confined in nanochannels

    International Nuclear Information System (INIS)

    Suma, Antonio; Micheletti, Cristian; Orlandini, Enzo

    2015-01-01

    Langevin dynamics simulations are used to characterize the typical mechanisms governing the spontaneous tying, untying and the dynamical evolution of knots in coarse-grained models of DNA chains confined in nanochannels. In particular we focus on how these mechanisms depend on the chain contour length, L c , at a fixed channel width D = 56 nm corresponding to the onset of the Odijk scaling regime where chain backfoldings and hence knots are disfavoured but not suppressed altogether. We find that the lifetime of knots grows significantly with L c , while that of unknots varies to a lesser extent. The underlying kinetic mechanisms are clarified by analysing the evolution of the knot position along the chain. At the considered confinement, in fact, knots are typically tied by local backfoldings of the chain termini where they are eventually untied after a stochastic motion along the chain. Consequently, the lifetime of unknots is mostly controlled by backfoldings events at the chain ends, which is largely independent of L c . The lifetime of knots, instead, increases significantly with L c because knots can, on average, travel farther along the chain before being untied. The observed interplay of knots and unknots lifetimes underpins the growth of the equilibrium knotting probability of longer and longer chains at fixed channel confinement. (paper)

  16. Electrohydrodynamics in nanochannels coated by mixed polymer brushes: effects of electric field strength and solvent quality

    Science.gov (United States)

    Cao, Qianqian; Tian, Xiu; You, Hao

    2018-04-01

    We examine the electrohydrodynamics in mixed polymer brush-coated nanochannels and the conformational dynamics of grafted polymers using molecular dynamics simulations. Charged (A) and neutral polymers (B) are alternately grafted on the channel surfaces. The effects of the electric field strength and solvent quality are addressed in detail. The dependence of electroosmotic flow characteristics and polymer conformational behavior on the solvent quality is influenced due to the change of the electric field strength. The enhanced electric field induces a collapse of the neutral polymer chains which adopt a highly extended conformation along the flow direction. However, the thickness of the charged polymer layer is affected weakly by the electric field, and even a slight swelling is identified for the A-B attraction case, implying the conformational coupling between two polymer species. Furthermore, the charged polymer chains incline entirely towards the electric field direction oppositely to the flow direction. More importantly, unlike the neutral polymer chains, the shape factor of the charged polymer chains, which is used to describe the overall shape of polymer chains, is reduced significantly with increasing the electric field strength, corresponding to a more coiled structure.

  17. Functionalization of nanochannels by radio-induced grafting polymerization on PET track-etched membranes

    International Nuclear Information System (INIS)

    Soto Espinoza, S.L.; Arbeitman, C.R.; Clochard, M.C.; Grasselli, M.

    2014-01-01

    The application of swift-heavy ion bombardment to polymers is a well-established technique to manufacture micro- and nanopores onto polymeric films to obtain porous membranes. A few years ago, it was realized that, during ion bombardment, the high energy deposition along the ion path through the polymer reached cylindrical damage regions corresponding to the core trace and the penumbra. After the etching procedure, there are still enough active sites left in the penumbra that can be used to initiate a polymerization process selectively inside the membrane pores. In this study, we report the grafting polymerization of glycidyl methacrylate onto etched PET foils to obtain functionalized nanochannels. Grafted polymers were labeled with a fluorescent tag and analyzed by different fluorescence techniques such as direct fluorescence, fluorescence microscopy and confocal microscopy. These techniques allowed identifying and quantifying the grafted regions on the polymeric foils. - Highlights: • Irradiated PET foils with swift-heavy ions were etched and grafted in a step-by-step process. • Grafting polymerization was performed on the remaining active sites after etching. • Track-etched PET membranes were fluorescently labeled by chemical functionalization. • Functionalized track-etched PET membranes were analyzed by fluorescence and confocal microscopy

  18. Probing electron density across Ar{sup +} irradiation-induced self-organized TiO{sub 2−x} nanochannels for memory application

    Energy Technology Data Exchange (ETDEWEB)

    Barman, A.; Saini, C. P.; Ghosh, S. K.; Dhar, S.; Kanjilal, A., E-mail: aloke.kanjilal@snu.edu.in [Department of Physics, School of Natural Sciences, Shiv Nadar University, NH-91, Tehsil Dadri, Gautam Buddha Nagar, Uttar Pradesh 201314 (India); Sarkar, P. K.; Roy, A. [Department of Physics, National Institute of Technology, Silchar, Assam 788010 (India); Satpati, B. [Surface Physics and Material Science Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Kanjilal, D. [Inter University Accelerator Centre, Aruna Asaf Ali Marg, New Delhi 110067 (India)

    2016-06-13

    The variation of electron density in TiO{sub 2−x} nanochannels, exhibiting resistive switching phenomenon, produced by Ar{sup +} ion-irradiation at the threshold fluence of 5 × 10{sup 16} ions/cm{sup 2} is demonstrated by X-ray reflectivity (XRR). The transmission electron microscopy reveals the formation of nanochannels, while the energy dispersive X-ray spectroscopy confirms Ti enrichment near the surface due to ion-irradiation, in consistent with the increase in electron density by XRR measurements. Such a variation in Ti concentration indicates the evolution of oxygen vacancies (OVs) along the TiO{sub 2−x} nanochannels, and thus paves the way to explain the operation and performance of the Pt/TiO{sub 2−x}/Pt-based memory devices via OV migration.

  19. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  20. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Czech Academy of Sciences Publication Activity Database

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav

    2014-01-01

    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  1. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  2. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  3. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  4. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  5. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  6. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  7. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  8. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  9. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  10. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  11. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  12. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  13. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  14. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways

    Science.gov (United States)

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying

    2017-08-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  15. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  16. Suppression of ion conductance by electro-osmotic flow in nano-channels with weakly overlapping electrical double layers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2016-08-01

    Full Text Available This theoretical study investigates the nonlinear ionic current-voltage characteristics of nano-channels that have weakly overlapping electrical double layers. Numerical simulations as well as a 1-D mathematical model are developed to reveal that the electro-osmotic flow (EOF interplays with the concentration-polarization process and depletes the ion concentration inside the channels, thus significantly suppressing the channel conductance. The conductance may be restored at high electrical biases in the presence of recirculating vortices within the channels. As a result of the EOF-driven ion depletion, a limiting-conductance behavior is identified, which is intrinsically different from the classical limiting-current behavior.

  17. Magnetic domain walls as reconfigurable spin-wave nano-channels

    Science.gov (United States)

    Wagner, Kai

    Research efforts to utilize spin waves as information carriers for wave based logic in micro- and nano-structured ferromagnetic materials have increased tremendously over the recent years. However, finding efficient means of tailoring and downscaling guided spin-wave propagation in two dimensions, while maintaining energy efficiency and reconfigurability, still remains a delicate challenge. Here we target these challenges by spin-wave transport inside nanometer-scaled potential wells formed along magnetic domain walls. For this, we investigate the magnetization dynamics of a rectangular-like element in a Landau state exhibiting a so called 180° Néel wall along its center. By microwave antennae the rf-excitation is constricted to one end of the domain wall and the spin-wave intensities are recorded by means of Brillouin-Light Scattering microscopy revealing channeled transport. Additional micromagnetic simulations with pulsed as well as cw-excitation are performed to yield further insight into this class of modes. We find several spin-wave modes quantized along the width of the domain wall yet with well defined wave vectors along the wall, exhibiting positive dispersion. In a final step, we demonstrate the flexibility of these spin-wave nano-channels based on domain walls. In contrast to wave guides realised by fixed geometries, domain walls can be easily manipulated. Here we utilize small external fields to control its position with nanometer precision over a micrometer range, while still enabling transport. Domain walls thus, open the perspective for reprogrammable and yet non-volatile spin-wave waveguides of nanometer width. Financial support by the Deutsche Forschungsgemeinschaft within project SCHU2922/1-1 is gratefully acknowledged.

  18. Molecular dynamics simulations for the motion of evaporative droplets driven by thermal gradients along nanochannels

    KAUST Repository

    Wu, Congmin

    2013-04-04

    For a one-component fluid on a solid substrate, a thermal singularity may occur at the contact line where the liquid-vapor interface intersects the solid surface. Physically, the liquid-vapor interface is almost isothermal at the liquid-vapor coexistence temperature in one-component fluids while the solid surface is almost isothermal for solids of high thermal conductivity. Therefore, a temperature discontinuity is formed if the two isothermal interfaces are of different temperatures and intersect at the contact line. This leads to the so-called thermal singularity. The localized hydrodynamics involving evaporation/condensation near the contact line leads to a contact angle depending on the underlying substrate temperature. This dependence has been shown to lead to the motion of liquid droplets on solid substrates with thermal gradients (Xu and Qian 2012 Phys. Rev. E 85 061603). In the present work, we carry out molecular dynamics (MD) simulations as numerical experiments to further confirm the predictions made from our previous continuum hydrodynamic modeling and simulations, which are actually semi-quantitatively accurate down to the small length scales in the problem. Using MD simulations, we investigate the motion of evaporative droplets in one-component Lennard-Jones fluids confined in nanochannels with thermal gradients. The droplet is found to migrate in the direction of decreasing temperature of solid walls, with a migration velocity linearly proportional to the temperature gradient. This agrees with the prediction of our continuum model. We then measure the effect of droplet size on the droplet motion. It is found that the droplet mobility is inversely proportional to a dimensionless coefficient associated with the total rate of dissipation due to droplet movement. Our results show that this coefficient is of order unity and increases with the droplet size for the small droplets (∼10 nm) simulated in the present work. These findings are in semi

  19. Correlation between inter-spin interaction and molecular dynamics of organic radicals in organic 1D nanochannels

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Hirokazu [Department of Chemistry, College of Humanities and Sciences, Nihon University 3-25-40, Sakura-jo-sui, Setagaya-ku, Tokyo, 156-8550 (Japan)

    2015-12-31

    One-dimensional (1D) molecular chains of 4-substituted-2,2,6,6-tetramethyl-1-piperidinyloxyl (4-X-TEMPO) radicals were constructed in the crystalline 1D nanochannels of 2,4,6-tris(4-chlorophenoxy)-1,3,5-triazine (CLPOT) used as a template. The ESR spectra of CLPOT inclusion compounds (ICs) using 4-X-TEMPO were examined on the basis of spectral simulation using EasySpin program package for simulating and fitting ESR spectra. The ESR spectra of [(CLPOT){sub 2}-(TEMPO){sub 1.0}] IC were isotropic in the total range of temperatures. The peak-to-peak line width (ΔB{sub pp}) became monotonically narrower from 2.8 to 1.3 mT with increase in temperature in the range of 4.2–298 K. The effect of the rotational diffusion motion of TEMPO radicals in the CLPOT nanochannels for the inter-spin interaction of the [(CLPOT){sub 2}-(TEMPO){sub 1.0}] IC was found to be smaller than the case of [(TPP){sub 2}−(TEMPO){sub 1.0}] IC (TPP = tris(o-phenylenedioxy)cyclotriphosphazene) reported in our previous study. The ΔB{sub pp} of the [(CLPOT){sub 2}-(TEMPO){sub 1.0}] IC in the whole range of temperatures was much narrower than the estimation to be based on the Van Vleck’s formula for the second moment of the rigid lattice model where the electron spin can be considered as fixed; 11 mT of Gaussian line-width component. This suggests the possibility of exchange narrowing in the 1D organic-radical chains of the [(CLPOT){sub 2}-(TEMPO){sub 1.0}] IC. On the other hand, the ESR spectra of [(CLPOT){sub 2}-(MeO-TEMPO){sub 0.41}] IC (MeO-TEMPO = 4-methoxy-TEMPO) were reproduced by a superposition of major broad isotropic adsorption line and minor temperature-dependent modulated triplet component. This suggests that the IC has the part of 1D organic-radical chains and MeO-TEMPO molecules isolated in the CLPOT nanochannels.

  20. Novel Protic Ionic Liquid Composite Membranes with Fast and Selective Gas Transport Nanochannels for Ethylene/Ethane Separation.

    Science.gov (United States)

    Dou, Haozhen; Jiang, Bin; Xiao, Xiaoming; Xu, Mi; Tantai, Xiaowei; Wang, Baoyu; Sun, Yongli; Zhang, Luhong

    2018-04-25

    Protic ionic liquids (PILs) were utilized for the fabrication of composite membranes containing silver salt as the C 2 H 4 transport carrier to perform C 2 H 4 /C 2 H 6 separation for the first time. The intrinsic nanostructures of PILs were adopted to construct fast and selective C 2 H 4 transport nanochannels. The investigation of structure-performance relationships of composite membranes suggested that transport nanochannels (polar domains of PILs) could be tuned by the sizes of cations, which greatly manipulated activity of the carrier and determined the separation performances of membranes. The role of different carriers in the facilitated transport was studied, which revealed that the PILs were good solvents for dissolution and activation of the carrier due to their hydrogen bond networks and waterlike properties. The operating conditions of separation process were investigated systemically and optimized, confirming C 2 H 4 /C 2 H 6 selectivity was enhanced with the increase of silver salt concentration, the flow rate of sweep gas, and the feed ratio of C 2 H 4 to C 2 H 6 , as well as the decrease of the transmembrane pressure and operating temperature. Furthermore, the composite membranes exhibited long-term stability and obtained very competitive separation performances compared with other results. In summary, PIL composite membranes, which possess good long-term stability, high C 2 H 4 /C 2 H 6 selectivity, and excellent C 2 H 4 permeability, may have a good perspective in industrial C 2 H 4 /C 2 H 6 separation.

  1. Structure and dynamics of water confined in a graphene nanochannel under gigapascal high pressure: dependence of friction on pressure and confinement.

    Science.gov (United States)

    Yang, Lei; Guo, Yanjie; Diao, Dongfeng

    2017-05-31

    Recently, water flow confined in nanochannels has become an interesting topic due to its unique properties and potential applications in nanofluidic devices. The trapped water is predicted to experience high pressure in the gigapascal regime. Theoretical and experimental studies have reported various novel structures of the confined water under high pressure. However, the role of this high pressure on the dynamic properties of water has not been elucidated to date. In the present study, the structure evolution and interfacial friction behavior of water constrained in a graphene nanochannel were investigated via molecular dynamics simulations. Transitions of the confined water to different ice phases at room temperature were observed in the presence of lateral pressure at the gigapascal level. The friction coefficient at the water/graphene interface was found to be dependent on the lateral pressure and nanochannel height. Further theoretical analyses indicate that the pressure dependence of friction is related to the pressure-induced change in the structure of water and the confinement dependence results from the variation in the water/graphene interaction energy barrier. These findings provide a basic understanding of the dynamics of the nanoconfined water, which is crucial in both fundamental and applied science.

  2. Forging Fast Ion Conducting Nanochannels with Swift Heavy Ions: The Correlated Role of Local Electronic and Atomic Structure

    Energy Technology Data Exchange (ETDEWEB)

    Sachan, Ritesh [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Material Science and Technology Division; Cooper, Valentino R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Material Science and Technology Division; Liu, Bin [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Materials Science and Engineering; Aidhy, Dilpuneet S. [Univ. of Wyoming, Laramie, WY (United States). Dept. of Mechanical Engineering; Voas, Brian K. [Iowa State Univ., Ames, IA (United States). Dept. of Materials Science and Engineering; Lang, Maik [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Nuclear Engineering; Ou, Xin [Chinese Academy of Sciences (CAS), Shanghai (China). State Key Lab. of Functional Material for Informatics; Trautmann, Christina [GSI Helmholtz Centre for Heavy Ion Research, Darmstadt (Germany); Technical Univ. of Darmstadt (Germany). Dept. of Materials Science; Zhang, Yanwen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Material Science and Technology Division; Univ. of Tennessee, Knoxville, TN (United States). Dept. of Materials Science and Engineering; Chisholm, Matthew F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Material Science and Technology Division; Weber, William J. [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Materials Science and Engineering; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Material Science and Technology Division

    2016-12-19

    Atomically disordered oxides have attracted significant attention in recent years due to the possibility of enhanced ionic conductivity. However, the correlation between atomic disorder, corresponding electronic structure, and the resulting oxygen diffusivity is not well understood. The disordered variants of the ordered pyrochlore structure in gadolinium titanate (Gd2Ti2O7) are seen as a particularly interesting prospect due to intrinsic presence of a vacant oxygen site in the unit atomic structure, which could provide a channel for fast oxygen conduction. In this paper, we provide insights into the subangstrom scale on the disordering-induced variations in the local atomic environment and its effect on the electronic structure in high-energy ion irradiation-induced disordered nanochannels, which can be utilized as pathways for fast oxygen ion transport. With the help of an atomic plane-by-plane-resolved analyses, the work shows how the presence of various types of TiOx polyhedral that exist in the amorphous and disordered crystalline phase modify the electronic structures relative to the ordered pyrochlore phase in Gd2Ti2O7. Finally, the correlated molecular dynamics simulations on the disordered structures show a remarkable enhancement in oxygen diffusivity as compared with ordered pyrochlore lattice and make that a suitable candidate for applications requiring fast oxygen conduction.

  3. Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels

    Science.gov (United States)

    Orlandini, Enzo; Micheletti, Cristian

    2014-03-01

    Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.

  4. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents

    Czech Academy of Sciences Publication Activity Database

    Belmonte-Reche, E.; Martínez-García, M.; Guédin, A.; Zuffo, M.; Arevalo-Ruiz, M.; Doria, F.; Campos-Salinas, J.; Maynadier, M.; Lopez-Rubio, J.J.; Freccero, M.; Mergny, Jean-Louis; Maria Perez-Victoria, J.; Carlos Morales, J.

    2018-01-01

    Roč. 61, č. 3 (2018), s. 1231-1240 ISSN 0022-2623 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : terminal repeat promoter * plasmodium-falciparum Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 6.259, year: 2016

  5. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Science.gov (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  6. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    OpenAIRE

    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  8. Hierarchically porous carbon membranes containing designed nanochannel architectures obtained by pyrolysis of ion-track etched polyimide

    Energy Technology Data Exchange (ETDEWEB)

    Muench, Falk, E-mail: muench@ca.tu-darmstadt.de [Department of Material- and Geoscience, Technische Universität Darmstadt, Alarich-Weiss-Straße 2, 64287 Darmstadt (Germany); Seidl, Tim; Rauber, Markus [Department of Material- and Geoscience, Technische Universität Darmstadt, Alarich-Weiss-Straße 2, 64287 Darmstadt (Germany); Material Research Department, GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Peter, Benedikt; Brötz, Joachim [Department of Material- and Geoscience, Technische Universität Darmstadt, Alarich-Weiss-Straße 2, 64287 Darmstadt (Germany); Krause, Markus; Trautmann, Christina [Department of Material- and Geoscience, Technische Universität Darmstadt, Alarich-Weiss-Straße 2, 64287 Darmstadt (Germany); Material Research Department, GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Roth, Christina [Department of Chemistry and Biochemistry, Freie Universität Berlin, Takustraße 3, 14195 Berlin (Germany); Katusic, Stipan [Evonik Industries AG, Rodenbacher Chaussee 4, 63457 Hanau (Germany); Ensinger, Wolfgang [Department of Material- and Geoscience, Technische Universität Darmstadt, Alarich-Weiss-Straße 2, 64287 Darmstadt (Germany)

    2014-12-15

    Well-defined, porous carbon monoliths are highly promising materials for electrochemical applications, separation, purification and catalysis. In this work, we present an approach allowing to transfer the remarkable degree of synthetic control given by the ion-track etching technology to the fabrication of carbon membranes with porosity structured on multiple length scales. The carbonization and pore formation processes were examined with Raman, Brunauer–Emmett–Teller (BET), scanning electron microscopy (SEM) and X-ray diffraction (XRD) measurements, while model experiments demonstrated the viability of the carbon membranes as catalyst support and pollutant adsorbent. Using ion-track etching, specifically designed, continuous channel-shaped pores were introduced into polyimide foils with precise control over channel diameter, orientation, density and interconnection. At a pyrolysis temperature of 950 °C, the artificially created channels shrunk in size, but their shape was preserved, while the polymer was transformed to microporous, amorphous carbon. Channel diameters ranging from ∼10 to several 100 nm could be achieved. The channels also gave access to previously closed micropore volume. Substantial surface increase was realized, as it was shown by introducing a network consisting of 1.4 × 10{sup 10} channels per cm{sup 2} of 30 nm diameter, which more than tripled the mass-normalized surface of the pyrolytic carbon from 205 m{sup 2} g{sup −1} to 732 m{sup 2} g{sup −1}. At a pyrolysis temperature of 3000 °C, membranes consisting of highly ordered graphite were obtained. In this case, the channel shape was severely altered, resulting in a pronounced conical geometry in which the channel diameter quickly decreased with increasing distance to the membrane surface. - Highlights: • Pyrolysis of ion-track etched polyimide yields porous carbon membranes. • Hierarchic porosity: continuous nanochannels embedded in a microporous carbon matrix.

  9. Hierarchically porous carbon membranes containing designed nanochannel architectures obtained by pyrolysis of ion-track etched polyimide

    International Nuclear Information System (INIS)

    Muench, Falk; Seidl, Tim; Rauber, Markus; Peter, Benedikt; Brötz, Joachim; Krause, Markus; Trautmann, Christina; Roth, Christina; Katusic, Stipan; Ensinger, Wolfgang

    2014-01-01

    Well-defined, porous carbon monoliths are highly promising materials for electrochemical applications, separation, purification and catalysis. In this work, we present an approach allowing to transfer the remarkable degree of synthetic control given by the ion-track etching technology to the fabrication of carbon membranes with porosity structured on multiple length scales. The carbonization and pore formation processes were examined with Raman, Brunauer–Emmett–Teller (BET), scanning electron microscopy (SEM) and X-ray diffraction (XRD) measurements, while model experiments demonstrated the viability of the carbon membranes as catalyst support and pollutant adsorbent. Using ion-track etching, specifically designed, continuous channel-shaped pores were introduced into polyimide foils with precise control over channel diameter, orientation, density and interconnection. At a pyrolysis temperature of 950 °C, the artificially created channels shrunk in size, but their shape was preserved, while the polymer was transformed to microporous, amorphous carbon. Channel diameters ranging from ∼10 to several 100 nm could be achieved. The channels also gave access to previously closed micropore volume. Substantial surface increase was realized, as it was shown by introducing a network consisting of 1.4 × 10 10 channels per cm 2 of 30 nm diameter, which more than tripled the mass-normalized surface of the pyrolytic carbon from 205 m 2  g −1 to 732 m 2  g −1 . At a pyrolysis temperature of 3000 °C, membranes consisting of highly ordered graphite were obtained. In this case, the channel shape was severely altered, resulting in a pronounced conical geometry in which the channel diameter quickly decreased with increasing distance to the membrane surface. - Highlights: • Pyrolysis of ion-track etched polyimide yields porous carbon membranes. • Hierarchic porosity: continuous nanochannels embedded in a microporous carbon matrix. • Freely adjustable meso- or

  10. ZnO nanoparticles modulate the ionic transport and voltage regulation of lysenin nanochannels.

    Science.gov (United States)

    Bryant, Sheenah L; Eixenberger, Josh E; Rossland, Steven; Apsley, Holly; Hoffmann, Connor; Shrestha, Nisha; McHugh, Michael; Punnoose, Alex; Fologea, Daniel

    2017-12-16

    The insufficient understanding of unintended biological impacts from nanomaterials (NMs) represents a serious impediment to their use for scientific, technological, and medical applications. While previous studies have focused on understanding nanotoxicity effects mostly resulting from cellular internalization, recent work indicates that NMs may interfere with transmembrane transport mechanisms, hence enabling contributions to nanotoxicity by affecting key biological activities dependent on transmembrane transport. In this line of inquiry, we investigated the effects of charged nanoparticles (NPs) on the transport properties of lysenin, a pore-forming toxin that shares fundamental features with ion channels such as regulation and high transport rate. The macroscopic conductance of lysenin channels greatly diminished in the presence of cationic ZnO NPs. The inhibitory effects were asymmetrical relative to the direction of the electric field and addition site, suggesting electrostatic interactions between ZnO NPs and a binding site. Similar changes in the macroscopic conductance were observed when lysenin channels were reconstituted in neutral lipid membranes, implicating protein-NP interactions as the major contributor to the reduced transport capabilities. In contrast, no inhibitory effects were observed in the presence of anionic SnO 2 NPs. Additionally, we demonstrate that inhibition of ion transport is not due to the dissolution of ZnO NPs and subsequent interactions of zinc ions with lysenin channels. We conclude that electrostatic interactions between positively charged ZnO NPs and negative charges within the lysenin channels are responsible for the inhibitory effects on the transport of ions. These interactions point to a potential mechanism of cytotoxicity, which may not require NP internalization.

  11. Positronium in the AEgIS experiment: study on its emission from nanochanneled samples and design of a new apparatus for Rydberg excitations

    CERN Document Server

    Di Noto, Lea

    This experimental thesis has been done in the framework of AEgIS (Antimatter Experiment: Gravity, Interferometry, Spectroscopy), an experiment installed at CERN, whose primary goal is the measurement of the Earth's gravitational acceleration on anti-hydrogen. The antiatoms will be produced by the charge exchange reaction, where a cloud of Ps in Rydberg states interacts with cooled trapped antiprotons. Since the charge exchange cross section depends on Ps velocity and quantum number, the velocity distribution of Ps emitted by a positron-positronium converter as well as its excitation in Rydberg states have to be studied and optimized. In this thesis Ps cooling and emission into vacuum from nanochannelled silicon targets was studied by performing Time of Flight measurements with a dedicated apparatus conceived to receive the slow positron beam as produced at the Trento laboratory or at the NEPOMUC facility at Munich. Measurements were done by varying the positron implantation energy, the sample temperature and ...

  12. A polymeric liquid membrane electrode responsive to 3,3',5,5'-tetramethylbenzidine oxidation for sensitive peroxidase/peroxidase mimetic-based potentiometric biosensing.

    Science.gov (United States)

    Wang, Xuewei; Yang, Yangang; Li, Long; Sun, Mingshuang; Yin, Haogen; Qin, Wei

    2014-05-06

    The oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) has great utility in bioanalysis such as peroxidase/peroxidase mimetic-based biosensing. In this paper, the behaviors of TMB oxidation intermediates/products in liquid/liquid biphasic systems have been investigated for the first time. The free radical, charge transfer complex, and diimine species generated by TMB oxidation are all positively charged under acidic and near-neutral conditions. Electron paramagnetic resonance and visible absorbance spectroscopy data demonstrate that these cationic species can be effectively transferred from an aqueous phase into a water-immiscible liquid phase functionalized by an appropriate cation exchanger. Accordingly, sensitive potential responses of TMB oxidation have been obtained on a cation exchanger-doped polymeric liquid membrane electrode under mildly acidic and near-neutral conditions. By using the membrane electrode responsive to TMB oxidations, two sensitive potentiometric biosensing schemes including the peroxidase-labeled sandwich immunoassay and G-quadruplex DNAzyme-based DNA hybridization assay have been developed. The obtained detection limits for the target antigen and DNA are 0.02 ng/mL and 0.1 nM, respectively. Coupled with other advantages such as low cost, high reliability, and ease of miniaturization and integration, the proposed polymeric liquid membrane electrode holds great promise as a facile and efficient transducer for TMB oxidation and related biosensing applications.

  13. Radiation induced deposition of copper nanoparticles inside the nanochannels of poly(acrylic acid)-grafted poly(ethylene terephthalate) track-etched membranes

    Science.gov (United States)

    Korolkov, Ilya V.; Güven, Olgun; Mashentseva, Anastassiya A.; Atıcı, Ayse Bakar; Gorin, Yevgeniy G.; Zdorovets, Maxim V.; Taltenov, Abzal A.

    2017-01-01

    Poly(ethylene terephthalate) PET, track-etched membranes (TeMs) with 400 nm average pore size were UV-grafted with poly(acrylic acid) (PAA) after oxidation of inner surfaces by H2O2/UV system. Carboxylate groups of grafted PAA chains were easily complexed with Cu2+ ions in aqueous solutions. These ions were converted into metallic copper nanoparticles (NPs) by radiation-induced reduction of copper ions in aqueous-alcohol solution by gamma rays in the dose range of 46-250 kGy. Copper ions chelating with -COOH groups of PAA chains grafted on PET TeMs form polymer-metal ion complex that prevent the formation of agglomerates during reduction of copper ions to metallic nanoparticles. The detailed analysis by X-Ray diffraction technique (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM) and energy-dispersive X-ray spectroscopy (EDX) confirmed the deposition of copper nanoparticles with the average size of 70 nm on the inner surface of nanochannels of PET TeMs. Samples were also investigated by FTIR, ESR spectroscopies to follow copper ion reduction.

  14. Novel three-dimensional tin/carbon hybrid core/shell architecture with large amount of solid cross-linked micro/nanochannels for lithium ion battery application

    International Nuclear Information System (INIS)

    Yang, Zunxian; Meng, Qing; Yan, Wenhuan; Lv, Jun; Guo, Zaiping; Yu, Xuebin; Chen, Zhixin; Guo, Tailiang; Zeng, Rong

    2015-01-01

    Uniform Sn/C hybrid core/shell nanocomposites were synthesized by a combination of electrospinning and subsequent thermal treatment in a reducing atmosphere. The particular three-dimensional architecture, consisting of a Sn@C nanoparticle core and porous hollow carbon nanofiber shell, is characterized by many micro/nanochannels, enhanced mechanical support from the three-dimensional hollow carbon shell, and the abundant porous carbon matrix. The as-prepared Sn/C core/shell nanomaterials exhibit excellent electrochemical performance. They display a reversible capacity of 546.7 mAhg −1 up to 100 cycles at the current density of 40 mAg −1 and good rate capability of 181.8 mAhg −1 at 4000 mAg −1 . These results indicate that the composite could be a promising anode candidate for lithium ion batteries. - Highlights: • Sn/C core/shell composites were synthesized by an electrospinning, a hydrothermal process, and further thermal treatment. • The best-performing 3D composite consists of a Sn@C nanoparticle core and porous hollow carbon nanofiber shell. • The Sn/C composite electrode exhibit excellent Li ion storage capacity and cycling stability

  15. Response

    Science.gov (United States)

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  16. Epigenetics of peripheral B cell differentiation and the antibody response

    Directory of Open Access Journals (Sweden)

    Hong eZan

    2015-12-01

    Full Text Available Epigenetic modifications, such as histone post-translational modifications, DNA methylation, and alteration of gene expression by non-coding RNAs, including microRNAs (miRNAs and long non-coding RNAs (lncRNAs, are heritable changes that are independent from the genomic DNA sequence. These regulate gene activities and, therefore, cellular functions. Epigenetic modifications act in concert with transcription factors and play critical roles in B cell development and differentiation, thereby modulating antibody responses to foreign- and self-antigens. Upon antigen encounter by mature B cells in the periphery, alterations of these lymphocytes epigenetic landscape are induced by the same stimuli that drive the antibody response. Such alterations instruct B cells to undergo immunoglobulin class switch DNA recombination (CSR and somatic hypermutation (SHM, as well as differentiation to memory B cells or long-lived plasma cells for the immune memory. Inducible histone modifications, together with DNA methylation and miRNAs modulate the transcriptome, particularly the expression of activation-induced cytidine deaminase (AID, which is essential for CSR and SHM, and factors central to plasma cell differentiation, such as B lymphocyte-induced maturation protein-1 (Blimp-1. These inducible B cell-intrinsic epigenetic marks guide the maturation of antibody responses. Combinatorial histone modifications also function as histone codes to target CSR and, possibly, SHM machinery to the Ig loci by recruiting specific adaptors that can stabilize CSR/SHM factors. In addition, lncRNAs, such as recently reported lncRNA-CSR and an lncRNA generated through transcription of the S region that form G-quadruplex structures, are also important for CSR targeting. Epigenetic dysregulation in B cells, including the aberrant expression of non-coding RNAs and alterations of histone modifications and DNA methylation, can result in aberrant antibody responses to foreign antigens

  17. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  18. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  19. Coarse-Grained Simulations Complemented by Atomistic Molecular Dynamics Provide New Insights into Folding and Unfolding of Human Telomeric G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Mazzanti, L.; Cragnolini, T.; Wales, D.J.; Derreumaux, P.; Pasquali, C.; Sponer, Jiri

    2016-01-01

    Roč. 12, č. 12 (2016), s. 6077-6097 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : particle mesh ewald * amber force-field * free-energy profiles * binding dna aptamer Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  20. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  1. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  2. Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay

    Czech Academy of Sciences Publication Activity Database

    Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.

    2017-01-01

    Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  3. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Czech Academy of Sciences Publication Activity Database

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip

    2016-01-01

    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016 http://www.nature.com/articles/srep23499

  4. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-01-01

    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  5. Electrochemical and circular dichroism spectroscopic evidence of two types of interaction between [Ru(NH3)(6)](3+) and an elongated thrombin binding aptamer G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Kejnovská, Iva; Buess-Herman, C.; Doneux, T.

    2015-01-01

    Roč. 179, OCT 2015 (2015), s. 84-92 ISSN 0013-4686 Institutional support: RVO:68081707 Keywords : Biosensors * Thrombin binding aptamer * Hexaammineruthenium Subject RIV: BO - Biophysics Impact factor: 4.803, year: 2015

  6. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  7. Switchable pH-responsive polymeric membranes prepared via block copolymer micelle assembly

    KAUST Repository

    Nunes, Suzana Pereira

    2011-05-24

    A process is described to manufacture monodisperse asymmetric pH-responsive nanochannels with very high densities (pore density >2 × 10 14 pores per m2), reproducible in m2 scale. Cylindric pores with diameters in the sub-10 nm range and lengths in the 400 nm range were formed by self-assembly of metal-block copolymer complexes and nonsolvent-induced phase separation. The film morphology was tailored by taking into account the stability constants for a series of metal-polymer complexes and confirmed by AFM. The distribution of metal-copolymer micelles was imaged by transmission electron microscopy tomography. The pH response of the polymer nanochannels is the strongest reported with synthetic pores in the nm range (reversible flux increase of more than 2 orders of magnitude when switching the pH from 2 to 8) and could be demonstrated by cryo-field emission scanning electron microscopy, SAXS, and ultra/nanofiltration experiments. © 2011 American Chemical Society.

  8. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    Science.gov (United States)

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-05

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery.

  9. Electron velocity of 6 × 107 cm/s at 300 K in stress engineered InAlN/GaN nano-channel high-electron-mobility transistors

    International Nuclear Information System (INIS)

    Arulkumaran, S.; Manoj Kumar, C. M.; Ranjan, K.; Teo, K. L.; Ng, G. I.; Shoron, O. F.; Rajan, S.; Bin Dolmanan, S.; Tripathy, S.

    2015-01-01

    A stress engineered three dimensional (3D) Triple T-gate (TT-gate) on lattice matched In 0.17 Al 0.83 N/GaN nano-channel (NC) Fin-High-Electron-Mobility Transistor (Fin-HEMT) with significantly enhanced device performance was achieved that is promising for high-speed device applications. The Fin-HEMT with 200-nm effective fin-width (W eff ) exhibited a very high I Dmax of 3940 mA/mm and a highest g m of 1417 mS/mm. This dramatic increase of I D and g m in the 3D TT-gate In 0.17 Al 0.83 N/GaN NC Fin-HEMT translated to an extracted highest electron velocity (v e ) of 6.0 × 10 7  cm/s, which is ∼1.89× higher than that of the conventional In 0.17 Al 0.83 N/GaN HEMT (3.17 × 10 7  cm/s). The v e in the conventional III-nitride transistors are typically limited by highly efficient optical-phonon emission. However, the unusually high v e at 300 K in the 3D TT-gate In 0.17 Al 0.83 N/GaN NC Fin-HEMT is attributed to the increase of in-plane tensile stress component by SiN passivation in the formed NC which is also verified by micro-photoluminescence (0.47 ± 0.02 GPa) and micro-Raman spectroscopy (0.39 ± 0.12 GPa) measurements. The ability to reach the v e  = 6 × 10 7  cm/s at 300 K by a stress engineered 3D TT-gate lattice-matched In 0.17 Al 0.83 N/GaN NC Fin-HEMTs shows they are promising for next-generation ultra-scaled high-speed device applications

  10. Electron velocity of 6 × 10{sup 7 }cm/s at 300 K in stress engineered InAlN/GaN nano-channel high-electron-mobility transistors

    Energy Technology Data Exchange (ETDEWEB)

    Arulkumaran, S., E-mail: SArulkumaran@pmail.ntu.edu.sg; Manoj Kumar, C. M.; Ranjan, K.; Teo, K. L. [Temasek Laboratories@NTU, Nanyang Technological University, Research Techno Plaza, 50 Nanyang Drive, Singapore 637553 (Singapore); Ng, G. I., E-mail: eging@ntu.edu.sg [School of Electrical and Electronics Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Shoron, O. F.; Rajan, S. [Electrical and Computer Engineering Department, The Ohio State University, Columbus, Ohio 43210 (United States); Bin Dolmanan, S.; Tripathy, S. [Institute of Materials Research and Engineering, A*STAR (Agency for Science, Technology, and Research), 3 Research Link, Singapore 117602 (Singapore)

    2015-02-02

    A stress engineered three dimensional (3D) Triple T-gate (TT-gate) on lattice matched In{sub 0.17}Al{sub 0.83}N/GaN nano-channel (NC) Fin-High-Electron-Mobility Transistor (Fin-HEMT) with significantly enhanced device performance was achieved that is promising for high-speed device applications. The Fin-HEMT with 200-nm effective fin-width (W{sub eff}) exhibited a very high I{sub Dmax} of 3940 mA/mm and a highest g{sub m} of 1417 mS/mm. This dramatic increase of I{sub D} and g{sub m} in the 3D TT-gate In{sub 0.17}Al{sub 0.83}N/GaN NC Fin-HEMT translated to an extracted highest electron velocity (v{sub e}) of 6.0 × 10{sup 7 }cm/s, which is ∼1.89× higher than that of the conventional In{sub 0.17}Al{sub 0.83}N/GaN HEMT (3.17 × 10{sup 7 }cm/s). The v{sub e} in the conventional III-nitride transistors are typically limited by highly efficient optical-phonon emission. However, the unusually high v{sub e} at 300 K in the 3D TT-gate In{sub 0.17}Al{sub 0.83}N/GaN NC Fin-HEMT is attributed to the increase of in-plane tensile stress component by SiN passivation in the formed NC which is also verified by micro-photoluminescence (0.47 ± 0.02 GPa) and micro-Raman spectroscopy (0.39 ± 0.12 GPa) measurements. The ability to reach the v{sub e} = 6 × 10{sup 7 }cm/s at 300 K by a stress engineered 3D TT-gate lattice-matched In{sub 0.17}Al{sub 0.83}N/GaN NC Fin-HEMTs shows they are promising for next-generation ultra-scaled high-speed device applications.

  11. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  12. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  13. Fluorescence Microscopy of Nanochannel-Confined DNA.

    Science.gov (United States)

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  14. Water transport in graphene nano-channels

    DEFF Research Database (Denmark)

    Wagemann, Enrique; Oyarzua, Elton; Walther, J. H.

    The transport of water in nanopores is of both fundamental and practical interest. Graphene Channels (GCs) are potential building blocks for nanofluidic devices dueto their molecularly smooth walls and exceptional mechanical properties. Numerous studies have found a significant flow rate enhancem......The transport of water in nanopores is of both fundamental and practical interest. Graphene Channels (GCs) are potential building blocks for nanofluidic devices dueto their molecularly smooth walls and exceptional mechanical properties. Numerous studies have found a significant flow rate...... between the chirality of the graphene walls and the slip length has not been established. In this study, we perform non-equilibrium molecular dynamics simulations of water flow in single- and multi-walled GCs. We examine the influence on the flow rates of dissipating the viscous heat produced...... by connecting the thermostat to the water molecules, the CNT wall atoms or both of them. From the atomic trajectories, we compute the fluid flow rates in GCs with zig-zag and armchair walls, heights from 1 to 4 nm and different number of graphene layers on the walls. A relation between the chirality, slip...

  15. Concentration polarization in nanochannel DNA electrophoresis

    NARCIS (Netherlands)

    Dubsky, P.; Das, Siddhartha; van den Berg, Albert; Eijkel, Jan C.T.

    2011-01-01

    We demonstrate that the large field electrophoresis of a single DNA molecule in nanofluidic systems is accompanied by concentration polarization. We illustrate this phenomena by utilizing our electrophoretic simulation tool SIMUL. First we in-vestigate a simple system with univalent strong

  16. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn

    2016-04-15

    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  17. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  18. Glass transition on the development of a hydrogen-bond network in nano-channel ice, and subsequent phase transitions of the ordering of hydrogen atom positions within the network in [Co(H{sub 2}bim){sub 3}](TMA){center_dot}20H{sub 2}O

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Keisuke [Department of Chemistry, Graduate School of Science and Engineering, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8551 (Japan); Oguni, Masaharu [Department of Chemistry, Graduate School of Science and Engineering, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8551 (Japan); Tadokoro, Makoto [Faculty of Science, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan); Oohata, Yuki [Faculty of Science, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan); Nakamura, Ryouhei [Department of Chemistry, Graduate School of Science, Osaka Municipal University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585 (Japan)

    2006-09-20

    Low-temperature thermal properties of crystalline [Co(H{sub 2}bim){sub 3}](TMA){center_dot}20H{sub 2}O were studied by adiabatic calorimetry, where H{sub 2}bim is 2,2'-biimidazole, TMA is 1,3,5-benzene tricarboxylic acid, and 20H{sub 2}O represents the water forming nano-channel in the crystal. A glass transition was observed at T{sub g} = 107 K. It was discussed as a freezing-in phenomenon of a small number of water molecules remaining partially disordered in their positional arrangement. The possibility that some defects really remain in the hydrogen-bond network of channel water was mentioned. Two subsequent phase transitions were observed at 54.8 and 59 K. These were interpreted as being of a (super-structural commensurate)-incommensurate-(normal commensurate) type in the heating direction with respect to the hydrogen-atom positions as referred to the periodicity of the hydrogen-bond network. The transition entropy was evaluated to be 0.65 J K{sup -1}(H{sub 2}O-mol){sup -1} as a total of the two, indicating that the disorder of the hydrogen atoms is present only in part of the water molecules of the channel. Based on the fact that the excess heat capacity due to the equilibrium phase transition is observed down to 35-40 K, the relaxation time for the rearrangement of the hydrogen-atom positions was assumed at the longest to be 1 ks at 35 K. This indicates that the activation energy of the rearrangement amounts to at most 13 kJ mol{sup -1} and that the transfer of Bjerrum defects is attributed to the rearrangement.

  19. Responsibility and Responsiveness

    DEFF Research Database (Denmark)

    Nissen, Ulrik Becker

    2011-01-01

    The debate on the role and identity of Christian social ethics in liberal democracy touches upon the question about the relationship between universality and speci-ficity. Rather than argue for the difference between these approaches, it can be argued that they are to be understood in a different......The debate on the role and identity of Christian social ethics in liberal democracy touches upon the question about the relationship between universality and speci-ficity. Rather than argue for the difference between these approaches, it can be argued that they are to be understood...... contemporary positions of communicative ethics, H. Richard Niebuhr’s understanding of responsibility as responsiveness, and Dietrich Bonhoeffer’s Christological concept of responsibility in a constructive dialogue with each other, the article has attempted to outline main tenets of a responsive concept...

  20. Corporate Responsibility

    DEFF Research Database (Denmark)

    Waddock, Sandra; Rasche, Andreas

    2015-01-01

    We define and discuss the concept of corporate responsibility. We suggest that corporate responsibility has some unique characteristics, which makes it different from earlier conceptions of corporate social responsibility. Our discussion further shows commonalities and differences between corporate...... responsibility and related concepts, such as corporate citizenship and business ethics. We also outline some ways in which corporations have implemented corporate responsibility in practice....

  1. Responsible drinking

    Science.gov (United States)

    Alcohol use disorder - responsible drinking; Drinking alcohol responsibly; Drinking in moderation; Alcoholism - responsible drinking ... 2016. National Institute on Alcohol Abuse and Alcoholism. Alcohol use disorder. www.niaaa.nih.gov/alcohol-health/overview-alcohol- ...

  2. Relational responsibilities in responsive evaluation

    NARCIS (Netherlands)

    Visse, M.A.; Abma, T.A.; Widdershoven, G.A.M.

    2012-01-01

    This article explores how we can enhance our understanding of the moral responsibilities in daily, plural practices of responsive evaluation. It introduces an interpretive framework for understanding the moral aspects of evaluation practice. The framework supports responsive evaluators to better

  3. Effective electrodiffusion equation for non-uniform nanochannels.

    Science.gov (United States)

    Marini Bettolo Marconi, Umberto; Melchionna, Simone; Pagonabarraga, Ignacio

    2013-06-28

    We derive a one-dimensional formulation of the Planck-Nernst-Poisson equation to describe the dynamics of a symmetric binary electrolyte in channels whose section is nanometric and varies along the axial direction. The approach is in the spirit of the Fick-Jacobs diffusion equation and leads to a system of coupled equations for the partial densities which depends on the charge sitting at the walls in a non-trivial fashion. We consider two kinds of non-uniformities, those due to the spatial variation of charge distribution and those due to the shape variation of the pore and report one- and three-dimensional solutions of the electrokinetic equations.

  4. Transport of Multivalent Electrolyte Mixtures in Micro- and Nanochannels

    Science.gov (United States)

    2013-11-08

    equations for this process are the unsteady Navier-Stokes equations along with continuity and the Poisson- Nernst -Planck system for the electro- static part...about five times the Debye screening length D (the 1/e lengthscale for the potential from the solution of the linearized Poisson- Boltzmann equation

  5. From stripe to slab confinement for DNA linearization in nanochannels

    Science.gov (United States)

    Cifra, Peter; Benkova, Zuzana; Namer, Pavol

    We investigate suggested advantageous analysis in the linearization experiments with macromolecules confined in a stripe-like channel using Monte Carlo simulations. The enhanced chain extension in a stripe that is due to significant excluded volume interactions between monomers in two dimensions weakens on transition to experimentally feasible slit-like channel. Based on the chain extension-confinement strength dependence and the structure factor behavior for the chain in stripe we infer the excluded volume regime typical for two-dimensional systems. On transition to the slab geometry, the advantageous chain extension decreases and the Gaussian regime is observed for not very long semiflexible chains. The evidence for pseudo-ideality in confined chains is based on indicators such as the extension curves, variation of the extension with the persistence length or the structure factor. The slab behavior is observed when the stripe (originally of monomer thickness) reaches the thickness larger than cca 10nm in the third dimension. This maximum height of the slab to retain the advantage of the stripe is very low and this have implication for DNA linearization experiments. The presented analysis, however, has a broader relevance for confined polymers. Support from Slovak R&D Agency (SRDA-0451-11) is acknowledged.

  6. Nanochannel alignment analysis by scanning transmission ion microscopy

    DEFF Research Database (Denmark)

    Rajta, I.; Gál, G.A.B.; Szilasi, S.Z.

    2010-01-01

    In this paper a study on the ion transmission ratio of a nanoporous alumina sample is presented. The sample was investigated by scanning transmission ion microscopy (STIM) with different beam sizes. The hexagonally close-packed AlO nanocapillary array, realized as a suspended membrane of 15 νm...

  7. Artificial membranes with selective nanochannels for protein transport

    KAUST Repository

    Sutisna, Burhannudin

    2016-09-05

    A poly(styrene-b-tert-butoxystyrene-b-styrene) copolymer was synthesized by anionic polymerization and hydrolyzed to poly(styrene-b-4-hydroxystyrene-b-styrene). Lamellar morphology was confirmed in the bulk after annealing. Membranes were fabricated by self-assembly of the hydrolyzed copolymer in solution, followed by water induced phase separation. A high density of pores of 4 to 5 nm diameter led to a water permeance of 40 L m−2 h−1 bar−1 and molecular weight cut-off around 8 kg mol−1. The morphology was controlled by tuning the polymer concentration, evaporation time, and the addition of imidazole and pyridine to stabilize the terpolymer micelles in the casting solution via hydrogen bond complexes. Transmission electron microscopy of the membrane cross-sections confirmed the formation of channels with hydroxyl groups beneficial for hydrogen-bond forming sites. The morphology evolution was investigated by time-resolved grazing incidence small angle X-ray scattering experiments. The membrane channels reject polyethylene glycol with a molecular size of 10 kg mol−1, but are permeable to proteins, such as lysozyme (14.3 kg mol−1) and cytochrome c (12.4 kg mol−1), due to the right balance of hydrogen bond interactions along the channels, electrostatic attraction, as well as the right pore sizes. Our results demonstrate that artificial channels can be designed for protein transport via block copolymer self-assembly using classical methods of membrane preparation.

  8. Thermal Conductivity of Nano-fluids in Nano-channels

    OpenAIRE

    Frank, M; Asproulis, N; Drikakis, D; 4th Micro and Nano Flows Conference (MNF2014)

    2014-01-01

    This paper was presented at the 4th Micro and Nano Flows Conference (MNF2014), which was held at University College, London, UK. The conference was organised by Brunel University and supported by the Italian Union of Thermofluiddynamics, IPEM, the Process Intensification Network, the Institution of Mechanical Engineers, the Heat Transfer Society, HEXAG - the Heat Exchange Action Group, and the Energy Institute, ASME Press, LCN London Centre for Nanotechnology, UCL University College London, U...

  9. Highly conductive polymers: superconductivity in nanochannels or an experimental artifact?

    International Nuclear Information System (INIS)

    Hayden, Harley; Park, Seongho; Zhirnov, Victor; Cavin, Ralph; Kohl, Paul A.

    2010-01-01

    There is a significant body of literature concerning the potential formation of electrically conductive moieties in polymeric materials. The conductive path is not associated with conjugation (such as in the case of 'conductive polymers') but rather associated with a new conductivity route. The objective of the experiments reported herein was to provide insight into the phenomenon of unusually high electrical conductivity in polymers that have been reported by several research groups. In some experiments, the test apparatus did indeed indicate high levels of conductance. Arguments pro and con for high conductivity based on known physical phenomena and the collected data were examined.

  10. Artificial membranes with selective nanochannels for protein transport

    KAUST Repository

    Sutisna, Burhannudin; Polymeropoulos, Georgios; Mygiakis, E.; Musteata, Valentina-Elena; Peinemann, Klaus-Viktor; Smilgies, D. M.; Hadjichristidis, Nikolaos; Nunes, Suzana Pereira

    2016-01-01

    A poly(styrene-b-tert-butoxystyrene-b-styrene) copolymer was synthesized by anionic polymerization and hydrolyzed to poly(styrene-b-4-hydroxystyrene-b-styrene). Lamellar morphology was confirmed in the bulk after annealing. Membranes were fabricated by self-assembly of the hydrolyzed copolymer in solution, followed by water induced phase separation. A high density of pores of 4 to 5 nm diameter led to a water permeance of 40 L m−2 h−1 bar−1 and molecular weight cut-off around 8 kg mol−1. The morphology was controlled by tuning the polymer concentration, evaporation time, and the addition of imidazole and pyridine to stabilize the terpolymer micelles in the casting solution via hydrogen bond complexes. Transmission electron microscopy of the membrane cross-sections confirmed the formation of channels with hydroxyl groups beneficial for hydrogen-bond forming sites. The morphology evolution was investigated by time-resolved grazing incidence small angle X-ray scattering experiments. The membrane channels reject polyethylene glycol with a molecular size of 10 kg mol−1, but are permeable to proteins, such as lysozyme (14.3 kg mol−1) and cytochrome c (12.4 kg mol−1), due to the right balance of hydrogen bond interactions along the channels, electrostatic attraction, as well as the right pore sizes. Our results demonstrate that artificial channels can be designed for protein transport via block copolymer self-assembly using classical methods of membrane preparation.

  11. Early Regimes of Water Capillary Flow in Slit Silica Nanochannels

    DEFF Research Database (Denmark)

    Oyarzua, Elton; Walther, Jens Honore; Mejia, Andres

    2015-01-01

    on the dynamics of capillaryfilling. The results indicate that the nanoscale imbibition process is divided into three main flow regimes:an initial regime where the capillary force is balanced only by the inertial drag and characterized by aconstant velocity and a plug flow profile. In this regime, the meniscus...... velocity profiles identify the passage froman inviscid flow to a developing Poiseuille flow. Gas density profiles ahead of the capillary front indicatea transient accumulation of air on the advancing meniscus. Furthermore, slower capillary filling ratescomputed for higher air pressures reveal a significant...... retarding effect of the gas displaced by the advancing meniscus....

  12. Drag reduction in silica nanochannels induced by graphitic wall coatings

    DEFF Research Database (Denmark)

    Wagemann, Enrique; Walther, Jens Honore; Zambrano, Harvey

    . In this work, we propose the use of graphitic materials as wall coatings in hydrophilic silica nanopores. Specifically, by conducting atomistic simulations, we investigate the flow inside slit and cylindrical silica channels with walls coated with graphene (GE) layers and carbonnanotubes (CNTs), respectively...

  13. Corporate Responsibility

    OpenAIRE

    World Bank

    2004-01-01

    Appeals to corporate responsibility often simply take for granted that businesses have ethical responsibilities that go beyond just respecting the law. This paper addresses arguments to the effect that businesses have no such responsibilities. The interesting claim is not that businesses have no ethical responsibility at all but that their primal responsibility is to increase their profits. The extent to which there is reason to take such arguments seriously delineates the limits of corporate...

  14. Responsibility navigator

    NARCIS (Netherlands)

    Kuhlmann, Stefan; Edler, Jakob; Ordonez Matamoros, Hector Gonzalo; Randles, Sally; Walhout, Bart; Walhout, Bart; Gough, Clair; Lindner, Ralf; Lindner, Ralf; Kuhlmann, Stefan; Randles, Sally; Bedsted, Bjorn; Gorgoni, Guido; Griessler, Erich; Loconto, Allison; Mejlgaard, Niels

    2016-01-01

    Research and innovation activities need to become more responsive to societal challenges and concerns. The Responsibility Navigator, developed in the Res-AGorA project, supports decision-makers to govern such activities towards more conscious responsibility. What is considered “responsible” will

  15. Responsible nations

    DEFF Research Database (Denmark)

    Lippert-Rasmussen, Kasper

    2009-01-01

    In National Responsibility and Global Justice, David Miller defends the view that a member of a nation can be collectively responsible for an outcome despite the fact that: (i) she did not control it; (ii) she actively opposed those of her nation's policies that produced the outcome; and (iii......) actively opposing the relevant policy was costly for her. I argue that Miller's arguments in favor of this strong externalist view about responsibility and control are insufficient. Specifically, I show that Miller's two models of synchronic collective responsibility*the like-minded group model...

  16. Competing responsibly

    NARCIS (Netherlands)

    Jeurissen, R.J.M.; Ven, van de B.W.

    2005-01-01

    In this paper we examine the effects of different competitive conditions on the determination and evaluation of strategies of corporate social responsibility (CSR). Although the mainstream of current thinking in business ethics recognizes that a firm should invest in social responsibility, the

  17. Query responses

    Directory of Open Access Journals (Sweden)

    Paweł Łupkowski

    2017-05-01

    Full Text Available In this article we consider the phenomenon of answering a query with a query. Although such answers are common, no large scale, corpus-based characterization exists, with the exception of clarification requests. After briefly reviewing different theoretical approaches on this subject, we present a corpus study of query responses in the British National Corpus and develop a taxonomy for query responses. We point at a variety of response categories that have not been formalized in previous dialogue work, particularly those relevant to adversarial interaction. We show that different response categories have significantly different rates of subsequent answer provision. We provide a formal analysis of the response categories in the framework of KoS.

  18. Response Cries.

    Science.gov (United States)

    Goffman, Erving

    1978-01-01

    Considers utterances that appear to violate the interdependence assumed by the interactionist view, entering the stream of behavior at peculiar and unnatural places, producing communicative effects but no dialogue. Self-talk, imprecations, and response cries are discussed. (EJS)

  19. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  20. In Response

    Science.gov (United States)

    Egeland, Janice A.; Shaw, Jon A.; Endicott, Jean; Allen, Cleona R.; Hostetter, Abram M.

    2005-01-01

    This article features the response to the important commentary by Dr. Carlson. The Amish Study represents, as she notes, a special research population for investigation of "classic" bipolar disorder viewed against a homogeneous cultural landscape where emerging biological and behavioral prodromal features can be identified. Dr. Carlson questions…

  1. Responsible tourism

    Directory of Open Access Journals (Sweden)

    Birkaš E.

    2012-01-01

    Full Text Available Realising tourism in the context of responsibility is a problem of historical-social and economic time-space continuum; the problem of possibility of temporal unification of these parts. The study aims to emphasize that the essence of problem can only be understood in the depth of a general problematic of tourism, as a question of temporalisation of historical-social space, which, however, leads to a grand question of today: does the human activity which creates temporalised spaces have its own gravitational direction? Ad deliberandum. The study proposes the viewpoint that the context of responsibility requires overcoming the dimension of interpretation where the subject is understood as an ultimate human-singularity and a perfect match of responsibility with a dominant and current form of temporalisation of time suggests a paradigm of participating consciousness, the consciousness of unity, which, in Berdyaev's words, is never logical, but existential. The study, on the basis of a meticulous studying of a new narrative of tourism, primarily due to volume restrictions does not go beyond presenting the key attributes of this ever-expanding understanding of tourism - with a demonstration of a concrete practice - but all this with an emphasis that qualification of the actors' activities is possible only along the lines of a previous consideration of comprehension of structure of space and time - along the revalorisation of a motivational horison (Anzenbacher, A 1987, 264.p. and also the very term of responsibility and freedom. Responsibility can only then become an orientation of tourist activities, if the primary focus is set on re-comprehension (revalorisation of civilisational legacies in a timeless perspective.

  2. Responsive Innovation

    DEFF Research Database (Denmark)

    Pedersen, Carsten

    Although the importance of stakeholder networks has been recognized in recent years, a non-teleological model that incorporates their collective sensing into innovation processes has so far not been developed. Hence, this paper argues that traditional linear and sequential innovation models...... are insufficient in hypercompetitive environments. Instead, it is proposed that companies should ground their innovation processes in the collective sensing of frontline-employees and customers that operate around the organizational periphery. This frames the concept of responsive innovation, where key...... stakeholders engaged in the organization’s ongoing business activities collectively identify issues that central managers subsequently can resolve....

  3. Sustainable responsibilities?

    DEFF Research Database (Denmark)

    Lystbæk, Christian Tang

    2015-01-01

    , which have pervaded all areas of daily life, including the world of business. At local, national, international and global levels, policies have been formulated to encourage corporations to take responsibility for their social and environmental performance (Laszlo, 2007). In the European Union, the EU......, people and the natural environment have traditionally been viewed as available resources, which are taken for granted and, thus, treated as externalities (Livesey & Graham, 2007). But the last decade has seen increasing recognition of environmental problems such as climate change and resource depletion...

  4. Corporate responsibility

    DEFF Research Database (Denmark)

    Jensen, Karsten Klint

    2007-01-01

    Is it legitimate for a business to concentrate on profits under respect for the law and ethical custom? On the one hand, there seems to be good reasons for claiming that a corporation has a duty to act for the benefit of all its stakeholders. On the other hand, this seems to dissolve the notion...... of a private business; but then again, a private business would appear to be exempted from ethical responsibility. This is what Kenneth Goodpaster has called the stakeholder paradox: either we have ethics without business or we have business without ethics. Through a different route, I reach the same solution...

  5. Emotional Responses

    DEFF Research Database (Denmark)

    Hansen, Flemming; Christensen, Sverre Riis; Lundsteen, Steen

    2007-01-01

    Recent neurological research has pointed to the importance of fundamental emotional processes for most kinds of human behaviour. Measures of emotional response tendencies towards brands seem to reveal intangible aspects of brand equity, particularly in a marketing context. In this paper a procedure...... for estimating such emotional brand equity is presented and findings from two successive studies of more than 100 brands are reported. It demonstrates how changes that occur between two years are explainable in terms of factors identifiable in the markets, and that the measures otherwise are stable over time...

  6. Naturalizing Responsibility.

    Science.gov (United States)

    Zullo, Silvia

    2016-10-01

    In the contemporary debate on the use of the neurosciences in ethics and law, numerous arguments have been bandied about among scientists and philosophers looking to uphold or reject the reliability and validity of scientific findings obtained by brain imaging technologies. Among the most vexing questions is, Can we trust that technology? One point of disagreement is whether brain scans offer a window through which to observe the functioning of the mind, in such a way as to enable lawyers, judges, physicians, and lawmakers to detect anomalies in brain function that may account for criminal unconscious behavior. Those who stand behind brain imaging believe that this can indeed be achieved, whereas those in opposition stress that brain scans are highly open to interpretation and that the data they provide is insufficient to establish causal connections. The question essentially comes down to whether technology can reliably be used to determine the intentions of the individual, thus establishing mens rea, for example, and hence responsibility. This article focuses on the latter notion and explores whether we can rely on the neurosciences to shed light on a complex form of moral and legal reasoning, as well as the role of the neurosciences in reawakening a philosophical and legal interest in trying to set responsibility on an empirical basis.

  7. Tetra(p-tolyl)borate-functionalized solvent polymeric membrane: a facile and sensitive sensing platform for peroxidase and peroxidase mimetics.

    Science.gov (United States)

    Wang, Xuewei; Qin, Wei

    2013-07-22

    The determination of peroxidase activities is the basis for enzyme-labeled bioaffinity assays, peroxidase-mimicking DNAzymes- and nanoparticles-based assays, and characterization of the catalytic functions of peroxidase mimetics. Here, a facile, sensitive, and cost-effective solvent polymeric membrane-based peroxidase detection platform is described that utilizes reaction intermediates with different pKa values from those of substrates and final products. Several key but long-debated intermediates in the peroxidative oxidation of o-phenylenediamine (o-PD) have been identified and their charge states have been estimated. By using a solvent polymeric membrane functionalized by an appropriate substituted tetraphenylborate as a receptor, those cationic intermediates could be transferred into the membrane from the aqueous phase to induce a large cationic potential response. Thus, the potentiometric indication of the o-PD oxidation catalyzed by peroxidase or its mimetics can be fulfilled. Horseradish peroxidase has been detected with a detection limit at least two orders of magnitude lower than those obtained by spectrophotometric techniques and traditional membrane-based methods. As an example of peroxidase mimetics, G-quadruplex DNAzymes were probed by the intermediate-sensitive membrane and a label-free thrombin detection protocol was developed based on the catalytic activity of the thrombin-binding G-quadruplex aptamer. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. An enzyme-free strategy for ultrasensitive detection of adenosine using a multipurpose aptamer probe and malachite green.

    Science.gov (United States)

    Zhao, Hui; Wang, Yong-Sheng; Tang, Xian; Zhou, Bin; Xue, Jin-Hua; Liu, Hui; Liu, Shan-Du; Cao, Jin-Xiu; Li, Ming-Hui; Chen, Si-Han

    2015-08-05

    We report on an enzyme-free and label-free strategy for the ultrasensitive determination of adenosine. A novel multipurpose adenosine aptamer (MAAP) is designed, which serves as an effective target recognition probe and a capture probe for malachite green. In the presence of adenosine, the conformation of the MAAP is converted from a hairpin structure to a G-quadruplex. Upon addition of malachite green into this solution, a noticeable enhancement of resonance light scattering was observed. The signal response is directly proportional to the concentration of adenosine ranging from 75 pM to 2.2 nM with a detection limit of 23 pM, which was 100-10,000 folds lower than those obtained by previous reported methods. Moreover, this strategy has been applied successfully for detecting adenosine in human urine and blood samples, further proving its reliability. The mechanism of adenosine inducing MAAP to form a G-quadruplex was demonstrated by a series of control experiments. Such a MAAP probe can also be used to other strategies such as fluorescence or spectrophotometric ones. We suppose that this strategy can be expanded to develop a universal analytical platform for various target molecules in the biomedical field and clinical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  10. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  11. Responsible innovation

    CERN Document Server

    De Woot, Philippe

    2015-01-01

    Economic development is rooted in disruption, not in equilibrium. And a powerful engine of economic development is innovation; but is this innovation always for the common good? The dark side of the extraordinary dynamism of innovation lies precisely in its destructive power. If simply left to market forces, it could lead to social chaos and great human suffering. To face the challenges of our time, we must create the proper climate and culture to develop strong entrepreneurial drive. But, more than ever, we must give this entrepreneurial drive its ethical and societal dimensions. Responsible innovation means a more voluntary orientation towards the great problems of the 21st century, e.g. depletion of the planet's resources, rising inequality, and new scientific developments potentially threatening freedom, democracy and human integrity. We need to transform our ceaseless creativity into real progress for humankind. In this respect, the rapid development of social innovation opens the door for new methods an...

  12. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  13. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  14. Technology and responsibility

    International Nuclear Information System (INIS)

    Zimmerli, W.C.

    1987-01-01

    Philosophical reflections on the concepts of responsibility and type of responsibility are presented and discussed with regard to the developments of technology. The author states that neither the relationship between liability and responsibility has changed, nor the structure of responsibility. Any individual still is responsible for his actions and their consequences. What has changed, however, is the former restriction to the concept of internal responsibility and the overlapping of acting subject and responsible subject. (DG) [de

  15. Optimal Responsible Investment

    DEFF Research Database (Denmark)

    Jessen, Pernille

    The paper studies retail Socially Responsible Investment and portfolio allocation. It extends conventional portfolio theory by allowing for a personal value based investment decision. When preferences for responsibility enter the framework for mean-variance analysis, it yields an optimal...... responsible investment model. An example of index investing illustrates the theory. Results show that it is crucial for the responsible investor to consider portfolio risk, expected return, and responsibility simultaneously in order to obtain an optimal portfolio. The model enables responsible investors...

  16. Responsibility for what? Fairness and individual responsibility

    OpenAIRE

    Cappelen, Alexander Wright; Sørensen, Erik Øiolf; Tungodden, Bertil

    2010-01-01

    -This is the author's version of the article: "Responsibility for what? Fairness and individual responsibility", European Economic Review, Volume 54, Issue 3, April 2010, Pages 429–441. What should individuals be held responsible for? This is a fundamental question in much of the contemporary debate on distributive justice. Different fairness ideals, such as strict egalitarianism, and different versions of equal opportunity ethics and libertarianism give different answers to this question....

  17. Playful hyper responsibility

    DEFF Research Database (Denmark)

    Knudsen, Hanne; Andersen, Niels Åkerstrøm

    2014-01-01

    Over the past 10–15 years, state-funded schools have begun to require parents to assume an undefined and infinite personal responsibility. In this article, we investigate how schools organize responsibility games to respond to this challenge and how these games affect the concept of responsibility....... We point to a dislocation in the way parents are assigned responsibility, because the definition of responsibility is not only a question of formulating rules or providing advice. We argue that what emerges is a kind of playful hyper responsibility that identifies responsibility as the participation...

  18. Responsive web design workflow

    OpenAIRE

    LAAK, TIMO

    2013-01-01

    Responsive Web Design Workflow is a literature review about Responsive Web Design, a web standards based modern web design paradigm. The goals of this research were to define what responsive web design is, determine its importance in building modern websites and describe a workflow for responsive web design projects. Responsive web design is a paradigm to create adaptive websites, which respond to the properties of the media that is used to render them. The three key elements of responsi...

  19. DNA damage response pathway in radioadaptive response.

    Science.gov (United States)

    Sasaki, Masao S; Ejima, Yosuke; Tachibana, Akira; Yamada, Toshiko; Ishizaki, Kanji; Shimizu, Takashi; Nomura, Taisei

    2002-07-25

    Radioadaptive response is a biological defense mechanism in which low-dose ionizing irradiation elicits cellular resistance to the genotoxic effects of subsequent irradiation. However, its molecular mechanism remains largely unknown. We previously demonstrated that the dose recognition and adaptive response could be mediated by a feedback signaling pathway involving protein kinase C (PKC), p38 mitogen activated protein kinase (p38MAPK) and phospholipase C (PLC). Further, to elucidate the downstream effector pathway, we studied the X-ray-induced adaptive response in cultured mouse and human cells with different genetic background relevant to the DNA damage response pathway, such as deficiencies in TP53, DNA-PKcs, ATM and FANCA genes. The results showed that p53 protein played a key role in the adaptive response while DNA-PKcs, ATM and FANCA were not responsible. Wortmannin, a specific inhibitor of phosphatidylinositol 3-kinase (PI3K), mimicked the priming irradiation in that the inhibitor alone rendered the cells resistant against the induction of chromosome aberrations and apoptosis by the subsequent X-ray irradiation. The adaptive response, whether it was afforded by low-dose X-rays or wortmannin, occurred in parallel with the reduction of apoptotic cell death by challenging doses. The inhibitor of p38MAPK which blocks the adaptive response did not suppress apoptosis. These observations indicate that the adaptive response and apoptotic cell death constitute a complementary defense system via life-or-death decisions. The p53 has a pivotal role in channeling the radiation-induced DNA double-strand breaks (DSBs) into an adaptive legitimate repair pathway, where the signals are integrated into p53 by a circuitous PKC-p38MAPK-PLC damage sensing pathway, and hence turning off the signals to an alternative pathway to illegitimate repair and apoptosis. A possible molecular mechanism of adaptive response to low-dose ionizing irradiation has been discussed in relation to

  20. Biological Responses to Materials

    Science.gov (United States)

    Anderson, James M.

    2001-08-01

    All materials intended for application in humans as biomaterials, medical devices, or prostheses undergo tissue responses when implanted into living tissue. This review first describes fundamental aspects of tissue responses to materials, which are commonly described as the tissue response continuum. These actions involve fundamental aspects of tissue responses including injury, inflammatory and wound healing responses, foreign body reactions, and fibrous encapsulation of the biomaterial, medical device, or prosthesis. The second part of this review describes the in vivo evaluation of tissue responses to biomaterials, medical devices, and prostheses to determine intended performance characteristics and safety or biocompatibility considerations. While fundamental aspects of tissue responses to materials are important from research and development perspectives, the in vivo evaluation of tissue responses to these materials is important for performance, safety, and regulatory reasons.

  1. Decoupling Responsible Management Education

    DEFF Research Database (Denmark)

    Rasche, Andreas; Gilbert, Dirk Ulrich

    Business schools increasingly aim to embed corporate responsibility, sustainability, and ethics into their curricular and extracurricular activities. This paper examines under what conditions business schools may decouple the structural effects of their engagement in responsible management educat...

  2. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  3. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    Science.gov (United States)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

    2013-01-01

    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  4. Responsibility and Capacities

    DEFF Research Database (Denmark)

    Ryberg, Jesper

    2014-01-01

    That responsible moral agency presupposes certain mental capacities, constitutes a widely accepted view among theorists. Moreover, it is often assumed that degrees in the development of the relevant capacities co-vary with degrees of responsibility. In this article it is argued that, the move from...... the view that responsibility requires certain mental capacities to the position that degrees of responsibility co-vary with degrees of the development of the mental capacities, is premature....

  5. Instant responsive web design

    CERN Document Server

    Simmons, Cory

    2013-01-01

    A step-by-step tutorial approach which will teach the readers what responsive web design is and how it is used in designing a responsive web page.If you are a web-designer looking to expand your skill set by learning the quickly growing industry standard of responsive web design, this book is ideal for you. Knowledge of CSS is assumed.

  6. Risk and response

    Energy Technology Data Exchange (ETDEWEB)

    Warner, F W

    1980-12-01

    A discussion of nuclear power and public acceptability can quite properly begin with a general consideration of the nature of response to risk. Response follows perception and builds up from individual through group response to the judgement of society expressed in governmental decisions on what is acceptable. The subject is analysed in some detail, with examples.

  7. Risk and response

    Energy Technology Data Exchange (ETDEWEB)

    Warner, F [Cremer and Warner (UK)

    1981-01-01

    A discussion of nuclear power and public acceptability can quite properly begin with a general consideration of the nature of response to risk. Response follows perception, and builds up from the individual through group response to the judgement of society expressed in governmental decisions on what is acceptable. Various types of risk, and public reaction, are discussed.

  8. National Response Team

    Science.gov (United States)

    Response planning and coordination (not direct response itself) is accomplished at the federal level through the U.S. National Response Team (NRT), an interagency group co-chaired by EPA and U.S. Coast Guard. NRT distributes information, plans, and trains.

  9. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  10. Self-Responsibility and Responsibility for Others

    Directory of Open Access Journals (Sweden)

    Philip Buckley

    2016-09-01

    Full Text Available Because of the transcendent nature of the experience of my own self, responsibility for myself necessarily leads to responsibility for others. The aim of this paper is to approach this experience of the transcendence of the self and to show how it relates to a new sense of responsibility which transcends the self through a number of stages. First, the author outlines what might be called the "standard" view of authenticity in Husserl and how this particular view yields a certain view of responsibility as the ability to answer completely for "who" one is and "what" one does. Second, this standard view is challenged with another reading of the "self" in Husserl – one that emphasizes a necessary and productive division within the self. Thus, the author suggests that it is this second view of the self which is developed by Heidegger. Third, he demonstrates how this different view of the "authentic" self, that is inextricably linked to a "loss" of self, leads to a radically distinct view of responsibility for oneself, and for others.

  11. Optimal Responsible Investment

    DEFF Research Database (Denmark)

    Jessen, Pernille

    Numerous institutions are now engaged in Socially Responsible Investment or have signed the "UN Principles for Responsible Investment". Retail investors, however, are still lacking behind. This is peculiar since the sector constitutes key stakeholders in environmental, social and governmental...... standards. This paper considers optimal responsible investment for a small retail investor. It extends conventional portfolio theory by allowing for a personal-value based investment decision. Preferences for responsibility are defined in the framework of mean-variance analysis and an optimal responsible...... investment model identified. Implications of the altered investment problem are investigated when the dynamics between portfolio risk, expected return and responsibility is considered. Relying on the definition of a responsible investor, it is shown how superior investment opportunities can emerge when...

  12. Density Distribution of Liquid Argon in Nano-channel Poiseuille Flows

    Science.gov (United States)

    She, Jiangwei; Wang, Yuyi; Zhou, Zhe-Wei

    2017-11-01

    The density layering parallel to the boundaries of liquid has been measured in many experiments and also observed in molecular dynamics (MD) simulations. In this study, a detail and systematic investigation of density distribution in nano-scale Poiseuille flows is carried out. Through analyzing the difference of density distribution curves obtained under different conditions, the influence of interaction parameters, configuration form of solid wall and temperature on the layering are investigated. The internal mechanism is also explored in this paper. The detail description of the density distribution results and simulation algorithm is given. National natural science foundation (A020405).

  13. Earliest stage of the tetrahedral nanochannel formation in cubosome particles from unilamellar nanovesicles

    Czech Academy of Sciences Publication Activity Database

    Angelov, Borislav; Angelova, A.; Garamus, V. M.; Drechsler, M.; Willumeit, R.; Mutafchieva, R.; Štěpánek, Petr; Lesieur, S.

    Roč. 28, č. 48 ( 2012 ), s. 16647-16655 ISSN 0743-7463 R&D Projects: GA ČR GAP208/10/1600 Institutional research plan: CEZ:AV0Z40500505 Institutional support: RVO:61389013 Keywords : cryoTEM electron microscopy * SAXS * soft matter Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.187, year: 2012

  14. Molecular dynamics study of the influence of wall-gas interactions on heat flow in nanochannels

    NARCIS (Netherlands)

    Markvoort, Albert. J.; Hilbers, P.A.J.; Nedea, S.V.

    2005-01-01

    Especially at the nanometer scale interfaces play an important role. The effect of the wettability on the solid-liquid interface has already been studied with molecular dynamics. In this paper we study the dependence of wetting on the solid-gas interface for different density gases and investigate

  15. Exploring the boundaries of molecular modeling : a study of nanochannels and transmembrane proteins

    NARCIS (Netherlands)

    Spijker, P.

    2009-01-01

    Many interesting physical and biological phenomena can be investigated using molecular modeling techniques, either theoretically or by using computer simulation methods, such as molecular dynamics and Monte Carlo simulations. Due to the increasing power of computer processing units, these simulation

  16. Oligophenylenevinylenes in spatially confined nanochannels: Monitoring intermolecular interactions by UV/Vis and Raman spectroscopy

    DEFF Research Database (Denmark)

    Aloshyna, Mariya; Medina, Begona Milian; Poulsen, Lars

    2008-01-01

    -guest interactions are elucidated by UV/Vis and Raman spectroscopy. The impact of the local environment of the chromophore on the optical and photophysical properties is discussed in light of quantum-chemical calculations. In stark contrast to thin films where preferential side-by-side orientation leads to quenching...... of photoluminescence (PL) via non-emissive traps, the ICs are found to be attractive materials for opto-electronic applications: they offer high chromophore concentrations, but at the same time behave as quasi-isolated entities of tightly packed, well-oriented objects with high PL quantum yields and the possibility...

  17. Guided transmission of slow Ne ions through the nanochannels of highly ordered anodic alumina

    DEFF Research Database (Denmark)

    Mátéfi-Tempfli, Stefan; Mátéfi-Tempfli, M.; Piraux, L.

    2006-01-01

    as a suspended membrane of about 15νm thickness on the aluminium frame to which it belongs. The AlO capillaries were bombarded with 3keV Ne ions. The first results unambiguously show the existence of ion guiding observed at 5° and 7.5° tilt angles of the capillaries compared to the beam direction. To the best...

  18. Molecular dynamics simulations for the motion of evaporative droplets driven by thermal gradients along nanochannels

    KAUST Repository

    Wu, Congmin; Xu, Xinpeng; Qian, Tiezheng

    2013-01-01

    -vapor coexistence temperature in one-component fluids while the solid surface is almost isothermal for solids of high thermal conductivity. Therefore, a temperature discontinuity is formed if the two isothermal interfaces are of different temperatures and intersect

  19. Incipient ferroelectricity of water molecules confined to nano-channels of beryl

    Czech Academy of Sciences Publication Activity Database

    Gorshunov, B. P.; Torgashev, V. I.; Zhukova, E.S.; Thomas, V.G.; Belyanchikov, M. A.; Kadlec, Christelle; Kadlec, Filip; Savinov, Maxim; Ostapchuk, Tetyana; Petzelt, Jan; Prokleška, J.; Tomas, P. V.; Pestrjakov, E.V.; Fursenko, D.A.; Shakurov, G.S.; Prokhorov, A. S.; Gorelik, V. S.; Kadyrov, L.S.; Uskov, V.V.; Kremer, R. K.; Dressel, M.

    2016-01-01

    Roč. 7, Sep (2016), 1-10, č. článku 12842. ISSN 2041-1723 R&D Projects: GA ČR(CZ) GA14-25639S Institutional support: RVO:68378271 Keywords : water * beryl * ferroelectricity * quantum fluctuations * Curie–Weiss behaviour Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 12.124, year: 2016

  20. Electrokinetic pumping and detection of low-volume flows in nanochannels

    NARCIS (Netherlands)

    Mela, P.; Tas, Niels Roelof; Berenschot, Johan W.; van Nieuwkasteele, Jan William; van den Berg, Albert

    2004-01-01

    Electrokinetic pumping of low-volume rates was performed on-chip in channels of small cross sectional area and height in the sub-m range. The flow was detected with the current monitoring technique by monitoring the change in resistance of the fluid in the channel upon the electroosmosis-driven

  1. Note: Experimental observation of nano-channel pattern in light sheet laser interference nanolithography system

    Energy Technology Data Exchange (ETDEWEB)

    Mohan, Kavya; Mondal, Partha Pratim, E-mail: partha@iap.iisc.ernet.in [Nanobioimaging Laboratory, Department of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore 560012 (India)

    2016-06-15

    We experimentally observed nano-channel-like pattern in a light-sheet based interference nanolithography system. The optical system created nano-channel-like patterned illumination. Coherent counter-propagating light sheets are made to interfere at and near geometrical focus along the propagation z-axis. This results in the formation of nano-channel-like pattern (of size ≈ 300 nm and inter-channel periodicity of ≈337.5 nm) inside the sample due to constructive and destructive interference. In addition, the technique has the ability to generate large area patterning using larger light-sheets. Exciting applications are in the broad field of nanotechnology (nano-electronics and nano-fluidics).

  2. Modeling and simulation of diffusion-convection-reaction in heterogeneous nanochannels using OpenFOAM

    NARCIS (Netherlands)

    Pimpalgaonkar, H.G.; van Steijn, V.; Kreutzer, M.T.; Kleijn, C.R.; Simos, Theodore; Tsitouras, Charalambos

    2016-01-01

    We present a finite volume implementation of a phase field method in OpenFOAM as a tool to simulate reactive multiphase flows on heterogeneous surfaces. Using this tool, we simulate the formation and growth of a droplet due to a chemical reaction on a hydrophilic catalytic patch surrounded by a

  3. Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels.

    Science.gov (United States)

    Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita; Bruus, Henrik

    2011-01-01

    We present a combined theoretical and experimental analysis of the solid-liquid interface of fused-silica nanofabricated channels with and without a hydrophilic 3-cyanopropyldimethylchlorosilane (cyanosilane) coating. We develop a model that relaxes the assumption that the surface parameters C(1), C(2), and pK(+) are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy-Chapman-Stern triple-layer model of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary filling length ratio on ionic strength for different surface compositions, which can be difficult to achieve otherwise. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels

    DEFF Research Database (Denmark)

    Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita

    2011-01-01

    , and pK+ are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy–Chapman–Stern triple-layer model...... of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary...

  5. Responsible geographies and geographies of response

    DEFF Research Database (Denmark)

    Grindsted, Thomas Skou

    This dissertation engages with Danish University geographers at work and their explication of the role of geography in shaping socio-environmental debates in an era of the anthropocene. Situating sustainability concepts in a historygeographical context the dissertation examines responses and resp......This dissertation engages with Danish University geographers at work and their explication of the role of geography in shaping socio-environmental debates in an era of the anthropocene. Situating sustainability concepts in a historygeographical context the dissertation examines responses...... in higher education literature. The methodological framework is based on the social nature approach that tangles these quite distinct epistemological communities by consulting the socio-natures produced. It is concluded that though geographers find sustainability themes important to geography......, sustainability is more often implicit than it is explicit. This produces a number of dilemmas and contradictions since geographers both seek to distance themselves from produced politics while at the same time elucidating them. Geographies of response and responsibilities address the battleground over...

  6. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  7. Responsibility and climate change

    OpenAIRE

    Jamieson, Dale

    2015-01-01

    Ibegin by providing some background to conceptions of responsibility. I note the extent of disagreement in this area, the diverse and cross-cutting distinctions that are deployed, and the relative neglect of some important problems. These facts make it difficult to attribute responsibility for climate change, but so do some features of climate change itself which I go on to illuminate. Attributions of responsibility are often contested sites because such attributions are fundamentally pragmat...

  8. Radiological Emergency Response Data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Quality Data Asset includes all current and historical emergency radiological response event and incident of national significance data and surveillance, monitoring,...

  9. Environmentally Responsible Aviation Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Created in 2009 as part of NASA's Aeronautics Research Mission Directorate's Integrated Systems Research Program, the Environmentally Responsible Aviation...

  10. Biological response modifiers

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1991-10-01

    Much of what used to be called immunotherapy is now included in the term biological response modifiers. Biological response modifiers (BRMs) are defined as those agents or approaches that modify the relationship between the tumor and host by modifying the host's biological response to tumor cells with resultant therapeutic effects.'' Most of the early work with BRMs centered around observations of spontaneous tumor regression and the association of tumor regression with concurrent bacterial infections. The BRM can modify the host response in the following ways: Increase the host's antitumor responses through augmentation and/or restoration of effector mechanisms or mediators of the host's defense or decrease the deleterious component by the host's reaction; Increase the host's defenses by the administration of natural biologics (or the synthetic derivatives thereof) as effectors or mediators of an antitumor response; Augment the host's response to modified tumor cells or vaccines, which might stimulate a greater response by the host or increase tumor-cell sensitivity to an existing response; Decrease the transformation and/or increase differentiation (maturation) of tumor cells; or Increase the ability of the host to tolerate damage by cytotoxic modalities of cancer treatment.

  11. Oil Spill Response Manual

    NARCIS (Netherlands)

    Marieke Zeinstra; Sandra Heins; Wierd Koops

    2014-01-01

    A two year programme has been carried out by the NHL University of Applied Sciences together with private companies in the field of oil and chemical spill response to finalize these manuals on oil and chemical spill response. These manuals give a good overview of all aspects of oil and chemical

  12. Indicators of responsible investing

    NARCIS (Netherlands)

    Scholtens, Bert

    Responsible investment has witnessed significant changes in the past decade. It is estimated that about one fifth of assets under management in the US and about half of all assets under management in the EU are done on the basis of one of the seven responsible investment strategies. This paper

  13. Eastern Frequency Response Study

    Energy Technology Data Exchange (ETDEWEB)

    Miller, N.W.; Shao, M.; Pajic, S.; D' Aquila, R.

    2013-05-01

    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  14. Rapid response systems.

    Science.gov (United States)

    Lyons, Patrick G; Edelson, Dana P; Churpek, Matthew M

    2018-07-01

    Rapid response systems are commonly employed by hospitals to identify and respond to deteriorating patients outside of the intensive care unit. Controversy exists about the benefits of rapid response systems. We aimed to review the current state of the rapid response literature, including evolving aspects of afferent (risk detection) and efferent (intervention) arms, outcome measurement, process improvement, and implementation. Articles written in English and published in PubMed. Rapid response systems are heterogeneous, with important differences among afferent and efferent arms. Clinically meaningful outcomes may include unexpected mortality, in-hospital cardiac arrest, length of stay, cost, and processes of care at end of life. Both positive and negative interventional studies have been published, although the two largest randomized trials involving rapid response systems - the Medical Early Response and Intervention Trial (MERIT) and the Effect of a Pediatric Early Warning System on All-Cause Mortality in Hospitalized Pediatric Patients (EPOCH) trial - did not find a mortality benefit with these systems, albeit with important limitations. Advances in monitoring technologies, risk assessment strategies, and behavioral ergonomics may offer opportunities for improvement. Rapid responses may improve some meaningful outcomes, although these findings remain controversial. These systems may also improve care for patients at the end of life. Rapid response systems are expected to continue evolving with novel developments in monitoring technologies, risk prediction informatics, and work in human factors. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Responsible Hospitality. Prevention Updates

    Science.gov (United States)

    Colthurst, Tom

    2004-01-01

    Responsible Hospitality (RH)--also called Responsible Beverage Service (RBS)--encompasses a variety of strategies for reducing risks associated with the sale and service of alcoholic beverages. RH programs have three goals: (1) to prevent illegal alcohol service to minors; (2) to reduce the likelihood of drinkers becoming intoxicated; and (3) to…

  16. Collective Responsibility for Oppression

    NARCIS (Netherlands)

    Stahl, Titus

    2017-01-01

    Many contemporary forms of oppression are not primarily the result of formally organized collective action nor are they an unintended outcome of a combination of individual actions. This raises the question of collective responsibility. I argue that we can only determine who is responsible for

  17. Mechanical response of composites

    NARCIS (Netherlands)

    Camanho, Pedro P.; Dávila, C.G.; Pinho, Silvestre T.; Remmers, J.J.C.

    2008-01-01

    This book contains twelve selected papers presented at the ECCOMAS Thematic Conference ? Mechanical Response of Composites, and the papers presented by the three plenary speakers. It describes recent advances in the field of analysis models for the mechanical response of advanced composite

  18. Electrodermal Response in Gaming

    Directory of Open Access Journals (Sweden)

    J. Christopher Westland

    2011-01-01

    Full Text Available Steady improvements in technologies that measure human emotional response offer new possibilities for making computer games more immersive. This paper reviews the history of designs a particular branch of affective technologies that acquire electrodermal response readings from human subjects. Electrodermal response meters have gone through continual improvements to better measure these nervous responses, but still fall short of the capabilities of today's technology. Electrodermal response traditionally have been labor intensive. Protocols and transcription of subject responses were recorded on separate documents, forcing constant shifts of attention between scripts, electrodermal measuring devices and of observations and subject responses. These problems can be resolved by collecting more information and integrating it in a computer interface that is, by adding relevant sensors in addition to the basic electrodermal resistance reading to untangle (1 body resistance; (2 skin resistance; (3 grip movements; other (4 factors affecting the neural processing for regulation of the body. A device that solves these problems is presented and discussed. It is argued that the electrodermal response datastreams can be enriched through the use of added sensors and a digital acquisition and processing of information, which should further experimentation and use of the technology.

  19. Response Surface Methodology

    NARCIS (Netherlands)

    Kleijnen, Jack P.C.

    2014-01-01

    Abstract: This chapter first summarizes Response Surface Methodology (RSM), which started with Box and Wilson’s article in 1951 on RSM for real, non-simulated systems. RSM is a stepwise heuristic that uses first-order polynomials to approximate the response surface locally. An estimated polynomial

  20. Responsive Space Program Brief

    Energy Technology Data Exchange (ETDEWEB)

    Dors, Eric E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-03-11

    The goal of the Responsive Space program is to make significant, integrated science and technology contributions to the end-to-end missions of the U.S. Government that protect against global emerging and nuclear threats, from the earliest adversary planning through resilient event response report describes the LANL space program, mission, and other activities. The report describes some of their activities.

  1. Aligning Responsible Business Practices

    DEFF Research Database (Denmark)

    Weller, Angeli E.

    2017-01-01

    This article offers an in-depth case study of a global high tech manufacturer that aligned its ethics and compliance, corporate social responsibility, and sustainability practices. Few large companies organize their responsible business practices this way, despite conceptual relevance and calls t...... and managers interested in understanding how responsible business practices may be collectively organized.......This article offers an in-depth case study of a global high tech manufacturer that aligned its ethics and compliance, corporate social responsibility, and sustainability practices. Few large companies organize their responsible business practices this way, despite conceptual relevance and calls...... to manage them comprehensively. A communities of practice theoretical lens suggests that intentional effort would be needed to bridge meaning between the relevant managers and practices in order to achieve alignment. The findings call attention to the important role played by employees who broker...

  2. Oil spill response plan

    International Nuclear Information System (INIS)

    1999-08-01

    The plan outlined in this document specifies the actions that the Canadian Wildlife Service Atlantic Region is mandated to take in the event of an oil spill, or on discovering oiled migratory birds in terrestrial, fresh water, marine and inter-tidal habitats. In addition to describing the role and responsibilities of the Canadian Wildlife Service, the document also describes response plans of other agencies for dealing with all wildlife species affected by oil spills. Reporting paths, the lead agency concept, shared responsibilities with other Canadian Wildlife Service regional offices, provincial agencies, Heritage Canada, non-government wildlife response agencies, oil spill response organizations, and international organizations are outlined. An overview of the reporting and communications process is also provided

  3. Neutron response study

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Fix, J.J.; Thorson, M.R.; Nichols, L.L.

    1981-01-01

    Neutron response of the albedo type dosimeter is strongly dependent on the energy of the incident neutrons as well as the moderating material on the backside of the dosimeter. This study characterizes the response of the Hanford dosimeter for a variety of neutron energies for both a water and Rando phantom (a simulated human body consisting of an actual human skeleton with plastic for body muscles and certain organs). The Hanford dosimeter response to neutrons of different energies is typical of albedo type dosimeters. An approximate two orders of magnitude difference in response is observed between neutron energies of 100 keV and 10 MeV. Methods were described to compensate for the difference in dosimeter response between a laboratory neutron spectrum and the different spectra encountered at various facilities in the field. Generally, substantial field support is necessary for accurate neutron dosimetry

  4. Geospatial Information Response Team

    Science.gov (United States)

    Witt, Emitt C.

    2010-01-01

    Extreme emergency events of national significance that include manmade and natural disasters seem to have become more frequent during the past two decades. The Nation is becoming more resilient to these emergencies through better preparedness, reduced duplication, and establishing better communications so every response and recovery effort saves lives and mitigates the long-term social and economic impacts on the Nation. The National Response Framework (NRF) (http://www.fema.gov/NRF) was developed to provide the guiding principles that enable all response partners to prepare for and provide a unified national response to disasters and emergencies. The NRF provides five key principles for better preparation, coordination, and response: 1) engaged partnerships, 2) a tiered response, 3) scalable, flexible, and adaptable operations, 4) unity of effort, and 5) readiness to act. The NRF also describes how communities, tribes, States, Federal Government, privatesector, and non-governmental partners apply these principles for a coordinated, effective national response. The U.S. Geological Survey (USGS) has adopted the NRF doctrine by establishing several earth-sciences, discipline-level teams to ensure that USGS science, data, and individual expertise are readily available during emergencies. The Geospatial Information Response Team (GIRT) is one of these teams. The USGS established the GIRT to facilitate the effective collection, storage, and dissemination of geospatial data information and products during an emergency. The GIRT ensures that timely geospatial data are available for use by emergency responders, land and resource managers, and for scientific analysis. In an emergency and response capacity, the GIRT is responsible for establishing procedures for geospatial data acquisition, processing, and archiving; discovery, access, and delivery of data; anticipating geospatial needs; and providing coordinated products and services utilizing the USGS' exceptional pool of

  5. Frequency Response Analysis Tool

    Energy Technology Data Exchange (ETDEWEB)

    Etingov, Pavel V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kosterev, Dmitry [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Dai, T. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2014-12-01

    Frequency response has received a lot of attention in recent years at the national level, which culminated in the development and approval of North American Electricity Reliability Corporation (NERC) BAL-003-1 Frequency Response and Frequency Bias Setting Reliability Standard. This report is prepared to describe the details of the work conducted by Pacific Northwest National Laboratory (PNNL) in collaboration with the Bonneville Power Administration and Western Electricity Coordinating Council (WECC) Joint Synchronized Information Subcommittee (JSIS) to develop a frequency response analysis tool (FRAT). The document provides the details on the methodology and main features of the FRAT. The tool manages the database of under-frequency events and calculates the frequency response baseline. Frequency response calculations are consistent with frequency response measure (FRM) in NERC BAL-003-1 for an interconnection and balancing authority. The FRAT can use both phasor measurement unit (PMU) data, where available, and supervisory control and data acquisition (SCADA) data. The tool is also capable of automatically generating NERC Frequency Response Survey (FRS) forms required by BAL-003-1 Standard.

  6. Emergency response strategies

    International Nuclear Information System (INIS)

    Carrilo, D.; Dias de la Cruz, F.

    1984-01-01

    In the present study is estimated, on the basis of a release category (PWR4) and several accident scenarios previously set up, the emergency response efficacy obtained in the application of different response strategies on each of the above mentioned scenarios. The studied strategies contemplate the following protective measures: evacuation, shelter and relocation. The radiological response has been obtained by means of CRAC2 (Calculation of Reactor Accident Consequences) code, and calculated in terms of absorbed dose equivalent (Whole body and thyroid), as well as early and latent biological effects. (author)

  7. On being responsible

    DEFF Research Database (Denmark)

    Davies, Sarah Rachael; Glerup, Cecilie; Horst, Maja

    2014-01-01

    as to enable innovation. To call for responsibility has, indeed, become somewhat trite. In this essay we take not the normative demand for responsibility, but its operationalisation, as our analytical focus, arguing that it is important not to underestimate the term’s practical flexibility and discursive...... multiplicity. To illustrate this point we consider firstly the range of ways in which ‘responsibility’ is articulated within the literature on higher education and sociology of science; and, secondly, how notions of responsible development are understood, and acted upon, in two different US sites: an academic...

  8. Socially responsible investment engagement

    NARCIS (Netherlands)

    Goessling, T.; Buijter, Bas; Freeman, R.E.; Kujala, J.; Sachs, S.

    2017-01-01

    This study explores engagement in socially responsible investment (SRI) processes. More specifically, it researches the impact of shareholder salience on the success of engagement activities. The research question asks: What is the relationship between shareholder salience and engagement effort

  9. The EEG Photoparoxysmal Response

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2008-03-01

    Full Text Available Types of photosensitivity, prevalence and other characteristics of the photoparoxysmal response (PPR, associated seizures, effect of video games, and drug therapy are reviewed by the director of electroencephalography at the University of Illinois, Chicago.

  10. Responses to the contributors

    Directory of Open Access Journals (Sweden)

    Garrett Barden

    2011-09-01

    Full Text Available A set of responses to the papers on Garrett Barden's and Tim Murphy's book Law and Justice in Community (Oxford: OUP, 2010 published in this special issue of Nordicum-Mediterraneum.

  11. Responsive design high performance

    CERN Document Server

    Els, Dewald

    2015-01-01

    This book is ideal for developers who have experience in developing websites or possess minor knowledge of how responsive websites work. No experience of high-level website development or performance tweaking is required.

  12. NOAA Emergency Response Imagery

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The imagery posted on this site is in response to natural disasters. The aerial photography missions were conducted by the NOAA Remote Sensing Division. The majority...

  13. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  14. Drones and Responsibility

    DEFF Research Database (Denmark)

    How does the use of military drones affect the legal, political, and moral responsibility of different actors involved in their deployment and design? This volume offers a fresh contribution to the ethics of drone warfare by providing, for the first time, a systematic interdisciplinary discussion...... of different responsibility issues raised by military drones. The book discusses four main sets of questions: First, from a legal point of view, we analyse the ways in which the use of drones makes the attribution of criminal responsibility to individuals for war crimes more complicated and what adjustments...... may be required in international criminal law and in military practices to avoid ’responsibility gaps’ in warfare. From a moral and political perspective, the volume looks at the conditions under which the use of military drones by states is impermissible, permissible, or even obligatory and what...

  15. OEM Emergency Response Information

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Office of Emergency Management retains records of all incident responses in which it participates. This data asset includes three major sources of information:...

  16. CV equipment responsibilities

    CERN Document Server

    Pirollet, B

    2008-01-01

    This document describes the limits of the responsibilities of the TS/CV for fire fighting equipment at the LHC. The various interfaces, providers and users of the water supply systems and clean water raising systems are described.

  17. Social Responsibility Instruments

    Directory of Open Access Journals (Sweden)

    Katarzyna Mizera

    2008-09-01

    Full Text Available Responsible business notion is more and more present in Polish economy, however the results of the research carried out in Polish business still shows a low level of CRS idea knowledge, especially in small and medium companies. Although responsible business notion is generally known, its details, ways of preparing strategy, instruments and what is more its benefits are still narrowly spread. Many business people face the lack of knowledge and information, which on one hand make it easier to spread and deepen wrong stereotypes connected with this notion and on the other hand make business people unwilling to implement CRS in their companies. The subjects of this article are examples of instruments which are responsible for realization of social responsibility strategy.

  18. Pathological responses to terrorism.

    Science.gov (United States)

    Yehuda, Rachel; Bryant, Richard; Marmar, Charles; Zohar, Joseph

    2005-10-01

    Many important gains have been made in understanding PTSD and other responses to trauma as a result of neuroscience-based observations. Yet there are many gaps in our knowledge that currently impede our ability to predict those who will develop pathologic responses. Such knowledge is essential for developing appropriate strategies for mounting a mental health response in the aftermath of terrorism and for facilitating the recovery of individuals and society. This paper reviews clinical and biological studies that have led to an identification of pathologic responses following psychological trauma, including terrorism, and highlights areas of future-research. It is important to not only determine risk factors for the development of short- and long-term mental health responses to terrorism, but also apply these risk factors to the prediction of such responses on an individual level. It is also critical to consider the full spectrum of responses to terrorism, as well as the interplay between biological and psychological variables that contribute to these responses. Finally, it is essential to remove the barriers to collecting data in the aftermath of trauma by creating a culture of education in which the academic community can communicate to the public what is and is not known so that survivors of trauma and terrorism will understand the value of their participation in research to the generation of useful knowledge, and by maintaining the acquisition of knowledge as a priority for the government and those involved in the immediate delivery of services in the aftermath of large-scale disaster or trauma.

  19. Emergency response workers workshop

    International Nuclear Information System (INIS)

    Agapeev, S.A.; Glukhikh, E.N.; Tyurin, R.L.

    2012-01-01

    A training workshop entitled Current issues and potential improvements in Rosatom Corporation emergency prevention and response system was held in May-June, 2012. The workshop combined theoretical training with full-scale practical exercise that demonstrated the existing innovative capabilities for radiation reconnaissance, diving equipment and robotics, aircraft, emergency response and rescue hardware and machinery. This paper describes the activities carried out during the workshop [ru

  20. Advances in Crash Response

    Centers for Disease Control (CDC) Podcasts

    2009-06-29

    In this podcast, Dr. Richard C. Hunt, Director of CDC's Division of Injury Response, provides an overview on the benefits of using an Advanced Automatic Collision Notification system, or AACN, to help with emergency triage of people injured in vehicle crashes.  Created: 6/29/2009 by National Center for Injury Prevention and Control (NCIPC), Division of Injury Response (DIR).   Date Released: 6/29/2009.

  1. National Response Framework: Annexes

    Science.gov (United States)

    2008-01-01

    response Environmental short- and long-term cleanup ESF #11 – Agriculture and Natural Resources Nutrition assistance Animal and plant disease and pest ...continental United States, the Virgin Islands and Puerto Rico, and other U.S. territories and possession other than Alaska and U.S. territories in the...on the Pacific, Atlantic , and Gulf coasts, to provide response capabilities, technical advice, documentation and support assistance, communications

  2. Corporate Social Responsibility

    DEFF Research Database (Denmark)

    Kampf, Constance

    2007-01-01

    Understanding Corporate Social Responsibility (CSR) as having explicit policies and implicit norms situated in cultural systems highlights the connections between institutional and cultural structures of nation states and business' commitment to CSR as reflected in the strategies used to communic......Understanding Corporate Social Responsibility (CSR) as having explicit policies and implicit norms situated in cultural systems highlights the connections between institutional and cultural structures of nation states and business' commitment to CSR as reflected in the strategies used...

  3. Social responsibility of corporations

    Directory of Open Access Journals (Sweden)

    Babić Jovan

    2007-01-01

    Full Text Available The issue at stake in the article is corporate social responsibility. There are two rival theories regarding this issue. According to the classical theory managers are responsible to owners (stockholders and their obligation is to pursue the goal of maximizing the profit. According to the other, stakeholder theory, the interests of all corporate stakeholders, all those affected by business, not only stockholders, must be taken in consideration. In the paper these two theories are subject of thorough ethical analysis.

  4. Social Responsibility of Accounting

    OpenAIRE

    JINNAI, Yoshiaki

    2011-01-01

    Historical and theoretical inquiries into the function of accounting have provided fruitful insights into social responsibility of accounting, which is, and should be, based on accounts kept through everyday accounting activities. However, at the current stage of capitalist accounting, keeping accounts is often regarded as merely a preparatory process for creating financial statements at the end of an accounting period. Thus, discussions on the social responsibility of accounting tend to conc...

  5. Responsability of nuclear industry

    International Nuclear Information System (INIS)

    Cadiz Deleito, J.C.

    1985-01-01

    Since the beginning of nuclear industry, civil responsibility with damages to the public health and properties was a critical problem, because the special conditions of this industry (nuclear accident, damages could be very high but probability of these events is very low). Legal precepts, universally accepted, in the first 60 years for all countries interested in nuclear energy are being revised, then 20 years of experience. The civil responsibility limited is being questioned and indemnities updated. (author)

  6. Discord of response

    International Nuclear Information System (INIS)

    Roga, W; Illuminati, F; Giampaolo, S M

    2014-01-01

    The presence of quantum correlations in a quantum state is related to the state's response to local unitary perturbations. Such a response is quantified by the distance between the unperturbed and perturbed states, minimized with respect to suitably identified sets of local unitary operations. In order to be a bona fide measure of quantum correlations, the distance function must be chosen among those that are contractive under completely positive and trace preserving (CPTP) maps. The most relevant instances of such physically well-behaved metrics include the trace, the Bures, and the Hellinger distance. To each of these metrics one can associate the corresponding discord of response, namely the trace, or Hellinger, or Bures minimum distance from the set of unitarily perturbed states. All these three discords of response satisfy the basic axioms for a proper measure of quantum correlations. In the present work we focus in particular on the Bures distance, which enjoys the unique property of being both Riemannian and contractive under CPTP maps, and admits important operational interpretations in terms of state distinguishability. We compute analytically the Bures discord of response for two-qubit states with maximally mixed marginals and we compare it with the corresponding Bures geometric discord, namely the geometric measure of quantum correlations defined as the Bures distance from the set of classical-quantum states. Finally, we investigate and identify the maximally quantum correlated two-qubit states according to the Bures discord of response. These states exhibit a remarkable nonlinear dependence on the global state purity. (paper)

  7. Enviromental responsability and corporate social responsability

    Directory of Open Access Journals (Sweden)

    Jesús Marí Farinós

    2015-12-01

    Full Text Available The environmental management of companies and organizations in general is going to be internalized in the operation and management structures, linking conceptual and chronologically to improve corporate reputation, management excellence, knowledge and innovation. Embracing, undoubtedly too, with the assumption of an ethical commitment of the company to society: environmental sustainability and generational solidarity in the transmission of culture and values of that nature. The existing need to know the potential impact of business operations on society and the environment results in the appearance of a document, which may well be called a Sustainability Report or Social Balance, which is compiled from a series social indicators, which are the instruments responsible to reflect the value of the shares held by the company in social and environmental fields.

  8. Planned home birth: the professional responsibility response.

    Science.gov (United States)

    Chervenak, Frank A; McCullough, Laurence B; Brent, Robert L; Levene, Malcolm I; Arabin, Birgit

    2013-01-01

    This article addresses the recrudescence of and new support for midwife-supervised planned home birth in the United States and the other developed countries in the context of professional responsibility. Advocates of planned home birth have emphasized patient safety, patient satisfaction, cost effectiveness, and respect for women's rights. We provide a critical evaluation of each of these claims and identify professionally appropriate responses of obstetricians and other concerned physicians to planned home birth. We start with patient safety and show that planned home birth has unnecessary, preventable, irremediable increased risk of harm for pregnant, fetal, and neonatal patients. We document that the persistently high rates of emergency transport undermines patient safety and satisfaction, the raison d'etre of planned home birth, and that a comprehensive analysis undermines claims about the cost-effectiveness of planned home birth. We then argue that obstetricians and other concerned physicians should understand, identify, and correct the root causes of the recrudescence of planned home birth; respond to expressions of interest in planned home birth by women with evidence-based recommendations against it; refuse to participate in planned home birth; but still provide excellent and compassionate emergency obstetric care to women transported from planned home birth. We explain why obstetricians should not participate in or refer to randomized clinical trials of planned home vs planned hospital birth. We call on obstetricians, other concerned physicians, midwives and other obstetric providers, and their professional associations not to support planned home birth when there are safe and compassionate hospital-based alternatives and to advocate for a safe home-birth-like experience in the hospital. Copyright © 2013 Mosby, Inc. All rights reserved.

  9. Structural building response review

    International Nuclear Information System (INIS)

    1980-01-01

    The integrity of a nuclear power plant during a postulated seismic event is required to protect the public against radiation. Therefore, a detailed set of seismic analyses of various structures and equipment is performed while designing a nuclear power plant. This report describes the structural response analysis method, including the structural model, soil-structure interaction as it relates to structural models, methods for seismic structural analysis, numerical integration methods, methods for non-seismic response analysis approaches for various response combinations, structural damping values, nonlinear response, uncertainties in structural properties, and structural response analysis using random properties. The report describes the state-of-the-art in these areas for nuclear power plants. It also details the past studies made at Sargent and Lundy to evaluate different alternatives and the conclusions reached for the specific purposes that those studies were intended. These results were incorporated here because they fall into the general scope of this report. The scope of the present task does not include performing new calculations

  10. The nuclear response function

    International Nuclear Information System (INIS)

    Bertsch, G.F.

    1983-01-01

    These lectures present the theory of the nuclear response in the Random Phase Approximation (RPA). In the first lecture, various relations are derived between densities and currents which give rise to the well-known sum rules. Then RPA is derived via the time-dependent Hartree theory. The various formulations of RPA are shown: the configuration space representation, the coordinate space representation, the Landau theory of infinite systems and the RPA for separable interactions constrained by consistency. The remarkable success of RPA in describing the collective density oscillations of closed shell nuclei is illustrated with a few examples. In the final lecture, the σtau response is discussed with the application of simple theoretical considerations to the empirical data. Finally, we point out several problems which remain in the response theory. (author)

  11. Radio-adaptive response

    International Nuclear Information System (INIS)

    Ikushima, T.

    1992-01-01

    Knowledge about cellular events in mammalian cells exposed to low doses of ionizing radiation is meager. Recent works showed that human lymphocytes become resistant to radiation-induced chromosomal damage after exposure to low doses of ionizing radiation. Experimental evidence for radio-adaptive response (RAR) in cultured mammalian cells was obtained. Exposure to very low doses of gamma-rays or tritium beta-rays make cells less susceptible to the induction of micronuclei and sister chromatid exchanges by subsequent higher doses. Many important characteristics of the novel response suggest that RAR is a stress response resulting in the enhanced repair of chromosomal DNA damage in cell under restricted conditions. Experiments are still in progress in order to elucidate the molecular basis for RAR processes. (author). 13 refs.; 2 figs., 1 tab

  12. Radio-adaptive response

    International Nuclear Information System (INIS)

    Ikushima, Takaji

    1991-01-01

    An adaptive response to radiation stress was found in cultured Chinese hamster V79 cells, as a suppressed induction of micronuclei (MNs) and sister chromatid exchanges (SCEs) in the cells conditioned by very low doses. The important characteristics of the novel chromosomal response, called radio-adaptive response (RAR), that have newly emerged in this study are: 1) Low doses of beta-rays from tritiated water (HTO) as well as tritiated thymidine can cause the RAR. 2) Thermal neutrons, a high LET radiation, can not act as tritium beta-rays or gamma-rays. 3) The RAR expression is suppressed by an inhibition of protein synthesis. 4) Several proteins are newly synthesized concurrently with the RAR expression after adapting doses, viewed by two-dimensional electrophoresis of cellular proteins. These results suggest that the RAR is an adaptive chromosomal DNA repair induced by very low doses of low LET radiations under restricted conditions, accompanying the inducible specific gene expression. (author)

  13. Photovoltaic spectral responsivity measurements

    Energy Technology Data Exchange (ETDEWEB)

    Emery, K.; Dunlavy, D.; Field, H.; Moriarty, T. [National Renewable Energy Lab., Golden, CO (United States)

    1998-09-01

    This paper discusses the various elemental random and nonrandom error sources in typical spectral responsivity measurement systems. The authors focus specifically on the filter and grating monochrometer-based spectral responsivity measurement systems used by the Photovoltaic (PV) performance characterization team at NREL. A variety of subtle measurement errors can occur that arise from a finite photo-current response time, bandwidth of the monochromatic light, waveform of the monochromatic light, and spatial uniformity of the monochromatic and bias lights; the errors depend on the light source, PV technology, and measurement system. The quantum efficiency can be a function of he voltage bias, light bias level, and, for some structures, the spectral content of the bias light or location on the PV device. This paper compares the advantages and problems associated with semiconductor-detector-based calibrations and pyroelectric-detector-based calibrations. Different current-to-voltage conversion and ac photo-current detection strategies employed at NREL are compared and contrasted.

  14. Disaster mitigation: initial response.

    Science.gov (United States)

    Kennedy, George; Richards, Michael; Chicarelli, Michael; Ernst, Amy; Harrell, Andrew; Stites, Danniel

    2013-01-01

    The objective of this review is to stimulate the reader's considerations for developing community disaster mitigation. Disaster mitigation begins long before impact and is defined as the actions taken by a community to eliminate or minimize the impact of a disaster. The assessment of vulnerabilities, the development of infrastructure, memoranda of understanding, and planning for a sustainable response and recovery are parts of the process. Empowering leadership and citizens with knowledge of available resources through the planning and development of a disaster response can strengthen a community's resilience, which can only add to the viability and quality of life enjoyed by the entire community.

  15. Wind emergency response system

    International Nuclear Information System (INIS)

    Garrett, A.J.; Buckner, M.R.; Mueller, R.A.

    1981-01-01

    The WIND system is an automated emergency response system for real-time predictions of the consequences of liquid and airborne releases from SRP. The system consists of a minicomputer and associated peripherals necessary for acquisition and handling of large amounts of meteorological data from a local tower network and the National Weather Service. The minicomputer uses these data and several predictive models to assess the impact of accidental releases. The system is fast and easy to use, and output is displayed both in tabular form and as trajectory map plots for quick interpretation. The rapid response capabilities of the WIND system have been demonstrated in support of SRP operations

  16. Radiation response of tumours

    International Nuclear Information System (INIS)

    Twentyman, P.R.

    1988-01-01

    In this chapter knowledge regarding cellular radiation response and the factors which modify it is related to the volume changes and probability of control of irradiated solid tumors. After a discussion of the different cell populations present within solid tumors the cell population kinetics of the neoplastic cells are considered in more detail. The influence of factors related to the three-dimensional geometry of the tumor, particularly hypoxia, are considered, and also the role of the tumor vasculature in radiation response. Repair of sublethal damage (SLD) and potentially lethal damage (PLD) is dealt with and finally the relationship between the various end-points of tumor radioresponsiveness is discussed

  17. Response to Arend Flick

    Science.gov (United States)

    RiCharde, R. Stephen

    2009-01-01

    This article presents the author's response to Arend Flick. The author states that Flick is correct that the issue of rubrics is broader than interrater reliability, though it is the assessment practitioner's primary armament against what the author has heard dubbed "refried bean counting" (insinuating that assessment statistics are not just bean…

  18. When Immediate Responses Fail

    DEFF Research Database (Denmark)

    Dothan, Shai

    2018-01-01

    a disproportionately forceful response. The laws of war, criminal law, and international sales law all face some situations of uncertainty. This paper argues that each of these legal fields adopts a strategy of many-tits-for-many-tats to address conditions of acute uncertainty....

  19. Luxury organizations and responsibility

    DEFF Research Database (Denmark)

    Montesa, Farah; Rohrbeck, René

    2014-01-01

    In this article, findings from previous research, almost forty examples of responsible practices in luxury firms, were clustered and eight generic tools were revealed to advance sustainability. These tools are posed as questions to assess the luxury firm’s level of sustainability and to plan deve...

  20. Responsible Internet Use.

    Science.gov (United States)

    Truett, Carol; And Others

    1997-01-01

    Provides advice for making school Internet-use guidelines. Outlines responsible proactive use of the Internet for educators and librarians, discusses strengths and weaknesses of Internet blocking software and rating systems, and describes acceptable-use policies (AUP). Lists resources for creating your own AUP, Internet filtering software, and…

  1. Socially responsible firms

    NARCIS (Netherlands)

    Ferrell, A.; Liang, Hao; Renneboog, Luc

    2016-01-01

    In the corporate finance tradition, starting with Berle and Means (1932), corporations should generally be run to maximize shareholder value. The agency view of corporate social responsibility (CSR) considers CSR an agency problem and a waste of corporate resources. Given our identification strategy

  2. Critical Response Protocol

    Science.gov (United States)

    Ellingson, Charlene; Roehrig, Gillian; Bakkum, Kris; Dubinsky, Janet M.

    2016-01-01

    This article introduces the Critical Response Protocol (CRP), an arts-based technique that engages students in equitable critical discourse and aligns with the "Next Generation Science Standards" vision for providing students opportunities for language learning while advancing science learning (NGSS Lead States 2013). CRP helps teachers…

  3. Professionalization: Whose Responsibility?

    Science.gov (United States)

    Carter, Marcia J.; And Others

    One requisite of a profession is that its practitioners hold a credential certifying that the individual is competent to provide needed services. In the fields of health, physical education, recreation, and dance, diverse groups compete in credentialing practitioners. The four papers in this collection discuss who is, or should be, responsible for…

  4. Overcoming the "Run" Response

    Science.gov (United States)

    Swanson, Patricia E.

    2013-01-01

    Recent research suggests that it is not simply experiencing anxiety that affects mathematics performance but also how one responds to and regulates that anxiety (Lyons and Beilock 2011). Most people have faced mathematics problems that have triggered their "run response." The issue is not whether one wants to run, but rather…

  5. Implementing Responsibility Centre Budgeting

    Science.gov (United States)

    Vonasek, Joseph

    2011-01-01

    Recently, institutes of higher education (universities) have shown a renewed interest in organisational structures and operating methodologies that generate productivity and innovation; responsibility centre budgeting (RCB) is one such process. This paper describes the underlying principles constituting RCB, its origin and structural elements, and…

  6. The Chronic Responsibility

    DEFF Research Database (Denmark)

    Ravn, Iben M; Frederiksen, Kirsten; Beedholm, Kirsten

    2016-01-01

    behavior to be the main factors influencing susceptibility to chronic diseases. We argue that this discursive construction naturalizes a division between people who can actively manage responsible self-care and those who cannot. Such discourses may serve the interests of those patients who are already...

  7. Radio-adaptive response

    International Nuclear Information System (INIS)

    Ikushima, T.

    1992-01-01

    An adaptive response to radiation stress was found as a suppressed induction of chromosomal damage including micronuclei and sister chromatid exchanges in cultured Chinese hamster V79 cells pre-exposed to very low doses of ionizing radiations. The mechanism underlying this novel chromosomal response, called 'radio-adaptive response (RAR)' has been studied progressively. The following results were obtained in recent experiments. 1. Low doses of β-rays from tritiated water (HTO) as well as tritium-thymidine can cause RAR. 2. Thermal neutrons, a high LET radiation, can not act as tritium β-rays or γ-rays. 3. The RAR expression is suppressed not only by the treatment with an inhibitor of protein synthesis but also by RNA synthesis inhibition. 4. Several proteins are newly synthesized concurrently with the RAR expression after the adapting doses, viewed by two-dimensional electrophoresis of cellular proteins. These results suggests that the RAR might be a cellular stress response to a signal produced preferentially by very low doses of low LET radiation under restricted conditions, accompany the inducible specific gene expression. (author)

  8. Response to Tom Cobb

    Science.gov (United States)

    Nation, Paul

    2016-01-01

    In this article Paul Nation responds to Thomas Cobb's "Numbers or Numerology? A Response to Nation (2014) and McQuillan (2016)" (EJ1117024). Nation begins by clarifying his own position on vocabulary learning and goes on to highlight points made in Cobb's article with which he is in agreement, while drawing from his 2014 article,…

  9. Responsibility and Integrated Thinking

    OpenAIRE

    Robinson, SJ

    2014-01-01

    Integrated thinking is essentially focused in dialogue and communication. This is partly because relationships and related purpose focus on action, which itself acts as a means of integration, and partly because critical dialogue enables better, more responsive, integrated thinking and action.

  10. Whistleblowing & Professional Responsibilities.

    Science.gov (United States)

    Professional Engineer, 1979

    1979-01-01

    Discussed are the moral dilemmas encountered daily by professionals and how the teaching of ethics may help resolve the conflicts individuals face with respect to whistleblowing. Included are consideration of responsibilities, role of ethics codes, and courses on professional ethics. (CS)

  11. Response to Mackenzie

    Science.gov (United States)

    Peers, Chris

    2014-01-01

    Chris Peers begins his response to Jim Mackenzie's article, "Peers on Socrates and Plato" by asking "What is the 'masculine imaginary?'" Peers defines the term "imaginary" as it is applied in his article, "Freud, Plato and Irigaray: A Morpho-Logic of Teaching and Learning" (2012) and draws…

  12. Voice Response Systems Technology.

    Science.gov (United States)

    Gerald, Jeanette

    1984-01-01

    Examines two methods of generating synthetic speech in voice response systems, which allow computers to communicate in human terms (speech), using human interface devices (ears): phoneme and reconstructed voice systems. Considerations prior to implementation, current and potential applications, glossary, directory, and introduction to Input Output…

  13. Response to Trachtman's Article

    Science.gov (United States)

    Bardon, Jack I.

    1985-01-01

    This response to Trachtman's article (TM 510 399) argues that the Trachtman paper is inappropriate due to the time elapsed since the original Bardon proposal. The author acknowledges the difference in perspective between Trachtman and himself. He expresses the hope that discussion concerning this aspect of school psychology politics may be ended.…

  14. Plagiarism and Responsibility.

    Science.gov (United States)

    Martin, Brian

    1984-01-01

    There are several kinds of plagiarism, and its significance varies with its circumstances. College administrations seem to avoid responsibility for examining allegations of academic plagiarism, and few procedures exist for addressing them. Until standard and open procedures are established and accepted, rigid and unrealistic attitudes will prevail…

  15. The desmoplastic response

    International Nuclear Information System (INIS)

    Fearns, C.

    1989-04-01

    Desmoplasia, a process in which excessive connective tissue is deposited in a neoplasm, is discussed. To study the process, a human malignant melanoma cell line (UCT-Mel 7) was used, that was established in the laboratory, and when injected into athymic mice, it gave rise to tumours that showed a number of interesting features. The tumour induced a marked desmoplastic response and the desmoplasia was associated in UCT-Mel 7-derived tumours with an unusual phasic pattern of growth. Two possible mechanisms were identified by which UCT-Mel 7 cells could have induced the desmoplastic response. UCT-Mel 7 cells were shown to be chemotactic for mouse macrophages and human foreskin fibroblasts were stimulated, in a dose-dependent manner, to synthesize increased amounts of collagen when co-cultured with mouse peritoneal exudate cells. Tumour cells were also found to act directly. Co-culture of UCT-Mel 7 cells and fibroblasts resulted in increased collagen synthesis by the fibroblasts. DNA synthesis was not required. Dexamethasone, retinoic acid and the tumour promoter, phorbol myristate acetate, had significant primary effects on fibroblast collagen synthesis but did not modify the response to melanoma cells. Recombinant basic fibroblast growth factor did not seem to be involved in the desmoplastic response. A surprising finding was the production of a potent inhibitor of collagen synthesis by superinduced cells of the mouse macrophage cell line, P388D 1 . This inhibitor has not been fully characterised. 49 figs., 33 tabs., 362 refs

  16. Socially Responsible Firms

    NARCIS (Netherlands)

    Renneboog, L.D.R.; Liang, H.; Ferrell, A.

    2014-01-01

    In the corporate finance tradition starting with Berle & Means (1923), corporations should generally be run so as to maximize shareholder value. The agency view of corporate social responsibility (CSR) generally considers CSR as a managerial agency problem and a waste of corporate resources, since

  17. Developing Responsible Learners

    Science.gov (United States)

    Gautum, Satyen; Jangam, Sachin; Loh, Kai Chee

    2018-01-01

    Developing responsible learners is one of the key education challenges of our time. Education literature suggests that for students to see themselves as active and necessary participants in their own learning, it is important that they view themselves as stakeholders in education. This research aims at exploring the effectiveness of instructional…

  18. Chores and Responsibility

    Science.gov (United States)

    ... out on some valuable learning experiences, and their development of a sense of responsibility and initiative may not happen until later in life, if ever. As a result, whenever demands are placed upon these children, they appear to procrastinate or dawdle, never having ...

  19. Corporate social responsibility

    Directory of Open Access Journals (Sweden)

    Arsić Zoran

    2011-01-01

    Full Text Available Corporate Social Responsibility (CSR is a concept whereby companies integrate social and environmental concerns in their business operations and in their interaction with their stakeholders on a voluntary basis. Definition emphasizes three basic characteristics of CSR. CSR is voluntary concept, it covers environmental issues and interaction with stakeholders, not only shareholders, is taken into account.

  20. [Responsibility, compassion and ethics].

    Science.gov (United States)

    Furstenberg, Cécile

    2016-01-01

    The concepts of responsibility and compassion are fundamental in ethics. These notions help to safeguard humaneness, especially in the field of health care and notably in palliative care. These concepts can be put into practice by caregivers and applied to daily practice. Copyright © 2016 Elsevier Masson SAS. All rights reserved.