Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S
1996-01-01
we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Directory of Open Access Journals (Sweden)
Bo Liu
Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic
International Nuclear Information System (INIS)
Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.
1991-01-01
The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki
2011-01-01
The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
A core filamentation response network in Candida albicans is restricted to eight genes.
Directory of Open Access Journals (Sweden)
Ronny Martin
Full Text Available Although morphological plasticity is a central virulence trait of Candida albicans, the number of filament-associated genes and the interplay of mechanisms regulating their expression remain unknown. By correlation-based network modeling of the transcriptional response to different defined external stimuli for morphogenesis we identified a set of eight genes with highly correlated expression patterns, forming a core filamentation response. This group of genes included ALS3, ECE1, HGT2, HWP1, IHD1 and RBT1 which are known or supposed to encode for cell- wall associated proteins as well as the Rac1 guanine nucleotide exchange factor encoding gene DCK1 and the unknown function open reading frame orf19.2457. The validity of network modeling was confirmed using a dataset of advanced complexity that describes the transcriptional response of C. albicans during epithelial invasion as well as comparing our results with other previously published transcriptome studies. Although the set of core filamentation response genes was quite small, several transcriptional regulators are involved in the control of their expression, depending on the environmental condition.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response
Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly
2013-01-01
Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Directory of Open Access Journals (Sweden)
Boutennoune H.
2012-05-01
Full Text Available A pre-designed plasmid containing the gene encoding the second subunit of Echinococcus granulosus AgB8 (EgAgB8/2 was used to study the effect of the immunization route on the immune response in BALB/c mice. Mice were immunized with pDRIVEEgAgB8/ 2 or pDRIVE empty cassette using the intramuscular (i.m., intranasal (i.n. or the epidermal gene gun (g.g. routes. Analysis of the antibody response and cytokine data revealed that gene immunization by the i.m. route induced a marked bias towards a T helper type 1 (Th1 immune response as characterized by high IFN-γ gene expression and a low IgG1/IgG2a reactivity index (R.I. ratio of 0.04. The i.n. route showed a moderate IFN-γ expression but a higher IgG1/IgG2a R.I. ratio of 0.25 indicating a moderate Th1 response. In contrast, epidermal g.g. immunization induced a Th2 response characterized by high IL-4 expression and the highest IgG1/IgG2a R.I. ratio of 0.58. In conclusion, this study showed the advantage of genetic immunization using the i.m. route and i.n. over the epidermal g.g. routes in the induction of Th1 immunity in response to E. granulosus AgB gene immunization.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Rudžianskienė, Milda; Inčiūra, Arturas; Gerbutavičius, Rolandas; Dambrauskienė, Rūta; Rudžianskas, Viktoras; Juozaitytė, Elona
2016-01-01
Background: Previous researches have demonstrated, that the severity of pain perception and it’s response to analgesia is highly dependent on gene polymorphism encoding for cytokines. We evaluated 12 single nucleotide polymorphisms (SNP) in 6 genes encoding for cytokines in multiple myeloma patients (n = 81) and assessed their influence on pain severity and response to palliative radiotherapy. Methods: Pain intensity was assessed by Visual Analogue Scale. The total dose of opioids was convert...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Dryja, Thaddeus P.; McGee, Terri L.; Berson, Eliot L.; Fishman, Gerald A.; Sandberg, Michael A.; Alexander, Kenneth R.; Derlacki, Deborah J.; Rajagopalan, Aruna S.
2005-01-01
We report three unrelated patients with mutations in the GRM6 gene that normally encodes the glutamate receptor mGluR6. This neurotransmitter receptor has been shown previously to be present only in the synapses of the ON bipolar cell dendrites, and it mediates synaptic transmission from rod and cone photoreceptors to this type of second-order neuron. Despite the synaptic defect, best visual acuities were normal or only moderately reduced (20/15 to 20/40). The patients were night blind from an early age, and when maximally dark-adapted, they could perceive lights only with an intensity equal to or slightly dimmer than that normally detected by the cone system (i.e., 2-3 log units above normal). Electroretinograms (ERGs) in response to single brief flashes of light had clearly detectable a-waves, which are derived from photoreceptors, and greatly reduced b-waves, which are derived from the second-order inner retinal neurons. ERGs in response to sawtooth flickering light indicated a markedly reduced ON response and a nearly normal OFF response. There was no subjective delay in the perception of suddenly appearing white vs. black objects on a gray background. These patients exemplify a previously unrecognized, autosomal recessive form of congenital night blindness associated with a negative ERG waveform. PMID:15781871
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Directory of Open Access Journals (Sweden)
Borie Dominic C
2006-03-01
Full Text Available Abstract Background The use of porcine cells and organs as a source of xenografts for human patients would vastly increase the donor pool; however, both humans and Old World primates vigorously reject pig tissues due to xenoantibodies that react with the polysaccharide galactose α (1,3 galactose (αGal present on the surface of many porcine cells. We previously examined the xenoantibody response in patients exposed to porcine hepatocytes via treatment(s with bioartficial liver devices (BALs, composed of porcine cells in a support matrix. We determined that xenoantibodies in BAL-treated patients are predominantly directed at porcine αGal carbohydrate epitopes, and are encoded by a small number of germline heavy chain variable region (VH immunoglobulin genes. The studies described in this manuscript were designed to identify whether the xenoantibody responses and the IgVH genes encoding antibodies to porcine hepatocytes in non-human primates used as preclinical models are similar to those in humans. Adult non-immunosuppressed rhesus monkeys (Macaca mulatta were injected intra-portally with porcine hepatocytes or heterotopically transplanted with a porcine liver lobe. Peripheral blood leukocytes and serum were obtained prior to and at multiple time points after exposure, and the immune response was characterized, using ELISA to evaluate the levels and specificities of circulating xenoantibodies, and the production of cDNA libraries to determine the genes used by B cells to encode those antibodies. Results Xenoantibodies produced following exposure to isolated hepatocytes and solid organ liver grafts were predominantly encoded by genes in the VH3 family, with a minor contribution from the VH4 family. Immunoglobulin heavy-chain gene (VH cDNA library screening and gene sequencing of IgM libraries identified the genes as most closely-related to the IGHV3-11 and IGHV4-59 germline progenitors. One of the genes most similar to IGHV3-11, VH3-11cyno, has
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Transcriptomic analysis of salt stress responsive genes in Rhazya stricta.
Directory of Open Access Journals (Sweden)
Nahid H Hajrah
Full Text Available Rhazya stricta is an evergreen shrub that is widely distributed across Western and South Asia, and like many other members of the Apocynaceae produces monoterpene indole alkaloids that have anti-cancer properties. This species is adapted to very harsh desert conditions making it an excellent system for studying tolerance to high temperatures and salinity. RNA-Seq analysis was performed on R. stricta exposed to severe salt stress (500 mM NaCl across four time intervals (0, 2, 12 and 24 h to examine mechanisms of salt tolerance. A large number of transcripts including genes encoding tetrapyrroles and pentatricopeptide repeat (PPR proteins were regulated only after 12 h of stress of seedlings grown in controlled greenhouse conditions. Mechanisms of salt tolerance in R. stricta may involve the upregulation of genes encoding chaperone protein Dnaj6, UDP-glucosyl transferase 85a2, protein transparent testa 12 and respiratory burst oxidase homolog protein b. Many of the highly-expressed genes act on protecting protein folding during salt stress and the production of flavonoids, key secondary metabolites in stress tolerance. Other regulated genes encode enzymes in the porphyrin and chlorophyll metabolic pathway with important roles during plant growth, photosynthesis, hormone signaling and abiotic responses. Heme biosynthesis in R. stricta leaves might add to the level of salt stress tolerance by maintaining appropriate levels of photosynthesis and normal plant growth as well as by the participation in reactive oxygen species (ROS production under stress. We speculate that the high expression levels of PPR genes may be dependent on expression levels of their targeted editing genes. Although the results of PPR gene family indicated regulation of a large number of transcripts under salt stress, PPR actions were independent of the salt stress because their RNA editing patterns were unchanged.
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu
2005-01-01
We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Huang, Hao; Mackel, Brian J.; Grove, Anne
2013-01-01
Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report h...
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Institute of Scientific and Technical Information of China (English)
ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)
2002-01-01
Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.
Directory of Open Access Journals (Sweden)
Luciane S Fonseca
Full Text Available Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2 one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Population responses in V1 encode different figures by response amplitude.
Gilad, Ariel; Slovin, Hamutal
2015-04-22
The visual system simultaneously segregates between several objects presented in a visual scene. The neural code for encoding different objects or figures is not well understood. To study this question, we trained two monkeys to discriminate whether two elongated bars are either separate, thus generating two different figures, or connected, thus generating a single figure. Using voltage-sensitive dyes, we imaged at high spatial and temporal resolution V1 population responses evoked by the two bars, while keeping their local attributes similar among the two conditions. In the separate condition, unlike the connected condition, the population response to one bar is enhanced, whereas the response to the other is simultaneously suppressed. The response to the background remained unchanged between the two conditions. This divergent pattern developed ∼200 ms poststimulus onset and could discriminate well between the separate and connected single trials. The stimulus separation saliency and behavioral report were highly correlated with the differential response to the bars. In addition, the proximity and/or the specific location of the connectors seemed to have only a weak effect on this late activity pattern, further supporting the involvement of top-down influences. Additional neural codes were less informative about the separate and connected conditions, with much less consistency and discriminability compared with a response amplitude code. We suggest that V1 is involved in the encoding of each figure by different neuronal response amplitude, which can mediate their segregation and perception. Copyright © 2015 the authors 0270-6474/15/356335-15$15.00/0.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen
DEFF Research Database (Denmark)
Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup
2012-01-01
Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...
Directory of Open Access Journals (Sweden)
Elise Jackson
Full Text Available Previously, we showed that Killer Immunoglobulin-like Receptor (KIR3DS1 homozygotes (hmz are more frequent in HIV exposed seronegative (HESN than in recently HIV infected (HIV+ individuals. KIR3DS1 encodes an activating Natural Killer (NK cell receptor (NKR. The link between KIR genotype and HIV outcomes likely arises from the function that NK cells acquire through expression of particular NKRs. An initial screen of 97 HESN and 123 HIV+ subjects for the frequency of KIR region gene carriage observed between-group differences for several telomeric KIR region loci. In a larger set of up to 106 HESN and 439 HIV+ individuals, more HESN than HIV+ subjects were KIR3DS1 homozygotes, lacked a full length KIR2DS4 gene and carried the telomeric group B KIR haplotype motif, TB01. TB01 is characterized by the presence of KIR3DS1, KIR2DL5A, KIR2DS3/5 and KIR2DS1, in linkage disequilibrium with each other. We assessed which of the TB01 encoded KIR gene products contributed to NK cell responsiveness by stimulating NK cells from 8 HIV seronegative KIR3DS1 and TB01 motif homozygotes with 721.221 HLA null cells and evaluating the frequency of KIR3DS1+/-KIR2DL5+/-, KIR3DS1+/-KIR2DS1+/-, KIR3DS1+/-KIR2DS5+/- NK cells secreting IFN-γ and/or expressing CD107a. A higher frequency of NK cells expressing, versus not, KIR3DS1 responded to 721.221 stimulation. KIR2DL5A+, KIR2DS1+ and KIR2DS5+ NK cells did not contribute to 721.221 responses or modulate those by KIR3DS1+ NK cells. Thus, of the TB01 KIR gene products, only KIR3DS1 conferred responsiveness to HLA-null stimulation, demonstrating its ligation can activate ex vivo NK cells.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Meena, Mukesh Kumar; Ghawana, Sanjay; Sardar, Atish; Dwivedi, Vikas; Khandal, Hitaishi; Roy, Riti; Chattopadhyay, Debasis
2015-01-01
Calcium ion (Ca2+) is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs) are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea) genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS) suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL) were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA) at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Directory of Open Access Journals (Sweden)
Hao-li MA
2010-03-01
Full Text Available Ethylene response factors (ERFs play important roles in response to plant biotic and abiotic stresses. In this study, a gene encoding a putative AP2/ERF domain-containing protein was isolated by screening a SSH cDNA library from rice and designated as Oryza sativa AP2/ERF-like protein (OsAP2LP gene. OsAP2LP is 1491 bp in length, interrupted by seven introns, and encodes a putative protein of 348 amino acids. Temporal and spatial expression analysis showed that the OsAP2LP gene was preferentially expressed in roots, panicles, mature embryos and seeds in rice. Real-time quantitative PCR analysis indicated that the expression levels of the OsAP2LP gene were increased under the treatments of drought and gibberellin but decreased under the treatments of low temperature, salt, abscisic acid (ABA and zeatin. Taken together, these results suggest that OsAP2LP might be involved in stress responses, and probably plays roles as a transcription regulator when plants response to cold, salt and drought stresses through ABA and gibberellin pathways.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Zhou Yong
2018-01-01
Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario
2017-04-01
Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are
Directory of Open Access Journals (Sweden)
Mukesh Kumar Meena
Full Text Available Calcium ion (Ca2+ is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Directory of Open Access Journals (Sweden)
Saki Kondo
Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.
Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato
2017-09-01
Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.
Huang, Hao; Mackel, Brian J; Grove, Anne
2013-11-01
Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report here that the soil bacterium Streptomyces coelicolor also encodes a PecS homolog (SCO2647) that regulates a pecM gene (SCO2646). S. coelicolor PecS, which exists as a homodimer, binds the intergenic region between pecS and pecM genes with high affinity. Several potential PecS binding sites were found in this intergenic region. The binding of PecS to its target DNA can be efficiently attenuated by the ligand urate, which also quenches the intrinsic fluorescence of PecS, indicating a direct interaction between urate and PecS. In vivo measurement of gene expression showed that activity of pecS and pecM genes is significantly elevated after exposure of S. coelicolor cultures to urate. These results indicate that S. coelicolor PecS responds to the ligand urate by attenuated DNA binding in vitro and upregulation of gene activity in vivo. Since production of urate is associated with generation of reactive oxygen species by xanthine dehydrogenase, we propose that PecS functions under conditions of oxidative stress.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Directory of Open Access Journals (Sweden)
Xiangshu Dong
Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
DEFF Research Database (Denmark)
Oehlenschlæger, Christian Berg; Løvgreen, Monika Nøhr; Reinauer, Eva
2015-01-01
Analysis of the genome of Bacillus halodurans strain C125 indicated that two pathways leading from a cytosine deoxyribonucleotide to dUMP, used for dTMP synthesis, were encoded by the genome of the bacterium. The genes that were responsible, the comEB gene and the dcdB gene, encoding dCMP deaminase...
Induction of Th1 type response by DNA vaccinations with N, M, and E genes against SARS-CoV in mice
International Nuclear Information System (INIS)
Jin Huali; Xiao Chong; Chen Ze; Kang Youmin; Ma Yijie; Zhu Kaichun; Xie Qifa; Tu Yixian; Yu Yang; Wang Bin
2005-01-01
Vaccination against the SARS-CoV infection is an attractive means to control the spread of viruses in public. In this study, we employed a DNA vaccine technology with the levamisole, our newly discovered chemical adjuvant, to generate Th1 type of response. To avoid the enhancement antibody issue, genes encoding the nucleocapsid, membrane, and envelope protein of SARS-CoV were cloned and their expressions in mammalian cells were determined. After the intramuscular introduction into animals, we observed that the constructs of the E, M, and N genes could induce high levels of specific antibodies, T cell proliferations, IFN-γ, DTH responses, and in vivo cytotoxic T cells activities specifically against SARS-CoV antigens. The highest immune responses were generated by the construct encoding the nucleocapsid protein. The results suggest that the N, M, and E genes could be used as the targets to prevent SARS-CoV infection in the DNA vaccine development
Directory of Open Access Journals (Sweden)
Fernanda M Rodríguez-Tornos
Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Directory of Open Access Journals (Sweden)
Busche Tobias
2012-09-01
Full Text Available Abstract Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly
Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn
2012-09-03
The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
EBV-encoded miRNAs target ATM-mediated response in nasopharyngeal carcinoma.
Lung, Raymond W-M; Hau, Pok-Man; Yu, Ken H-O; Yip, Kevin Y; Tong, Joanna H-M; Chak, Wing-Po; Chan, Anthony W-H; Lam, Ka-Hei; Lo, Angela Kwok-Fung; Tin, Edith K-Y; Chau, Shuk-Ling; Pang, Jesse C-S; Kwan, Johnny S-H; Busson, Pierre; Young, Lawrence S; Yap, Lee-Fah; Tsao, Sai-Wah; To, Ka-Fai; Lo, Kwok-Wai
2018-04-01
Nasopharyngeal carcinoma (NPC) is a highly invasive epithelial malignancy that is prevalent in southern China and Southeast Asia. It is consistently associated with latent Epstein-Barr virus (EBV) infection. In NPC, miR-BARTs, the EBV-encoded miRNAs derived from BamH1-A rightward transcripts, are abundantly expressed and contribute to cancer development by targeting various cellular and viral genes. In this study, we establish a comprehensive transcriptional profile of EBV-encoded miRNAs in a panel of NPC patient-derived xenografts and an EBV-positive NPC cell line by small RNA sequencing. Among the 40 miR-BARTs, predominant expression of 22 miRNAs was consistently detected in these tumors. Among the abundantly expressed EBV-miRNAs, BART5-5p, BART7-3p, BART9-3p, and BART14-3p could negatively regulate the expression of a key DNA double-strand break (DSB) repair gene, ataxia telangiectasia mutated (ATM), by binding to multiple sites on its 3'-UTR. Notably, the expression of these four miR-BARTs represented more than 10% of all EBV-encoded miRNAs in tumor cells, while downregulation of ATM expression was commonly detected in all of our tested sequenced samples. In addition, downregulation of ATM was also observed in primary NPC tissues in both qRT-PCR (16 NP and 45 NPC cases) and immunohistochemical staining (35 NP and 46 NPC cases) analysis. Modulation of ATM expression by BART5-5p, BART7-3p, BART9-3p, and BART14-3p was demonstrated in the transient transfection assays. These findings suggest that EBV uses miRNA machinery as a key mechanism to control the ATM signaling pathway in NPC cells. By suppressing these endogenous miR-BARTs in EBV-positive NPC cells, we further demonstrated the novel function of miR-BARTs in inhibiting Zta-induced lytic reactivation. These findings imply that the four viral miRNAs work co-operatively to modulate ATM activity in response to DNA damage and to maintain viral latency, contributing to the tumorigenesis of NPC. © 2017 The Authors
EBV‐encoded miRNAs target ATM‐mediated response in nasopharyngeal carcinoma
Lung, Raymond W‐M; Hau, Pok‐Man; Yu, Ken H‐O; Yip, Kevin Y; Tong, Joanna H‐M; Chak, Wing‐Po; Chan, Anthony W‐H; Lam, Ka‐Hei; Lo, Angela Kwok‐Fung; Tin, Edith K‐Y; Chau, Shuk‐Ling; Pang, Jesse C‐S; Kwan, Johnny S‐H; Busson, Pierre; Young, Lawrence S; Yap, Lee‐Fah; Tsao, Sai‐Wah
2018-01-01
Abstract Nasopharyngeal carcinoma (NPC) is a highly invasive epithelial malignancy that is prevalent in southern China and Southeast Asia. It is consistently associated with latent Epstein–Barr virus (EBV) infection. In NPC, miR‐BARTs, the EBV‐encoded miRNAs derived from BamH1‐A rightward transcripts, are abundantly expressed and contribute to cancer development by targeting various cellular and viral genes. In this study, we establish a comprehensive transcriptional profile of EBV‐encoded miRNAs in a panel of NPC patient‐derived xenografts and an EBV‐positive NPC cell line by small RNA sequencing. Among the 40 miR‐BARTs, predominant expression of 22 miRNAs was consistently detected in these tumors. Among the abundantly expressed EBV‐miRNAs, BART5‐5p, BART7‐3p, BART9‐3p, and BART14‐3p could negatively regulate the expression of a key DNA double‐strand break (DSB) repair gene, ataxia telangiectasia mutated (ATM), by binding to multiple sites on its 3'‐UTR. Notably, the expression of these four miR‐BARTs represented more than 10% of all EBV‐encoded miRNAs in tumor cells, while downregulation of ATM expression was commonly detected in all of our tested sequenced samples. In addition, downregulation of ATM was also observed in primary NPC tissues in both qRT‐PCR (16 NP and 45 NPC cases) and immunohistochemical staining (35 NP and 46 NPC cases) analysis. Modulation of ATM expression by BART5‐5p, BART7‐3p, BART9‐3p, and BART14‐3p was demonstrated in the transient transfection assays. These findings suggest that EBV uses miRNA machinery as a key mechanism to control the ATM signaling pathway in NPC cells. By suppressing these endogenous miR‐BARTs in EBV‐positive NPC cells, we further demonstrated the novel function of miR‐BARTs in inhibiting Zta‐induced lytic reactivation. These findings imply that the four viral miRNAs work co‐operatively to modulate ATM activity in response to DNA damage and to maintain viral latency
Directory of Open Access Journals (Sweden)
Sumit Ghosh
Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.
Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis
2013-01-01
Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Ferreira, A B; Oliveira, M N V de; Freitas, F S; Paiva, A D; Alfenas-Zerbini, P; Silva, D F da; Queiroz, M V de; Borges, A C; Moraes, C A de
2015-01-01
Amino acid decarboxylation is important for the maintenance of intracellular pH under acid stress. This study aims to carry out phylogenetic and expression analysis by real-time PCR of two genes that encode proteins involved in ornithine decarboxylation in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress. Sequencing and phylogeny analysis of genes encoding ornithine decarboxylase and amino acid permease in L. delbrueckii UFV H2b20 showed their high sequence identity (99%) and grouping with those of L. delbrueckii subsp. bulgaricus ATCC 11842. Exposure of L. delbrueckii UFV H2b20 cells in MRS pH 3.5 for 30 and 60 min caused a significant increase in expression of the gene encoding ornithine decarboxylase (up to 8.1 times higher when compared to the control treatment). Increased expression of the ornithine decarboxylase gene demonstrates its involvement in acid stress response in L. delbrueckii UFV H2b20, evidencing that the protein encoded by that gene could be involved in intracellular pH regulation. The results obtained show ornithine decarboxylation as a possible mechanism of adaptation to an acidic environmental condition, a desirable and necessary characteristic for probiotic cultures and certainly important to the survival and persistence of the L. delbrueckii UFV H2b20 in the human gastrointestinal tract.
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the
Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.
Directory of Open Access Journals (Sweden)
Idit Hazan
2016-12-01
Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang
2011-11-01
Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.
Low Complexity Encoder of High Rate Irregular QC-LDPC Codes for Partial Response Channels
Directory of Open Access Journals (Sweden)
IMTAWIL, V.
2011-11-01
Full Text Available High rate irregular QC-LDPC codes based on circulant permutation matrices, for efficient encoder implementation, are proposed in this article. The structure of the code is an approximate lower triangular matrix. In addition, we present two novel efficient encoding techniques for generating redundant bits. The complexity of the encoder implementation depends on the number of parity bits of the code for the one-stage encoding and the length of the code for the two-stage encoding. The advantage of both encoding techniques is that few XOR-gates are used in the encoder implementation. Simulation results on partial response channels also show that the BER performance of the proposed code has gain over other QC-LDPC codes.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Rapid and preferential activation of the c-jun gene during the mammalian UV response
International Nuclear Information System (INIS)
Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.
1991-01-01
Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung
2014-04-16
Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Association of Candidate Genes With Submergence Response in Perennial Ryegrass
Directory of Open Access Journals (Sweden)
Xicheng Wang
2017-05-01
Full Text Available Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT, leaf fresh weight (LFW, leaf dry weight (LDW, and chlorophyll fluorescence (Fv/Fm at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments. Among 26 candidate genes tested by various models, single nucleotide polymorphisms (SNPs in 10 genes showed significant associations with traits including 16 associations for control, 10 for submergence, and 8 for recovery. Under submergence, Lp1-SST encoding sucrose:sucrose 1-fructosyltransferase and LpGA20ox encoding gibberellin 20-oxidase were associated with LFW and LDW, and LpACO1 encoding 1-aminocyclopropane-1-carboxylic acid oxidase was associated with LFW. Associations between Lp1-SST and HT, Lp6G-FFT encoding fructan:fructan 6G-fructosyltransferase and Fv/Fm, LpCAT encoding catalase and HT were also detected under submergence stress. Upon de-submergence, Lp1-SST, Lp6G-FFT, and LpPIP1 encoding plasma membrane intrinsic protein type 1 were associated with LFW or LDW, while LpCBF1b encoding C-repeat binding factor were associated with HT. Nine significant SNPs in Lp1-SST, Lp6G-FFT, LpCAT, and LpACO1 resulted in amino acid changes with five substitutions found in Lp1-SST under submergence or recovery. The results indicated that allelic diversity in genes involved in carbohydrate and antioxidant metabolism, ethylene and gibberellin biosynthesis, and transcript factor could contribute to growth variations in perennial ryegrass under submergence stress and recovery after de-submergence.
Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J
2013-05-01
Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.
Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2015-02-01
Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Two-stage gene regulation of the superoxide stress response soxRS system in Escherichia coli.
Nunoshiba, T
1996-01-01
All organisms have adapted to environmental changes by acquiring various functions controlled by gene regulation. In bacteria, a number of specific responses have been found to confer cell survival in various nutrient-limited conditions, and under physiological stresses such as high or low temperature, extreme pH, radiation, and oxidation (for review, see Neidhardt et al., 1987). In this article, I introduce an Escherichia coli (E. coli) global response induced by superoxide stress, the soxRS regulon. The functions controlled by this system consist of a wide variety of enzymes such as manganese-containing SOD (Mn-SOD); glucose 6-phosphate dehydrogenase (G6PD), the DNA repair enzyme endonuclease IV, fumarase C, NADPH:ferredoxin oxidoreductase, and aconitase. This response is positively regulated by a two-stage control system in which SoxR iron-sulfur protein senses exposure to superoxide and nitric oxide, and then activates transcription of the soxS gene, whose product stimulates the expression of the regulon genes. Our recent finding indicates that soxS transcription is initiated in a manner dependent on the rpoS gene encoding RNA polymerase sigma factor, theta s, in response to entering the stationary phase of growth. With this information, mechanisms for prokaryotic coordinating gene expression in response to superoxide stress and in stationary phase are discussed.
Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.
Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L
2017-08-01
Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya
2008-11-01
A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
transformation affects, directly or indirectly, expression of genes encoding for transcription factors that can activate a gene cascade responsible for the normal plant development.
Energy Technology Data Exchange (ETDEWEB)
Last, Jerold A [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Gohil, Kishorchandra [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Mathrani, Vivek C [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Kenyon, Nicholas J [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States)
2005-10-15
Rats or mice acutely exposed to high concentrations of ozone show an immediate and significant weight loss, even when allowed free access to food and water. The mechanisms underlying this systemic response to ozone have not been previously elucidated. We have applied the technique of global gene expression analysis to the livers of C57BL mice acutely exposed to ozone. Mice lost up to 14% of their original body weight, with a 42% decrease in total food consumption. We previously had found significant up-regulation of genes encoding proliferative enzymes, proteins related to acute phase reactions and cytoskeletal functions, and other biomarkers of a cachexia-like inflammatory state in lungs of mice exposed to ozone. These results are consistent with a general up-regulation of different gene families responsive to NF-{kappa}B in the lungs of the exposed mice. In the present study, we observed significant down-regulation of different families of mRNAs in the livers of the exposed mice, including genes related to lipid and fatty acid metabolism, and to carbohydrate metabolism in this tissue, consistent with a systemic cachexic response. Several interferon-dependent genes were down-regulated in the liver, suggesting a possible role for interferon as a signaling molecule between lung and liver. In addition, transcription of several mRNAs encoding enzymes of xenobiotic metabolism in the livers of mice exposed to ozone was decreased, suggesting cytokine-mediated suppression of cytochrome P450 expression. This finding may explain a previously controversial report from other investigators more than 20 years ago of prolongation of pentobarbital sleeping time in mice exposed to ozone.
International Nuclear Information System (INIS)
Last, Jerold A.; Gohil, Kishorchandra; Mathrani, Vivek C.; Kenyon, Nicholas J.
2005-01-01
Rats or mice acutely exposed to high concentrations of ozone show an immediate and significant weight loss, even when allowed free access to food and water. The mechanisms underlying this systemic response to ozone have not been previously elucidated. We have applied the technique of global gene expression analysis to the livers of C57BL mice acutely exposed to ozone. Mice lost up to 14% of their original body weight, with a 42% decrease in total food consumption. We previously had found significant up-regulation of genes encoding proliferative enzymes, proteins related to acute phase reactions and cytoskeletal functions, and other biomarkers of a cachexia-like inflammatory state in lungs of mice exposed to ozone. These results are consistent with a general up-regulation of different gene families responsive to NF-κB in the lungs of the exposed mice. In the present study, we observed significant down-regulation of different families of mRNAs in the livers of the exposed mice, including genes related to lipid and fatty acid metabolism, and to carbohydrate metabolism in this tissue, consistent with a systemic cachexic response. Several interferon-dependent genes were down-regulated in the liver, suggesting a possible role for interferon as a signaling molecule between lung and liver. In addition, transcription of several mRNAs encoding enzymes of xenobiotic metabolism in the livers of mice exposed to ozone was decreased, suggesting cytokine-mediated suppression of cytochrome P450 expression. This finding may explain a previously controversial report from other investigators more than 20 years ago of prolongation of pentobarbital sleeping time in mice exposed to ozone
Dose response relationship in anti-stress gene regulatory networks.
Zhang, Qiang; Andersen, Melvin E
2007-03-02
To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on
Dose response relationship in anti-stress gene regulatory networks.
Directory of Open Access Journals (Sweden)
Qiang Zhang
2007-03-01
Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Directory of Open Access Journals (Sweden)
Hai-Ting Hao
Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Snapshot of iron response in Shewanella oneidensis by gene network reconstruction
Energy Technology Data Exchange (ETDEWEB)
Yang, Yunfeng; Harris, Daniel P.; Luo, Feng; Xiong, Wenlu; Joachimiak, Marcin; Wu, Liyou; Dehal, Paramvir; Jacobsen, Janet; Yang, Zamin; Palumbo, Anthony V.; Arkin, Adam P.; Zhou, Jizhong
2008-10-09
Background: Iron homeostasis of Shewanella oneidensis, a gamma-proteobacterium possessing high iron content, is regulated by a global transcription factor Fur. However, knowledge is incomplete about other biological pathways that respond to changes in iron concentration, as well as details of the responses. In this work, we integrate physiological, transcriptomics and genetic approaches to delineate the iron response of S. oneidensis. Results: We show that the iron response in S. oneidensis is a rapid process. Temporal gene expression profiles were examined for iron depletion and repletion, and a gene co-expression network was reconstructed. Modules of iron acquisition systems, anaerobic energy metabolism and protein degradation were the most noteworthy in the gene network. Bioinformatics analyses suggested that genes in each of the modules might be regulated by DNA-binding proteins Fur, CRP and RpoH, respectively. Closer inspection of these modules revealed a transcriptional regulator (SO2426) involved in iron acquisition and ten transcriptional factors involved in anaerobic energy metabolism. Selected genes in the network were analyzed by genetic studies. Disruption of genes encoding a putative alcaligin biosynthesis protein (SO3032) and a gene previously implicated in protein degradation (SO2017) led to severe growth deficiency under iron depletion conditions. Disruption of a novel transcriptional factor (SO1415) caused deficiency in both anaerobic iron reduction and growth with thiosulfate or TMAO as an electronic acceptor, suggesting that SO1415 is required for specific branches of anaerobic energy metabolism pathways. Conclusions: Using a reconstructed gene network, we identified major biological pathways that were differentially expressed during iron depletion and repletion. Genetic studies not only demonstrated the importance of iron acquisition and protein degradation for iron depletion, but also characterized a novel transcriptional factor (SO1415) with a
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Directory of Open Access Journals (Sweden)
Christopher Ian Cazzonelli
2014-10-01
Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.
Cazzonelli, Christopher I; Nisar, Nazia; Roberts, Andrea C; Murray, Kevin D; Borevitz, Justin O; Pogson, Barry J
2014-01-01
Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3), which encodes a calmodulin-like protein (CML12). The gene neighboring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Directory of Open Access Journals (Sweden)
Boran Altincicek
Full Text Available Beetles (Coleoptera are the most diverse animal group on earth and interact with numerous symbiotic or pathogenic microbes in their environments. The red flour beetle Tribolium castaneum is a genetically tractable model beetle species and its whole genome sequence has recently been determined. To advance our understanding of the molecular basis of beetle immunity here we analyzed the whole transcriptome of T. castaneum by high-throughput next generation sequencing technology. Here, we demonstrate that the Illumina/Solexa sequencing approach of cDNA samples from T. castaneum including over 9.7 million reads with 72 base pairs (bp length (approximately 700 million bp sequence information with about 30× transcriptome coverage confirms the expression of most predicted genes and enabled subsequent qualitative and quantitative transcriptome analysis. This approach recapitulates our recent quantitative real-time PCR studies of immune-challenged and naïve T. castaneum beetles, validating our approach. Furthermore, this sequencing analysis resulted in the identification of 73 differentially expressed genes upon immune-challenge with statistical significance by comparing expression data to calculated values derived by fitting to generalized linear models. We identified up regulation of diverse immune-related genes (e.g. Toll receptor, serine proteinases, DOPA decarboxylase and thaumatin and of numerous genes encoding proteins with yet unknown functions. Of note, septic-injury resulted also in the elevated expression of genes encoding heat-shock proteins or cytochrome P450s supporting the view that there is crosstalk between immune and stress responses in T. castaneum. The present study provides a first comprehensive overview of septic-injury responsive genes in T. castaneum beetles. Identified genes advance our understanding of T. castaneum specific gene expression alteration upon immune-challenge in particular and may help to understand beetle immunity
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Machado, Vilmar; Serrano, Jose; Galián, Jose
2016-01-01
The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.
Directory of Open Access Journals (Sweden)
Eunseong Kim
Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation
African Journals Online (AJOL)
The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
Itzhaki, H; Maxson, J M; Woodson, W R
1994-01-01
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Acute toxicity and gene responses induced by endosulfan in zebrafish (Danio rerio embryos
Directory of Open Access Journals (Sweden)
Young-Sun Moon
2016-10-01
Full Text Available Endosulfan has been listed as a persistent organic pollutant, and is frequently found in agricultural environments during monitoring processes owing to its heavy use and persistent characteristics. This study was conducted to understand the effects of endosulfan on the development of zebrafish (Danio rerio embryos by exposing them to a specific range of endosulfan concentrations. Exposing zebrafish embryos to endosulfan for 96 h yielded no acute toxicity until the concentration reached 1500 μg L−1, whereas malformed zebrafish larvae developed severely curved spines and shortened tails. About 50% of zebrafish larvae were malformed when exposed to 600 μg L−1 of endosulfan. Comparative gene expression using real-time quantitative polymerase chain reaction was assessed using endosulfan-exposed zebrafish embryos. CYP1A and CYP3A were significantly enhanced in response to endosulfan treatment. Two genes, acacb and fasn, encoding acetyl-CoA carboxylase b and fatty acid synthase proteins, respectively, were also up-regulated after treating zebrafish embryos with endosulfan. These genes are also involved in fatty acid biosynthesis. The genes encoding vitellogenin and Hsp70 increased in a concentration-dependent manner in embryos. Finally, biochemical studies showed that acetylcholinesterase activity was reduced, whereas glutathione S-transferase and carboxylesterase activities were enhanced in zebrafish embryos after endosulfan treatment. These biochemical and molecular biological differences might be used for tools to determine contamination of endosulfan in the aquatic environment.
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya
2009-06-01
A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
2011-01-01
Background Entamoeba histolytica, an enteric protozoan parasite, causes amebic colitis and extra intestinal abscesses in millions of inhabitants of endemic areas. E. histolytica completely lacks glutathione metabolism but possesses L-cysteine as the principle low molecular weight thiol. L-Cysteine is essential for the structure, stability, and various protein functions, including catalysis, electron transfer, redox regulation, nitrogen fixation, and sensing for regulatory processes. Recently, we demonstrated that in E. histolytica, L-cysteine regulates various metabolic pathways including energy, amino acid, and phospholipid metabolism. Results In this study, employing custom-made Affymetrix microarrays, we performed time course (3, 6, 12, 24, and 48 h) gene expression analysis upon L-cysteine deprivation. We identified that out of 9,327 genes represented on the array, 290 genes encoding proteins with functions in metabolism, signalling, DNA/RNA regulation, electron transport, stress response, membrane transport, vesicular trafficking/secretion, and cytoskeleton were differentially expressed (≥3 fold) at one or more time points upon L-cysteine deprivation. Approximately 60% of these modulated genes encoded proteins of no known function and annotated as hypothetical proteins. We also attempted further functional analysis of some of the most highly modulated genes by L-cysteine depletion. Conclusions To our surprise, L-cysteine depletion caused only limited changes in the expression of genes involved in sulfur-containing amino acid metabolism and oxidative stress defense. In contrast, we observed significant changes in the expression of several genes encoding iron sulfur flavoproteins, a major facilitator super-family transporter, regulator of nonsense transcripts, NADPH-dependent oxido-reductase, short chain dehydrogenase, acetyltransferases, and various other genes involved in diverse cellular functions. This study represents the first genome-wide analysis of
Directory of Open Access Journals (Sweden)
Jeelani Ghulam
2011-05-01
Full Text Available Abstract Background Entamoeba histolytica, an enteric protozoan parasite, causes amebic colitis and extra intestinal abscesses in millions of inhabitants of endemic areas. E. histolytica completely lacks glutathione metabolism but possesses L-cysteine as the principle low molecular weight thiol. L-Cysteine is essential for the structure, stability, and various protein functions, including catalysis, electron transfer, redox regulation, nitrogen fixation, and sensing for regulatory processes. Recently, we demonstrated that in E. histolytica, L-cysteine regulates various metabolic pathways including energy, amino acid, and phospholipid metabolism. Results In this study, employing custom-made Affymetrix microarrays, we performed time course (3, 6, 12, 24, and 48 h gene expression analysis upon L-cysteine deprivation. We identified that out of 9,327 genes represented on the array, 290 genes encoding proteins with functions in metabolism, signalling, DNA/RNA regulation, electron transport, stress response, membrane transport, vesicular trafficking/secretion, and cytoskeleton were differentially expressed (≥3 fold at one or more time points upon L-cysteine deprivation. Approximately 60% of these modulated genes encoded proteins of no known function and annotated as hypothetical proteins. We also attempted further functional analysis of some of the most highly modulated genes by L-cysteine depletion. Conclusions To our surprise, L-cysteine depletion caused only limited changes in the expression of genes involved in sulfur-containing amino acid metabolism and oxidative stress defense. In contrast, we observed significant changes in the expression of several genes encoding iron sulfur flavoproteins, a major facilitator super-family transporter, regulator of nonsense transcripts, NADPH-dependent oxido-reductase, short chain dehydrogenase, acetyltransferases, and various other genes involved in diverse cellular functions. This study represents the first
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Gil, Fátima N; Becker, Jörg D; Viegas, Cristina A
2014-06-11
Pyrimethanil is a fungicide mostly applied in vineyards. When misused, residue levels detected in grape must or in the environment may be of concern. The present work aimed to analyze mechanisms underlying response to deleterious effects of pyrimethanil in the eukaryotic model Saccharomyces cerevisiae. Pyrimethanil concentration-dependent effects at phenotypic (inhibition of growth) and transcriptomic levels were examined. For transcriptional profiling, analysis focused on two sublethal exposure conditions that inhibited yeast growth by 20% or 50% compared with control cells not exposed to the fungicide. Gene expression modifications increased with the magnitude of growth inhibition, in numbers and fold-change of differentially expressed genes and in diversity of over-represented functional categories. These included mostly biosynthesis of arginine and sulfur amino acids metabolism, as well as energy conservation, antioxidant response, and multidrug transport. Several pyrimethanil-responsive genes encoded proteins sharing significant homology with proteins from phytopathogenic fungi and ecologically relevant higher eukaryotes.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions
Directory of Open Access Journals (Sweden)
Hamed Rezaei
2017-07-01
Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.
Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong
2017-09-11
Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.
Directory of Open Access Journals (Sweden)
Ian G Woods
2005-03-01
Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Luo, Anding; Qian, Qian; Yin, Hengfu; Liu, Xiaoqiang; Yin, Changxi; Lan, Ying; Tang, Jiuyou; Tang, Zuoshun; Cao, Shouyun; Wang, Xiujie; Xia, Kai; Fu, Xiangdong; Luo, Da; Chu, Chengcai
2006-02-01
Elongation of rice internodes is one of the most important agronomic traits, which determines the plant height and underlies the grain yield. It has been shown that the elongation of internodes is under genetic control, and various factors are implicated in the process. Here, we report a detailed characterization of an elongated uppermost internode1 (eui1) mutant, which has been used in hybrid rice breeding. In the eui1-2 mutant, the cell lengths in the uppermost internodes are significantly longer than that of wild type and thus give rise to the elongated uppermost internode. It was found that the level of active gibberellin was elevated in the mutant, whereas its growth in response to gibberellin is similar to that of the wild type, suggesting that the higher level accumulation of gibberellin in the eui1 mutant causes the abnormal elongation of the uppermost internode. Consistently, the expression levels of several genes which encode gibberellin biosynthesis enzymes were altered. We cloned the EUI1 gene, which encodes a putative cytochrome P450 monooxygenase, by map-based cloning and found that EUI1 was weakly expressed in most tissues, but preferentially in young panicles. To confirm its function, transgenic experiments with different constructs of EUI1 were conducted. Overexpression of EUI1 gave rise to the gibberellin-deficient-like phenotypes, which could be partially reversed by supplementation with gibberellin. Furthermore, apart from the alteration of expression levels of the gibberellin biosynthesis genes, accumulation of SLR1 protein was found in the overexpressing transgenic plants, indicating that the expression level of EUI1 is implicated in both gibberellin-mediated SLR1 destruction and a feedback regulation in gibberellin biosynthesis. Therefore, we proposed that EUI1 plays a negative role in gibberellin-mediated regulation of cell elongation in the uppermost internode of rice.
Mazzoni, C; Santori, F; Saliola, M; Falcone, C
2000-01-01
KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.
Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L
2003-02-01
Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
TaWRKY68 responses to biotic stresses are revealed by the orthologous genes from major cereals
Directory of Open Access Journals (Sweden)
Bo Ding
2014-01-01
Full Text Available WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies onWRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary,TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.
Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses
Directory of Open Access Journals (Sweden)
Redon Emma
2008-07-01
Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis
Isolation and characterization of a gene encoding a polyethylene ...
Indian Academy of Sciences (India)
Prakash
Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Transcriptome analysis of trichothecene-induced gene expression in barley.
Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J
2007-11-01
Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Kane, Garvan C; Lam, Chen-Fuh; O'Cochlain, Fearghas; Hodgson, Denice M; Reyes, Santiago; Liu, Xiao-Ke; Miki, Takashi; Seino, Susumu; Katusic, Zvonimir S; Terzic, Andre
2006-11-01
Sepsis, the systemic inflammatory response to infection, imposes a high demand for bodily adaptation, with the cardiovascular response a key determinant of outcome. The homeostatic elements that secure cardiac tolerance in the setting of the sepsis syndrome are poorly understood. Here, in a model of acute septic shock induced by endotoxin challenge with Escherichia coli lipopolysaccharide (LPS), knockout of the KCNJ8 gene encoding the vascular Kir6.1 K(ATP) channel pore predisposed to an early and profound survival disadvantage. The exaggerated susceptibility provoked by disruption of this stress-responsive sensor of cellular metabolism was linked to progressive deterioration in cardiac activity, ischemic myocardial damage, and contractile dysfunction. Deletion of KCNJ8 blunted the responsiveness of coronary vessels to cytokine- or metabolic-mediated vasodilation necessary to support myocardial perfusion in the wild-type (WT), creating a deficit in adaptive response in the Kir6.1 knockout. Application of a K(ATP) channel opener drug improved survival in the endotoxic WT but had no effect in the Kir6.1 knockout. Restoration of the dilatory capacity of coronary vessels was required to rescue the Kir6.1 knockout phenotype and reverse survival disadvantage in lethal endotoxemia. Thus, the Kir6.1-containing K(ATP) channel, by coupling vasoreactivity with metabolic demand, provides a vital feedback element for cardiovascular tolerance in endotoxic shock.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Thamm, Markus; Scheiner, Ricarda
2014-06-01
Division of labor is a hallmark of social insects. In honey bees, division of labor involves transition of female workers from one task to the next. The most distinct tasks are nursing (providing food for the brood) and foraging (collecting pollen and nectar). The brain mechanisms regulating this form of behavioral plasticity have largely remained elusive. Recently, it was suggested that division of labor is based on nutrition-associated signaling pathways. One highly conserved gene associated with food-related behavior across species is the foraging gene, which encodes a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG). Our analysis of this gene reveals the presence of alternative splicing in the honey bee. One isoform is expressed in the brain. Expression of this isoform is most pronounced in the mushroom bodies, the subesophageal ganglion, and the corpora allata. Division of labor and sucrose responsiveness in honey bees correlate significantly with foraging gene expression in distinct brain regions. Activating PKG selectively increases sucrose responsiveness in nurse bees to the level of foragers, whereas the same treatment does not affect responsiveness to light. These findings demonstrate a direct link between PKG signaling in distinct brain areas and division of labor. Furthermore, they demonstrate that the difference in sensory responsiveness between nurse bees and foragers can be compensated for by activating PKG. Our findings on the function of PKG in regulating specific sensory responsiveness and social organization offer valuable indications for the function of the cGMP/PKG pathway in many other insects and vertebrates. Copyright © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Global transcriptome analysis of the heat shock response ofshewanella oneidensis
Energy Technology Data Exchange (ETDEWEB)
Gao, Haichun; Wang, Sarah; Liu, Xueduan; Yan, Tinfeng; Wu, Liyou; Alm, Eric; Arkin, Adam P.; Thompson, Dorothea K.; Zhou, Jizhong
2004-04-30
Shewanella oneidensis is an important model organism for bioremediation studies because of its diverse respiratory capabilities. However, the genetic basis and regulatory mechanisms underlying the ability of S. oneidensis to survive and adapt to various environmentally relevant stresses is poorly understood. To define this organism's molecular response to elevated growth temperatures, temporal gene expression profiles were examined in cells subjected to heat stress using whole-genome DNA microarrays for S. oneidensis MR-1. Approximately 15 percent (711) of the predicted S. oneidensis genes represented on the microarray were significantly up- or down-regulated (P < 0.05) over a 25-min period following shift to the heat shock temperature (42 C). As expected, the majority of S. oneidensis genes exhibiting homology to known chaperones and heat shock proteins (Hsps) were highly and transiently induced. In addition, a number of predicted genes encoding enzymes in glycolys is and the pentose cycle, [NiFe] dehydrogenase, serine proteases, transcriptional regulators (MerR, LysR, and TetR families), histidine kinases, and hypothetical proteins were induced in response to heat stress. Genes encoding membrane proteins were differentially expressed, suggesting that cells possibly alter their membrane composition or structure in response to variations in growth temperature. A substantial number of the genes encoding ribosomal proteins displayed down-regulated co-expression patterns in response to heat stress, as did genes encoding prophage and flagellar proteins. Finally, based on computational comparative analysis of the upstream promoter regions of S.oneidensis heat-inducible genes, a putative regulatory motif, showing high conservation to the Escherichia coli sigma 32-binding consensus sequence, was identified.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Bester, Michael C; Jacobson, Dan; Bauer, Florian F
2012-01-01
The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Directory of Open Access Journals (Sweden)
Arjun Sham
Full Text Available Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20, encoding for a member of the caleosin (lipid surface protein family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research
Influence of the gene xthA in the activation of SOS response of Escherichia coli
International Nuclear Information System (INIS)
Dominguez M, V.
2013-01-01
The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)
McKenna, Benjamin S; Sutherland, Ashley N; Legenkaya, Anna P; Eyler, Lisa T
2014-05-01
Individuals with bipolar disorder (BD) have trait-like deficits in attention and working memory (WM). A fundamental dissociation for most verbal WM theories involves the separation of sensory-perceptual encoding, reliant upon attention, from the maintenance of this information in WM proper. The present study examined if patients with BD demonstrate differential neural changes in encoding and maintenance WM processes that underlie cognitive impairment. Event-related functional magnetic resonance imaging during a delayed match-to-sample WM paradigm was employed in 23 inter-episode medicated patients with BD and 23 demographically similar healthy comparison participants. We examined brain regions during encoding and maintenance task intervals to identify regions that demonstrated differential effects between groups. Medication effects and functional connectivity between prefrontal cortex and basal ganglia/thalamus were examined during the encoding interval due to the importance of these regions and the connection among them for encoding into WM. Patients with BD exhibited deficits in task accuracy and attenuated brain response during the encoding interval in areas of the prefrontal cortex, caudate, thalamus, and posterior visual regions. In contrast, patients with BD exhibited hyperactivation in posterior sensory regions during the maintenance interval. Among the BD group, those with greater medication load exhibited the greatest brain response within the prefrontal cortex. Reduction in activation during the encoding interval suggests that attentional deficits underlie WM deficits in patients with BD. These deficits appear to be trait-like in so far as they were observed during periods of euthymia in patients with BD. Medication effects remain to be further explored as there was evidence of prefrontal changes dependent on medication load. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Dedeurwaerder, Annelike; Olyslaegers, Dominique A J; Desmarets, Lowiese M B; Roukaerts, Inge D M; Theuns, Sebastiaan; Nauwynck, Hans J
2014-02-01
The type I IFN-mediated immune response is the first line of antiviral defence. Coronaviruses, like many other viruses, have evolved mechanisms to evade this innate response, ensuring their survival. Several coronavirus accessory genes play a central role in these pathways, but for feline coronaviruses this has never to our knowledge been studied. As it has been demonstrated previously that ORF7 is essential for efficient replication in vitro and virulence in vivo of feline infectious peritonitis virus (FIPV), the role of this ORF in the evasion of the IFN-α antiviral response was investigated. Deletion of ORF7 from FIPV strain 79-1146 (FIPV-Δ7) rendered the virus more susceptible to IFN-α treatment. Given that ORF7 encodes two proteins, 7a and 7b, it was further explored which of these proteins is active in this mechanism. Providing 7a protein in trans rescued the mutant FIPV-Δ7 from IFN sensitivity, which was not achieved by addition of 7b protein. Nevertheless, addition of protein 7a to FIPV-Δ3Δ7, a FIPV mutant deleted in both ORF3 and ORF7, could no longer increase the replication capacity of this mutant in the presence of IFN. These results indicate that FIPV 7a protein is a type I IFN antagonist and protects the virus from the antiviral state induced by IFN, but it needs the presence of ORF3-encoded proteins to exert its antagonistic function.
Directory of Open Access Journals (Sweden)
Shuiyuan Cheng
2016-03-01
Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.
Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang
2016-03-08
Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2011-12-01
In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Lowe, J.B.; Lennon, G.; Rouquier, S.; Giorgi, D.; Kelly, R.J.
1998-09-15
The gene encoding GDP-L-fucose: {beta}-D-Galactoside 2-{alpha}-Lfucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor. 30 figs.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
KBERG: KnowledgeBase for Estrogen Responsive Genes
DEFF Research Database (Denmark)
Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam
2007-01-01
Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro
2003-10-10
The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Sousa, C S; Barros, B A; Barh, D; Ghosh, P; Azevedo, V; Barros, E G; Moreira, M A
2016-08-26
The enzymes 1,2-diacylglycerol cholinephosphotrans-ferase (CPT) and lysophosphatidylcholine acyltransferase (LPCAT) are important in lipid metabolism in soybean seeds. Thus, understand-ing the genes that encode these enzymes may enable their modification and aid the improvement of soybean oil quality. In soybean, the genes encoding these enzymes have not been completely described; there-fore, this study aimed to identify, characterize, and analyze the in silico expression of these genes in soybean. We identified two gene models encoding CPT and two gene models encoding LPCAT, one of which presented an alternative transcript. The sequences were positioned on the physical map of soybean and the promoter regions were analyzed. Cis-elements responsible for seed-specific expression and responses to biotic and abiotic stresses were identified. Virtual expression analysis of the gene models for CPT and LPCAT indicated that these genes are expressed under different stress conditions, in somatic embryos during differentiation, in immature seeds, root tissues, and calli. Putative ami-no acid sequences revealed the presence of transmembrane domains, and analysis of the cellular localization of these enzymes revealed they are located in the endoplasmic reticulum.
Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción
2015-10-24
NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.
Lowe, John B.; Lennon, Gregory; Rouquier, Sylvie; Giorgi, Dominique; Kelly, Robert J.
1998-01-01
The gene encoding GDP-L-fucose: .beta.-D-Galactoside 2-.alpha.-L-fucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor.
A murC gene in Porphyromonas gingivalis 381.
Ansai, T; Yamashita, Y; Awano, S; Shibata, Y; Wachi, M; Nagai, K; Takehara, T
1995-09-01
The gene encoding a 51 kDa polypeptide of Porphyromonas gingivalis 381 was isolated by immunoblotting using an antiserum raised against P. gingivalis alkaline phosphatase. DNA sequence analysis of a 2.5 kb DNA fragment containing a gene encoding the 51 kDa protein revealed one complete and two incomplete ORFs. Database searches using the FASTA program revealed significant homology between the P. gingivalis 51 kDa protein and the MurC protein of Escherichia coli, which functions in peptidoglycan synthesis. The cloned 51 kDa protein encoded a functional product that complemented an E. coli murC mutant. Moreover, the ORF just upstream of murC coded for a protein that was 31% homologous with the E. coli MurG protein. The ORF just downstream of murC coded for a protein that was 17% homologous with the Streptococcus pneumoniae penicillin-binding protein 2B (PBP2B), which functions in peptidoglycan synthesis and is responsible for antibiotic resistance. These results suggest that P. gingivalis contains a homologue of the E. coli peptidoglycan synthesis gene murC and indicate the possibility of a cluster of genes responsible for cell division and cell growth, as in the E. coli mra region.
Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.
Directory of Open Access Journals (Sweden)
Hua Fu
Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.
Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len
2005-03-01
We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Nuruzzaman, Mohammed; Cao, Hongzhe; Xiu, Hao; Luo, Tiao; Li, Jijia; Chen, Xianghui; Luo, Junli; Luo, Zhiyong
2016-02-01
WRKY proteins belong to a transcription factor (TF) family and play dynamic roles in many plant processes, including plant responses to abiotic and biotic stresses, as well as secondary metabolism. However, no WRKY gene in Panax ginseng C.A. Meyer has been reported to date. In this study, a number of WRKY unigenes from methyl jasmonate (MeJA)-treated adventitious root transcriptome of this species were identified using next-generation sequencing technology. A total of 48 promising WRKY unigenes encoding WRKY proteins were obtained by eliminating wrong and incomplete open reading frame (ORF). Phylogenetic analysis reveals 48 WRKY TFs, including 11 Group I, 36 Group II, and 1 Group III. Moreover, one MeJA-responsive unigene designated as PgWRKY1 was cloned and characterized. It contains an entire ORF of 1077 bp and encodes a polypeptide of 358 amino acid residues. The PgWRKY1 protein contains a single WRKY domain consisting of a conserved amino acid sequence motif WRKYGQK and a C2H2-type zinc-finger motif belonging to WRKY subgroup II-d. Subcellular localization of PgWRKY1-GFP fusion protein in onion and tobacco epidermis cells revealed that PgWRKY1 was exclusively present in the nucleus. Quantitative real-time polymerase chain reaction analysis demonstrated that the expression of PgWRKY1 was relatively higher in roots and lateral roots compared with leaves, stems, and seeds. Importantly, PgWRKY1 expression was significantly induced by salicylic acid, abscisic acid, and NaCl, but downregulated by MeJA treatment. These results suggested that PgWRKY1 might be a multiple stress-inducible gene responding to hormones and salt stresses. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Bencke-Malato, Marta; Cabreira, Caroline; Wiebke-Strohm, Beatriz; Bücker-Neto, Lauro; Mancini, Estefania; Osorio, Marina B; Homrich, Milena S; Turchetto-Zolet, Andreia Carina; De Carvalho, Mayra C C G; Stolf, Renata; Weber, Ricardo L M; Westergaard, Gastón; Castagnaro, Atílio P; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Margis-Pinheiro, Márcia; Bodanese-Zanettini, Maria Helena
2014-09-10
Many previous studies have shown that soybean WRKY transcription factors are involved in the plant response to biotic and abiotic stresses. Phakopsora pachyrhizi is the causal agent of Asian Soybean Rust, one of the most important soybean diseases. There are evidences that WRKYs are involved in the resistance of some soybean genotypes against that fungus. The number of WRKY genes already annotated in soybean genome was underrepresented. In the present study, a genome-wide annotation of the soybean WRKY family was carried out and members involved in the response to P. pachyrhizi were identified. As a result of a soybean genomic databases search, 182 WRKY-encoding genes were annotated and 33 putative pseudogenes identified. Genes involved in the response to P. pachyrhizi infection were identified using superSAGE, RNA-Seq of microdissected lesions and microarray experiments. Seventy-five genes were differentially expressed during fungal infection. The expression of eight WRKY genes was validated by RT-qPCR. The expression of these genes in a resistant genotype was earlier and/or stronger compared with a susceptible genotype in response to P. pachyrhizi infection. Soybean somatic embryos were transformed in order to overexpress or silence WRKY genes. Embryos overexpressing a WRKY gene were obtained, but they were unable to convert into plants. When infected with P. pachyrhizi, the leaves of the silenced transgenic line showed a higher number of lesions than the wild-type plants. The present study reports a genome-wide annotation of soybean WRKY family. The participation of some members in response to P. pachyrhizi infection was demonstrated. The results contribute to the elucidation of gene function and suggest the manipulation of WRKYs as a strategy to increase fungal resistance in soybean plants.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
Directory of Open Access Journals (Sweden)
Schwerin Manfred
2003-06-01
Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
DEFF Research Database (Denmark)
Matheu, Victor; Treschow, Alexandra; Navikas, Vaidrius
2003-01-01
. OBJECTIVE: We sought to define the differential role of endogenous IFN-beta in controlling the development of allergic inflammation. METHODS: We assessed whether deletion of the gene encoding IFN-beta (IFNB) with knockout mice participated in the development of allergic response in ovalbumin (OVA......BACKGROUND: IFN-beta has been shown to be effective as therapy for multiple sclerosis. Some reports attributed its beneficial effects to the capacity to induce a T(H)2 response. However, other studies have suggested that endogenous type I IFN might downregulate the allergic response in mice...
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Isolation and characterization of the human parathyroid hormone-like peptide gene
International Nuclear Information System (INIS)
Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.
1989-01-01
A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors
Directory of Open Access Journals (Sweden)
Molenaar Douwe
2010-11-01
Full Text Available Abstract Background Modulation of the immune system is one of the most plausible mechanisms underlying the beneficial effects of probiotic bacteria on human health. Presently, the specific probiotic cell products responsible for immunomodulation are largely unknown. In this study, the genetic and phenotypic diversity of strains of the Lactobacillus plantarum species were investigated to identify genes of L. plantarum with the potential to influence the amounts of cytokines interleukin 10 (IL-10 and IL-12 and the ratio of IL-10/IL-12 produced by peripheral blood mononuclear cells (PBMCs. Results A total of 42 Lactobacillus plantarum strains isolated from diverse environmental and human sources were evaluated for their capacity to stimulate cytokine production in PBMCs. The L. plantarum strains induced the secretion of the anti-inflammatory cytokine IL-10 over an average 14-fold range and secretion of the pro-inflammatory cytokine IL-12 over an average 16-fold range. Comparisons of the strain-specific cytokine responses of PBMCs to comparative genome hybridization profiles obtained with L. plantarum WCFS1 DNA microarrays (also termed gene-trait matching resulted in the identification of 6 candidate genetic loci with immunomodulatory capacities. These loci included genes encoding an N-acetyl-glucosamine/galactosamine phosphotransferase system, the LamBDCA quorum sensing system, and components of the plantaricin (bacteriocin biosynthesis and transport pathway. Deletion of these genes in L. plantarum WCFS1 resulted in growth phase-dependent changes in the PBMC IL-10 and IL-12 cytokine profiles compared with wild-type cells. Conclusions The altered PBMC cytokine profiles obtained with the L. plantarum WCFS1 mutants were in good agreement with the predictions made by gene-trait matching for the 42 L. plantarum strains. This study therefore resulted in the identification of genes present in certain strains of L. plantarum which might be responsible for
International Nuclear Information System (INIS)
Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard
2008-01-01
Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
A murC gene from coryneform bacteria.
Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K
1999-02-01
The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.
Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A
2017-05-13
In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge. Copyright © 2017. Published by Elsevier Inc.
Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald
2018-01-11
In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .
Directory of Open Access Journals (Sweden)
Stefanie Staats
2018-01-01
Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Guzmán-Rodríguez, Jaquelina J; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Ochoa-Zarzosa, Alejandra; Suárez-Rodríguez, Luis María; Rodríguez-Zapata, Luis C; Salgado-Garciglia, Rafael; Jimenez-Moraila, Beatriz; López-Meza, Joel E; López-Gómez, Rodolfo
2013-09-01
Avocado is one of the most important fruits in the world. Avocado "native mexicano" (Persea americana var. drymifolia) seeds are widely used in the propagation of this plant and are the primary source of rootstocks globally for a variety of avocado cultivars, such as the Hass avocado. Here, we report the isolation of 5005 ESTs from the 5' ends of P. americana var. drymifolia seed cDNA clones representing 1584 possible unigenes. These avocado seed ESTs were compared with the avocado flower EST library, and we detected several genes that are expressed either in both tissues or only in the seed. The snakin gene, which encodes an element of the innate immune response in plants, was one of those most frequently found among the seed ESTs, and this suggests that it is abundantly expressed in the avocado seed. We expressed the snakin gene in a heterologous system, namely the bovine endothelial cell line BVE-E6E7. Conditioned media from transfected BVE-E6E7 cells showed antimicrobial activity against strains of Escherichia coli and Staphylococcus aureus. This is the first study of the function of the snakin gene in plant seed tissue, and our observations suggest that this gene might play a protective role in the avocado seed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song
2018-02-09
Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.
Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus
International Nuclear Information System (INIS)
Mojumdar, M.
1986-01-01
pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Directory of Open Access Journals (Sweden)
Hsiao-Ling Lu
Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.
Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2014-01-01
Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515
Ritchey, Maureen; McCullough, Andrew M; Ranganath, Charan; Yonelinas, Andrew P
2017-01-01
Acute stress has been shown to modulate memory for recently learned information, an effect attributed to the influence of stress hormones on medial temporal lobe (MTL) consolidation processes. However, little is known about which memories will be affected when stress follows encoding. One possibility is that stress interacts with encoding processes to selectively protect memories that had elicited responses in the hippocampus and amygdala, two MTL structures important for memory formation. There is limited evidence for interactions between encoding processes and consolidation effects in humans, but recent studies of consolidation in rodents have emphasized the importance of encoding "tags" for determining the impact of consolidation manipulations on memory. Here, we used functional magnetic resonance imaging in humans to test the hypothesis that the effects of post-encoding stress depend on MTL processes observed during encoding. We found that changes in stress hormone levels were associated with an increase in the contingency of memory outcomes on hippocampal and amygdala encoding responses. That is, for participants showing high cortisol reactivity, memories became more dependent on MTL activity observed during encoding, thereby shifting the distribution of recollected events toward those that had elicited relatively high activation. Surprisingly, this effect was generally larger for neutral, compared to emotionally negative, memories. The results suggest that stress does not uniformly enhance memory, but instead selectively preserves memories tagged during encoding, effectively acting as mnemonic filter. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Directory of Open Access Journals (Sweden)
O. V. Blazhenko
2014-02-01
Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
Transcriptional feedback regulation of YUCCA genes in response to auxin levels in Arabidopsis.
Suzuki, Masashi; Yamazaki, Chiaki; Mitsui, Marie; Kakei, Yusuke; Mitani, Yuka; Nakamura, Ayako; Ishii, Takahiro; Soeno, Kazuo; Shimada, Yukihisa
2015-08-01
The IPyA pathway, the major auxin biosynthesis pathway, is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels. The phytohormone auxin plays an important role in plant growth and development, and levels of active free auxin are determined by biosynthesis, conjugation, and polar transport. Unlike conjugation and polar transport, little is known regarding the regulatory mechanism of auxin biosynthesis. We discovered that expression of genes encoding indole-3-pyruvic acid (IPyA) pathway enzymes is regulated by elevated or reduced active auxin levels. Expression levels of TAR2, YUC1, YUC2, YUC4, and YUC6 were downregulated in response to synthetic auxins [1-naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D)] exogenously applied to Arabidopsis thaliana L. seedlings. Concomitantly, reduced levels of endogenous indole-3-acetic acid (IAA) were observed. Alternatively, expression of these YUCCA genes was upregulated by the auxin biosynthetic inhibitor kynurenine in Arabidopsis seedlings, accompanied by reduced IAA levels. These results indicate that expression of YUCCA genes is regulated by active auxin levels. Similar results were also observed in auxin-overproduction and auxin-deficient mutants. Exogenous application of IPyA to Arabidopsis seedlings preincubated with kynurenine increased endogenous IAA levels, while preincubation with 2,4-D reduced endogenous IAA levels compared to seedlings exposed only to IPyA. These results suggest that in vivo conversion of IPyA to IAA was enhanced under reduced auxin levels, while IPyA to IAA conversion was depressed in the presence of excess auxin. Based on these results, we propose that the IPyA pathway is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Urzica, Eugen I.; Adler, Lital N.; Page, M. Dudley; Linster, Carole L.; Arbing, Mark A.; Casero, David; Pellegrini, Matteo; Merchant, Sabeeha S.; Clarke, Steven G.
2012-01-01
The l-galactose (Smirnoff-Wheeler) pathway represents the major route to l-ascorbic acid (vitamin C) biosynthesis in higher plants. Arabidopsis thaliana VTC2 and its paralogue VTC5 function as GDP-l-galactose phosphorylases converting GDP-l-galactose to l-galactose-1-P, thus catalyzing the first committed step in the biosynthesis of l-ascorbate. Here we report that the l-galactose pathway of ascorbate biosynthesis described in higher plants is conserved in green algae. The Chlamydomonas reinhardtii genome encodes all the enzymes required for vitamin C biosynthesis via the l-galactose pathway. We have characterized recombinant C. reinhardtii VTC2 as an active GDP-l-galactose phosphorylase. C. reinhardtii cells exposed to oxidative stress show increased VTC2 mRNA and l-ascorbate levels. Genes encoding enzymatic components of the ascorbate-glutathione system (e.g. ascorbate peroxidase, manganese superoxide dismutase, and dehydroascorbate reductase) are also up-regulated in response to increased oxidative stress. These results indicate that C. reinhardtii VTC2, like its plant homologs, is a highly regulated enzyme in ascorbate biosynthesis in green algae and that, together with the ascorbate recycling system, the l-galactose pathway represents the major route for providing protective levels of ascorbate in oxidatively stressed algal cells. PMID:22393048
Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens
International Nuclear Information System (INIS)
Murphy, K.E.
1989-01-01
In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity
An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis
Directory of Open Access Journals (Sweden)
Hongyan eGuo
2015-05-01
Full Text Available Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid, a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice.
Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them
Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika
2007-03-13
The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).
Burton, Amanda C; Bissonette, Gregory B; Zhao, Adam C; Patel, Pooja K; Roesch, Matthew R
2017-08-09
Dorsal lateral striatum (DLS) is a highly associative structure that encodes relationships among environmental stimuli, behavioral responses, and predicted outcomes. DLS is known to be disrupted after chronic drug abuse; however, it remains unclear what neural signals in DLS are altered. Current theory suggests that drug use enhances stimulus-response processing at the expense of response-outcome encoding, but this has mostly been tested in simple behavioral tasks. Here, we investigated what neural correlates in DLS are affected by previous cocaine exposure as rats performed a complex reward-guided decision-making task in which predicted reward value was independently manipulated by changing the delay to or size of reward associated with a response direction across a series of trial blocks. After cocaine self-administration, rats exhibited stronger biases toward higher-value reward and firing in DLS more strongly represented action-outcome contingencies independent from actions subsequently taken rather than outcomes predicted by selected actions (chosen-outcome contingencies) and associations between stimuli and actions (stimulus-response contingencies). These results suggest that cocaine self-administration strengthens action-outcome encoding in rats (as opposed to chosen-outcome or stimulus-response encoding), which abnormally biases behavior toward valued reward when there is a choice between two options during reward-guided decision-making. SIGNIFICANCE STATEMENT Current theories suggest that the impaired decision-making observed in individuals who chronically abuse drugs reflects a decrease in goal-directed behaviors and an increase in habitual behaviors governed by neural representations of response-outcome (R-O) and stimulus-response associations, respectively. We examined the impact that prior cocaine self-administration had on firing in dorsal lateral striatum (DLS), a brain area known to be involved in habit formation and affected by drugs of abuse
HRGFish: A database of hypoxia responsive genes in fishes
Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo
2017-02-01
Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Sonia Podvin
Full Text Available By virtue of its ability to regulate the composition of cerebrospinal fluid (CSF, the choroid plexus (CP is ideally suited to instigate a rapid response to traumatic brain injury (TBI by producing growth regulatory proteins. For example, Esophageal Cancer Related Gene-4 (Ecrg4 is a tumor suppressor gene that encodes a hormone-like peptide called augurin that is present in large concentrations in CP epithelia (CPe. Because augurin is thought to regulate senescence, neuroprogenitor cell growth and differentiation in the CNS, we evaluated the kinetics of Ecrg4 expression and augurin immunoreactivity in CPe after CNS injury. Adult rats were injured with a penetrating cortical lesion and alterations in augurin immunoreactivity were examined by immunohistochemistry. Ecrg4 gene expression was characterized by in situ hybridization. Cell surface augurin was identified histologically by confocal microscopy and biochemically by sub-cellular fractionation. Both Ecrg4 gene expression and augurin protein levels were decreased 24-72 hrs post-injury but restored to uninjured levels by day 7 post-injury. Protein staining in the supraoptic nucleus of the hypothalamus, used as a control brain region, did not show a decrease of auguin immunoreactivity. Ecrg4 gene expression localized to CPe cells, and augurin protein to the CPe ventricular face. Extracellular cell surface tethering of 14 kDa augurin was confirmed by cell surface fractionation of primary human CPe cells in vitro while a 6-8 kDa fragment of augurin was detected in conditioned media, indicating release from the cell surface by proteolytic processing. In rat CSF however, 14 kDa augurin was detected. We hypothesize the initial release and proteolytic processing of augurin participates in the activation phase of injury while sustained Ecrg4 down-regulation is dysinhibitory during the proliferative phase. Accordingly, augurin would play a constitutive inhibitory function in normal CNS while down
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S
2011-02-01
Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.
International Nuclear Information System (INIS)
Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori
2005-01-01
The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism
Directory of Open Access Journals (Sweden)
Clara Pons
Full Text Available Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding
Pons, Clara; Martí, Cristina; Forment, Javier; Crisosto, Carlos H; Dandekar, Abhaya M; Granell, Antonio
2014-01-01
Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding strategies to better
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Creelman, R A; Mullet, J E
1991-10-01
Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
DEFF Research Database (Denmark)
Wissinger, Bernd; Schaich, Simone; Baumann, Britta
2011-01-01
KCNV2 gene and one also includes the adjacent VLDLR gene. Furthermore, we investigated N-terminal amino acid substitution mutations for its effect on interaction with Kv2.1 using yeast two-hybrid technology. We found that these mutations dramatically reduce or abolish this interaction suggesting a lack......Cone dystrophy with supernormal rod response (CDSRR) is considered to be a very rare autosomal recessive retinal disorder. CDSRR is associated with mutations in KCNV2, a gene that encodes a modulatory subunit (Kv8.2) of a voltage-gated potassium channel. In this study, we found that KCNV2 mutations...... are present in a substantial fraction (2.2-4.3%) of a sample of 367 independent patients with a variety of initial clinical diagnoses of cone malfunction, indicating that CDSRR is underdiagnosed and more common than previously thought. In total, we identified 20 different KCNV2 mutations; 15 of them are novel...
T-cell activation and early gene response in dogs.
Directory of Open Access Journals (Sweden)
Sally-Anne Mortlock
Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru
2016-03-02
Brachypodium distachyon is a promising model plants for grasses. Infections of Brachypodium by various pathogens that severely impair crop production have been reported, and the species accordingly provides an alternative platform for investigating molecular mechanisms of pathogen virulence and plant disease resistance. To date, we have a broad picture of plant immunity only in Arabidopsis and rice; therefore, Brachypodium may constitute a counterpart that displays the commonality and uniqueness of defence systems among plant species. Phytohormones play key roles in plant biotic stress responses, and hormone-responsive genes are used to qualitatively and quantitatively evaluate disease resistance responses during pathogen infection. For these purposes, defence-related phytohormone marker genes expressed at time points suitable for defence-response monitoring are needed. Information about their expression profiles over time as well as their response specificity is also helpful. However, useful marker genes are still rare in Brachypodium. We selected 34 candidates for Brachypodium marker genes on the basis of protein-sequence similarity to known marker genes used in Arabidopsis and rice. Brachypodium plants were treated with the defence-related phytohormones salicylic acid, jasmonic acid and ethylene, and their transcription levels were measured 24 and 48 h after treatment. Two genes for salicylic acid, 7 for jasmonic acid and 2 for ethylene were significantly induced at either or both time points. We then focused on 11 genes encoding pathogenesis-related (PR) 1 protein and compared their expression patterns with those of Arabidopsis and rice. Phylogenetic analysis suggested that Brachypodium contains several PR1-family genes similar to rice genes. Our expression profiling revealed that regulation patterns of some PR1 genes as well as of markers identified for defence-related phytohormones are closely related to those in rice. We propose that the Brachypodium immune
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Directory of Open Access Journals (Sweden)
Fu Shenzao
2018-05-01
Full Text Available Abstract:: The critical node (CN is an important stage during seed aging, which is related to effective genebank conservation. Previous studies have demonstrated that proteins undergo carbonylated modification at the CN in rice, indicating oxidative damage. However, the levels of reactive carbonyl species (RCS and the associated scavenging system at the CN are largely unknown. In this study, we optimized methods for the extraction and analysis of RCS from dry rice embryos. In order to acquire seeds at the CN, rice seeds were subjected to natural conditions for 7, 9, 11 and 13 months, and the seed germination rates were reduced to 90%, 82%, 71% and 57%, respectively. We chose the stage with seed germination rate of 82% as the CN according to the rice seed vigor loss curve. The levels of crotonaldehyde and 4-hydroxy-(E-2-nonenal (HNE were significantly increased at the CN. In addition, genes encoding carbonyl-scavenging enzyme, including OsALDHs and OsAKRs, were significantly down-regulated at the CN, and reductions in the expression of OsALDH2-2, OsALDH2-5, OsALDH3-4, OsALDH7, OsAKR1 and OsAKR2 in particular could be responsible for RCS accumulation. Thus, the accumulations of crotonaldehyde and HNE and down-regulation of genes encoding carbonyl-scavenging enzyme might be related to an accelerating loss of seed viability at the CN. Key words: carbonyl-scavenging system, reactive carbonyl species, seed aging, crotonaldehyde, critical node, rice storage
Directory of Open Access Journals (Sweden)
Peng Gao
2008-01-01
Full Text Available The balance between carbon (C and nitrogen (N nutrients must be tightly coordinated so that cells can optimize their opportunity for metabolism, growth and development. However, the C and N nutrient balance perception and signaling mechanism remains poorly understood. Here, we report the isolation and characterization of two allelic oversensitive to sugar 1 mutants (osu1-1, osu1-2 in Arabidopsis thaliana. Using the cotyledon anthocyanin accumulation and root growth inhibition assays, we show that the osu1 mutants are more sensitive than wild-type to both of the imbalanced C/N conditions, high C/low N and low C/high N. However, under the balanced C/N conditions (low C/low N or high C/high N, the osu1 mutants have similar anthocyanin levels and root lengths as wild-type. Consistently, the genes encoding two MYB transcription factors (MYB75 and MYB90 and an Asn synthetase isoform (ASN1 are strongly up-regulated by the OSU1 mutation in response to high C/low N and low C/high N, respectively. Furthermore, the enhanced sensitivity of osu1-1 to high C/low N with respect to anthocyanin accumulation but not root growth inhibition can be suppressed by co-suppression of MYB75, indicating that MYB75 acts downstream of OSU1 in the high C/low N imbalance response. Map-based cloning reveals that OSU1 encodes a member of a large family of putative methyltransferases and is allelic to the recently reported QUA2/TSD2 locus identified in genetic screens for cell-adhesion-defective mutants. Accumulation of OSU1/QUA2/TSD2 transcript was not regulated by C and N balance, but the OSU1 promoter was slightly more active in the vascular system. Taken together, our results show that the OSU1/QUA2/TSD2-encoded putative methyltransferase is required for normal C/N nutrient balance response in plants.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
International Nuclear Information System (INIS)
Deveaux, Yves
1999-01-01
DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
International Nuclear Information System (INIS)
Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung
2003-01-01
To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming
2015-03-01
Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Chevalier Frédéric
2012-01-01
Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host
A Novel PCR Assay for Listeria welshimeri Targeting Transcriptional Regulator Gene lwe1801
Transcriptional regulator genes encode a group of specialized molecules that play essential roles in microbial responses to changing external conditions. These genes have been shown to possess species or group specificity and are useful as detection targets for diagnostic application. The present st...
Paige, Laura E; Amado, Selen; Gutchess, Angela H
2017-10-01
Prior cross-cultural research has reported cultural variations in memory. One study revealed that Americans remembered images with more perceptual detail than East Asians (Millar et al. in Cult Brain 1(2-4):138-157, 2013). However, in a later study, this expected pattern was not replicated, possibly due to differences in encoding instructions (Paige et al. in Cortex 91:250-261, 2017). The present study sought to examine when cultural variation in memory-related decisions occur and the role of instructions. American and East Asian participants viewed images of objects while making a Purchase decision or an Approach decision and later completed a surprise recognition test. Results revealed Americans had higher hit rates for specific memory, regardless of instruction type, and a less stringent response criterion relative to East Asians. Additionally, a pattern emerged where the Approach decision enhanced hit rates for specific memory relative to the Purchase decision only when administered first; this pattern did not differ across cultures. Results suggest encoding instructions do not magnify cross-cultural differences in memory. Ultimately, cross-cultural differences in response bias, rather than memory sensitivity per se, may account for findings of cultural differences in memory specificity.
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Li-Tempel, Ting; Larra, Mauro F; Winnikes, Ulrike; Tempel, Tobias; DeRijk, Roel H; Schulz, André; Schächinger, Hartmut; Meyer, Jobst; Schote, Andrea B
2016-09-01
The hypothalamus-pituitary-adrenal (HPA) axis is a crucial endocrine system for coping with stress. A reliable and stable marker for the basal state of that system is the cortisol awakening response (CAR). We examined the influence of variants of four relevant candidate genes; the mineralocorticoid receptor gene (MR), the glucocorticoid receptor gene (GR), the serotonin transporter gene (5-HTT) and the gene encoding the brain-derived neurotrophic factor (BDNF) on CAR and self-perceived stress in 217 healthy subjects. We found that polymorphisms of GR influenced both, the basal state of the HPA axis as well as self-perceived stress. MR only associated with self-perceived stress and 5-HTT only with CAR. BDNF did not affected any of the investigated indices. In summary, we suggest that GR variants together with the CAR and supplemented with self reports on perceived stress might be useful indicators for the basal HPA axis activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Jurecka-Lubieniecka, Beata; Ploski, Rafal; Kula, Dorota; Krol, Aleksandra; Bednarczuk, Tomasz; Kolosza, Zofia; Tukiendorf, Andrzej; Szpak-Ulczok, Sylwia; Stanjek-Cichoracka, Anita; Polanska, Joanna; Jarzab, Barbara
2013-01-01
Background Graves' disease (GD) is a complex disease in which genetic predisposition is modified by environmental factors. The aim of the study was to examine the association between genetic variants in genes encoding proteins involved in immune response and the age at diagnosis of GD. Methods 735 GD patients and 1216 healthy controls from Poland were included into the study. Eight genetic variants in the HLA-DRB1, TNF, CTLA4, CD40, NFKb, PTPN22, IL4 and IL10 genes were genotyped. Patients were stratified by the age at diagnosis of GD and the association with genotype was analysed. Results Polymorphism in the HLA-DRB1, TNF and CTLA4 genes were associated with GD. The carriers of the HLA DRB1*03 allele were more frequent in patients with age at GD diagnosis ≤30 years than in patients with older age at GD diagnosis. Conclusions HLADRB1*03 allele is associated with young age at diagnosis of Graves' disease in polish population. PMID:23544060
Directory of Open Access Journals (Sweden)
Yew Margaret
2007-03-01
Full Text Available Abstract Background Natural antibodies directed at carbohydrates reject porcine xenografts. They are initially expressed in germline configuration and are encoded by a small number of structurally-related germline progenitors. The transplantation of genetically-modified pig organs prevents hyperacute rejection, but delayed graft rejection still occurs, partly due to humoral responses. IgVH genes encoding induced xenoantibodies are predominantly, not exclusively, derived from germline progenitors in the VH3 family. We have previously identified the immunoglobulin heavy chain genes encoding VH3 xenoantibodies in patients and primates. In this manuscript, we complete the structural analysis of induced xenoantibodies by identifying the IgVH genes encoding the small proportion of VH4 xenoantibodies and the germline progenitors encoding xenoantibody light chains. This information has been used to define the xenoantibody/carbohydrate binding site using computer-simulated modeling. Results The VH4-59 gene encodes antibodies in the VH4 family that are induced in human patients mounting active xenoantibody responses. The light chain of xenoantibodies is encoded by DPK5 and HSIGKV134. The structural information obtained by sequencing analysis was used to create computer-simulated models. Key contact sites for xenoantibody/carbohydrate interaction for VH3 family xenoantibodies include amino acids in sites 31, 33, 50, 57, 58 and the CDR3 region of the IgVH gene. Site-directed mutagenesis indicates that mutations in predicted contact sites alter binding to carbohydrate xenoantigens. Computer-simulated modeling suggests that the CDR3 region directly influences binding. Conclusion Xenoantibodies induced during early and delayed xenograft responses are predominantly encoded by genes in the VH3 family, with a small proportion encoded by VH4 germline progenitors. This restricted group can be identified by the unique canonical structure of the light chain, heavy
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
International Nuclear Information System (INIS)
Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.
1988-01-01
Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)
Li, Jiaojiao; Mandal, Goutam; Rosen, Barry P
2016-06-01
The response of the obligate anaerobe Bacteroides vulgatus ATCC 8482, a common human gut microbiota, to arsenic was determined. B. vulgatus ATCC 8482 is highly resistant to pentavalent As(V) and methylarsenate (MAs(V)). It is somewhat more sensitive to trivalent inorganic As(III) but 100-fold more sensitive to methylarsenite (MAs(III)) than to As(III). B. vulgatus ATCC 8482 has eight continuous genes in its genome that we demonstrate form an arsenical-inducible transcriptional unit. The first gene of this ars operon, arsR, encodes a putative ArsR As(III)-responsive transcriptional repressor. The next three genes encode proteins of unknown function. The remaining genes, arsDABC, have well-characterized roles in detoxification of inorganic arsenic, but there are no known genes for MAs(III) resistance. Expression of each gene after exposure to trivalent and pentavalent inorganic and methylarsenicals was analyzed. MAs(III) was the most effective inducer. The arsD gene was the most highly expressed of the ars operon genes. These results demonstrate that this anaerobic microbiome bacterium has arsenic-responsive genes that confer resistance to inorganic arsenic and may be responsible for the organism's ability to maintain its prevalence in the gut following dietary exposure to inorganic arsenic. Copyright © 2016 Elsevier Ltd. All rights reserved.
Induction of protective immune responses in mice by double DNA ...
African Journals Online (AJOL)
Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...
International Nuclear Information System (INIS)
Nakamori, Taizo; Fujimori, Akira; Kinoshita, Keiji; Ban-nai, Tadaaki; Kubota, Yoshihisa; Yoshida, Satoshi
2010-01-01
The gene expression of environmental organisms is useful as a biomarker of environmental pollution. One of its advantages is high sensitivity. We identified the cDNA of a novel cadmium-responsive gene in the soil collembolan Folsomia candida. The deduced protein, designated 'metallothionein-like motif containing protein' (MTC), was cysteine-rich and contained a metallothionein-like motif with similarity to metallothionein, but had a much longer sequence than metallothionein and contained repeated sequences of amino acids. Expression of MTC mRNA was sensitively induced by cadmium exposure at 0.3 mg/kg of dry food, a concentration at which toxic effects are not observed, but expression was not affected by γ-ray exposure (an inducer of oxidative stress). These findings suggest that MTC is involved in cadmium-binding processes rather than in oxidative-stress responses. In conclusion, we suggest that gene expression of MTC may be a candidate biomarker for detecting low levels of cadmium contamination in soil. - The mRNA expression of a gene potentially encoding a metallothionein-like motif containing protein is sensitively induced by cadmium exposure in the soil collembolan Folsomia candida.
Energy Technology Data Exchange (ETDEWEB)
Nakamori, Taizo, E-mail: taizo@ynu.ac.j [Environmental Radiation Effects Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Fujimori, Akira [Heavy-Ion Radiobiology Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kinoshita, Keiji [Nagoya University Avian Bioscience Research Centre, Graduate School of Bioagricultural Sciences, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Ban-nai, Tadaaki; Kubota, Yoshihisa; Yoshida, Satoshi [Environmental Radiation Effects Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)
2010-05-15
The gene expression of environmental organisms is useful as a biomarker of environmental pollution. One of its advantages is high sensitivity. We identified the cDNA of a novel cadmium-responsive gene in the soil collembolan Folsomia candida. The deduced protein, designated 'metallothionein-like motif containing protein' (MTC), was cysteine-rich and contained a metallothionein-like motif with similarity to metallothionein, but had a much longer sequence than metallothionein and contained repeated sequences of amino acids. Expression of MTC mRNA was sensitively induced by cadmium exposure at 0.3 mg/kg of dry food, a concentration at which toxic effects are not observed, but expression was not affected by gamma-ray exposure (an inducer of oxidative stress). These findings suggest that MTC is involved in cadmium-binding processes rather than in oxidative-stress responses. In conclusion, we suggest that gene expression of MTC may be a candidate biomarker for detecting low levels of cadmium contamination in soil. - The mRNA expression of a gene potentially encoding a metallothionein-like motif containing protein is sensitively induced by cadmium exposure in the soil collembolan Folsomia candida.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
Development of a radiation-responsive gene expression system
International Nuclear Information System (INIS)
Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko
2013-01-01
We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Sánchez Timm, Eduardo; Hidalgo Pardo, Lisette; Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to Black Sigatoka
Directory of Open Access Journals (Sweden)
Eduardo Sánchez Timm
Full Text Available Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Lo, Miranda; Murray, Gerald L; Khoo, Chen Ai; Haake, David A; Zuerner, Richard L; Adler, Ben
2010-11-01
Leptospirosis is a globally significant zoonosis caused by Leptospira spp. Iron is essential for growth of most bacterial species. Since iron availability is low in the host, pathogens have evolved complex iron acquisition mechanisms to survive and establish infection. In many bacteria, expression of iron uptake and storage proteins is regulated by Fur. L. interrogans encodes four predicted Fur homologs; we have constructed a mutation in one of these, la1857. We conducted microarray analysis to identify iron-responsive genes and to study the effects of la1857 mutation on gene expression. Under iron-limiting conditions, 43 genes were upregulated and 49 genes were downregulated in the wild type. Genes encoding proteins with predicted involvement in inorganic ion transport and metabolism (including TonB-dependent proteins and outer membrane transport proteins) were overrepresented in the upregulated list, while 54% of differentially expressed genes had no known function. There were 16 upregulated genes of unknown function which are absent from the saprophyte L. biflexa and which therefore may encode virulence-associated factors. Expression of iron-responsive genes was not significantly affected by mutagenesis of la1857, indicating that LA1857 is not a global regulator of iron homeostasis. Upregulation of heme biosynthetic genes and a putative catalase in the mutant suggested that LA1857 is more similar to PerR, a regulator of the oxidative stress response. Indeed, the la1857 mutant was more resistant to peroxide stress than the wild type. Our results provide insights into the role of iron in leptospiral metabolism and regulation of the oxidative stress response, including genes likely to be important for virulence.
Systems-level analysis of risk genes reveals the modular nature of schizophrenia.
Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing
2018-05-19
Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Zhang, Haokun; Kiuchi, Takashi; Wang, Lingyan; Kawamoto, Munetaka; Suzuki, Yutaka; Sugano, Sumio; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru
2017-09-20
"Tanaka's mottled translucent" (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3' end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Cloning and expression of calmodulin gene in Scoparia dulcis.
Saitoh, Daisuke; Asakura, Yuki; Nkembo, Marguerite Kasidimoko; Shite, Masato; Sugiyama, Ryuji; Lee, Jung-Bum; Hayashi, Toshimitsu; Kurosaki, Fumiya
2007-06-01
A homology-based cloning strategy yielded a cDNA clone, designated Sd-cam, encoding calmodulin protein from Scoparia dulcis. The restriction digests of genomic DNA of S. dulcis showed a single hybridized signal when probed with the fragment of this gene in Southern blot analyses, suggesting that Sd-cam occurs as a sole gene encoding calmodulin in the plant. The reverse-transcription polymerase chain reaction analysis revealed that Sd-cam was appreciably expressed in leaf, root and stem tissues. It appeared that transcription of this gene increased transiently when the leaf cultures of S. dulcis were treated with methyl jasmonate and calcium ionophore A23187. These results suggest that transcriptional activation of Sd-cam is one of the early cellular events of the methyl jasmonate-induced responses of S. dulcis.
Startle responses in hereditary hyperekplexia
Tijssen, M. A.; Voorkamp, L. M.; Padberg, G. W.; van Dijk, J. G.
1997-01-01
BACKGROUND: Patients with hereditary hyperekplexia have excessive startle responses that are accompanied by transient stiffness and also continuous stiffness in infancy. A point of mutation has been identified for the major form of hereditary hyperekplexia in the gene encoding the alpha 1 subunit of
Startle responses in hereditary hyperekplexia
Tijssen, MAJ; Voorkamp, LM; Padberg, GW; vanDijk, JG
Background: Patients with hereditary hyperekplexia have excessive startle responses that are accompanied by transient stiffness and also continuous stiffness in infancy. A point of mutation has been identified for the major form of hereditary hyperekplexia in the gene encoding the alpha 1 subunit of
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Electrotransfer parameters as a tool for controlled and targeted gene expression in skin
Directory of Open Access Journals (Sweden)
Spela Kos
2016-01-01
Full Text Available Skin is an attractive target for gene electrotransfer. It consists of different cell types that can be transfected, leading to various responses to gene electrotransfer. We demonstrate that these responses could be controlled by selecting the appropriate electrotransfer parameters. Specifically, the application of low or high electric pulses, applied by multi-electrode array, provided the possibility to control the depth of the transfection in the skin, the duration and the level of gene expression, as well as the local or systemic distribution of the transgene. The influence of electric pulse type was first studied using a plasmid encoding a reporter gene (DsRed. Then, plasmids encoding therapeutic genes (IL-12, shRNA against endoglin, shRNA against melanoma cell adhesion molecule were used, and their effects on wound healing and cutaneous B16F10 melanoma tumors were investigated. The high-voltage pulses resulted in gene expression that was restricted to superficial skin layers and induced a local response. In contrast, the low-voltage electric pulses promoted transfection into the deeper skin layers, resulting in prolonged gene expression and higher transgene production, possibly with systemic distribution. Therefore, in the translation into the clinics, it will be of the utmost importance to adjust the electrotransfer parameters for different therapeutic approaches and specific mode of action of the therapeutic gene.
Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative
Energy Technology Data Exchange (ETDEWEB)
Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka; Pigli, Ying Z.; Boyle-Vavra, Susan; Rice , Phoebe A. (UC)
2016-08-29
Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-family replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.
Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin
2013-07-01
A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Response of Methicillin-Resistant Staphylococcus aureus to Amicoumacin A
Lama, Amrita; Pané-Farré, Jan; Chon, Tai; Wiersma, Anna M.; Sit, Clarissa S.; Vederas, John C.; Hecker, Michael; Nakano, Michiko M.
2012-01-01
Amicoumacin A exhibits strong antimicrobial activity against methicillin-resistant Staphylococcus aureus (MRSA), hence we sought to uncover its mechanism of action. Genome-wide transcriptome analysis of S. aureus COL in response to amicoumacin A showed alteration in transcription of genes specifying several cellular processes including cell envelope turnover, cross-membrane transport, virulence, metabolism, and general stress response. The most highly induced gene was lrgA, encoding an antiho...
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine
2017-12-01
Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.
Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K
2015-04-01
Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a
Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance
Ensminger, Stephan M.; Spriewald, Bernd M.
2012-01-01
Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H
1994-09-15
The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.
Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata
2017-07-01
Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
Energy Technology Data Exchange (ETDEWEB)
Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.
2010-03-18
The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Characterization of the largest effector gene cluster of Ustilago maydis.
Directory of Open Access Journals (Sweden)
Thomas Brefort
2014-07-01
Full Text Available In the genome of the biotrophic plant pathogen Ustilago maydis, many of the genes coding for secreted protein effectors modulating virulence are arranged in gene clusters. The vast majority of these genes encode novel proteins whose expression is coupled to plant colonization. The largest of these gene clusters, cluster 19A, encodes 24 secreted effectors. Deletion of the entire cluster results in severe attenuation of virulence. Here we present the functional analysis of this genomic region. We show that a 19A deletion mutant behaves like an endophyte, i.e. is still able to colonize plants and complete the infection cycle. However, tumors, the most conspicuous symptoms of maize smut disease, are only rarely formed and fungal biomass in infected tissue is significantly reduced. The generation and analysis of strains carrying sub-deletions identified several genes significantly contributing to tumor formation after seedling infection. Another of the effectors could be linked specifically to anthocyanin induction in the infected tissue. As the individual contributions of these genes to tumor formation were small, we studied the response of maize plants to the whole cluster mutant as well as to several individual mutants by array analysis. This revealed distinct plant responses, demonstrating that the respective effectors have discrete plant targets. We propose that the analysis of plant responses to effector mutant strains that lack a strong virulence phenotype may be a general way to visualize differences in effector function.
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
Isolation of a novel abscisic acid stress ripening ( OsASR ) gene ...
African Journals Online (AJOL)
Isolation of a novel abscisic acid stress ripening ( OsASR ) gene from rice and analysis of the response of this gene to abiotic stresses. ... The cDNA with the whole open reading frame (ORF) was amplified by PCR and cloned. Sequence analysis showed that the cDNA encodes a protein of 284 amino acid residues with ...
Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip
2009-05-01
Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.
Argyris, Jason; Truco, María José; Ochoa, Oswaldo; McHale, Leah; Dahal, Peetambar; Van Deynze, Allen; Michelmore, Richard W; Bradford, Kent J
2011-01-01
Thermoinhibition, or failure of seeds to germinate when imbibed at warm temperatures, can be a significant problem in lettuce (Lactuca sativa L.) production. The reliability of stand establishment would be improved by increasing the ability of lettuce seeds to germinate at high temperatures. Genes encoding germination- or dormancy-related proteins were mapped in a recombinant inbred line population derived from a cross between L. sativa cv. Salinas and L. serriola accession UC96US23. This revealed several candidate genes that are located in the genomic regions containing quantitative trait loci (QTLs) associated with temperature and light requirements for germination. In particular, LsNCED4, a temperature-regulated gene in the biosynthetic pathway for abscisic acid (ABA), a germination inhibitor, mapped to the center of a previously detected QTL for high temperature germination (Htg6.1) from UC96US23. Three sets of sister BC(3)S(2) near-isogenic lines (NILs) that were homozygous for the UC96US23 allele of LsNCED4 at Htg6.1 were developed by backcrossing to cv. Salinas and marker-assisted selection followed by selfing. The maximum temperature for germination of NIL seed lots with the UC96US23 allele at LsNCED4 was increased by 2-3°C when compared with sister NIL seed lots lacking the introgression. In addition, the expression of LsNCED4 was two- to threefold lower in the former NIL lines as compared to expression in the latter. Together, these data strongly implicate LsNCED4 as the candidate gene responsible for the Htg6.1 phenotype and indicate that decreased ABA biosynthesis at high imbibition temperatures is a major factor responsible for the increased germination thermotolerance of UC96US23 seeds.
Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier
2006-01-01
NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new
Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans
Directory of Open Access Journals (Sweden)
Chen Xu
2016-09-01
Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
Directory of Open Access Journals (Sweden)
Andrea D McCue
2012-02-01
Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
Host genetic variation influences gene expression response to rhinovirus infection.
Directory of Open Access Journals (Sweden)
Minal Çalışkan
2015-04-01
Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.