WorldWideScience

Sample records for response gene activity

  1. T-cell activation and early gene response in dogs.

    Directory of Open Access Journals (Sweden)

    Sally-Anne Mortlock

    Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in

  2. Ultrasound-responsive gene-activated matrices for osteogenic gene therapy using matrix-assisted sonoporation.

    Science.gov (United States)

    Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P

    2018-01-01

    Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  3. Phenylalanine ammonia-lyase (PAL) gene activity in response to ...

    African Journals Online (AJOL)

    Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...

  4. Rapid and preferential activation of the c-jun gene during the mammalian UV response

    International Nuclear Information System (INIS)

    Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.

    1991-01-01

    Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase

  5. Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

    Science.gov (United States)

    Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

    2013-01-01

    After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

  6. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  7. Influence of the gene xthA in the activation of SOS response of Escherichia coli

    International Nuclear Information System (INIS)

    Dominguez M, V.

    2013-01-01

    The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)

  8. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    Science.gov (United States)

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  9. Nerve Growth Factor Gene Therapy: Activation of Neuronal Responses in Alzheimer Disease.

    Science.gov (United States)

    Tuszynski, Mark H; Yang, Jennifer H; Barba, David; U, Hoi-Sang; Bakay, Roy A E; Pay, Mary M; Masliah, Eliezer; Conner, James M; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H

    2015-10-01

    Alzheimer disease (AD) is the most common neurodegenerative disorder and lacks effective disease-modifying therapies. In 2001, we initiated a clinical trial of nerve growth factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in patients with AD. We present postmortem findings in 10 patients with survival times ranging from 1 to 10 years after treatment. To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. Patients in this anatomicopathological study were enrolled in clinical trials from March 2001 to October 2012 at the University of California, San Diego, Medical Center in La Jolla. Ten patients with early AD underwent NGF gene therapy using ex vivo or in vivo gene transfer. The brains of all 8 patients in the first phase 1 ex vivo trial and of 2 patients in a subsequent phase 1 in vivo trial were examined. Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In 2 patients, NGF protein levels were measured by enzyme-linked immunosorbent assay. Among 10 patients, degenerating neurons in the AD brain responded to NGF. All patients exhibited a trophic response to NGF in the form of axonal sprouting toward the NGF source. Comparing treated and nontreated sides of the brain in 3 patients who underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P < .05). Activation of cellular signaling and functional markers was present in 2 patients who underwent adeno-associated viral vectors (serotype 2)-mediated NGF gene transfer. Neurons exhibiting tau pathology and neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic

  10. Trichomonas vaginalis Cysteine Proteinases: Iron Response in Gene Expression and Proteolytic Activity

    Science.gov (United States)

    Cárdenas-Guerra, Rosa Elena; Figueroa-Angulo, Elisa Elvira; Puente-Rivera, Jonathan; Zamudio-Prieto, Olga; Ortega-López, Jaime

    2015-01-01

    We focus on the iron response of Trichomonas vaginalis to gene family products such as the cysteine proteinases (CPs) involved in virulence properties. In particular, we examined the effect of iron on the gene expression regulation and function of cathepsin L-like and asparaginyl endopeptidase-like CPs as virulence factors. We addressed some important aspects about CPs genomic organization and we offer possible explanations to the fact that only few members of this large gene family are expressed at the RNA and protein levels and the way to control their proteolytic activity. We also summarized all known iron regulations of CPs at transcriptional, posttranscriptional, and posttranslational levels along with new insights into the possible epigenetic and miRNA processes. PMID:26090464

  11. Nerve Growth Factor Gene Therapy Activates Neuronal Responses in Alzheimer’s Disease

    Science.gov (United States)

    Tuszynski, Mark H.; Yang, Jennifer H.; Barba, David; U, H S.; Bakay, Roy; Pay, Mary M.; Masliah, Eliezer; Conner, James M.; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H.

    2016-01-01

    IMPORTANCE Alzheimer’s disease (AD) is the most common neurodegenerative disorder, and lacks effective disease modifying therapies. In 2001 we initiated a clinical trial of Nerve Growth Factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in AD patients. We present post-mortem findings in 10 subjects with survival times ranging from 1 to 10 years post-treatment. OBJECTIVE To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. DESIGN, SETTING, AND PARTICIPANTS 10 patients with early AD underwent NGF gene therapy using either ex vivo or in vivo gene transfer. The brains of all eight patients in the first Phase 1 ex vivo trial and two patients in a subsequent Phase 1 in vivo trial were examined. MAIN OUTCOME MEASURES Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In two cases, NGF protein levels were measured by ELISA. RESULTS Degenerating neurons in the AD brain respond to NGF. All patients exhibited a trophic response to NGF, in the form of axonal sprouting toward the NGF source. Comparing treated and non-treated sides of the brain in three patients that underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P>0.05). Activation of cellular signaling and functional markers were present in two patients that underwent AAV2-mediated NGF gene transfer. Neurons exhibiting tau pathology as well as neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic genes with resulting activation of cell signaling. No adverse pathological effects related to NGF were observed. CONCLUSIONS AND RELEVANCE These findings indicate that

  12. Occupational Styrene Exposure Induces Stress-Responsive Genes Involved in Cytoprotective and Cytotoxic Activities

    Science.gov (United States)

    Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory

    2013-01-01

    Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524

  13. Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.

    Directory of Open Access Journals (Sweden)

    Idit Hazan

    2016-12-01

    Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.

  14. Digital quantification of gene expression in sequential breast cancer biopsies reveals activation of an immune response.

    Directory of Open Access Journals (Sweden)

    Rinath M Jeselsohn

    Full Text Available Advancements in molecular biology have unveiled multiple breast cancer promoting pathways and potential therapeutic targets. Large randomized clinical trials remain the ultimate means of validating therapeutic efficacy, but they require large cohorts of patients and are lengthy and costly. A useful approach is to conduct a window of opportunity study in which patients are exposed to a drug pre-surgically during the interval between the core needle biopsy and the definitive surgery. These are non-therapeutic studies and the end point is not clinical or pathological response but rather evaluation of molecular changes in the tumor specimens that can predict response. However, since the end points of the non-therapeutic studies are biologic, it is critical to first define the biologic changes that occur in the absence of treatment. In this study, we compared the molecular profiles of breast cancer tumors at the time of the diagnostic biopsy versus the definitive surgery in the absence of any intervention using the Nanostring nCounter platform. We found that while the majority of the transcripts did not vary between the two biopsies, there was evidence of activation of immune related genes in response to the first biopsy and further investigations of the immune changes after a biopsy in early breast cancer seem warranted.

  15. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  16. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    OpenAIRE

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-01-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...

  17. Reporter gene assay for the quantification of the activity and neutralizing antibody response to TNFα antagonists

    DEFF Research Database (Denmark)

    Lallemand, Christophe; Kavrochorianou, Nadia; Steenholdt, Casper

    2011-01-01

    A cell-based assay has been developed for the quantification of the activity of TNFα antagonists based on human erythroleukemic K562 cells transfected with a NFκB regulated firefly luciferase reporter-gene construct. Both drug activity and anti-drug neutralizing antibodies can be quantified...... with a high degree of precision within 2h, and without interference from cytokines and other factors known to activate NFκB. The assay cells also contain the Renilla luciferase reporter gene under the control of a constitutive promoter that allows TNFα-induced firefly luciferase activity to be normalized...... relative to Renilla luciferase expression. Thus, results are independent of cell number or differences in cell viability, resulting in intra and inter assay coefficients of variation of 10% or less. Normalization of results relative to the expression of an internal standard also provides a means...

  18. Integrating circadian activity and gene expression profiles to predict chronotoxicity of Drosophila suzukii response to insecticides.

    Science.gov (United States)

    Hamby, Kelly A; Kwok, Rosanna S; Zalom, Frank G; Chiu, Joanna C

    2013-01-01

    Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between 'summer' and 'winter' conditions due to differences in photoperiod and temperature. In the 'summer', D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the 'winter', activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing

  19. E2F1 activation is responsible for pituitary adenomas induced by HMGA2 gene overexpression

    Directory of Open Access Journals (Sweden)

    Fusco Alfredo

    2006-08-01

    Full Text Available Abstract The High Mobility Group protein HMGA2 is a nuclear architectural factor that plays a critical role in a wide range of biological processes including regulation of gene expression, embryogenesis and neoplastic transformation. Several studies are trying to identify the mechanisms by which HMGA2 protein is involved in each of these activities, and only recently some new significant insights are emerging from the study of transgenic and knock-out mice. Overexpression of HMGA2 gene leads to the onset of prolactin and GH-hormone induced pituitary adenomas in mice, suggesting a critical role of this protein in pituitary tumorigenesis. This was also confirmed in the human pathology by the finding that HMGA2 amplification and/or overexpression is present in human prolactinomas. This review focuses on recent data that explain the mechanism by which HMGA2 induces the development of pituitary adenomas in mice. This mechanism entails the activation of the E2F1 protein by the HMGA2-mediated displacement of HDAC1 from pRB protein.

  20. Activation of Innate Immune-Response Genes in Little Brown Bats (Myotis lucifugus) Infected with the Fungus Pseudogymnoascus destructans

    Science.gov (United States)

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M.; Bollinger, Trent K.; Willis, Craig K. R.; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  1. Activation of innate immune-response genes in little brown bats (Myotis lucifugus infected with the fungus Pseudogymnoascus destructans.

    Directory of Open Access Journals (Sweden)

    Noreen Rapin

    Full Text Available Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  2. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.

    Science.gov (United States)

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  3. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    Science.gov (United States)

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  4. Hypoxic activation of the unfolded protein response (UPR) induces expression of the metastasis-associated gene LAMP3

    International Nuclear Information System (INIS)

    Mujcic, Hilda; Rzymski, Tomasz; Rouschop, Kasper M.A.; Koritzinsky, Marianne; Milani, Manuela; Harris, Adrian L.; Wouters, Bradly G.

    2009-01-01

    Background and purpose: Tumour hypoxia contributes to failure of cancer treatment through its ability to protect against therapy and adversely influence tumour biology. In particular, several studies suggest that hypoxia promotes metastasis. Hypoxia-induced cellular changes are mediated by oxygen-sensitive signaling pathways that activate downstream transcription factors. We have investigated the induction and transcriptional regulation of a novel metastasis-associated gene, LAMP3 during hypoxia. Materials and methods: Microarray, quantitative PCR, Western blot analysis and immunohistochemistry were used to investigate hypoxic regulation of LAMP3. The mechanism for LAMP3 induction was investigated using transient RNAi and stable shRNA targeting components of the hypoxic response. Endoplasmic reticulum stress inducing agents, including proteasome inhibitors were assessed for their ability to regulate LAMP3. Results: LAMP3 is strongly induced by hypoxia at both the mRNA and protein levels in a large panel of human tumour cell lines. Induction of LAMP3 occurs as a consequence of the activation of the PERK/eIF2α/ATF4 arm of the unfolded protein response (UPR) and is independent of HIF-1α. LAMP3 is expressed heterogeneously within the microenvironment of tumours, overexpressed in breast cancer, and increases in tumours treated with avastin. Conclusions: These data identify LAMP3 as a novel hypoxia-inducible gene regulated by the UPR. LAMP3 is a new candidate biomarker of UPR activation by hypoxia in tumours and is a potential mediator of hypoxia-induced metastasis.

  5. RNA-seq analysis of clinical-grade osteochondral allografts reveals activation of early response genes

    NARCIS (Netherlands)

    Lin, Yang; Lewallen, Eric A.; Camilleri, Emily T.; Bonin, Carolina A.; Jones, Dakota L.; Dudakovic, Amel; Galeano-Garces, Catalina; Wang, Wei; Karperien, Marcel J.; Larson, Annalise N.; Dahm, Diane L.; Stuart, Michael J.; Levy, Bruce A.; Smith, Jay; Ryssman, Daniel B.; Westendorf, Jennifer J.; Im, Hee-Jeong; van Wijnen, Andre J.; Riester, Scott M.; Krych, Aaron J.

    2016-01-01

    Preservation of osteochondral allografts used for transplantation is critical to ensure favorable outcomes for patients after surgical treatment of cartilage defects. To study the biological effects of protocols currently used for cartilage storage, we investigated differences in gene expression

  6. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  7. Apoptotic activity and gene responses in Drosophila melanogaster S2 cells, induced by azadirachtin A.

    Science.gov (United States)

    Xu, Lin; Li, Sheng; Ran, Xueqin; Liu, Chang; Lin, Rutao; Wang, Jiafu

    2016-09-01

    Azadirachtin has been used as an antifeedant and growth disruption agent for many insect species. Previous investigations have reported the apoptotic effects of azadirachtin on some insect cells, but the molecular mechanisms are still not clear. This study investigated the underlying molecular mechanisms for the apoptotic effects induced by azadirachtin on Drosophila melanogaster S2 cells in vitro. The results of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay demonstrated that azadirachtin exhibited significant cytotoxicity to S2 cells in a time- and dose-dependent manner. The changes in cellular morphology and the DNA fragmentation demonstrated that azadirachtin induced remarkable apoptosis of S2 cells. Expression levels of 276 genes were found to be significantly changed in S2 cells after exposure to azadirachtin, as detected by Drosophila genome array. Among these genes, calmodulin (CaM) was the most highly upregulated gene. Azadirachtin was further demonstrated to trigger intracellular Ca(2+) release in S2 cells. The genes related to the apoptosis pathway, determined from chip data, were validated by the real-time quantitative polymerase chain reaction method. The results showed that azadirachtin-mediated intracellular Ca(2+) release was the primary event that triggered apoptosis in Drosophila S2 cells through both pathways of the Ca(2+) -CaM and EcR/Usp signalling cascade. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  8. Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes.

    Science.gov (United States)

    Kenyon, Amy; Gavriouchkina, Daria; Zorman, Jernej; Chong-Morrison, Vanessa; Napolitani, Giorgio; Cerundolo, Vincenzo; Sauka-Spengler, Tatjana

    2018-04-06

    A complex network of inflammatory genes is closely linked to somatic cell transformation and malignant disease. Immune cells and their associated molecules are responsible for detecting and eliminating cancer cells as they establish themselves as the precursors of a tumour. By the time a patient has a detectable solid tumour, cancer cells have escaped the initial immune response mechanisms. Here, we describe the development of a double binary zebrafish model that enables regulatory programming of the myeloid cells as they respond to oncogene-activated melanocytes to be explored, focussing on the initial phase when cells become the precursors of cancer. A hormone-inducible binary system allows for temporal control of expression of different Ras oncogenes ( NRas Q61K , HRas G12V and KRas G12V ) in melanocytes, leading to proliferation and changes in morphology of the melanocytes. This model was coupled to binary cell-specific biotagging models allowing in vivo biotinylation and subsequent isolation of macrophage or neutrophil nuclei for regulatory profiling of their active transcriptomes. Nuclear transcriptional profiling of neutrophils, performed as they respond to the earliest precursors of melanoma in vivo , revealed an intricate landscape of regulatory factors that may promote progression to melanoma, including Serpinb1l4, Fgf1, Fgf6, Cathepsin H, Galectin 1 and Galectin 3. The model presented here provides a powerful platform to study the myeloid response to the earliest precursors of melanoma. © 2018. Published by The Company of Biologists Ltd.

  9. Gene expression based evidence of innate immune response activation in the epithelium with oral lichen planus

    Science.gov (United States)

    Adami, Guy R.; Yeung, Alexander C.F.; Stucki, Grant; Kolokythas, Antonia; Sroussi, Herve Y.; Cabay, Robert J.; Kuzin, Igor; Schwartz, Joel L.

    2014-01-01

    Objective Oral lichen planus (OLP) is a disease of the oral mucosa of unknown cause producing lesions with an intense band-like inflammatory infiltrate of T cells to the subepithelium and keratinocyte cell death. We performed gene expression analysis of the oral epithelium of lesions in subjects with OLP and its sister disease, oral lichenoid reaction (OLR), in order to better understand the role of the keratinocytes in these diseases. Design Fourteen patients with OLP or OLR were included in the study, along with a control group of 23 subjects with a variety of oral diseases and a normal group of 17 subjects with no clinically visible mucosal abnormalities. Various proteins have been associated with OLP, based on detection of secreted proteins or changes in RNA levels in tissue samples consisting of epithelium, stroma, and immune cells. The mRNA level of twelve of these genes expressed in the epithelium was tested in the three groups. Results Four genes showed increased expression in the epithelium of OLP patients: CD14, CXCL1, IL8, and TLR1, and at least two of these proteins, TLR1 and CXCL1, were expressed at substantial levels in oral keratinocytes. Conclusions Because of the large accumulation of T cells in lesions of OLP it has long been thought to be an adaptive immunity malfunction. We provide evidence that there is increased expression of innate immune genes in the epithelium with this illness, suggesting a role for this process in the disease and a possible target for treatment. PMID:24581860

  10. Do dopaminergic gene polymorphisms affect mesolimbic reward activation of music listening response? Therapeutic impact on Reward Deficiency Syndrome (RDS).

    Science.gov (United States)

    Blum, Kenneth; Chen, Thomas J H; Chen, Amanda L H; Madigan, Margaret; Downs, B William; Waite, Roger L; Braverman, Eric R; Kerner, Mallory; Bowirrat, Abdalla; Giordano, John; Henshaw, Harry; Gold, Mark S

    2010-03-01

    Using fMRI, Menon and Levitin [9] clearly found for the first time that listening to music strongly modulates activity in a network of mesolimbic structures involved in reward processing including the nucleus accumbens (NAc) and the ventral tegmental area (VTA), as well as the hypothalamus, and insula, which are thought to be involved in regulating autonomic and physiological responses to rewarding and emotional stimuli. Importantly, responses in the NAc and VTA were strongly correlated pointing to an association between dopamine release and NAc response to music. Listing to pleasant music induced a strong response and significant activation of the VTA-mediated interaction of the NAc with the hypothalamus, insula, and orbitofrontal cortex. Blum et al. [10] provided the first evidence that the dopamine D2 receptor gene (DRD2) Taq 1 A1 allele significantly associated with severe alcoholism whereby the author's suggested that they found the first "reward gene" located in the mesolimbic system. The enhanced functional and effective connectivity between brain regions mediating reward, autonomic, and cognitive processing provides insight into understanding why listening to music is one of the most rewarding and pleasurable human experiences. However, little is known about why some people have a more or less powerful mesolimbic experience when they are listening to music. It is well-known that music may induce an endorphinergic response that is blocked by naloxone, a known opioid antagonist (Goldstein [19]). Opioid transmission in the NAc is associated with dopamine release in the VTA. Moreover, dopamine release in the VTA is linked to polymorphisms of the DRD2 gene and even attention-deficit hyperactivity disorder (ADHD), whereby carriers of the DRD2 A1 allele show a reduced NAc release of dopamine (DA). Thus it is conjectured that similar mechanisms in terms of adequate dopamine release and subsequent activation of reward circuitry by listening to music might also be

  11. Upregulated ATM gene expression and activated DNA crosslink-induced damage response checkpoint in Fanconi anemia: implications for carcinogenesis.

    Science.gov (United States)

    Yamamoto, Kazuhiko; Nihrane, Abdallah; Aglipay, Jason; Sironi, Juan; Arkin, Steven; Lipton, Jeffrey M; Ouchi, Toru; Liu, Johnson M

    2008-01-01

    Fanconi anemia (FA) predisposes to hematopoietic failure, birth defects, leukemia, and squamous cell carcinoma of the head and neck (HNSCC) and cervix. The FA/BRCA pathway includes 8 members of a core complex and 5 downstream gene products closely linked with BRCA1 or BRCA2. Precancerous lesions are believed to trigger the DNA damage response (DDR), and we focused on the DDR in FA and its putative role as a checkpoint barrier to cancer. In primary fibroblasts with mutations in the core complex FANCA protein, we discovered that basal expression and phosphorylation of ATM (ataxia telangiectasia mutated) and p53 induced by irradiation (IR) or mitomycin C (MMC) were upregulated. This heightened response appeared to be due to increased basal levels of ATM in cultured FANCA-mutant cells, highlighting the new observation that ATM can be regulated at the transcriptional level in addition to its well-established activation by autophosphorylation. Functional analysis of this response using gamma-H2AX foci as markers of DNA double-stranded breaks (DSBs) demonstrated abnormal persistence of only MMC- and not IR-induced foci. Thus, we describe a processing defect that leads to general DDR upregulation but specific persistence of DNA crosslinker-induced damage response foci. Underscoring the significance of these findings, we found resistance to DNA crosslinker-induced cell cycle arrest and apoptosis in a TP53-mutant, patient-derived HNSCC cell line, whereas a lymphoblastoid cell line derived from this same individual was not mutated at TP53 and retained DNA crosslinker sensitivity. Our results suggest that cancer in FA may arise from selection for cells that escape from a chronically activated DDR checkpoint.

  12. Antibacterial activity and immune responses of a molluscan macrophage expressed gene-1 from disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Bathige, S D N K; Umasuthan, Navaneethaiyer; Whang, Ilson; Lim, Bong-Soo; Won, Seung Hwan; Lee, Jehee

    2014-08-01

    The membrane-attack complex/perforin (MACPF) domain-containing proteins play an important role in the innate immune response against invading microbial pathogens. In the current study, a member of the MACPF domain-containing proteins, macrophage expressed gene-1 (MPEG1) encoding 730 amino acids with the theoretical molecular mass of 79.6 kDa and an isoelectric point (pI) of 6.49 was characterized from disk abalone Haliotis discus discus (AbMPEG1). We found that the characteristic MACPF domain (Val(131)-Tyr(348)) and transmembrane segment (Ala(669)-Ile(691)) of AbMPEG1 are located in the N- and C-terminal ends of the protein, respectively. Ortholog comparison revealed that AbMPEG1 has the highest sequence identity with its pink abalone counterpart, while sequences identities of greater than 90% were observed with MPEG1 members from other abalone species. Likewise, the furin cleavage site KRRRK was highly conserved in all abalone species, but not in other species investigated. We identified an intron-less genomic sequence within disk abalone AbMPEG1, which was similar to other mammalian, avian, and reptilian counterparts. Transcription factor binding sites, which are important for immune responses, were identified in the 5'-flanking region of AbMPEG1. qPCR revealed AbMPEG1 transcripts are present in every tissues examined, with the highest expression level occurring in mantle tissue. Significant up-regulation of AbMPEG1 transcript levels was observed in hemocytes and gill tissues following challenges with pathogens (Vibrio parahemolyticus, Listeria monocytogenes and viral hemorrhagic septicemia virus) as well as pathogen-associated molecular patterns (PAMPs: lipopolysaccharides and poly I:C immunostimulant). Finally, the antibacterial activity of the MACPF domain was characterized against Gram-negative and -positive bacteria using a recombinant peptide. Taken together, these results indicate that the biological significance of the AbMPEG1 gene includes a role in

  13. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  14. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  15. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  16. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

    Science.gov (United States)

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi

    2017-01-29

    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  18. Alteration of Neurokinin B Gene Expression and Hypothalamic-Pituitary- Gonadal Axis in Response to One-month Regular Moderate Physical Activity

    Directory of Open Access Journals (Sweden)

    Nazli Khajehnasiri

    2017-08-01

    Full Text Available Abstract Background: The advantageous effects of the regular moderate physical activity (Exercise on reproduction is widely accepted, but until now, the alterations of the expression of hypothalamic arcuate nuclei gene affecting on reproduction axis in response to this type of physical activity are not clear. Therefore, the goal of the present investigation was to study the effect of one –month regular moderate physical activity on neurokinin B gene expression and reproductive axis hormonal changes. Materials and Methods: In the experimental study, fourteen adult male Wistar rats were randomly divided into control and one- month regular moderate exercise groups. After one - month physical activity (20m/min, the arcuate nucleus was isolated from brain and stored in -80 refrigerators for neurokinin B gene expression assay by Real-time PCR method. In addition, serum samples were taken to assess the corticosterone, luteinizing hormone and testosterone levels by ELISA method. Data were analyzed by Independent t-test in SPSS. Results: Neurokinin-B gene expression level was lower in the group which received physical activity than the control group(p<0.05. Also, corticosterone serum concentration was decreased in the physical activity group(p<0.05. By contrast, the physical activity induced luteinizing hormone and Testosterone serum levels evaluation in exersice group compared with control group (p<0.05. Conclusion: Regular moderate physical activity may improve male reproductive performance by reducing the corticosterone hormone level and decreasing neurokinin B expression.

  19. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  20. Affected pathways and transcriptional regulators in gene expression response to an ultra-marathon trail: Global and independent activity approaches.

    Directory of Open Access Journals (Sweden)

    Maria Maqueda

    Full Text Available Gene expression (GE analyses on blood samples from marathon and half-marathon runners have reported significant impacts on the immune and inflammatory systems. An ultra-marathon trail (UMT represents a greater effort due to its more testing conditions. For the first time, we report the genome-wide GE profiling in a group of 16 runners participating in an 82 km UMT competition. We quantified their differential GE profile before and after the race using HuGene2.0st microarrays (Affymetrix Inc., California, US. The results obtained were decomposed by means of an independent component analysis (ICA targeting independent expression modes. We observed significant differences in the expression levels of 5,084 protein coding genes resulting in an overrepresentation of 14% of the human biological pathways from the Kyoto Encyclopedia of Genes and Genomes database. These were mainly clustered on terms related with protein synthesis repression, altered immune system and infectious diseases related mechanisms. In a second analysis, 27 out of the 196 transcriptional regulators (TRs included in the Open Regulatory Annotation database were overrepresented. Among these TRs, we identified transcription factors from the hypoxia-inducible factors (HIF family EPAS1 (p< 0.01 and HIF1A (p<0.001, and others jointly described in the gluconeogenesis program such as HNF4 (p< 0.001, EGR1 (p<0.001, CEBPA (p< 0.001 and a highly specific TR, YY1 (p<0.01. The five independent components, obtained from ICA, further revealed a down-regulation of 10 genes distributed in the complex I, III and V from the electron transport chain. This mitochondrial activity reduction is compatible with HIF-1 system activation. The vascular endothelial growth factor (VEGF pathway, known to be regulated by HIF, also emerged (p<0.05. Additionally, and related to the brain rewarding circuit, the endocannabinoid signalling pathway was overrepresented (p<0.05.

  1. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  2. Deciphering the role of the signal- and Sty1 kinase-dependent phosphorylation of the stress-responsive transcription factor Atf1 on gene activation.

    Science.gov (United States)

    Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena

    2017-08-18

    Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Dynamic Response Genes in CD4+ T Cells Reveal a Network of Interactive Proteins that Classifies Disease Activity in Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Sandra Hellberg

    2016-09-01

    Full Text Available Multiple sclerosis (MS is a chronic inflammatory disease of the CNS and has a varying disease course as well as variable response to treatment. Biomarkers may therefore aid personalized treatment. We tested whether in vitro activation of MS patient-derived CD4+ T cells could reveal potential biomarkers. The dynamic gene expression response to activation was dysregulated in patient-derived CD4+ T cells. By integrating our findings with genome-wide association studies, we constructed a highly connected MS gene module, disclosing cell activation and chemotaxis as central components. Changes in several module genes were associated with differences in protein levels, which were measurable in cerebrospinal fluid and were used to classify patients from control individuals. In addition, these measurements could predict disease activity after 2 years and distinguish low and high responders to treatment in two additional, independent cohorts. While further validation is needed in larger cohorts prior to clinical implementation, we have uncovered a set of potentially promising biomarkers.

  4. D-Serine exposure resulted in gene expression changes indicative of activation of fibrogenic pathways and down-regulation of energy metabolism and oxidative stress response

    International Nuclear Information System (INIS)

    Soto, Armando; DelRaso, Nicholas J.; Schlager, John J.; Chan, Victor T.

    2008-01-01

    Renal toxicity can commonly occur after exposure to xenobiotics, pharmaceutical agents or environmental pollutants. Changes in the gene expression in kidney parenchymal cells that precede and/or accompany renal injury may be hallmark critical events in the onset of pathologic changes of renal functions. Over the last several years, transcriptomic analysis has evolved to enable simultaneous analysis of the expression profiles of tens of thousands of genes in response to various endogenous and exogenous stimuli. In this study, we investigated gene expression changes in the kidney after acute exposure to a nephrotoxin, D-serine, which targets the proximal tubule of the kidney. Male F-344 rats injected intraperitoneally with a single dose of D-serine (5, 20, 50, 200 or 500 mg/kg), and gene expression profiles in the kidney were determined using the Affymetrix RAE230A gene arrays at 96 h post-dosing. D-Serine treatment resulted in the up- and down-regulation of 1158 and 749 genes, respectively, over the entire dose range based on the intersection of the results of t-test, p < 0.01 over two consecutive doses, and ANOVA with Bonferonni correction for multiple testing. Interestingly, both the up-and down-regulated genes show a unified dose response pattern as revealed in the self-organized map clustering analysis using the expression profiles of the 1907 differentially expressed genes as input data. There appears to be minimal changes in the expression level of these genes in the dose range of 5-50 mg/kg, while the most prominent changes were observed at the highest doses tested, i.e. 200 and 500 mg/kg. Pathway analysis of the differentially expressed genes showed perturbation of a large number of biological processes/pathways after D-serine exposure. Among the up-regulated pathways are actin cytoskeleton biogenesis and organization, apoptosis, cell cycle regulation, chromatin assembly, excision repair of damaged DNA, DNA replication and packaging, protein biosynthesis

  5. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors.

    Science.gov (United States)

    Loboda, Andrey; Nebozhyn, Michael; Klinghoffer, Rich; Frazier, Jason; Chastain, Michael; Arthur, William; Roberts, Brian; Zhang, Theresa; Chenard, Melissa; Haines, Brian; Andersen, Jannik; Nagashima, Kumiko; Paweletz, Cloud; Lynch, Bethany; Feldman, Igor; Dai, Hongyue; Huang, Pearl; Watters, James

    2010-06-30

    Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90%) sensitivity but relatively low (50%) specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical utility in lung and breast tumors.

  6. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors

    Directory of Open Access Journals (Sweden)

    Paweletz Cloud

    2010-06-01

    Full Text Available Abstract Background Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. Methods We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. Results The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90% sensitivity but relatively low (50% specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. Conclusions These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical

  7. Transcriptional activation of LON Gene by a new form of mitochondrial stress: A role for the nuclear respiratory factor 2 in StAR overload response (SOR).

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2015-06-15

    High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Physical activity: genes & health

    CERN Multimedia

    2002-01-01

    Carl Johan SUNDBERG is an Associate Professor in Physiology and Licenced Physician. His research focus is Molecular mechanisms involved in the adaptation of human skeletal muscle to physical activity.

  9. Do Fanconi anemia genes control cell response to cross-linking agents by modulating cytochrome P-450 reductase activity?

    NARCIS (Netherlands)

    Kruyt, FAE; Youssoufian, H

    2000-01-01

    The Fanconi anemia (FA) genes play an important role in maintaining chromosomal stability and the defense of mammalian cells against cross-linking agents, such as cisplatin and mitomycin C (MMC). Cells derived from FA patients display a characteristic hypersensitivity toward cross-linking agents.

  10. dFOXO Activates Large and Small Heat Shock Protein Genes in Response to Oxidative Stress to Maintain Proteostasis in Drosophila.

    Science.gov (United States)

    Donovan, Marissa R; Marr, Michael T

    2016-09-02

    Maintaining protein homeostasis is critical for survival at the cellular and organismal level (Morimoto, R. I. (2011) Cold Spring Harb. Symp. Quant. Biol. 76, 91-99). Cells express a family of molecular chaperones, the heat shock proteins, during times of oxidative stress to protect against proteotoxicity. We have identified a second stress responsive transcription factor, dFOXO, that works alongside the heat shock transcription factor to activate transcription of both the small heat shock protein and the large heat shock protein genes. This expression likely protects cells from protein misfolding associated with oxidative stress. Here we identify the regions of the Hsp70 promoter essential for FOXO-dependent transcription using in vitro methods and find a physiological role for FOXO-dependent expression of heat shock proteins in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Liver-specific deletion of the signal transducer and activator of transcription 5 gene aggravates fatty liver in response to a high-fat diet in mice.

    Science.gov (United States)

    Baik, Myunggi; Nam, Yoon Seok; Piao, Min Yu; Kang, Hyeok Joong; Park, Seung Ju; Lee, Jae-Hyuk

    2016-03-01

    Growth hormone (GH) signal is mediated by signal transducer and activator of transcription 5 (STAT5), which controls hepatic lipid metabolism. Nonalcoholic fatty liver disease (NAFLD) is clinically associated with a deficiency in GH. This study was performed to understand the role of local STAT5 signaling on hepatic lipid and glucose metabolism utilizing liver-specific STAT5 gene deletion (STAT5 LKO) mice under both normal diet and high-fat diet (HFD) feeding conditions. STAT5 LKO induced hepatic steatosis under HFD feeding, while this change was not observed in mice on normal diet. STAT5 LKO caused hyperglycemia, hyperinsulinemia, hyperleptinemia and elevated free fatty acid and cholesterol concentrations under HFD feeding but induced only hyperglycemia on normal diet. At the molecular level, STAT5 LKO up-regulated the expression of genes involved in lipid uptake (CD36), very low-density lipoprotein receptor (VLDLR), lipogenic stearoyl-CoA desaturase and adipogenic peroxisome proliferator-activated receptor gamma, in both diet groups. In response to HFD feeding, further increases in CD36 and VLDLR expression were found in STAT5 LKO mice. In conclusion, our study suggests that low STAT5 signaling on normal diet predisposes STAT5 LKO mice to early development of fatty liver by hyperglycemia and activation of lipid uptake and adipogenesis. A deficiency in STAT5 signaling under HFD feeding deregulates hepatic and body glucose and lipid metabolism, leading to the development of hepatic steatosis. Our study indicates that low STAT5 signaling, due to low GH secretion, may increase a chance for NAFLD development in elderly people. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. ASSESSING VINCLOZOLIN FOR ANTIANDROGENIC ACTIVITY: A DOSE-RESPONSE STUDY OF GENE EXPRESSION IN THE RAT VENTRAL PROSTATE

    Science.gov (United States)

    The United States Environmental Protection Agency, along with agencies within the European Union, are currently evaluating in vitro and in vivo assays to detect compounds that display antiandrogenic orandrogenic activity. Thein vivo assay is based on weight changes in androgen d...

  13. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  14. Occupational exposure to 50 Hz magnetic fields does not alter responses of inflammatory genes and activation of splenic lymphocytes in mice

    Directory of Open Access Journals (Sweden)

    Xue Luo

    2016-04-01

    Full Text Available Objectives: The objective of the present study was to observe the effects of 50 Hz magnetic fields (MFs on the immune function of splenic lymphocytes in mice. Material and Methods: Twenty male Kunming mice (6 weeks old, weighing 18– 25 g, were randomly divided into sham exposure (N = 10 and 500 μT MFs (N = 10 groups. The mice in the MFs group were exposed to 500 μT MFs for 8 h daily (5 days/week for up to 60 days. In vitro study was carried out to examine the effects of 50 Hz MFs on the expression of inflammatory factor genes and a cluster of differentiation 69 (CD69 in mouse prime splenic lymphocytes activated by para-Methoxyamphetamine (PMA and ionomycin. In the in vitro experiments, lymphocytes were isolated from the spleen of 10 healthy Kunming mice, the cells were cultured in the Roswell Park Memorial Institute 1640 medium (RPMI-1640 and exposed to 0 μT, 250 μT, 500 μT, or 1 mT MFs in an incubator under 5% carbon dioxide (CO2 at 37°C for 6 h. The levels of interleukin-2 (IL-2, IL-4, interferon-gamma (IFN-γ, GATA binding protein 3 (GATA-3 and T cell-specific T-box transcription factor (T-bet were assessed by the real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR, respectively. The expression of CD69 was checked using the flow cytometry. Results: Under our experimental conditions, body weight of the mice exposed to occupational, extremely low frequency- electromagnetic fields (ELF-EMFs significantly decreased on day 20 and day 30. There were no significant changes observed in vivo in spleen weight, splenic coefficient, splenic histology profile and cytokine production in spleen tissues. Our in vitro experiments showed that 50 Hz MFs had no effect on the expression of these genes and CD69 to primary splenic cells. Conclusions: In conclusion, under the applied experimental conditions, occupational exposure to 50 Hz magnetic field did not alter responses of inflammatory genes and activation of splenic

  15. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  16. Radiation-induced gene responses

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Paunesku, T.; Shearin-Jones, P.; Oryhon, J.

    1996-01-01

    In the process of identifying genes that are differentially regulated in cells exposed to ultraviolet radiation (UV), we identified a transcript that was repressed following the exposure of cells to a combination of UV and salicylate, a known inhibitor of NF-kappaB. Sequencing this band determined that it has identify to lactate dehydrogenase, and Northern blots confirmed the initial expression pattern. Analysis of the sequence of the LDH 5' region established the presence of NF-kappaB, Sp1, and two Ap-2 elements; two partial AP- 1; one partial RE, and two halves of E-UV elements were also found. Electromobility shift assays were then performed for the AP-1, NF- kappaB, and E-UV elements. These experiments revealed that binding to NF-kappaB was induced by UV but repressed with salicylic acid; UV did not affect AP-1 binding, but salicylic acid inhibited it alone or following UV exposure; and E-UV binding was repressed by UV, and salicylic acid had little effect. Since the binding of no single element correlated with the expression pattern of LDH, it is likely that multiple elements govern UV/salicylate-mediated expression

  17. Development of a radiation-responsive gene expression system

    International Nuclear Information System (INIS)

    Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko

    2013-01-01

    We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)

  18. Host genetic variation influences gene expression response to rhinovirus infection.

    Directory of Open Access Journals (Sweden)

    Minal Çalışkan

    2015-04-01

    Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  19. Host genetic variation influences gene expression response to rhinovirus infection.

    Science.gov (United States)

    Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole

    2015-04-01

    Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  20. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    International Nuclear Information System (INIS)

    Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

    2013-01-01

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP 3 /calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation

  1. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    Energy Technology Data Exchange (ETDEWEB)

    Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  2. Influence of the gene xthA in the activation of SOS response of Escherichia coli; Influencia del gen xthA en la activacion de la respuesta SOS de Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez M, V.

    2013-07-01

    The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)

  3. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  4. Macrophage Expression of Inflammatory Genes in Response to EMCV Infection

    Directory of Open Access Journals (Sweden)

    Zachary R. Shaheen

    2015-08-01

    Full Text Available The expression and production of type 1 interferon is the classic cellular response to virus infection. In addition to this antiviral response, virus infection also stimulates the production of proinflammatory mediators. In this review, the pathways controlling the induction of inflammatory genes and the roles that these inflammatory mediators contribute to host defense against viral pathogens will be discussed. Specific focus will be on the role of the chemokine receptor CCR5, as a signaling receptor controlling the activation of pathways leading to virus-induced inflammatory gene expression.

  5. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  6. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  7. Activation of Tax protein by c-Jun-N-terminal kinase is not dependent on the presence or absence of the early growth response-1 gene product.

    Science.gov (United States)

    Parra, Eduardo; Gutierréz, Luís; Ferreira, Jorge

    2016-02-01

    The Tax protein of human T cell leukemia virus type 1 plays a major role in the pathogenesis of adult T cell leukemia (ATL), an aggressive neoplasia of CD4+ T cells. In the present study, we investigated whether the EGR-1 pathway is involved in the regulation of Tax-induced JNK expression in human Jurkat T cells transfected to express the Tax protein in the presence or absence of PMA or ionomycin. Overexpression of EGR-1 in Jurkat cells transfected to express Tax, promoted the activation of several genes, with the most potent being those that contained AP-1 (Jun/c-Fos), whereas knockdown of endogenous EGR-1 by small interfering RNA (siRNA) somewhat reduced Tax-mediated JNK-1 transcription. Additionally, luciferase-based AP-1 and NF-κB reporter gene assays demonstrated that inhibition of EGR-1 expression by an siRNA did not affect the transcriptional activity of a consensus sequence of either AP-1 or NF-κB. On the other hand, the apoptosis assay, using all-trans retinoic acid (ATRA) as an inducer of apoptosis, confirmed that siRNA against EGR-1 failed to suppress ATRA-induced apoptosis in Jurkat and Jurkat-Tax cells, as noted by the low levels of both DEVDase activity and DNA fragmentation, indicating that the induction of apoptosis by ATRA was Egr-1-independent. Finally, our data showed that activation of Tax by JNK-1 was not dependent on the EGR-1 cascade of events, suggesting that EGR-1 is important but not a determinant for the activity for Tax-induced proliferation of Jurkat cells.

  8. Gene-physical activity interactions and their impact on diabetes

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Franks, Paul W

    2014-01-01

    to an equal bout of physical activity. Individuals with specific genetic profiles are also expected to be more responsive to the beneficial effects of physical activity in the prevention of type 2 diabetes. Identification of such gene-physical activity interactions could give new insights into the biological...... the reader to the recent advances in the genetics of type 2 diabetes, summarize the current evidence on gene-physical activity interactions in relation to type 2 diabetes, and outline how information on gene-physical activity interactions might help improve the prevention and treatment of type 2 diabetes....... Finally, we will discuss the existing and emerging strategies that might enhance our ability to identify and exploit gene-physical activity interactions in the etiology of type 2 diabetes. © 2014 S. Karger AG, Basel....

  9. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  10. Growth, serum biochemistry, complement activity, and liver gene expression responses of Pekin ducklings to graded levels of cultured aflatoxin B1.

    Science.gov (United States)

    Chen, X; Horn, N; Cotter, P F; Applegate, T J

    2014-08-01

    A 14-d study was conducted to evaluate the effects of cultured aflatoxin B1 (AFB1) on performance, serum biochemistry, serum natural antibody and complement activity, and hepatic gene expression parameters in Pekin ducklings. A total of 144 male Pekin ducklings were weighed, tagged, and randomly allotted to 4 dietary treatments containing 4 concentrations of AFB1 (0, 0.11, 0.14, and 0.21 mg/kg) from 0 to 14 d of age (6 cages per diet; 6 ducklings per cage). Compared with the control group, there was a 10.9, 31.7, and 47.4% (P feed efficiency was not affected. Increasing concentrations of AFB1 reduced cumulative BW gain and feed intake both linearly and quadratically, and regression equations were developed with r(2) ≥0.73. Feeding 0.11 to 0.21 mg of AFB1/kg reduced serum glucose, creatinine, albumin, total protein, globulin, Ca, P, and creatine phosphokinase linearly, whereas serum urea N, Cl, alkaline phosphatase, and aspartate amino transferase concentrations increased linearly with increasing AFB1 (P complement pathways in the duckling serum when tested by lysis of rabbit, human type O, and horse erythrocytes, and decreased rabbit and horse agglutinins (P feed intake and BW gain decrease approximately 230 and 169 g per duckling from hatch to 14 d; and that AFB1 at very low concentrations can significantly impair liver function and gene expression, and innate immune dynamics in Pekin ducklings. © Poultry Science Association Inc.

  11. Langerin+ dermal dendritic cells are critical for CD8+ T cell activation and IgH γ-1 class switching in response to gene gun vaccines.

    Science.gov (United States)

    Stoecklinger, Angelika; Eticha, Tekalign D; Mesdaghi, Mehrnaz; Kissenpfennig, Adrien; Malissen, Bernard; Thalhamer, Josef; Hammerl, Peter

    2011-02-01

    The C-type lectin langerin/CD207 was originally discovered as a specific marker for epidermal Langerhans cells (LC). Recently, additional and distinct subsets of langerin(+) dendritic cells (DC) have been identified in lymph nodes and peripheral tissues of mice. Although the role of LC for immune activation or modulation is now being discussed controversially, other langerin(+) DC appear crucial for protective immunity in a growing set of infection and vaccination models. In knock-in mice that express the human diphtheria toxin receptor under control of the langerin promoter, injection of diphtheria toxin ablates LC for several weeks whereas other langerin(+) DC subsets are replenished within just a few days. Thus, by careful timing of diphtheria toxin injections selective states of deficiency in either LC only or all langerin(+) cells can be established. Taking advantage of this system, we found that, unlike selective LC deficiency, ablation of all langerin(+) DC abrogated the activation of IFN-γ-producing and cytolytic CD8(+) T cells after gene gun vaccination. Moreover, we identified migratory langerin(+) dermal DC as the subset that directly activated CD8(+) T cells in lymph nodes. Langerin(+) DC were also critical for IgG1 but not IgG2a Ab induction, suggesting differential polarization of CD4(+) T helper cells by langerin(+) or langerin-negative DC, respectively. In contrast, protein vaccines administered with various adjuvants induced IgG1 independently of langerin(+) DC. Taken together, these findings reflect a highly specialized division of labor between different DC subsets both with respect to Ag encounter as well as downstream processes of immune activation.

  12. A potent and selective calcitonin gene-related peptide (CGRP) receptor antagonist, MK-8825, inhibits responses to nociceptive trigeminal activation: Role of CGRP in orofacial pain.

    Science.gov (United States)

    Romero-Reyes, Marcela; Pardi, Vanessa; Akerman, Simon

    2015-09-01

    Temporomandibular disorders (TMDs) are orofacial pains within the trigeminal distribution, which involve the masticatory musculature, the temporomandibular joint or both. Their pathophysiology remains unclear, as inflammatory mediators are thought to be involved, and clinically TMD presents pain and sometimes limitation of function, but often appears without gross indications of local inflammation, such as visible edema, redness and increase in temperature. Calcitonin gene-related peptide (CGRP) has been implicated in other pain disorders with trigeminal distribution, such as migraine, of which TMD shares a significant co-morbidity. CGRP causes activation and sensitization of trigeminal primary afferent neurons, independent of any inflammatory mechanisms, and thus may also be involved in TMD. Here we used a small molecule, selective CGRP receptor antagonist, MK-8825, to dissect the role of CGRP in inducing spontaneous nociceptive facial grooming behaviors, neuronal activation in the trigeminal nucleus, and systemic release of pro-inflammatory cytokines, in a mouse model of acute orofacial masseteric muscle pain that we have developed, as a surrogate of acute TMD. We show that CFA masseteric injection causes significant spontaneous orofacial pain behaviors, neuronal activation in the trigeminal nucleus, and release of interleukin-6 (IL-6). In mice pre-treated with MK-8825 there is a significant reduction in these spontaneous orofacial pain behaviors. Also, at 2 and 24h after CFA injection the level of Fos immunoreactivity in the trigeminal nucleus, used as a marker of neuronal activation, was much lower on both ipsilateral and contralateral sides after pre-treatment with MK-8825. There was no effect of MK-8825 on the release of IL-6. These data suggest that CGRP may be involved in TMD pathophysiology, but not via inflammatory mechanisms, at least in the acute stage. Furthermore, CGRP receptor antagonists may have therapeutic efficacy in the treatment of TMD, as they

  13. Gene expression of corals in response to macroalgal competitors.

    Directory of Open Access Journals (Sweden)

    Tonya L Shearer

    Full Text Available As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora versus the more resistant (M. digitata coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens.

  14. Non-MHC genes influence virus clearance through regulation of the antiviral T-cell response: correlation between virus clearance and Tc and Td activity in segregating backcross progeny

    DEFF Research Database (Denmark)

    Christensen, Jan Pravsgaard; Marker, O; Thomsen, Allan Randrup

    1994-01-01

    ) was followed by measurement of footpad swelling. Ten days after virus inoculation, the animals were sacrificed and spleen virus titer together with splenic Tc activity was measured. With regard to all three parameters a continuous distribution was observed in this backcross population. However, using cutoff...... values based on parental and F1 animals tested in parallel, 11/30 animals were assigned Tc responders, 23/30 DTH responders and 10/30 cleared virus with maximal efficiency. Comparison of responder status with regard to the different parameters revealed a strong correlation between Tc responsiveness...... and the ability to clear virus. Amongst Tc low responders a correlation between DTH reactivity and virus clearance was observed. Taken together, these results indicate that non-MHC genes affect virus clearance through regulation of the antiviral T-cell response, especially the virus-specific Tc response. However...

  15. Amitriptyline induces early growth response-1 gene expression via ERK and JNK mitogen-activated protein kinase pathways in rat C6 glial cells.

    Science.gov (United States)

    Chung, Eun Young; Shin, Soon Young; Lee, Young Han

    2007-07-05

    Astrocytes play important roles in guiding the construction of the nervous system, controlling extracellular ions and neurotransmitters, and regulating CNS synaptogenesis. Egr-1 is a transcription factor involved in neuronal differentiation and astrocyte cell proliferation. In this study, we investigated whether the tricyclic antidepressant (TCA) amitriptyline induces Egr-1 expression in astrocytes using rat C6 glioma cells as a model. We found that amitriptyline increased the expression of Egr-1 in a dose- and time-dependent manner. The amitriptyline-induced Egr-1 expression was mediated through serum response elements (SREs) in the Egr-1 promoter. SREs were activated by the Ets-domain transcription factor Elk-1 through the ERK and JNK mitogen-activated protein (MAP) kinase pathways. The inhibition of the ERK and JNK MAP kinase signals attenuated amitriptyline-induced transactivation of Gal4-Elk-1 and Egr-1 promoter activity. Our findings suggest that the induction of Egr-1 expression in astrocytes may be required to attain the therapeutic effects of antidepressant drugs.

  16. Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.

    Science.gov (United States)

    Inoue, Masayo; Kaneko, Kunihiko

    2013-04-01

    Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.

  17. Local and global responses in complex gene regulation networks

    Science.gov (United States)

    Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro

    2009-04-01

    An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.

  18. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Variation in serotonin neurotransmission genes affects neural activation during response inhibition in adolescents and young adults with ADHD and healthy controls

    NARCIS (Netherlands)

    Van Rooij, Daan; Hartman, Catharina A.; Van Donkelaar, Marjolein M. J.; Bralten, Janita; Von Rhein, Daniel; Hakobjan, Marina; Franke, Barbara; Heslenfeld, Dirk J.; Oosterlaan, Jaap; Rommelse, Nanda; Buitelaar, Jan K.; Hoekstra, Pieter J.

    2015-01-01

    Objectives. Deficits in response inhibition have been associated with attention-deficit/hyperactivity disorder (ADHD). Given the role of serotonin in ADHD and impulsivity, we postulated that genetic variants within the serotonin pathway might influence response inhibition. Methods. We measured

  20. Skeletal Muscle Estrogen Receptor Activation in Response to Eccentric Exercise Up-Regulates Myogenic-Related Gene Expression Independent of Differing Serum Estradiol Levels Occurring during the Human Menstrual Cycle.

    Science.gov (United States)

    Haines, Mackenzie; McKinley-Barnard, Sarah K; Andre, Thomas L; Gann, Josh J; Hwang, Paul S; Willoughby, Darryn S

    2018-03-01

    This study sought to determine if the differences in serum estradiol we have previously observed to occur during the mid-follicular (MF) and mid-luteal (ML) phases of the female menstrual cycle could be attributed to estrogen-induced receptor activation and subsequent effects on myogenic-related genes which may otherwise impact muscle regeneration in response to eccentric exercise. Twenty-two physically-active females (20.9 ± 1.4 years, 63.5 ± 9.0 kg, 1.65 ± 0.08 m) underwent an eccentric exercise bout of the knee extensors during the MF and ML phases of their 28-day menstrual cycle. Prior to (PRE), at 6 (6HRPOST), and 24 (24HRPOST) hours post-exercise for each session, participants had muscle biopsies obtained. Skeletal muscle estradiol and estrogen receptor-α (ER-α) content and ER-DNA binding were determined with ELISA. Real-time PCR was used to assess ER-α, Myo-D, and cyclin D1 mRNA expression. Data were analyzed utilizing a 2 x 3 repeated measures univariate analyses of variance (ANOVA) for each criterion variable (p ≤ .05). Skeletal muscle estradiol levels were not significantly impacted by either menstrual phase (p > 0.05); however, both ER-α mRNA and protein were significantly increased during MF (p < 0.05). ER-DNA binding and Myo-D mRNA expression increased significantly in both menstrual phases in response to exercise but were not different from one another; however, cyclin D1 mRNA expression was significantly greater during MF. This study demonstrates that skeletal muscle ER-α activation in response to eccentric exercise up-regulates myogenic-related gene expression independent of serum estradiol levels occurring during the human menstrual cycle.

  1. Stress, and pathogen response gene expression in modeled microgravity

    Science.gov (United States)

    Sundaresan, Alamelu; Pellis, Neal R.

    2006-01-01

    Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and

  2. Dose response relationship in anti-stress gene regulatory networks.

    Science.gov (United States)

    Zhang, Qiang; Andersen, Melvin E

    2007-03-02

    the level of local gains, presence of gain-changing events, and degree of feedforward gene activation, this region can appear as superlinear, sublinear, or even J-shaped. The general dose response transition proposed here was further examined in a complex anti-electrophilic stress pathway, which involves multiple genes, enzymes, and metabolic reactions. This work would help biologists and especially toxicologists to better assess and predict the cellular impact brought about by biological stressors.

  3. Dose response relationship in anti-stress gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2007-03-01

    , and depending on the level of local gains, presence of gain-changing events, and degree of feedforward gene activation, this region can appear as superlinear, sublinear, or even J-shaped. The general dose response transition proposed here was further examined in a complex anti-electrophilic stress pathway, which involves multiple genes, enzymes, and metabolic reactions. This work would help biologists and especially toxicologists to better assess and predict the cellular impact brought about by biological stressors.

  4. Early growth response 4 is involved in cell proliferation of small cell lung cancer through transcriptional activation of its downstream genes.

    Directory of Open Access Journals (Sweden)

    Taisuke Matsuo

    Full Text Available Small cell lung cancer (SCLC is aggressive, with rapid growth and frequent bone metastasis; however, its detailed molecular mechanism remains poorly understood. Here, we report the critical role of early growth factor 4 (EGR4, a DNA-binding, zinc-finger transcription factor, in cell proliferation of SCLC. EGR4 overexpression in HEK293T cells conferred significant upregulation of specific splice variants of the parathyroid hormone-related protein (PTHrP gene, resulting in enhancement of the secretion of PTHrP protein, a known mediator of osteolytic bone metastasis. More importantly, depletion of EGR4 expression by siRNA significantly suppressed growth of the SCLC cell lines, SBC-5, SBC-3 and NCI-H1048. On the other hand, introduction of EGR4 into NIH3T3 cells significantly enhanced cell growth. We identified four EGR4 target genes, SAMD5, RAB15, SYNPO and DLX5, which were the most significantly downregulated genes upon depletion of EGR4 expression in all of the SCLC cells examined, and demonstrated the direct recruitment of EGR4 to their promoters by ChIP and luciferase reporter analysis. Notably, knockdown of the expression of these genes by siRNA remarkably suppressed the growth of all the SCLC cells. Taken together, our findings suggest that EGR4 likely regulates the bone metastasis and proliferation of SCLC cells via transcriptional regulation of several target genes, and may therefore be a promising target for the development of anticancer drugs for SCLC patients.

  5. Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response.

    Science.gov (United States)

    Guzman, Christine; Conaco, Cecilia

    2016-01-01

    Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions.

  6. Granulomatous response to Coxiella burnetii, the agent of Q fever: the lessons from gene expression analysis

    Directory of Open Access Journals (Sweden)

    delphine efaugaret

    2014-12-01

    Full Text Available The formation of granulomas is associated with the resolution of Q fever, a zoonosis due to Coxiella burnetii; however the molecular mechanisms of granuloma formation remain poorly understood. We generated human granulomas with peripheral blood mononuclear cells and beads coated with C. burnetii, using BCG extracts as controls. A microarray analysis showed dramatic changes in gene expression in granuloma cells of which more than 50% were commonly modulated genes in response to C. burnetii and BCG. They included M1-related genes and genes related to chemotaxis. The inhibition of the chemokines, CCL2 and CCL5, directly interfered with granuloma formation. C. burnetii granulomas also expressed a specific transcriptional profile that was essentially enriched in genes associated with type I interferon response. Our results showed that granuloma formation is associated with a core of transcriptional response based on inflammatory genes. The specific granulomatous response to C. burnetii is characterized by the activation of type I interferon pathway.

  7. KBERG: KnowledgeBase for Estrogen Responsive Genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam

    2007-01-01

    Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...

  8. Memory responses of jasmonic acid-associated Arabidopsis genes to a repeated dehydration stress.

    Science.gov (United States)

    Liu, Ning; Staswick, Paul E; Avramova, Zoya

    2016-11-01

    Dehydration stress activates numerous genes co-regulated by diverse signaling pathways. Upon repeated exposures, however, a subset of these genes does not respond maintaining instead transcription at their initial pre-stressed levels ('revised-response' genes). Most of these genes are involved in jasmonic acid (JA) biosynthesis, JA-signaling and JA-mediated stress responses. How these JA-associated genes are regulated to provide different responses to similar dehydration stresses is an enigma. Here, we investigate molecular mechanisms that contribute to this transcriptional behavior. The memory-mechanism is stress-specific: one exposure to dehydration stress or to abscisic acid (ABA) is required to prevent transcription in the second. Both ABA-mediated and JA-mediated pathways are critical for the activation of these genes, but the two signaling pathways interact differently during a single or multiple encounters with dehydration stress. Synthesis of JA during the first (S1) but not the second dehydration stress (S2) accounts for the altered transcriptional responses. We propose a model for these memory responses, wherein lack of MYC2 and of JA synthesis in S2 is responsible for the lack of expression of downstream genes. The similar length of the memory displayed by different memory-type genes suggests biological relevance for transcriptional memory as a gene-regulating mechanism during recurring bouts of drought. © 2016 John Wiley & Sons Ltd.

  9. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  10. Diurnal oscillations of soybean circadian clock and drought responsive genes.

    Directory of Open Access Journals (Sweden)

    Juliana Marcolino-Gomes

    Full Text Available Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i drought stress affects gene expression of circadian clock components and (ii several stress responsive genes display diurnal oscillation in soybeans.

  11. Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses

    Directory of Open Access Journals (Sweden)

    Magdalena eMazur

    2012-09-01

    Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.

  12. Determination of relative assay response factors for toxic chlorinated and brominated dioxins/furans using an enzyme immunoassay (EIA) and a chemically-activated luciferase gene expression cell bioassay (CALUX).

    Science.gov (United States)

    Samara, Fatin; Gullett, Brian K; Harrison, Robert O; Chu, Andrew; Clark, George C

    2009-04-01

    Determination of toxic activity requires knowledge of both the concentration and toxicity to evaluate the risk for adverse human health and environmental effects. A chemically-activated luciferase gene expression cell bioassay system (CALUX) and an antibody-based method enzyme immunoassay (EIA) were used to detect the dioxin-like response of several polybrominated, polychlorinated, and polybrominated/chlorinated dibenzo-p-dioxins/furans (PBDDs/Fs, PCDDs/Fs, and PBCDDs/Fs, respectively). It has been suggested that the biological activity of the brominated and mixed bromo/chloro compounds is similar to their chlorinated analogues (measured by binding to the Ah receptor). PBDD/F, PCDD/F, and PBCDD/F laboratory standards exhibited biological activity ranging over three orders of magnitude. The highest relative potency (REP) values from CALUX analysis, when compared to 2,3,7,8-TCDD, were 2,3,7,8-TBDD at 0.99 (+/-0.07), 1,2,3,7,8-PeCDD at 0.69, and 2-Br-3,7,8-TriCDD at 0.72 (+/-0.02). Cross-reactivities were calculated using EIA for several PBDDs/Fs and PBCDDs. The highest percent cross-reactivity was found for 2,3,7,8-TBDD at 138 (+/-34%), and 2,3,7-TriBDD at 84 (+/-36%).

  13. HRGFish: A database of hypoxia responsive genes in fishes

    Science.gov (United States)

    Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

    2017-02-01

    Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

  14. Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

    Science.gov (United States)

    Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

    2011-01-01

    The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

  15. Active Response Gravity Offload System

    Science.gov (United States)

    Valle, Paul; Dungan, Larry; Cunningham, Thomas; Lieberman, Asher; Poncia, Dina

    2011-01-01

    The Active Response Gravity Offload System (ARGOS) provides the ability to simulate with one system the gravity effect of planets, moons, comets, asteroids, and microgravity, where the gravity is less than Earth fs gravity. The system works by providing a constant force offload through an overhead hoist system and horizontal motion through a rail and trolley system. The facility covers a 20 by 40-ft (approximately equals 6.1 by 12.2m) horizontal area with 15 ft (approximately equals4.6 m) of lifting vertical range.

  16. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  17. Genistein-induced alterations of radiation-responsive gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Grace, M.B. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F.; Landauer, M.R. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)

    2007-07-15

    In order to clarify the molecular mechanism of radioprotection and understand biological dosimetry in the presence of medical countermeasure-radioprotectants, their effects on ionizing radiation (IR)-responsive molecular biomarkers must be examined. We used genistein in a radiation model system and measured gene expression by multiplex QRT-PCR assay in drug-treated healthy human blood cultures. Genistein has been demonstrated to be a radiosensitizer of malignant cells and a radioprotector against IR-induced lethality in a mouse model. Whole-blood cultures were supplemented with 50, 100, and 200{mu}M concentrations of genistein, 16 h prior to receiving a 2-Gy ({sup 60}Co-{gamma} rays, 10 cGy/min) dose of IR. Total RNA was isolated from whole blood 24 h postirradiation for assessments. Combination treatments of genistein and IR resulted in no significant genistein effects on ddb2 and bax downstream transcripts to p53, or proliferating cell-nuclear antigen, pcna, necessary for DNA synthesis and cell-cycle progression. Use of these radiation-responsive targets would be recommended for dose-assessment applications. We also observed decreased expression of pro-survival transcript, bcl-2. Genistein and IR-increased expression of cdkn1a and gadd45a, showing that genistein also stimulates p53 transcriptional activity. These results confirm published molecular signatures for genistein in numerous in vitro models. Evaluation of gene biomarkers may be further exploited for devising novel radiation countermeasure and/or therapeutic strategies.

  18. Mechanisms of radiation-induced gene responses

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Paunesku, T.

    1996-01-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5' region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3' region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process

  19. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  20. Computational method for discovery of estrogen responsive genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar

    2004-01-01

    Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...

  1. Analysis of the Aspergillus fumigatus proteome reveals metabolic changes and the activation of the pseurotin A biosynthesis gene cluster in response to hypoxia.

    Science.gov (United States)

    Vödisch, Martin; Scherlach, Kirstin; Winkler, Robert; Hertweck, Christian; Braun, Hans-Peter; Roth, Martin; Haas, Hubertus; Werner, Ernst R; Brakhage, Axel A; Kniemeyer, Olaf

    2011-05-06

    The mold Aspergillus fumigatus is the most important airborne fungal pathogen. Adaptation to hypoxia represents an important virulence attribute for A. fumigatus. Therefore, we aimed at obtaining a comprehensive overview about this process on the proteome level. To ensure highly reproducible growth conditions, an oxygen-controlled, glucose-limited chemostat cultivation was established. Two-dimensional gel electrophoresis analysis of mycelial and mitochondrial proteins as well as two-dimensional Blue Native/SDS-gel separation of mitochondrial membrane proteins led to the identification of 117 proteins with an altered abundance under hypoxic in comparison to normoxic conditions. Hypoxia induced an increased activity of glycolysis, the TCA-cycle, respiration, and amino acid metabolism. Consistently, the cellular contents in heme, iron, copper, and zinc increased. Furthermore, hypoxia induced biosynthesis of the secondary metabolite pseurotin A as demonstrated at proteomic, transcriptional, and metabolite levels. The observed and so far not reported stimulation of the biosynthesis of a secondary metabolite by oxygen depletion may also affect the survival of A. fumigatus in hypoxic niches of the human host. Among the proteins so far not implicated in hypoxia adaptation, an NO-detoxifying flavohemoprotein was one of the most highly up-regulated proteins which indicates a link between hypoxia and the generation of nitrosative stress in A. fumigatus.

  2. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  3. Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

    Science.gov (United States)

    Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

    2018-03-08

    The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

  4. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    -scale sequencing began with simple organisms, viruses and bacteria, progressed to eukaryotes such as yeast, and more recently (1998) progressed to a multi-cellular animal, the nematode Caenorhabditis elegans. Sequencers have now moved on to the fruit fly Drosophila melanogaster, whose sequence is slated for completion by the end of 1999. The human genome project is expected to determine the complete sequence of all 3 billion bases of human DNA within the next five years. In the wake of genome-scale sequencing, further instrumentation is being developed to assay gene expression and function on a comparably large scale. Much of the work in computational biology focuses on computational tools used in sequencing, finding genes that are related to a particular gene, finding which parts of the DNA code for proteins and which do not, understanding what proteins will be formed from a given length of DNA, predicting how the proteins will fold from a one-dimensional structure into a three dimensional structure, and so on. Much less computational work has been done regarding the function of proteins. One reason for this is that different proteins function very differently, and so work on protein function is very specific to certain classes of proteins. There are, for example, proteins such enzymes that catalyze various intracellular reactions, receptors that respond to extracellular signals and ion channels that regulate the flow of charged particles into and out of the cell. In this chapter, we will consider a particular class of proteins called transcription factors(TFs), which are responsible for regulating when a certain gene is expressed in a certain cell, which cells it is express in, and how much is expressed. Understanding these processes will involve developing a deeper understanding of transcription, translation, and the cellular processes that control those processes. All of these elements fall under the aegis of gene regulation or more narrowly transcriptional regulation. Some of

  5. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  6. Corporate responses to stakeholder activism

    DEFF Research Database (Denmark)

    Uldam, Julie; Krause Hansen, Hans

    2017-01-01

    Corporations are increasingly expected to act responsibly. The purpose of this paper is to examine two types of corporate responses to these expectations: overt and covert responses. Specifically, it examines oil companies’ involvement in multi-stakeholder initiatives and sponsorships (overt...

  7. Reactive oxygen species (ROS) and the heat stress response of Daphnia pulex: ROS-mediated activation of hypoxia-inducible factor 1 (HIF-1) and heat shock factor 1 (HSF-1) and the clustered expression of stress genes.

    Science.gov (United States)

    Klumpen, Eva; Hoffschröer, Nadine; Zeis, Bettina; Gigengack, Ulrike; Dohmen, Elias; Paul, Rüdiger J

    2017-01-01

    Heat stress in ectotherms involves direct (e.g. protein damage) and/or indirect effects (temperature-induced hypoxia and ROS formation), which cause activation of the transcription factors (TF) heat shock factor 1 (HSF-1) and/or hypoxia-inducible factor 1 (HIF-1). The present study focused on the links between stress (ROS) signals, nuclear (n) and cytoplasmic (c) HSF-1/HIF-1 levels, and stress gene expression on mRNA and protein levels (e.g. heat-shock protein 90, HSP90) upon acute heat and ROS (H 2 O 2 ) stress. Acute heat stress (30°C) evoked fluctuations in ROS level. Different feeding regimens, which affected the glutathione (GSH) level, allowed altering the frequency of ROS fluctuations. Other data showed fluctuation frequency to depend also on ROS production rate. The heat-induced slow or fast ROS fluctuations (at high or low GSH levels) evoked slow or fast fluctuations in the levels of nHIF-1α, nHSF-1 and gene products (mRNAs and protein), albeit after different time delays. Time delays to ROS fluctuations were, for example,shorter for nHIF-1α than for nHSF-1 fluctuations, and nHIF-1α fluctuations preceded and nHSF-1 fluctuations followed fluctuations in HSP90 mRNA level. Cytoplasmic TF levels either changed little (cHIF-1α) or showed a steady increase (cHSF-1). Applying acute H 2 O 2 stress (at 20°C) revealed effects on nHIF-1α and mRNA levels, but no significant effects on nHSF-1 level. Transcriptome data additionally showed coordinated fluctuations of mRNA levels upon acute heat stress, involving mRNAs for HSPs and other stress proteins, with all corresponding genes carrying DNA binding motifs for HIF-1 and HSF-1. This study provided evidence for promoting effects of ROS and HIF-1 on early haemoglobin, HIF-1α and HSP90 mRNA expressions upon heat or ROS stress. The increasing cHSF-1 level likely affected nHSF-1 level and later HSP90 mRNA expression. Heat stress evoked ROS fluctuations, with this stress signal forwarded via nHIF-1 and nHSF-1

  8. Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma

    International Nuclear Information System (INIS)

    Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van

    2005-01-01

    Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype

  9. Distinguishing the rates of gene activation from phenotypic variations.

    Science.gov (United States)

    Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun

    2015-06-18

    Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which regime a considered gene regulatory network is in from their phenotypic variations. We studied a gene expression model with positive feedbacks when genetic switching rates vary over a wide range. With the goal of providing a method to distinguish the regime of the switching rates, we first focus on understanding the essential dynamics of gene expression system in different cases. In the regime of slow switching rates, we found that the effective dynamics can be reduced to independent evolutions on two separate layers corresponding to gene activation and inactivation states, and the transitions between two layers are rare events, after which the system goes mainly along deterministic ODE trajectories on a particular layer to reach new steady states. The energy landscape in this regime can be well approximated by using Gaussian mixture model. In the regime of intermediate switching rates, we analyzed the mean switching time to investigate the stability of the system in different parameter ranges. We also discussed the case of fast switching rates from the viewpoint of transition state theory. Based on the obtained results, we made a proposal to distinguish these three regimes in a simulation experiment. We identified the intermediate regime from the fact that the strength of cellular memory is lower than the other two cases, and the fast and slow regimes can be distinguished by their different perturbation-response behavior with respect to the switching rates perturbations. We proposed a

  10. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    Directory of Open Access Journals (Sweden)

    Yuling Bai

    2018-06-01

    Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  11. Influence of the xonA gene of Escherichia coli in response to radiation

    International Nuclear Information System (INIS)

    Ponce M, J.; Serment G, J.; Brena V, M.

    2003-01-01

    The Escherichia coli bacteria has a repair and tolerance system known as SOS that works when there is damage in the DNA. However it is necessary that this damage modifies before the system is activated. For this it has intended to the enzymes that degrade DNA like responsible for generating this modifications. It has already been identified to the product of the gene recJ and according to the results that here are presented that of the gene xonA has similar activity. When both genes fail, not alone the activity SOS is inhibited but rather the mortality increases, for ionizing radiation. The above mentioned reinforces the importance of these genes in the recovery to the damage caused to the genome. (Author)

  12. Estrogen-Responsive Genes Overlap with Triiodothyronine-Responsive Genes in a Breast Carcinoma Cell Line

    Directory of Open Access Journals (Sweden)

    Nancy Bueno Figueiredo

    2014-01-01

    Full Text Available It has been well established that estrogen plays an important role in the progression and treatment of breast cancer. However, the role of triiodothyronine (T3 remains controversial. We have previously shown its capacity to stimulate the development of positive estrogen receptor breast carcinoma, induce the expression of genes (PR, TGF-alpha normally stimulated by estradiol (E2, and suppress genes (TGF-beta normally inhibited by E2. Since T3 regulates growth hormones, metabolism, and differentiation, it is important to verify its action on other genes normally induced by E2. Therefore, we used DNA microarrays to compare gene expression patterns in MCF-7 breast adenocarcinoma cells treated with E2 and T3. Several genes were modulated by both E2 and T3 in MCF-7 cells (Student’s t-test, P 2.0, pFDR < 0.05. We confirmed our microarray results by real-time PCR. Our findings reveal that certain genes in MCF-7 cells can be regulated by both E2 and T3.

  13. Faba bean drought responsive gene identification and validation

    Directory of Open Access Journals (Sweden)

    Megahed H. Ammar

    2017-01-01

    Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.

  14. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.

  15. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...

  16. Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction.

    Science.gov (United States)

    Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua

    2014-01-01

    Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.

  17. Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction

    Directory of Open Access Journals (Sweden)

    Antonia Y. Tetteh

    2014-01-01

    Full Text Available Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se0, but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3 treatment and then used quantitative real-time PCR (qRT-PCR to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.

  18. Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors

    International Nuclear Information System (INIS)

    Ahmed, M.

    2003-01-01

    Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation

  19. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    Science.gov (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-09-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

  20. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    Science.gov (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-01-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172

  1. Stochastic biological response to radiation. Comprehensive analysis of gene expression

    International Nuclear Information System (INIS)

    Inoue, Tohru; Hirabayashi, Yoko

    2012-01-01

    Authors explain that the radiation effect on biological system is stochastic along the law of physics, differing from chemical effect, using instances of Cs-137 gamma-ray (GR) and benzene (BZ) exposures to mice and of resultant comprehensive analyses of gene expression. Single GR irradiation is done with Gamma Cell 40 (CSR) to C57BL/6 or C3H/He mouse at 0, 0.6 and 3 Gy. BE is given orally at 150 mg/kg/day for 5 days x 2 weeks. Bone marrow cells are sampled 1 month after the exposure. Comprehensive gene expression is analyzed by Gene Chip Mouse Genome 430 2.0 Array (Affymetrix) and data are processed by programs like case normalization, statistics, network generation, functional analysis etc. GR irradiation brings about changes of gene expression, which are classifiable in common genes variable commonly on the dose change and stochastic genes variable stochastically within each dose: e.g., with Welch-t-test, significant differences are between 0/3 Gy (dose-specific difference, 455 pbs (probe set), in stochastic 2113 pbs), 0/0.6 Gy (267 in 1284 pbs) and 0.6/3 Gy (532 pbs); and with one-way analysis of variation (ANOVA) and hierarchial/dendrographic analyses, 520 pbs are shown to involve the dose-dependent 226 and dose-specific 294 pbs. It is also shown that at 3 Gy, expression of common genes are rather suppressed, including those related to the proliferation/apoptosis of B/T cells, and of stochastic genes, related to cell division/signaling. Ven diagram of the common genes of above 520 pbs, stochastic 2113 pbs at 3 Gy and 1284 pbs at 0.6 Gy shows the overlapping genes 29, 2 and 4, respectively, indicating only 35 pbs are overlapping in total. Network analysis of changes by GR shows the rather high expression of genes around hub of cAMP response element binding protein (CREB) at 0.6 Gy, and rather variable expression around CREB hub/suppressed expression of kinesin hub at 3 Gy; in the network by BZ exposure, unchanged or low expression around p53 hub and suppression

  2. Gene expression in epithelial cells in response to pneumovirus infection

    Directory of Open Access Journals (Sweden)

    Rosenberg Helene F

    2001-05-01

    Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.

  3. Oxytocin receptor gene variation predicts subjective responses to MDMA.

    Science.gov (United States)

    Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet

    2016-12-01

    3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.

  4. GENE RESPONSE OF THE GASTROCNEMIUS AND SOLEUS MUSCLES TO AN ACUTE AEROBIC RUN IN RATS

    Directory of Open Access Journals (Sweden)

    Michael J. McKenzie

    2011-06-01

    Full Text Available Genes can be activated or inhibited by signals within the tissues in response to an acute bout of exercise. It is unclear how a particular aerobic exercise bout may influence two muscles with similar actions to the activity. Therefore, the purposes of this investigation was to determine the gene response of selected genes involved in the "stress" response of the gastrocnemius (fast-twitch and soleus (slow-twitch muscles to a single two hour aerobic exercise bout in female Sprague-Dawley Rats at the 1 hour time point after the exercise. Exercised rats were run (n=8 for 2 hours at 20 m.min-1 and one hour after the completion of the bout had their soleus (S and gastrocnemius (G muscles removed. Age and timed matched sedentary control rats had both S and G muscles removed also. RNA was isolated from all muscles. Real-time PCR analysis was performed on the following genes: NFκB, TNFα, and Atf3. GAPDH was used as the housekeeping gene for both muscles. S muscle showed more genes altered (n = 52 vs G (n = 26. NFκB gene expression was 0.83 ± 0.14 in the exercised S but was + 1.36 ± 0.58 in the exercised G and was not significantly different between the muscles. TNFα was altered 1.30 ± 0. 34 in the exercised S and 1.36 ± 0.71 in the exercised G and was not significantly different between the muscles. The gene Atf3 was significantly altered at 4.97 ± 1.01 in the exercised S, while it was not significantly altered in the exercised G (0.70 ± 0.55. This study demonstrates that an acute bout of aerobic exercise can alter gene expression to a different extent in both the S and G muscles. It is highly likely that muscle recruitment was a factor which influenced the gene expression in theses muscles. It is interesting to note that some genes were similarly activated in these two muscles but other genes may demonstrate a varied response to the same exercise bout depending on the type of muscle

  5. Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Andrea Farini

    2014-01-01

    Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.

  6. Moderation of antidepressant response by the serotonin transporter gene

    DEFF Research Database (Denmark)

    Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca

    2009-01-01

    Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...

  7. Comparison of Fusarium graminearum transcriptomes on living or dead wheat differentiates substrate-responsive and defense-responsive genes.

    Directory of Open Access Journals (Sweden)

    Stefan Boedi

    2016-07-01

    Full Text Available Fusarium graminearum is an opportunistic pathogen of cereals where it causes severe yield losses and concomitant mycotoxin contamination of the grains. The pathogen has mixed biotrophic and necrotrophic (saprophytic growth phases during infection and the regulatory networks associated with these phases have so far always been analyzed together. In this study we compared the transcriptomes of fungal cells infecting a living, actively defending plant representing the mixed live style (pathogenic growth on living flowering wheat heads to the response of the fungus infecting identical, but dead plant tissues (cold-killed flowering wheat heads representing strictly saprophytic conditions. We found that the living plant actively suppressed fungal growth and promoted much higher toxin production in comparison to the identical plant tissue without metabolism suggesting that molecules signaling secondary metabolite induction are not pre-existing or not stable in the plant in sufficient amounts before infection. Differential gene expression analysis was used to define gene sets responding to the active or the passive plant as main impact factor and driver for gene expression. We correlated our results to the published F. graminearum transcriptomes, proteomes and secretomes and found that only a limited number of in planta- expressed genes require the living plant for induction but the majority uses simply the plant tissue as signal. Many secondary metabolite (SM gene clusters show a heterogeneous expression pattern within the cluster indicating that different genetic or epigenetic signals govern the expression of individual genes within a physically linked cluster. Our bioinformatic approach also identified fungal genes which were actively repressed by signals derived from the active plant and may thus represent direct targets of the plant defense against the invading pathogen.

  8. Gene activation by induced DNA rearrangements

    International Nuclear Information System (INIS)

    Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.

    1989-01-01

    A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

  9. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  10. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  11. Supplementary Material for: Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard; Ravasi, Timothy; Marcondes, Maria

    2017-01-01

    Abstract Background Astrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use. Methods We developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders. Results We identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes. Conclusions Gene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  12. Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki

    2017-03-09

    BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  13. Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro

    KAUST Repository

    Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard S.; Ravasi, Timothy; Marcondes, Maria Cecilia G.

    2017-01-01

    BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.

  14. Muscle myeloid type I interferon gene expression may predict therapeutic responses to rituximab in myositis patients.

    Science.gov (United States)

    Nagaraju, Kanneboyina; Ghimbovschi, Svetlana; Rayavarapu, Sree; Phadke, Aditi; Rider, Lisa G; Hoffman, Eric P; Miller, Frederick W

    2016-09-01

    To identify muscle gene expression patterns that predict rituximab responses and assess the effects of rituximab on muscle gene expression in PM and DM. In an attempt to understand the molecular mechanism of response and non-response to rituximab therapy, we performed Affymetrix gene expression array analyses on muscle biopsy specimens taken before and after rituximab therapy from eight PM and two DM patients in the Rituximab in Myositis study. We also analysed selected muscle-infiltrating cell phenotypes in these biopsies by immunohistochemical staining. Partek and Ingenuity pathway analyses assessed the gene pathways and networks. Myeloid type I IFN signature genes were expressed at higher levels at baseline in the skeletal muscle of rituximab responders than in non-responders, whereas classic non-myeloid IFN signature genes were expressed at higher levels in non-responders at baseline. Also, rituximab responders have a greater reduction of the myeloid and non-myeloid type I IFN signatures than non-responders. The decrease in the type I IFN signature following administration of rituximab may be associated with the decreases in muscle-infiltrating CD19(+) B cells and CD68(+) macrophages in responders. Our findings suggest that high levels of myeloid type I IFN gene expression in skeletal muscle predict responses to rituximab in PM/DM and that rituximab responders also have a greater decrease in the expression of these genes. These data add further evidence to recent studies defining the type I IFN signature as both a predictor of therapeutic responses and a biomarker of myositis disease activity. Published by Oxford University Press on behalf British Society for Rheumatology 2016. This work is written by US Government employees and is in the public domain in the US.

  15. Redox-Active Antibiotics Control Gene Expression and Community Behavior in Divergent Bacteria

    OpenAIRE

    Dietrich, Lars E. P.; Teal, Tracy K.; Price-Whelan, Alexa; Newman, Dianne K.

    2008-01-01

    It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for ...

  16. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    Science.gov (United States)

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are

  17. Activated Glucocorticoid Receptor Interacts with the INHAT Component Set/TAF-Iβ and Releases it from a Glucocorticoid-responsive Gene Promoter, Relieving Repression: Implications for the Pathogenesis of Glucocorticoid Resistance in Acute Undifferentiated Leukemia with Set-Can Translocation

    Science.gov (United States)

    Ichijo, Takamasa; Chrousos, George P.; Kino, Tomoshige

    2008-01-01

    SUMMARY Set/template-activating factor (TAF)-Iβ, part of the Set-Can oncogene product found in acute undifferentiated leukemia, is a component of the inhibitor of acetyltransferases (INHAT) complex. Set/TAF-Iβ interacted with the DNA-binding domain of the glucocorticoid receptor (GR) in yeast two-hybrid screening, and repressed GR-induced transcriptional activity of a chromatin-integrated glucocorticoid-responsive and a natural promoter. Set/TAF-Iβ was co-precipitated with glucocorticoid response elements (GREs) of these promoters in the absence of dexamethasone, while addition of the hormone caused dissociation of Set/TAF-Iβ from and attraction of the p160-type coactivator GRIP1 to the promoter GREs. Set-Can fusion protein, on the other hand, did not interact with GR, was constitutively co-precipitated with GREs and suppressed GRIP1-induced enhancement of GR transcriptional activity and histone acetylation. Thus, Set/TAF-Iβ acts as a ligand-activated GR-responsive transcriptional repressor, while Set-Can does not retain physiologic responsiveness to ligand-bound GR, possibly contributing to the poor responsiveness of Set-Can-harboring leukemic cells to glucocorticoids. PMID:18096310

  18. Activated glucocorticoid receptor interacts with the INHAT component Set/TAF-Ibeta and releases it from a glucocorticoid-responsive gene promoter, relieving repression: implications for the pathogenesis of glucocorticoid resistance in acute undifferentiated leukemia with Set-Can translocation.

    Science.gov (United States)

    Ichijo, Takamasa; Chrousos, George P; Kino, Tomoshige

    2008-02-13

    Set/template-activating factor (TAF)-Ibeta, part of the Set-Can oncogene product found in acute undifferentiated leukemia, is a component of the inhibitor of acetyltransferases (INHAT) complex. Set/TAF-Ibeta interacted with the DNA-binding domain of the glucocorticoid receptor (GR) in yeast two-hybrid screening, and repressed GR-induced transcriptional activity of a chromatin-integrated glucocorticoid-responsive and a natural promoter. Set/TAF-Ibeta was co-precipitated with glucocorticoid response elements (GREs) of these promoters in the absence of dexamethasone, while addition of the hormone caused dissociation of Set/TAF-Ibeta from and attraction of the p160-type coactivator GRIP1 to the promoter GREs. Set-Can fusion protein, on the other hand, did not interact with GR, was constitutively co-precipitated with GREs and suppressed GRIP1-induced enhancement of GR transcriptional activity and histone acetylation. Thus, Set/TAF-Ibeta acts as a ligand-activated GR-responsive transcriptional repressor, while Set-Can does not retain physiologic responsiveness to ligand-bound GR, possibly contributing to the poor responsiveness of Set-Can-harboring leukemic cells to glucocorticoids.

  19. Immunoglobulin gene usage in the human anti-pathogen response.

    Science.gov (United States)

    Newkirk, M M; Rioux, J D

    1995-09-01

    The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Radiation and desiccation response motif mediates radiation induced gene expression in D. radiodurans

    International Nuclear Information System (INIS)

    Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar

    2015-01-01

    Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that

  1. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    International Nuclear Information System (INIS)

    Teodorov, E.; Ferrari, M.F.R.; Fior-Chadi, D.R.; Camarini, R.; Felício, L.F.

    2012-01-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  2. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Teodorov, E. [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, São Paulo, SP (Brazil); Ferrari, M.F.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Fior-Chadi, D.R. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Camarini, R. [Departamento de Farmacologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil); Felício, L.F. [Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP (Brazil)

    2012-06-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  3. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Directory of Open Access Journals (Sweden)

    E. Teodorov

    2012-10-01

    Full Text Available The periaqueductal gray (PAG has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc or 0.9% saline (up to 1 mL/kg and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05 because a lower percentage of kappa group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR. A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05 and lactating female rats (P < 0.01, with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in

  4. Transcriptomic analysis of salt stress responsive genes in Rhazya stricta.

    Directory of Open Access Journals (Sweden)

    Nahid H Hajrah

    Full Text Available Rhazya stricta is an evergreen shrub that is widely distributed across Western and South Asia, and like many other members of the Apocynaceae produces monoterpene indole alkaloids that have anti-cancer properties. This species is adapted to very harsh desert conditions making it an excellent system for studying tolerance to high temperatures and salinity. RNA-Seq analysis was performed on R. stricta exposed to severe salt stress (500 mM NaCl across four time intervals (0, 2, 12 and 24 h to examine mechanisms of salt tolerance. A large number of transcripts including genes encoding tetrapyrroles and pentatricopeptide repeat (PPR proteins were regulated only after 12 h of stress of seedlings grown in controlled greenhouse conditions. Mechanisms of salt tolerance in R. stricta may involve the upregulation of genes encoding chaperone protein Dnaj6, UDP-glucosyl transferase 85a2, protein transparent testa 12 and respiratory burst oxidase homolog protein b. Many of the highly-expressed genes act on protecting protein folding during salt stress and the production of flavonoids, key secondary metabolites in stress tolerance. Other regulated genes encode enzymes in the porphyrin and chlorophyll metabolic pathway with important roles during plant growth, photosynthesis, hormone signaling and abiotic responses. Heme biosynthesis in R. stricta leaves might add to the level of salt stress tolerance by maintaining appropriate levels of photosynthesis and normal plant growth as well as by the participation in reactive oxygen species (ROS production under stress. We speculate that the high expression levels of PPR genes may be dependent on expression levels of their targeted editing genes. Although the results of PPR gene family indicated regulation of a large number of transcripts under salt stress, PPR actions were independent of the salt stress because their RNA editing patterns were unchanged.

  5. Calmodulin Gene Expression in Response to Mechanical Wounding and Botrytis cinerea Infection in Tomato Fruit

    Directory of Open Access Journals (Sweden)

    Hui Peng

    2014-08-01

    Full Text Available Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.

  6. Determination of relative assay response factors for toxic chlorinated and bromiated dioxins/furans using an enyme immunoassay (EIA) and a chemically-activated luciferase gene expression cell bioassay (CALUX)

    Science.gov (United States)

    Determination of dioxin-like activity requires knowledge of both the concentration and toxicity to evaluate the risk of adverse human health and environmental effects. The dioxin-like response of several polybrominated dibenzo-p-dioxins/furans (PBDDs/Fs) and polybrominated/chlori...

  7. Gene transcription and biomarker responses in the clam Ruditapes philippinarum after exposure to ibuprofen

    International Nuclear Information System (INIS)

    Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca; Marin, Maria Gabriella; Matozzo, Valerio

    2013-01-01

    Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 μg IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both “IBU concentration” and “exposure duration” on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.

  8. Gene Expression Programs in Response to Hypoxia: Cell Type Specificity and Prognostic Significance in Human Cancers.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis

  9. A TAD further: exogenous control of gene activation.

    Science.gov (United States)

    Mapp, Anna K; Ansari, Aseem Z

    2007-01-23

    Designer molecules that can be used to impose exogenous control on gene transcription, artificial transcription factors (ATFs), are highly desirable as mechanistic probes of gene regulation, as potential therapeutic agents, and as components of cell-based devices. Recently, several advances have been made in the design of ATFs that activate gene transcription (activator ATFs), including reports of small-molecule-based systems and ATFs that exhibit potent activity. However, the many open mechanistic questions about transcriptional activators, in particular, the structure and function of the transcriptional activation domain (TAD), have hindered rapid development of synthetic ATFs. A compelling need thus exists for chemical tools and insights toward a more detailed portrait of the dynamic process of gene activation.

  10. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  11. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  12. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Science.gov (United States)

    2013-01-01

    Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the

  13. Identification of formaldehyde-responsive genes by suppression subtractive hybridization

    International Nuclear Information System (INIS)

    Lee, Min-Ho; Kim, Young-Ae; Na, Tae-Young; Kim, Sung-Hye; Shin, Young Kee; Lee, Byung-Hoon; Shin, Ho-Sang; Lee, Mi-Ock

    2008-01-01

    Formaldehyde is frequently used in indoor household and occupational environments. Inhalation of formaldehyde invokes an inflammatory response, including a variety of allergic signs and symptoms. Therefore, formaldehyde has been considered as the most prevalent cause of sick building syndrome, which has become a major social problem, especially in developing urban areas. Further formaldehyde is classified as a genotoxicant in the respiratory tract of rats and humans. To better understand the molecular mechanisms involved in formaldehyde intoxication, we sought differentially regulated genes by formaldehyde exposure to Hs 680.Tr human trachea cells, using polymerase chain reaction (PCR)-based suppression subtractive hybridization. We identified 27 different formaldehyde-inducible genes, including those coding for the major histocompatibility complex, class IA, calcyclin, glutathione S-transferase pi, mouse double minute 2 (MDM2), platelet-derived growth factor receptor alpha, and which are known to be associated with cell proliferation and differentiation, immunity and inflammation, and detoxification. Induction of these genes by formaldehyde treatment was confirmed by reverse transcription PCR and western blot analysis. Further, the expression of calcyclin, glutathione S-transferase pi, PDGFRA and MDM2 were significantly induced in the tracheal epithelium of Sprague Dawley rats after formaldehyde inhalation. Our results suggest that the elevated levels of these genes may be associated with the formaldehyde-induced toxicity, and that they deserve evaluation as potential biomarkers for formaldehyde intoxication

  14. Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles.

    Science.gov (United States)

    Niazi, Javed H; Sang, Byoung-In; Kim, Yeon Seok; Gu, Man Bock

    2011-08-01

    Silver nanoparticles (AgNPs), exhibiting a broad size range and morphologies with highly reactive facets, which are widely applicable in real-life but not fully verified for biosafety and ecotoxicity, were subjected to report transcriptome profile in yeast Saccharomyces cerevisiae. A large number of genes accounted for ∼3% and ∼5% of the genome affected by AgNPs and Ag-ions, respectively. Principal component and cluster analysis suggest that the different physical forms of Ag were the major cause in differential expression profile. Among 90 genes affected by both AgNPs and Ag-ions, metalloprotein mediating high resistance to copper (CUP1-1 and CUP1-2) were strongly induced by AgNPs (∼45-folds) and Ag-ions (∼22-folds), respectively. A total of 17 genes, responsive to chemical stimuli, stress, and transport processes, were differentially induced by AgNPs. The differential expression was also seen with Ag-ions that affected 73 up- and 161 down-regulating genes, and most of these were involved in ion transport and homeostasis. This study provides new information on the knowledge for impact of nanoparticles on living microorganisms that can be extended to other nanoparticles.

  15. Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.

    Science.gov (United States)

    Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M

    2010-10-01

    Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response.

  16. Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

    Directory of Open Access Journals (Sweden)

    Luciane S Fonseca

    Full Text Available Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2 one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

  17. Assessing the Role of ETHYLENE RESPONSE FACTOR Transcriptional Repressors in Salicylic Acid-Mediated Suppression of Jasmonic Acid-Responsive Genes

    NARCIS (Netherlands)

    Caarls, Lotte; van der Does, Adriana; Hickman, Richard; Jansen, Wouter; van Verk, Marcel; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M

    2017-01-01

    Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the

  18. Redox-active antibiotics control gene expression and community behavior in divergent bacteria.

    Science.gov (United States)

    Dietrich, Lars E P; Teal, Tracy K; Price-Whelan, Alexa; Newman, Dianne K

    2008-08-29

    It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for stress responses, despite the fact that many of these organisms still produce redox-active small molecules, which indicates that redox-active pigments play a role independent of oxidative stress. These compounds had profound effects on the structural organization of colony biofilms in both P. aeruginosa and S. coelicolor, which shows that "secondary metabolites" play important conserved roles in gene expression and development.

  19. GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses

    Science.gov (United States)

    Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli

    2016-03-01

    Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.

  20. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  1. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

    Science.gov (United States)

    Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-02-01

    Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    hence presumably of the GDF8 gene, in both CHO and C2C12 cultured cells. In vitro the MYOD1-A allelic variant could up-regulate the expression of MYOD1 gene. Additionally, we could assess a different response of in vitro gene expression according to cell type used to transfect constructs, suggesting that MyoD activation is regulated by mechanisms that are specific of myoblasts.

  3. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  4. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  5. Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays

    Science.gov (United States)

    Badri, Hanène; Monsieurs, Pieter; Coninx, Ilse; Nauts, Robin; Wattiez, Ruddy; Leys, Natalie

    2015-01-01

    The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA) and Calvin-Benson-Bassham (CBB) cycles, combined with an activation of the pentose phosphate pathway (PPP). For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation resistance of

  6. Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays.

    Directory of Open Access Journals (Sweden)

    Hanène Badri

    Full Text Available The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA and Calvin-Benson-Bassham (CBB cycles, combined with an activation of the pentose phosphate pathway (PPP. For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation

  7. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  8. The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.

    Science.gov (United States)

    Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather

    2012-07-01

    • Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  9. Robust, synergistic regulation of human gene expression using TALE activators.

    Science.gov (United States)

    Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

    2013-03-01

    Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

  10. Onconase responsive genes in human mesothelioma cells: implications for an RNA damaging therapeutic agent

    International Nuclear Information System (INIS)

    Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima

    2010-01-01

    Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment

  11. Testing differential susceptibility: Plasticity genes, the social environment, and their interplay in adolescent response inhibition.

    Science.gov (United States)

    Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K

    2017-06-01

    Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.

  12. Transcriptional 'memory' of a stress: transient chromatin and memory (epigenetic) marks at stress-response genes.

    Science.gov (United States)

    Avramova, Zoya

    2015-07-01

    Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. © 2015 The Author The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. Esophageal cancer related gene-4 is a choroid plexus-derived injury response gene: evidence for a biphasic response in early and late brain injury.

    Directory of Open Access Journals (Sweden)

    Sonia Podvin

    Full Text Available By virtue of its ability to regulate the composition of cerebrospinal fluid (CSF, the choroid plexus (CP is ideally suited to instigate a rapid response to traumatic brain injury (TBI by producing growth regulatory proteins. For example, Esophageal Cancer Related Gene-4 (Ecrg4 is a tumor suppressor gene that encodes a hormone-like peptide called augurin that is present in large concentrations in CP epithelia (CPe. Because augurin is thought to regulate senescence, neuroprogenitor cell growth and differentiation in the CNS, we evaluated the kinetics of Ecrg4 expression and augurin immunoreactivity in CPe after CNS injury. Adult rats were injured with a penetrating cortical lesion and alterations in augurin immunoreactivity were examined by immunohistochemistry. Ecrg4 gene expression was characterized by in situ hybridization. Cell surface augurin was identified histologically by confocal microscopy and biochemically by sub-cellular fractionation. Both Ecrg4 gene expression and augurin protein levels were decreased 24-72 hrs post-injury but restored to uninjured levels by day 7 post-injury. Protein staining in the supraoptic nucleus of the hypothalamus, used as a control brain region, did not show a decrease of auguin immunoreactivity. Ecrg4 gene expression localized to CPe cells, and augurin protein to the CPe ventricular face. Extracellular cell surface tethering of 14 kDa augurin was confirmed by cell surface fractionation of primary human CPe cells in vitro while a 6-8 kDa fragment of augurin was detected in conditioned media, indicating release from the cell surface by proteolytic processing. In rat CSF however, 14 kDa augurin was detected. We hypothesize the initial release and proteolytic processing of augurin participates in the activation phase of injury while sustained Ecrg4 down-regulation is dysinhibitory during the proliferative phase. Accordingly, augurin would play a constitutive inhibitory function in normal CNS while down

  14. A WRKY gene from Tamarix hispida, ThWRKY4, mediates abiotic stress responses by modulating reactive oxygen species and expression of stress-responsive genes.

    Science.gov (United States)

    Zheng, Lei; Liu, Guifeng; Meng, Xiangnan; Liu, Yujia; Ji, Xiaoyu; Li, Yanbang; Nie, Xianguang; Wang, Yucheng

    2013-07-01

    WRKY transcription factors are involved in various biological processes, such as development, metabolism and responses to stress. However, their exact roles in abiotic stress tolerance are largely unknown. Here, we demonstrated a working model for the function of a WRKY gene (ThWRKY4) from Tamarix hispida in the stress response. ThWRKY4 is highly induced by abscisic acid (ABA), salt and drought in the early period of stress (stress for 3, 6, or 9 h), which can be regulated by ABF (ABRE binding factors) and Dof (DNA binding with one finger), and also can be crossregulated by other WRKYs and autoregulated as well. Overexpression of ThWRKY4 conferred tolerance to salt, oxidative and ABA treatment in transgenic plants. ThWRKY4 can improve the tolerance to salt and ABA treatment by improving activities of superoxide dismutase and peroxidase, decreasing levels of O2 (-) and H2O2, reducing electrolyte leakage, keeping the loss of chlorophyll, and protecting cells from death. Microarray analyses showed that overexpression of ThWRKY4 in Arabidopsis leads to 165 and 100 genes significantly up- and downregulated, respectively. Promoter scanning analysis revealed that ThWRKY4 regulates the gene expression via binding to W-box motifs present in their promoter regions. This study shows that ThWRKY4 functions as a transcription factor to positively modulate abiotic stress tolerances, and is involved in modulating reactive oxygen species.

  15. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    Directory of Open Access Journals (Sweden)

    Maryam Rakhshandehroo

    2010-01-01

    Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  16. Gene × physical activity interactions in obesity

    DEFF Research Database (Denmark)

    Ahmad, Shafqat; Rukh, Gull; Varga, Tibor V

    2013-01-01

    Numerous obesity loci have been identified using genome-wide association studies. A UK study indicated that physical activity may attenuate the cumulative effect of 12 of these loci, but replication studies are lacking. Therefore, we tested whether the aggregate effect of these loci is diminished...... in adults of European ancestry reporting high levels of physical activity. Twelve obesity-susceptibility loci were genotyped or imputed in 111,421 participants. A genetic risk score (GRS) was calculated by summing the BMI-associated alleles of each genetic variant. Physical activity was assessed using self...... combined using meta-analysis weighted by cohort sample size. The meta-analysis yielded a statistically significant GRS × physical activity interaction effect estimate (Pinteraction  = 0.015). However, a statistically significant interaction effect was only apparent in North American cohorts (n = 39...

  17. Innate immune responses: Crosstalk of signaling and regulation of gene transcription

    International Nuclear Information System (INIS)

    Zhong Bo; Tien Po; Shu Hongbing

    2006-01-01

    Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes

  18. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  19. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  20. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

    Science.gov (United States)

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

    2012-03-01

    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  1. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    International Nuclear Information System (INIS)

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-01-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses

  2. PKG in honey bees: spatial expression, Amfor gene expression, sucrose responsiveness, and division of labor.

    Science.gov (United States)

    Thamm, Markus; Scheiner, Ricarda

    2014-06-01

    Division of labor is a hallmark of social insects. In honey bees, division of labor involves transition of female workers from one task to the next. The most distinct tasks are nursing (providing food for the brood) and foraging (collecting pollen and nectar). The brain mechanisms regulating this form of behavioral plasticity have largely remained elusive. Recently, it was suggested that division of labor is based on nutrition-associated signaling pathways. One highly conserved gene associated with food-related behavior across species is the foraging gene, which encodes a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG). Our analysis of this gene reveals the presence of alternative splicing in the honey bee. One isoform is expressed in the brain. Expression of this isoform is most pronounced in the mushroom bodies, the subesophageal ganglion, and the corpora allata. Division of labor and sucrose responsiveness in honey bees correlate significantly with foraging gene expression in distinct brain regions. Activating PKG selectively increases sucrose responsiveness in nurse bees to the level of foragers, whereas the same treatment does not affect responsiveness to light. These findings demonstrate a direct link between PKG signaling in distinct brain areas and division of labor. Furthermore, they demonstrate that the difference in sensory responsiveness between nurse bees and foragers can be compensated for by activating PKG. Our findings on the function of PKG in regulating specific sensory responsiveness and social organization offer valuable indications for the function of the cGMP/PKG pathway in many other insects and vertebrates. Copyright © 2013 Wiley Periodicals, Inc.

  3. OxyGene: an innovative platform for investigating oxidative-response genes in whole prokaryotic genomes

    Directory of Open Access Journals (Sweden)

    Barloy-Hubler Frédérique

    2008-12-01

    Full Text Available Abstract Background Oxidative stress is a common stress encountered by living organisms and is due to an imbalance between intracellular reactive oxygen and nitrogen species (ROS, RNS and cellular antioxidant defence. To defend themselves against ROS/RNS, bacteria possess a subsystem of detoxification enzymes, which are classified with regard to their substrates. To identify such enzymes in prokaryotic genomes, different approaches based on similarity, enzyme profiles or patterns exist. Unfortunately, several problems persist in the annotation, classification and naming of these enzymes due mainly to some erroneous entries in databases, mistake propagation, absence of updating and disparity in function description. Description In order to improve the current annotation of oxidative stress subsystems, an innovative platform named OxyGene has been developed. It integrates an original database called OxyDB, holding thoroughly tested anchor-based signatures associated to subfamilies of oxidative stress enzymes, and a new anchor-driven annotator, for ab initio detection of ROS/RNS response genes. All complete Bacterial and Archaeal genomes have been re-annotated, and the results stored in the OxyGene repository can be interrogated via a Graphical User Interface. Conclusion OxyGene enables the exploration and comparative analysis of enzymes belonging to 37 detoxification subclasses in 664 microbial genomes. It proposes a new classification that improves both the ontology and the annotation of the detoxification subsystems in prokaryotic whole genomes, while discovering new ORFs and attributing precise function to hypothetical annotated proteins. OxyGene is freely available at: http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software

  4. Recombination activating activity of XRCC1 analogous genes in X-ray sensitive and resistant CHO cell lines

    International Nuclear Information System (INIS)

    Golubnitchaya-Labudova, O.; Hoefer, M.; Portele, A.; Vacata, V.; Rink, H.; Lubec, G.

    1997-01-01

    The XRCC1 gene (X-ray repair cross complementing) complements the DNA repair deficiency of the radiation sensitive Chinese hamster ovary (CHO) mutant cell line EM9 but the mechanism of the correction is not elucidated yet. XRCC1 shows substantial homology to the RAG2 gene (recombination activating gene) and we therefore tried to answer the question, whether structural similarities (sequence of a putative recombination activating domain, aa 332-362 for XRCC1 and aa 286-316 in RAG2) would reflect similar functions of the homologous, putative recombination activating domain. PCR experiments revealed that no sequence homologous to the structural part of human XRCC1 was present in cDNA of CHO. Differential display demonstrated two putative recombination activating in the parental CHO line AA8 and one in the radiosensitive mutant EM9. Southern blot experiments showed the presence of several genes with partial homology to human XRCC1. Recombination studies consisted of expressing amplified target domains within chimeric proteins in recA - bacteria and subsequent detection of recombination events by sequencing the recombinant plasmids. Recombination experiments demonstrated recombination activating activity of all putative recombination activating domains amplified from AA8 and EM9 genomes as reflected by deletions within the inserts of the recombinant plasmids. The recombination activating activity of XRCC1 analogues could explain a mechanism responsible for the correction of the DNA repair defect in EM9. (author)

  5. Massive activation of archaeal defense genes during viral infection.

    Science.gov (United States)

    Quax, Tessa E F; Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob; Prangishvili, David

    2013-08-01

    Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo.

  6. Stat1-independent regulation of gene expression in response to IFN-γ

    Science.gov (United States)

    Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.

    2001-01-01

    Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994

  7. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  8. PPARα gene expression is up-regulated by LXR and PXR activators in the small intestine

    International Nuclear Information System (INIS)

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro

    2008-01-01

    LXR, PXR, and PPARα are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPARα gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPARα in the mouse small intestine

  9. Gene Expression Deconvolution for Uncovering Molecular Signatures in Response to Therapy in Juvenile Idiopathic Arthritis.

    Directory of Open Access Journals (Sweden)

    Ang Cui

    Full Text Available Gene expression-based signatures help identify pathways relevant to diseases and treatments, but are challenging to construct when there is a diversity of disease mechanisms and treatments in patients with complex diseases. To overcome this challenge, we present a new application of an in silico gene expression deconvolution method, ISOpure-S1, and apply it to identify a common gene expression signature corresponding to response to treatment in 33 juvenile idiopathic arthritis (JIA patients. Using pre- and post-treatment gene expression profiles only, we found a gene expression signature that significantly correlated with a reduction in the number of joints with active arthritis, a measure of clinical outcome (Spearman rho = 0.44, p = 0.040, Bonferroni correction. This signature may be associated with a decrease in T-cells, monocytes, neutrophils and platelets. The products of most differentially expressed genes include known biomarkers for JIA such as major histocompatibility complexes and interleukins, as well as novel biomarkers including α-defensins. This method is readily applicable to expression datasets of other complex diseases to uncover shared mechanistic patterns in heterogeneous samples.

  10. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  11. Cellular Stress Response Gene Expression During Upper and Lower Body High Intensity Exercises.

    Science.gov (United States)

    Kochanowicz, Andrzej; Sawczyn, Stanisław; Niespodziński, Bartłomiej; Mieszkowski, Jan; Kochanowicz, Kazimierz; Żychowska, Małgorzata

    2017-01-01

    The aim was to compare the effect of upper and lower body high-intensity exercise on chosen genes expression in athletes and non-athletes. Fourteen elite male artistic gymnasts (EAG) aged 20.6 ± 3.3 years and 14 physically active men (PAM) aged 19.9 ± 1.0 years performed lower and upper body 30 s Wingate Tests. Blood samples were collected before, 5 and 30 minutes after each effort to assess gene expression via PCR. Significantly higher mechanical parameters after lower body exercise was observed in both groups, for relative power (8.7 ± 1.2 W/kg in gymnasts, 7.2 ± 1.2 W/kg in controls, p = 0.01) and mean power (6.7 ± 0.7 W/kg in gymnasts, 5.4 ± 0.8 W/kg in controls, p = 0.01). No differences in lower versus upper body gene expression were detected for all tested genes as well as between gymnasts and physical active man. For IL-6 m-RNA time-dependent effect was observed. Because of no significant differences in expression of genes associated with cellular stress response the similar adaptive effect to exercise may be obtained so by lower and upper body exercise.

  12. Study of the Genes and Mechanism Involved in the Radioadaptive Response

    Science.gov (United States)

    Dasgupta, Pushan R.

    2009-01-01

    The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor

  13. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  14. Evolutionary relationships between miRNA genes and their activity.

    Science.gov (United States)

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  15. Global gene expression response to telomerase in bovine adrenocortical cells

    International Nuclear Information System (INIS)

    Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H.

    2005-01-01

    The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state

  16. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes.

    Science.gov (United States)

    Xiao, Yun-yi; Chen, Jian-ye; Kuang, Jiang-fei; Shan, Wei; Xie, Hui; Jiang, Yue-ming; Lu, Wang-jin

    2013-05-01

    The involvement of ethylene response factor (ERF) transcription factor (TF) in the transcriptional regulation of ethylene biosynthesis genes during fruit ripening remains largely unclear. In this study, 15 ERF genes, designated as MaERF1-MaERF15, were isolated and characterized from banana fruit. These MaERFs were classified into seven of the 12 known ERF families. Subcellular localization showed that MaERF proteins of five different subfamilies preferentially localized to the nucleus. The 15 MaERF genes displayed differential expression patterns and levels in peel and pulp of banana fruit, in association with four different ripening treatments caused by natural, ethylene-induced, 1-methylcyclopropene (1-MCP)-delayed, and combined 1-MCP and ethylene treatments. MaERF9 was upregulated while MaERF11 was downregulated in peel and pulp of banana fruit during ripening or after treatment with ethylene. Furthermore, yeast-one hybrid (Y1H) and transient expression assays showed that the potential repressor MaERF11 bound to MaACS1 and MaACO1 promoters to suppress their activities and that MaERF9 activated MaACO1 promoter activity. Interestingly, protein-protein interaction analysis revealed that MaERF9 and -11 physically interacted with MaACO1. Taken together, these results suggest that MaERFs are involved in banana fruit ripening via transcriptional regulation of or interaction with ethylene biosynthesis genes.

  17. Distinguishing the rates of gene activation from phenotypic variations

    OpenAIRE

    Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun

    2015-01-01

    Background Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which r...

  18. Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

    Science.gov (United States)

    Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

    2013-01-01

    Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

  19. Gene transcription and biomarker responses in the clam Ruditapes philippinarum after exposure to ibuprofen

    Energy Technology Data Exchange (ETDEWEB)

    Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca [Department of Comparative Biomedicine and Food Science, University of Padova, Viale dell' Universita 16, Legnaro (Padova) (Italy); Marin, Maria Gabriella [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy); Matozzo, Valerio, E-mail: matozzo@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy)

    2013-01-15

    Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 {mu}g IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both 'IBU concentration' and 'exposure duration' on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.

  20. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    Science.gov (United States)

    2011-01-01

    Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599

  1. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    Directory of Open Access Journals (Sweden)

    Lisowska Katarzyna Marta

    2011-06-01

    Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.

  2. Network-based association of hypoxia-responsive genes with cardiovascular diseases

    International Nuclear Information System (INIS)

    Wang, Rui-Sheng; Oldham, William M; Loscalzo, Joseph

    2014-01-01

    Molecular oxygen is indispensable for cellular viability and function. Hypoxia is a stress condition in which oxygen demand exceeds supply. Low cellular oxygen content induces a number of molecular changes to activate regulatory pathways responsible for increasing the oxygen supply and optimizing cellular metabolism under limited oxygen conditions. Hypoxia plays critical roles in the pathobiology of many diseases, such as cancer, heart failure, myocardial ischemia, stroke, and chronic lung diseases. Although the complicated associations between hypoxia and cardiovascular (and cerebrovascular) diseases (CVD) have been recognized for some time, there are few studies that investigate their biological link from a systems biology perspective. In this study, we integrate hypoxia genes, CVD genes, and the human protein interactome in order to explore the relationship between hypoxia and cardiovascular diseases at a systems level. We show that hypoxia genes are much closer to CVD genes in the human protein interactome than that expected by chance. We also find that hypoxia genes play significant bridging roles in connecting different cardiovascular diseases. We construct a hypoxia-CVD bipartite network and find several interesting hypoxia-CVD modules with significant gene ontology similarity. Finally, we show that hypoxia genes tend to have more CVD interactors in the human interactome than in random networks of matching topology. Based on these observations, we can predict novel genes that may be associated with CVD. This network-based association study gives us a broad view of the relationships between hypoxia and cardiovascular diseases and provides new insights into the role of hypoxia in cardiovascular biology. (paper)

  3. Transcriptional feedback regulation of YUCCA genes in response to auxin levels in Arabidopsis.

    Science.gov (United States)

    Suzuki, Masashi; Yamazaki, Chiaki; Mitsui, Marie; Kakei, Yusuke; Mitani, Yuka; Nakamura, Ayako; Ishii, Takahiro; Soeno, Kazuo; Shimada, Yukihisa

    2015-08-01

    The IPyA pathway, the major auxin biosynthesis pathway, is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels. The phytohormone auxin plays an important role in plant growth and development, and levels of active free auxin are determined by biosynthesis, conjugation, and polar transport. Unlike conjugation and polar transport, little is known regarding the regulatory mechanism of auxin biosynthesis. We discovered that expression of genes encoding indole-3-pyruvic acid (IPyA) pathway enzymes is regulated by elevated or reduced active auxin levels. Expression levels of TAR2, YUC1, YUC2, YUC4, and YUC6 were downregulated in response to synthetic auxins [1-naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D)] exogenously applied to Arabidopsis thaliana L. seedlings. Concomitantly, reduced levels of endogenous indole-3-acetic acid (IAA) were observed. Alternatively, expression of these YUCCA genes was upregulated by the auxin biosynthetic inhibitor kynurenine in Arabidopsis seedlings, accompanied by reduced IAA levels. These results indicate that expression of YUCCA genes is regulated by active auxin levels. Similar results were also observed in auxin-overproduction and auxin-deficient mutants. Exogenous application of IPyA to Arabidopsis seedlings preincubated with kynurenine increased endogenous IAA levels, while preincubation with 2,4-D reduced endogenous IAA levels compared to seedlings exposed only to IPyA. These results suggest that in vivo conversion of IPyA to IAA was enhanced under reduced auxin levels, while IPyA to IAA conversion was depressed in the presence of excess auxin. Based on these results, we propose that the IPyA pathway is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels.

  4. Trait specific expression profiling of salt stress responsive genes in diverse rice genotypes as determined by modified Significance Analysis of Microarrays

    Directory of Open Access Journals (Sweden)

    Mohammad Rashed Hossain

    2016-05-01

    Full Text Available Stress responsive gene expression is commonly profiled in a comparative manner involving different stress conditions or genotypes with contrasting reputation of tolerance/resistance. In contrast, this research exploited a wide natural variation in terms of taxonomy, origin and salt sensitivity in eight genotypes of rice to identify the trait specific patterns of gene expression under salt stress. Genome wide transcptomic responses were interrogated by the weighted continuous morpho-physiological trait responses using modified Significance Analysis of Microarrays. More number of genes was found to be differentially expressed under salt stressed compared to that of under unstressed conditions. Higher numbers of genes were observed to be differentially expressed for the traits shoot Na+/K+, shoot Na+, root K+, biomass and shoot Cl-, respectively. The results identified around sixty genes to be involved in Na+, K+ and anion homeostasis, transport and transmembrane activity under stressed conditions. Gene Ontology (GO enrichment analysis identified 1.36% (578 genes of the entire transcriptome to be involved in the major molecular functions such as signal transduction (>150 genes, transcription factor (81 genes and translation factor activity (62 genes etc. under salt stress. Chromosomal mapping of the genes suggests that majority of the genes are located on chromosomes 1, 2, 3, 6 & 7. The gene network analysis showed that the transcription factors and translation initiation factors formed the major gene networks and are mostly active in nucleus, cytoplasm and mitochondria whereas the membrane and vesicle bound proteins formed a secondary network active in plasma membrane and vacuoles. The novel genes and the genes with unknown functions thus identified provide picture of a synergistic salinity response representing the potentially fundamental mechanisms that are active in the wide natural genetic background of rice and will be of greater use once

  5. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis

    Directory of Open Access Journals (Sweden)

    Larissa Lazzarini Furlan

    2017-11-01

    Conclusions: This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene.

  6. Genome wide analyses of metal responsive genes in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Michael eAschner

    2012-04-01

    Full Text Available Metals are major contaminants that influence human health. Many metals have physiologic roles, but excessive levels can be harmful. Advances in technology have made toxicogenomic analyses possible to characterize the effects of metal exposure on the entire genome. Much of what is known about cellular responses to metals has come from mammalian systems; however the use of non-mammalian species is gaining wider attention. Caenorhabditis elegans (C. elegans is a small round worm whose genome has been fully sequenced and its development from egg to adult is well characterized. It is an attractive model for high throughput screens due to its short lifespan, ease of genetic mutability, low cost and high homology with humans. Research performed in C. elegans has led to insights in apoptosis, gene expression and neurodegeneration, all of which can be altered by metal exposure. Additionally, by using worms one can potentially study how the mechanisms that underline differential responses to metals in nematodes and humans, allowing for identification of novel pathways and therapeutic targets. In this review, toxicogenomic studies performed in C. elegans exposed to various metals will be discussed, highlighting how this non-mammalian system can be utilized to study cellular processes and pathways induced by metals. Recent work focusing on neurodegeneration in Parkinson’s disease will be discussed as an example of the usefulness of genetic screens in C. elegans and the novel findings that can be produced.

  7. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  8. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.

    Science.gov (United States)

    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale

    2016-08-01

    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis.

    Science.gov (United States)

    Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni

    2004-12-01

    Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.

  10. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2006-10-01

    Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent

  11. The landscape of human genes involved in the immune response to parasitic worms

    Directory of Open Access Journals (Sweden)

    Fumagalli Matteo

    2010-08-01

    Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.

  12. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

    Directory of Open Access Journals (Sweden)

    Chevalier Frédéric

    2012-01-01

    Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host

  13. Gene expression patterns of the coral Acropora millepora in response to contact with macroalgae

    Science.gov (United States)

    Shearer, T. L.; Rasher, D. B.; Snell, T. W.; Hay, M. E.

    2012-12-01

    Contact with macroalgae often causes coral mortality, but the roles of abrasion versus shading versus allelopathy in these interactions are rarely clear, and effects on gene expression are unknown. Identification of gene expression changes within corals in response to contact with macroalgae can provide insight into the mode of action of allelochemicals, as well as reveal transcriptional strategies of the coral that mitigate damage from this competitive interaction, enabling the coral to survive. Gene expression responses of the coral Acropora millepora after long-term (20 days) direct contact with macroalgae ( Chlorodesmis fastigiata, Dictyota bartayresiana, Galaxaura filamentosa, and Turbinaria conoides) and short-term (1 and 24 h) exposure to C. fastigiata thalli and their hydrophobic extract were assessed. After 20 days of exposure, T. conoides thalli elicited no significant change in visual bleaching or zooxanthellae PSII quantum yield within A. millepora nubbins, but stimulated the greatest alteration in gene expression of all treatments. Chlorodesmis fastigiata, D. bartayresiana, and G. filamentosa caused significant visual bleaching of coral nubbins and reduced the PSII quantum yield of associated zooxanthellae after 20 days, but elicited fewer changes in gene expression relative to T. conoides at day 20. To evaluate initial molecular processes leading to reduction of zooxanthella PSII quantum yield, visual bleaching, and coral death, short-term exposures to C. fastigiata thalli and hydrophobic extracts were conducted; these interactions revealed protein degradation and significant changes in catalytic and metabolic activity within 24 h of contact. These molecular responses are consistent with the hypothesis that allelopathic interactions lead to alteration of signal transduction and an imbalance between reactive oxidant species production and antioxidant capabilities within the coral holobiont. This oxidative imbalance results in rapid protein degradation

  14. Gene expression profile of endoscopically active and inactive ulcerative colitis: preliminary data.

    Science.gov (United States)

    Ţieranu, Cristian George; Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Popa, Caterina; Mănuc, Mircea; Ţieranu, Ioana; Preda, Carmen Monica; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel

    2017-01-01

    Multiple cytokines and chemokines related to immune response, apoptosis and inflammation have been identified as molecules implicated in ulcerative colitis (UC) pathogenesis. The aim of this study was to identify the differences at gene expression level of a panel of candidate genes in mucosa from patients with active UC (UCA), patients in remission (UCR), and normal controls. Eleven individuals were enrolled in the study: eight UC patients (four with active lesions, four with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression profile was evaluated by polymerase chain reaction (PCR) array, investigating 84 genes implicated in apoptosis, inflammation, immune response, cellular adhesion, tissue remodeling and mucous secretion. Seventeen and three genes out of 84 were found significantly differentially expressed in UCA and UCR compared to controls, respectively. In particular, REG1A and CHI3L1 genes reported an up-regulation in UCA with a fold difference above 200. In UCR patients, the levels of CASP1, LYZ and ISG15 were different compared to controls. However, since a significant up-regulation of both CASP1 and LYZ was observed also in the UCA group, only ISG15 levels remained associated to the remission state. ISG15, that plays a key role in the innate immune response, seemed to be specifically associated to the UC remission state. These preliminary data represent a starting point for defining the gene profile of UC in different stages in Romanian population. Identification of genes implicated in UC pathogenesis could be useful to select new therapeutic targets.

  15. Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora.

    Science.gov (United States)

    Norman-Setterblad, C; Vidal, S; Palva, E T

    2000-04-01

    We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.

  16. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  17. Acute toxicity and gene responses induced by endosulfan in zebrafish (Danio rerio embryos

    Directory of Open Access Journals (Sweden)

    Young-Sun Moon

    2016-10-01

    Full Text Available Endosulfan has been listed as a persistent organic pollutant, and is frequently found in agricultural environments during monitoring processes owing to its heavy use and persistent characteristics. This study was conducted to understand the effects of endosulfan on the development of zebrafish (Danio rerio embryos by exposing them to a specific range of endosulfan concentrations. Exposing zebrafish embryos to endosulfan for 96 h yielded no acute toxicity until the concentration reached 1500 μg L−1, whereas malformed zebrafish larvae developed severely curved spines and shortened tails. About 50% of zebrafish larvae were malformed when exposed to 600 μg L−1 of endosulfan. Comparative gene expression using real-time quantitative polymerase chain reaction was assessed using endosulfan-exposed zebrafish embryos. CYP1A and CYP3A were significantly enhanced in response to endosulfan treatment. Two genes, acacb and fasn, encoding acetyl-CoA carboxylase b and fatty acid synthase proteins, respectively, were also up-regulated after treating zebrafish embryos with endosulfan. These genes are also involved in fatty acid biosynthesis. The genes encoding vitellogenin and Hsp70 increased in a concentration-dependent manner in embryos. Finally, biochemical studies showed that acetylcholinesterase activity was reduced, whereas glutathione S-transferase and carboxylesterase activities were enhanced in zebrafish embryos after endosulfan treatment. These biochemical and molecular biological differences might be used for tools to determine contamination of endosulfan in the aquatic environment.

  18. Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells

    Directory of Open Access Journals (Sweden)

    Yoshiaki Tabuchi

    2013-11-01

    Full Text Available Although low-intensity pulsed ultrasound (LIPUS has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2 did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down, which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells.

  19. TaWRKY68 responses to biotic stresses are revealed by the orthologous genes from major cereals

    Directory of Open Access Journals (Sweden)

    Bo Ding

    2014-01-01

    Full Text Available WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies onWRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary,TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.

  20. Differential gene expression in liver tissues of streptozotocin-induced diabetic rats in response to resveratrol treatment.

    Directory of Open Access Journals (Sweden)

    Gökhan Sadi

    Full Text Available This study was conducted to elucidate the genome-wide gene expression profile in streptozotocin induced diabetic rat liver tissues in response to resveratrol treatment and to establish differentially expressed transcription regulation networks with microarray technology. In addition to measure the expression levels of several antioxidant and detoxification genes, real-time quantitative polymerase chain reaction (qRT-PCR was also used to verify the microarray results. Moreover, gene and protein expressions as well as enzymatic activities of main antioxidant enzymes; superoxide dismutase (SOD-1 and SOD-2 and glutathione S-transferase (GST-Mu were analyzed. Diabetes altered 273 genes significantly and 90 of which were categorized functionally which suggested that genes in cellular catalytic activities, oxidation-reduction reactions, co-enzyme binding and terpenoid biosynthesis were dominated by up-regulated expression in diabetes. Whereas; genes responsible from cellular carbohydrate metabolism, regulation of transcription, cell signal transduction, calcium independent cell-to-cell adhesion and lipid catabolism were down-regulated. Resveratrol increased the expression of 186 and decreased the expression of 494 genes in control groups. While cellular and extracellular components, positive regulation of biological processes, biological response to stress and biotic stimulants, and immune response genes were up-regulated, genes responsible from proteins present in nucleus and nucleolus were mainly down-regulated. The enzyme assays showed a significant decrease in diabetic SOD-1 and GST-Mu activities. The qRT-PCR and Western-blot results demonstrated that decrease in activity is regulated at gene expression level as both mRNA and protein expressions were also suppressed. Resveratrol treatment normalized the GST activities towards the control values reflecting a post-translational effect. As a conclusion, global gene expression in the liver tissues is

  1. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah

    2012-10-26

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  2. Identification of estrogen responsive genes using esophageal squamous cell carcinoma (ESCC) as a model

    KAUST Repository

    Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.

    2012-01-01

    Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first

  3. Controlling nuclear JAKs and STATs for specific gene activation by IFNγ

    International Nuclear Information System (INIS)

    Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.

    2011-01-01

    Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The

  4. P-glycoprotein activity and biological response

    International Nuclear Information System (INIS)

    Vaalburg, W.; Hendrikse, N.H.; Elsinga, P.H.; Bart, J.; Waarde, A. van

    2005-01-01

    P-glycoprotein (P-gp) is a transmembrane drug efflux pump encoded by the MDR-1 gene in humans. Most likely P-gp protects organs against endogenous and exogenous toxins by extruding toxic compounds such as chemotherapeutics and other drugs. Many drugs are substrates for P-gp. Since P-gp is also expressed in the blood-brain barrier, P-gp substrates reach lower concentrations in the brain than in P-gp-negative tissues. Failure of response to chemotherapy of malignancies can be due to intrinsic or acquired drug resistance. Many tumors are multidrug resistant (MDR); resistant to several structurally unrelated chemotherapeutic agents. Several mechanisms are involved in MDR of which P-gp is studied most extensively. P-gp extrudes drugs out of tumor cells resulting in decreased intracellular drug concentrations, leading to the MDR phenotype. Furthermore, the MDR-1 gene exhibits several single nucleotide polymorphisms, some of which result in different transport capabilities. P-gp functionality and the effect of P-gp modulation on the pharmacokinetics of novel and established drugs can be studied in vivo by positron emission tomography (PET) using carbon-11 and fluorine-18-labeled P-gp substrates and modulators. PET may demonstrate the consequences of genetic differences on tissue pharmacokinetics. Inhibitors such as calcium-channel blockers (verapamil), cyclosporin A, ONT-093, and XR9576 can modulate the P-gp functionality. With PET the effect of P-gp modulation on the bioavailability of drugs can be investigated in humans in vivo. PET also allows the measurement of the efficacy of newly developed P-gp modulators

  5. De novo transcriptome sequencing of Isaria cateniannulata and comparative analysis of gene expression in response to heat and cold stresses.

    Directory of Open Access Journals (Sweden)

    Dingfeng Wang

    Full Text Available Isaria cateniannulata is a very important and virulent entomopathogenic fungus that infects many insect pest species. Although I. cateniannulata is commonly exposed to extreme environmental temperature conditions, little is known about its molecular response mechanism to temperature stress. Here, we sequenced and de novo assembled the transcriptome of I. cateniannulata in response to high and low temperature stresses using Illumina RNA-Seq technology. Our assembly encompassed 17,514 unigenes (mean length = 1,197 bp, in which 11,445 unigenes (65.34% showed significant similarities to known sequences in NCBI non-redundant protein sequences (Nr database. Using digital gene expression analysis, 4,483 differentially expressed genes (DEGs were identified after heat treatment, including 2,905 up-regulated genes and 1,578 down-regulated genes. Under cold stress, 1,927 DEGs were identified, including 1,245 up-regulated genes and 682 down-regulated genes. The expression patterns of 18 randomly selected candidate DEGs resulting from quantitative real-time PCR (qRT-PCR were consistent with their transcriptome analysis results. Although DEGs were involved in many pathways, we focused on the genes that were involved in endocytosis: In heat stress, the pathway of clathrin-dependent endocytosis (CDE was active; however at low temperature stresses, the pathway of clathrin-independent endocytosis (CIE was active. Besides, four categories of DEGs acting as temperature sensors were observed, including cell-wall-major-components-metabolism-related (CWMCMR genes, heat shock protein (Hsp genes, intracellular-compatible-solutes-metabolism-related (ICSMR genes and glutathione S-transferase (GST. These results enhance our understanding of the molecular mechanisms of I. cateniannulata in response to temperature stresses and provide a valuable resource for the future investigations.

  6. RNA-Guided Activation of Pluripotency Genes in Human Fibroblasts

    DEFF Research Database (Denmark)

    Xiong, Kai; Zhou, Yan; Blichfeld, Kristian Aabo

    2017-01-01

    -associated protein 9 (dCas9)-VP64 (CRISPRa) alone, or a combination of dCas9-VP64 and MS2-P65-HSF1 [synergistic activation mediator (SAM) system] mediated activation of five pluripotency genes: KLF4 (K), LIN28 (L), MYC (M), OCT4 (O), and SOX2 (S) in human cells (HEK293T, HeLa, HepG2, and primary fibroblasts...... could be obtained from these SAM fibroblasts. In conclusion, our study showed that CRISPR/Cas9-based ATFs are potent to activate and maintain transcription of endogenous human pluripotent genes. However, future improvements of the system are still required to improve activation efficiency and cellular...

  7. Responsibility in the activities of transnational companies

    Directory of Open Access Journals (Sweden)

    Wojciech Zysk

    2016-10-01

    Full Text Available The activities of transnational corporations bring many benefits, but also threats in the host countries and the world. The phenomenon of CSR, SRI and FT has been growing rapidly in recent years. The objectives of the article are: a description of the participation of transnational corporations in raising the level of stratification of society in the rich North and the poor South as well as an analysis of processes related to liability and justice – Corporate Social responsibility (CSR and Socially responsible investing (SRI, including the concept of Fair Trade (FT 3.0. Descriptive method was applied in respect to the first goal, in the case of second objective, the phenomena of CSR, responsible investing and Fair Trade 3.0. were examined and described. This study confirms prior voices that it is necessary to develop a new economy – the economy of social development – oriented to increase the standards of living and prosperity, and to stimulate economic growth and social development influencing positively the reduction of social inequalities. The originality of this work lays in proposal a new concept of Fair Trade 3.0 and indicates its theoretical assumptions. This is new concept of foreign trade is based on responsibility “towards others” and “for others”.

  8. Plant responses to environmental stresses-from gene to biotechnology.

    Science.gov (United States)

    Ahanger, Mohammad Abass; Akram, Nudrat Aisha; Ashraf, Muhammad; Alyemeni, Mohammed Nasser; Wijaya, Leonard; Ahmad, Parvaiz

    2017-07-01

    Increasing global population, urbanization and industrialization are increasing the rate of conversion of arable land into wasteland. Supplying food to an ever-increasing population is one of the biggest challenges that agriculturalists and plant scientists are currently confronting. Environmental stresses make this situation even graver. Despite the induction of several tolerance mechanisms, sensitive plants often fail to survive under environmental extremes. New technological approaches are imperative. Conventional breeding methods have a limited potential to improve plant genomes against environmental stress. Recently, genetic engineering has contributed enormously to the development of genetically modified varieties of different crops such as cotton, maize, rice, canola and soybean. The identification of stress-responsive genes and their subsequent introgression or overexpression within sensitive crop species are now being widely carried out by plant scientists. Engineering of important tolerance pathways, like antioxidant enzymes, osmolyte accumulation, membrane-localized transporters for efficient compartmentation of deleterious ions and accumulation of essential elements and resistance against pests or pathogens is also an area that has been intensively researched. In this review, the role of biotechnology and its successes, prospects and challenges in developing stress-tolerant crop cultivars are discussed.

  9. Mucosal CCR1 gene expression as a marker of molecular activity in Crohn's disease: preliminary data.

    Science.gov (United States)

    Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Ţieranu, Eugen Nicolae; Popa, Caterina; Mănuc, Mircea; Preda, Carmen Monica; Ţieranu, Ioana; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel

    2017-01-01

    A series of mechanisms of immune response, inflammation and apoptosis have been demonstrated to contribute to the appearance and evolution of Crohn's disease (CD) through the overexpression of several cytokines and chemokines in a susceptible host. The aim of this study was to identify the differences in gene expression profiles analyzing a panel of candidate genes in the mucosa from patients with active CD (CD-A), patients in remission (CD-R), and normal controls. Nine individuals were enrolled in the study: six CD patients (three with active lesions, three with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression levels of 84 genes previously associated with CD were evaluated by polymerase chain reaction (PCR) array. Ten genes out of 84 were found significantly differentially expressed in CD-A (CCL11, CCL25, DEFA5, GCG, IL17A, LCN2, REG1A, STAT3, MUC1, CCR1) and eight genes in CD-R (CASP1, IL23A, STAT1, STAT3, TNF, CCR1, CCL5, and HSP90B1) when compared to controls. A quantitative gene expression analysis revealed that CCR1 gene was more expressed in CD-A than in CD-R. Our data suggest that CCR1 gene may be a putative marker of molecular activity of Crohn's disease. Following these preliminary data, a confirmation in larger cohort studies could represent a useful method in order to identify new therapeutic targets.

  10. Heat Shock Protein Genes Undergo Dynamic Alteration in Their Three-Dimensional Structure and Genome Organization in Response to Thermal Stress.

    Science.gov (United States)

    Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S

    2017-12-15

    Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.

  11. Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide

    Science.gov (United States)

    Fomenko, Dmitri E.; Koc, Ahmet; Agisheva, Natalia; Jacobsen, Michael; Kaya, Alaattin; Malinouski, Mikalai; Rutherford, Julian C.; Siu, Kam-Leung; Jin, Dong-Yan; Winge, Dennis R.; Gladyshev, Vadim N.

    2011-01-01

    Hydrogen peroxide is thought to regulate cellular processes by direct oxidation of numerous cellular proteins, whereas antioxidants, most notably thiol peroxidases, are thought to reduce peroxides and inhibit H2O2 response. However, thiol peroxidases have also been implicated in activation of transcription factors and signaling. It remains unclear if these enzymes stimulate or inhibit redox regulation and whether this regulation is widespread or limited to a few cellular components. Herein, we found that Saccharomyces cerevisiae cells lacking all eight thiol peroxidases were viable and withstood redox stresses. They transcriptionally responded to various redox treatments, but were unable to activate and repress gene expression in response to H2O2. Further studies involving redox transcription factors suggested that thiol peroxidases are major regulators of global gene expression in response to H2O2. The data suggest that thiol peroxidases sense and transfer oxidative signals to the signaling proteins and regulate transcription, whereas a direct interaction between H2O2 and other cellular proteins plays a secondary role. PMID:21282621

  12. Soil radon response around an active volcano

    International Nuclear Information System (INIS)

    Segovia, N.; Valdes, C.; Pena, P.; Mena, M.; Tamez, E.

    2001-01-01

    Soil radon behavior related to the volcanic eruptive period 1997-1999 of Popocatepetl volcano has been studied as a function of the volcanic activity. Since the volcano is located 60 km from Mexico City, the risk associated with an explosive eruptive phase is high and an intense surveillance program has been implemented. Previous studies in this particular volcano showed soil radon pulses preceding the initial phase of the eruption. The radon survey was performed with LR-115 track detectors at a shallow depth and the effect of the soil moisture during the rainy season has been observed on the detectors response. In the present state of the volcanic activity the soil radon behavior has shown more stability than in previous eruptive stages

  13. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Xiangshu Dong

    Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  14. GST(phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses

    Institute of Scientific and Technical Information of China (English)

    CHEN Shihua; CHEN Xin; DOU Weihong; WANG Liang; YIN Haibo; GUO Shanli

    2016-01-01

    Reactive oxygen species (ROS) scavengers,including ascorbate peroxidase,superoxide dismutase,catalase and peroxidase,are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses.In this study,we cloned an 866 bp GST(phi) gene in Lemna minor and investigated its characteristics,expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers.GST(phi) gene expression patterns were similar to those of other scavengers of ROS.This suggests that GST(phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.

  15. Role of the Talaromyces marneffei (Penicillium marneffei) sakA gene in nitrosative stress response, conidiation and red pigment production.

    Science.gov (United States)

    Nimmanee, Panjaphorn; Tam, Emily W T; Woo, Patrick C Y; Vanittanakom, Pramote; Vanittanakom, Nongnuch

    2017-04-01

    Stress-activated MAPK pathways are systems used to regulate the stress adaptation of most fungi. It has been shown that in Talaromyces marneffei (Penicillium marneffei), a pathogenic dimorphic fungus, the sakA gene is involved, not only in tolerance against oxidative and heat stresses, but also in playing a role in asexual development, yeast cell generation in vitro and survival inside macrophage cell lines. In this study, the role of the T. marneffei sakA gene on the nitrosative stress response and the regulation of gene expression were investigated. The susceptibility of the sakA mutant to NaNO2 was investigated using drop dilution assay and the expression of genes of interest were determined by RT-PCR, comparing them to the wild-type and complemented strains. The results demonstrated that the T. marneffei sakA gene played a role in the stress response to NaNO2, the expression of genes functioning in conidial development (brlA, abaA and wetA) and red pigment biosynthesis (pks3, rp1, rp2 and rp3). These findings suggest that T. marneffei sakA is broadly involved in a wide variety of cell activities, including stress response, cell morphogenesis, asexual development and pigmentation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Investigation of the mechanisms by which UV irradiation activates the tyrosinase gene

    International Nuclear Information System (INIS)

    Bao, Y.

    2000-04-01

    Tyrosinase, tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2) are the enzymes involved in melanin pigment synthesis. They are expressed specifically in melanocytic cells. UV irradiation is the major physiological stimulant of melanogenesis. Tyrosinase is the rate-limiting enzyme in melanin synthesis and its activity is regulated by UV irradiation in melanocytes. The molecular mechanism underlying the activation of tyrosinase by UV is still not clear. In this thesis, the effects of UV irradiation on tyrosinase, TRP-1 and TRP-2 gene expression in mouse B16 melanoma cells were studied as well as the effects of UV irradiation on the activity of the tyrosinase promoter in mouse, and human melanoma cells. UV irradiation caused an increase in tyrosinase mRNA level, without change in either TRP-1 or TRP-2 mRNA levels, as determined by Northern blot analysis. In order to determine whether UV- induced increase of tyrosinase mRNA expression involved modulation of tyrosinase promoter activity, transient transfection approaches involving a series of constructs containing either chloramphenicol acetyl transferase (CAT) or luciferase reporter genes linked to different lengths of the tyrosinase gene- promoter were used. UV irradiation specifically induced CAT gene expression from both the mouse and the human tyrosinase promoters, suggesting that UV irradiation induced the transcription of the tyrosinase gene. These observations indicated that the promoter region between -250 and -150 bp of the human tyrosinase promoter may contain important cis-regulatory elements involved in the UV response. To localise the cis-regulatory elements responsible for the UV response of the tyrosinase promoter, the 100-bp between -250 bp and -150 bp of the tyrosinase promoter was inserted upstream of a CAT reporter. It was shown that transcription from the 100-bp promoter fragment was activated by UV irradiation. Mutations of a potential cAMP response element (CRE) motif

  17. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  18. Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

    Science.gov (United States)

    Dennig, Jörg

    Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

  19. An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Hongyan eGuo

    2015-05-01

    Full Text Available Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid, a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice.

  20. A systematic study on drug-response associated genes using baseline gene expressions of the Cancer Cell Line Encyclopedia

    Science.gov (United States)

    Liu, Xiaoming; Yang, Jiasheng; Zhang, Yi; Fang, Yun; Wang, Fayou; Wang, Jun; Zheng, Xiaoqi; Yang, Jialiang

    2016-03-01

    We have studied drug-response associated (DRA) gene expressions by applying a systems biology framework to the Cancer Cell Line Encyclopedia data. More than 4,000 genes are inferred to be DRA for at least one drug, while the number of DRA genes for each drug varies dramatically from almost 0 to 1,226. Functional enrichment analysis shows that the DRA genes are significantly enriched in genes associated with cell cycle and plasma membrane. Moreover, there might be two patterns of DRA genes between genders. There are significantly shared DRA genes between male and female for most drugs, while very little DRA genes tend to be shared between the two genders for a few drugs targeting sex-specific cancers (e.g., PD-0332991 for breast cancer and ovarian cancer). Our analyses also show substantial difference for DRA genes between young and old samples, suggesting the necessity of considering the age effects for personalized medicine in cancers. Lastly, differential module and key driver analyses confirm cell cycle related modules as top differential ones for drug sensitivity. The analyses also reveal the role of TSPO, TP53, and many other immune or cell cycle related genes as important key drivers for DRA network modules. These key drivers provide new drug targets to improve the sensitivity of cancer therapy.

  1. A nucleotide metabolite controls stress-responsive gene expression and plant development.

    Directory of Open Access Journals (Sweden)

    Hao Chen

    Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt

  2. A nucleotide metabolite controls stress-responsive gene expression and plant development

    KAUST Repository

    Chen, Hao

    2011-10-19

    Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target

  3. Differential response of two somatolactin genes to zinc or estrogen in pituitary of Cyprinus carpio.

    Science.gov (United States)

    Valenzuela, G E; Perez, A; Navarro, M; Romero, A; Figueroa, J; Kausel, G

    2015-05-01

    Environmental changes affect gene expression that we addressed in the pituitary, a central regulatory organ at the interface between the central nervous system and the endocrine system. With the aim to reveal effects of changes in the aquatic environment on the expression of hypothalamo-hypophyseal factors, we characterized somatolactin (SL) in Cyprinus carpio. SL, a fish specific pituitary hormone belonging to the prolactin (PRL) superfamily, is involved in background adaptation, osmoregulation, reproduction and fatty acid metabolism. Two sl genes, α and β, were discovered in carp and transcripts of both were detected in pituitaries. Clearly, expression of slα and slβ was modulated significantly in pituitary of male adult carp in response to treatment with ZnCl2 (Zn), but only slβ responded to 17β-estrogen (E2), relative to control carp as shown by RT-qPCR analyses. Furthermore, the amount of mRNA of related factors was assessed revealing variable effects on prl, growth hormone (gh), and factors involved in sl regulation: the pituitary transcription factor pit1 and hypothalamic pituitary adenylase cyclase activating peptide (pacap). In parallel, the physiological response of the experimental animals to Zn or E2 was confirmed by showing a significant increase of metallothionein (mt) or vitellogenin (vg) gene expression in liver, classical sentinels for exposure to heavy metal or estrogens. These data suggest that the sl genes seem to be involved in the response to Zn, as well as to estrogen, and could contribute to evaluate biological relevant changes in the aquatic environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Transcription Factor NF-IL6 (C/EBPbeta) Activates the Expression of the Mouse MHC Class I H2-Kb Gene in Response to TNF-alpha via the Intragenic Downstream Regulatory Element

    Czech Academy of Sciences Publication Activity Database

    Hatina, J.; Jansa, Petr; Reischig, J.

    2002-01-01

    Roč. 22, - (2002), s. 741-749 ISSN 1079-9907 R&D Projects: GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mouse MHC Class I Gene, Intragenic Downstream Regulatory Element Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.885, year: 2002

  5. Characterization of a dehydrogenase activity responsible for oxidation of 11-cis-retinol in the retinal pigment epithelium of mice with a disrupted RDH5 gene. A model for the human hereditary disease fundus albipunctatus.

    NARCIS (Netherlands)

    Jang, G.F.; Hooser, J.P. van; Kuksa, V.; McBee, J.K.; He, Y.G.; Janssen, J.J.M.; Driessen, C.A.G.G.; Palczewski, K.

    2001-01-01

    In the vertebrate retina, the final step of visual chromophore production is the oxidation of 11-cis-retinol to 11-cis-retinal. This reaction is catalyzed by 11-cis-retinol dehydrogenases (11-cis-RDHs), prior to the chromophore rejoining with the visual pigment apo-proteins. The RDH5 gene encodes a

  6. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  7. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley

    2017-10-01

    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  8. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

    Science.gov (United States)

    Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

    2014-04-16

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

  9. De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

    Science.gov (United States)

    Liu, Chuan-He; Fan, Chao

    2016-01-01

    A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene

  10. Identification of bovine leukemia virus tax function associated with host cell transcription, signaling, stress response and immune response pathway by microarray-based gene expression analysis

    Directory of Open Access Journals (Sweden)

    Arainga Mariluz

    2012-03-01

    Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting

  11. A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors

    Science.gov (United States)

    2017-02-01

    affecting the function of Fanconi Anemia (FA) genes ( FANCA /B/C/D2/E/F/G/I/J/L/M, PALB2) or DNA damage response genes involved in HR 5 (ATM, ATR...Award Number: W81XWH-10-1-0585 TITLE: A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors...To) 15 July 2010 – 2 Nov.2016 4. TITLE AND SUBTITLE A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP

  12. Mapping of brain activity by automated volume analysis of immediate early genes

    Science.gov (United States)

    Renier, Nicolas; Adams, Eliza L.; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E.; Kadiri, Lolahon; Venkataraju, Kannan Umadevi; Zhou, Yu; Wang, Victoria X.; Tang, Cheuk Y.; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc

    2016-01-01

    Summary Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization and quantification of the activity of all neurons across the entire brain, which has not to date been achieved in the mammalian brain. We introduce a pipeline for high speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to Haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Lastly, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available. PMID:27238021

  13. Gene expression profiling of chicken intestinal host responses

    NARCIS (Netherlands)

    Hemert, van S.

    2007-01-01

    Chicken lines differ in genetic disease susceptibility. The scope of the research described in this thesis was to identify genes involved in genetic disease resistance in the chicken intestine. Therefore gene expression in the jejunum was investigated using a microarray approach. An intestine

  14. An Interactive Database of Cocaine-Responsive Gene Expression

    Directory of Open Access Journals (Sweden)

    Willard M. Freeman

    2002-01-01

    Full Text Available The postgenomic era of large-scale gene expression studies is inundating drug abuse researchers and many other scientists with findings related to gene expression. This information is distributed across many different journals, and requires laborious literature searches. Here, we present an interactive database that combines existing information related to cocaine-mediated changes in gene expression in an easy-to-use format. The database is limited to statistically significant changes in mRNA or protein expression after cocaine administration. The Flash-based program is integrated into a Web page, and organizes changes in gene expression based on neuroanatomical region, general function, and gene name. Accompanying each gene is a description of the gene, links to the original publications, and a link to the appropriate OMIM (Online Mendelian Inheritance in Man entry. The nature of this review allows for timely modifications and rapid inclusion of new publications, and should help researchers build second-generation hypotheses on the role of gene expression changes in the physiology and behavior of cocaine abuse. Furthermore, this method of organizing large volumes of scientific information can easily be adapted to assist researchers in fields outside of drug abuse.

  15. Two-stage gene regulation of the superoxide stress response soxRS system in Escherichia coli.

    Science.gov (United States)

    Nunoshiba, T

    1996-01-01

    All organisms have adapted to environmental changes by acquiring various functions controlled by gene regulation. In bacteria, a number of specific responses have been found to confer cell survival in various nutrient-limited conditions, and under physiological stresses such as high or low temperature, extreme pH, radiation, and oxidation (for review, see Neidhardt et al., 1987). In this article, I introduce an Escherichia coli (E. coli) global response induced by superoxide stress, the soxRS regulon. The functions controlled by this system consist of a wide variety of enzymes such as manganese-containing SOD (Mn-SOD); glucose 6-phosphate dehydrogenase (G6PD), the DNA repair enzyme endonuclease IV, fumarase C, NADPH:ferredoxin oxidoreductase, and aconitase. This response is positively regulated by a two-stage control system in which SoxR iron-sulfur protein senses exposure to superoxide and nitric oxide, and then activates transcription of the soxS gene, whose product stimulates the expression of the regulon genes. Our recent finding indicates that soxS transcription is initiated in a manner dependent on the rpoS gene encoding RNA polymerase sigma factor, theta s, in response to entering the stationary phase of growth. With this information, mechanisms for prokaryotic coordinating gene expression in response to superoxide stress and in stationary phase are discussed.

  16. The defense-responsive genes showing enhanced and repressed expression after pathogen infection in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)

    2002-01-01

    Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.

  17. Differential expression of poplar sucrose nonfermenting1-related protein kinase 2 genes in response to abiotic stress and abscisic acid.

    Science.gov (United States)

    Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato

    2017-09-01

    Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.

  18. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  19. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    Purpose: The intracellular adhesion molecule (ICAM-1) binds and activates inflammatory cells and thereby contributes to the pathogenesis of tissue injury. To characterize a model for radiation-induction of tissue injury, we studied radiation-mediated lung injury in mice deficient in the ICAM-1 gene. To study the mechanisms of x-ray mediated ICAM induction, we studied transcriptional activation of the ICAM promoter and nuclear protein binding to the 5' untranslated region of the ICAM gene. Methods: Immunohistochemistry and immunofluorescence were used to study the histologic pattern of ICAM expression in irradiated tissue. The ICAM-1 knockout mice were bred with wild type mice to create heterozygous mice with attenuated ICAM expression. ICAM -/-, ICAM+/- and ICAM +/+ mice were treated with thoracic irradiation and lung sections were stained for leukocyte common antigen (CD45) to study inflammation. To study the mechanism of x-ray induction of ICAM, we linked the 5' untranslated region of the ICAM gene to the luciferase reporter gene and delated DNA segments from the promoter to determine which elements are required for induction. We performed electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells to study transcription factor activation. Results: Immunohistochemistry showed dose and time dependent increases in ICAM protein expression in irradiated lungs which was prolonged as compared to endothelial cells in vitro. The histologic pattern of ICAM expression was in the capillary endothelium and was distinct from the pattern of expression of other radiation-inducible adhesion molecules. ICAM knockout mice had no ICAM expression and no inflammatory cell accumulation in the irradiated lung. ICAM+/+ mice developed leukocyte adhesion to irradiated endothelium within hours of irradiation and radiation pneumonitis 5 to 6 weeks later. The DNA sequence between -981 and -769 (relative to start codon) contains two 16-base pair repeats, each

  20. The schizophrenia risk gene ZNF804A influences the antipsychotic response of positive schizophrenia symptoms

    OpenAIRE

    Mössner, R; Schumacher, A; Wagner, M; Lennertz, L; Steinbrecher, A; Quednow, Boris B; Rujescu, D; Rietschel, M; Maier, W

    2012-01-01

    Genetic factors determining the response to antipsychotic treatment in schizophrenia are poorly understood. A new schizophrenia susceptibility gene, the zinc-finger gene ZNF804A, has recently been identified. To assess the pharmacogenetic importance of this gene, we treated 144 schizophrenia patients and assessed the response of positive and negative symptoms by PANSS. Patients homozygous for the ZNF804A risk allele for schizophrenia (rs1344706 AA) showed poorer improvement of positive sympto...

  1. Physcomitrella patens Activates Defense Responses against the Pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Guillermo Reboledo

    2015-09-01

    Full Text Available The moss Physcomitrella patens is a suitable model plant to analyze the activation of defense mechanisms after pathogen assault. In this study, we show that Colletotrichum gloeosporioides isolated from symptomatic citrus fruit infects P. patens and cause disease symptoms evidenced by browning and maceration of tissues. After C. gloeosporioides infection, P. patens reinforces the cell wall by the incorporation of phenolic compounds and induces the expression of a Dirigent-protein-like encoding gene that could lead to the formation of lignin-like polymers. C. gloeosporioides-inoculated protonemal cells show cytoplasmic collapse, browning of chloroplasts and modifications of the cell wall. Chloroplasts relocate in cells of infected tissues toward the initially infected C. gloeosporioides cells. P. patens also induces the expression of the defense genes PAL and CHS after fungal colonization. P. patens reporter lines harboring the auxin-inducible promoter from soybean (GmGH3 fused to β-glucuronidase revealed an auxin response in protonemal tissues, cauloids and leaves of C. gloeosporioides-infected moss tissues, indicating the activation of auxin signaling. Thus, P. patens is an interesting plant to gain insight into defense mechanisms that have evolved in primitive land plants to cope with microbial pathogens.

  2. Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity

    Directory of Open Access Journals (Sweden)

    Schwartz Robert J

    2007-11-01

    motility as well as cellular redox status, which may contribute to cardiovascular abnormalities in mouse embryos lacking Folr1 gene activity.

  3. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    Science.gov (United States)

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  4. A rice gene of de novo origin negatively regulates pathogen-induced defense response.

    Directory of Open Access Journals (Sweden)

    Wenfei Xiao

    Full Text Available How defense genes originated with the evolution of their specific pathogen-responsive traits remains an important problem. It is generally known that a form of duplication can generate new genes, suggesting that a new gene usually evolves from an ancestral gene. However, we show that a new defense gene in plants may evolve by de novo origination, resulting in sophisticated disease-resistant functions in rice. Analyses of gene evolution showed that this new gene, OsDR10, had homologs only in the closest relative, Leersia genus, but not other subfamilies of the grass family; therefore, it is a rice tribe-specific gene that may have originated de novo in the tribe. We further show that this gene may evolve a highly conservative rice-specific function that contributes to the regulation difference between rice and other plant species in response to pathogen infections. Biologic analyses including gene silencing, pathologic analysis, and mutant characterization by transformation showed that the OsDR10-suppressed plants enhanced resistance to a broad spectrum of Xanthomonas oryzae pv. oryzae strains, which cause bacterial blight disease. This enhanced disease resistance was accompanied by increased accumulation of endogenous salicylic acid (SA and suppressed accumulation of endogenous jasmonic acid (JA as well as modified expression of a subset of defense-responsive genes functioning both upstream and downstream of SA and JA. These data and analyses provide fresh insights into the new biologic and evolutionary processes of a de novo gene recruited rapidly.

  5. Burkholderia thailandensis harbors two identical rhl gene clusters responsible for the biosynthesis of rhamnolipids

    Directory of Open Access Journals (Sweden)

    Woods Donald E

    2009-12-01

    Full Text Available Abstract Background Rhamnolipids are surface active molecules composed of rhamnose and β-hydroxydecanoic acid. These biosurfactants are produced mainly by Pseudomonas aeruginosa and have been thoroughly investigated since their early discovery. Recently, they have attracted renewed attention because of their involvement in various multicellular behaviors. Despite this high interest, only very few studies have focused on the production of rhamnolipids by Burkholderia species. Results Orthologs of rhlA, rhlB and rhlC, which are responsible for the biosynthesis of rhamnolipids in P. aeruginosa, have been found in the non-infectious Burkholderia thailandensis, as well as in the genetically similar important pathogen B. pseudomallei. In contrast to P. aeruginosa, both Burkholderia species contain these three genes necessary for rhamnolipid production within a single gene cluster. Furthermore, two identical, paralogous copies of this gene cluster are found on the second chromosome of these bacteria. Both Burkholderia spp. produce rhamnolipids containing 3-hydroxy fatty acid moieties with longer side chains than those described for P. aeruginosa. Additionally, the rhamnolipids produced by B. thailandensis contain a much larger proportion of dirhamnolipids versus monorhamnolipids when compared to P. aeruginosa. The rhamnolipids produced by B. thailandensis reduce the surface tension of water to 42 mN/m while displaying a critical micelle concentration value of 225 mg/L. Separate mutations in both rhlA alleles, which are responsible for the synthesis of the rhamnolipid precursor 3-(3-hydroxyalkanoyloxyalkanoic acid, prove that both copies of the rhl gene cluster are functional, but one contributes more to the total production than the other. Finally, a double ΔrhlA mutant that is completely devoid of rhamnolipid production is incapable of swarming motility, showing that both gene clusters contribute to this phenotype. Conclusions Collectively, these

  6. Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Kenneth W. Berendzen

    2013-04-01

    Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

  7. The safeguards active response inventory system (SARIS)

    International Nuclear Information System (INIS)

    Carlson, R.L.; Hairston, L.A.; O'Callaghan, P.B.; Grambihler, A.J.; Ruemmler, W.P.

    1987-01-01

    The Safeguards Active Response Inventory System (SARIS) is a computerized accountability system developed for nuclear materials control that incorporates elements of process monitoring, criticality safety, physical inventory and safeguards. It takes data from the process operations, stores it in an on-line database and translates the information into the formats needed by the various users. It traces the material through the process from feed to product; including recycle, waste and scraps streams. It models the process as the material changes form to ensure that artificial losses are not created. It automatically generates input to Nuclear Materials Management and Safeguards System (NMMSS), performs checks to prevent the possibility of a criticality accident, prepares an audit trail for Safeguards, prints labels for nuclear material containers, and produces DOE/NRC 741 forms. SARIS has been installed at three laboratories across the country

  8. The Safeguards Active Response Inventory System (SARIS)

    International Nuclear Information System (INIS)

    Carlson, R.L.

    1985-04-01

    The Safeguards Active Response Inventory System (SARIS) was developed by Westinghouse Hanford Company (WHC) to perform material control and accountability on all the nuclear material under WHC's jurisdiction. SARIS has been in operation for four and one-half years. It has reduced physical inventory plant shutdown time from several days to a few hours. The user-friendly interface has proven successful, as the training time for a new operator is only two to three hours; also errors have been dramatically reduced. The modeling features of SARIS have reduced the reported inventory difference and provide better information for measurement of scrap and waste. The audit files have been usefull in resolving data entry errors and the backup features have averted several potential problems. SARIS as a computerized accountability system has replaced manual record keeping with a consequent increase in productivity. 4 refs

  9. Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell cycle-related genes

    International Nuclear Information System (INIS)

    Logemann, E.; Wu ShengCheng; Schröder, J.; Schmelzer, E.; Somssich, I.E.; Hahlbrock, K.

    1995-01-01

    The effects of UV light or fungal elicitors on plant cells have so far been studied mostly with respect to defense-related gene activation. Here, an inverse correlation of these stimulatory effects with the activities of several cell cycle-related genes is demonstrated. Concomitant with the induction of flavonoid biosynthetic enzymes in UV-irradiated cell suspension cultures of parsley (Petroselinum crispum), total histone synthesis declined to about half the initial rate. A subclass of the histone H3 gene family was selected to demonstrate the close correlation of its expression with cell division, both in intact plants and cultured cells. Using RNA-blot and run-on transcription assays, it was shown that one arbitrarily selected subclass of each of the histone H2A, H2B, H3 and H4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV-irradiated as well as fungal elicitor-treated parsley cells. The timing and extent of repression differed between the two stimuli; the response to light was more transient and smaller in magnitude. These differential responses to light and elicitor were inversely correlated with the induction of phenylalanine ammonia-lyase, a key enzyme of phenylpropanoid metabolism. Essentially the same result was obtained with a defined oligopeptide elicitor, indicating that the same signaling pathway is responsible for defense-related gene activation and cell cycle-related gene repression. A temporary (UV light) or long-lasting (fungal elicitor) cessation of cell culture growth is most likely due to an arrest of cell division which may be a prerequisite for full commitment of the cells to transcriptional activation of full commitment of the cells to transcriptional activation of pathways involved in UV protection or pathogen defense. This conclusion is corroborated by the observation that the histone H3 mRNA level greatly declined around fungal infection sites in young parsley

  10. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    Science.gov (United States)

    2012-01-01

    Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I

  11. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    Directory of Open Access Journals (Sweden)

    Cribbs David H

    2012-07-01

    Full Text Available Abstract Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD. Methods In a well-powered microarray study of young (20 to 59 years, aged (60 to 99 years, and AD (74 to 95 years cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%. In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets, with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc receptors and human

  12. In Vivo Anti-estrogenic Effects of Menadione on Hepatic Estrogen-responsive Gene Expression in Male Medaka (Oryzias latipes)

    OpenAIRE

    Yamaguchi, Akemi; Kohra, Shinya; Ishibashi, Hiroshi; Arizono, Koji; Tominaga, Nobuaki

    2008-01-01

    Menadione, a synthetic vitamin K3, exhibits anti-estrogenic activity on in vitro assay. However, the in vivo anti-estrogenic effects of menadione have not been determined, while correlations between biological effects and structural changes are unclear. Thus, we investigated the in vivo anti-estrogenic activity of menadione under fluorescent light and dark conditions. Suppression of the hepatic estrogen response genes vitellogenin1 (VTG1), VTG2 and estrogen receptor-α (ER-α) was used as an in...

  13. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    Science.gov (United States)

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  15. Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

    Directory of Open Access Journals (Sweden)

    Paules Richard S

    2007-11-01

    Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

  16. The 'warrior gene' and the Mãori people: the responsibility of the geneticists.

    Science.gov (United States)

    Perbal, Laurence

    2013-09-01

    The 'gene of' is a teleosemantic expression that conveys a simplistic and linear relationship between a gene and a phenotype. Throughout the 20th century, geneticists studied these genes of traits. The studies were often polemical when they concerned human traits: the 'crime gene', 'poverty gene', 'IQ gene', 'gay gene' or 'gene of alcoholism'. Quite recently, a controversy occurred in 2006 in New Zealand that started with the claim that a 'warrior gene' exists in the Mãori community. This claim came from a geneticist working on the MAOA gene. This article is interested in the responsibility of that researcher regarding the origin of the controversy. Several errors were made: overestimation of results, abusive use of the 'gene of' kind of expression, poor communication with the media and a lack of scientific culture. The issues of the debate were not taken into account sufficiently, either from the political, social, ethical or even the genetic points of view. After more than 100 years of debates around 'genes of' all kinds (here, the 'warrior gene'), geneticists may not hide themselves behind the media when a controversy occurs. Responsibilities have to be assumed. © 2012 John Wiley & Sons Ltd.

  17. Genome-wide targeted prediction of ABA responsive genes in rice based on over-represented cis-motif in co-expressed genes.

    Science.gov (United States)

    Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C

    2009-02-01

    Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.

  18. Probiotic lactobacillus and estrogen effects on vaginal epithelial gene expression responses to Candida albicans.

    Science.gov (United States)

    Wagner, R Doug; Johnson, Shemedia J

    2012-06-20

    Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic

  19. Genetic control of eosinophilia in mice: gene(s) expressed in bone marrow-derived cells control high responsiveness

    International Nuclear Information System (INIS)

    Vadas, M.A.

    1982-01-01

    A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy

  20. Dual responsive supramolecular hydrogel with electrochemical activity.

    Science.gov (United States)

    Du, Ping; Liu, Jianghua; Chen, Guosong; Jiang, Ming

    2011-08-02

    Supramolecular materials with reversible responsiveness to environmental changes are of particular research interest in recent years. Inclusion complexation between cyclodextrin (CD) and ferrocene (Fc) is well-known and extensively studied because of its reversible association-dissociation controlled by the redox state of Fc. Although there are quite a few reported nanoscale materials incorporating this host-guest pair, polymeric hydrogels with electrochemical activity based on this interactive pair are still rare. Taking advantage of our previous reported hybrid inclusion complex (HIC) hydrogel structure, a new Fc-HIC was designed and obtained with β-CD-modified quantum dots as the core and Fc-ended diblock co-polymer p(DMA-b-NIPAM) as the shell, to achieve an electrochemically active hydrogel at elevated temperatures. Considering the two independent cross-linking strategies in the network structure, i.e., the interchain aggregation of pNIPAM and inclusion complexation between CD and Fc on the surface of the quantum dots, the hydrogel was fully thermo-reversible and its gel-sol transition was achieved after the addition of either an oxidizing agent or a competitive guest to Fc.

  1. Identification of vernalization responsive genes in the winter wheat ...

    Indian Academy of Sciences (India)

    2National Engineering Research Centre for Wheat, 3Collaborative Innovation Center of ... among the specific genes were selected for validation by quantitative reverse transcription ... expression of TaSnRK2.8 enhanced the tolerance to low.

  2. Plant reference genes for development and stress response studies

    Indian Academy of Sciences (India)

    Joyous T Joseph

    2018-02-09

    Feb 9, 2018 ... HKGs are constitutive genes required for the maintenance of basic cellular functions like cell ... abiotic, biotic, and developmental factors affecting the cells in which they express. ..... expression. Theory Biosci. 131 215–223.

  3. Predicting response to primary chemotherapy: gene expression profiling of paraffin-embedded core biopsy tissue.

    Science.gov (United States)

    Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D

    2007-06-01

    Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.

  4. An Alfin-like gene from Atriplex hortensis enhances salt and drought tolerance and abscisic acid response in transgenic Arabidopsis.

    Science.gov (United States)

    Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song

    2018-02-09

    Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.

  5. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Directory of Open Access Journals (Sweden)

    Luca Crepaldi

    Full Text Available In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE conditions. We discovered that Short Interspersed Elements (SINEs located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs, and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  6. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    Science.gov (United States)

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  7. Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Kehua Wang

    2017-06-01

    Full Text Available Perennial ryegrass (Lolium perenne is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants.

  8. Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

    Directory of Open Access Journals (Sweden)

    James eReynolds

    2015-03-01

    Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  9. A central regulatory system largely controls transcriptional activation and repression responses to phosphate starvation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Regla Bustos

    2010-09-01

    Full Text Available Plants respond to different stresses by inducing or repressing transcription of partially overlapping sets of genes. In Arabidopsis, the PHR1 transcription factor (TF has an important role in the control of phosphate (Pi starvation stress responses. Using transcriptomic analysis of Pi starvation in phr1, and phr1 phr1-like (phl1 mutants and in wild type plants, we show that PHR1 in conjunction with PHL1 controls most transcriptional activation and repression responses to phosphate starvation, regardless of the Pi starvation specificity of these responses. Induced genes are enriched in PHR1 binding sequences (P1BS in their promoters, whereas repressed genes do not show such enrichment, suggesting that PHR1(-like control of transcriptional repression responses is indirect. In agreement with this, transcriptomic analysis of a transgenic plant expressing PHR1 fused to the hormone ligand domain of the glucocorticoid receptor showed that PHR1 direct targets (i.e., displaying altered expression after GR:PHR1 activation by dexamethasone in the presence of cycloheximide corresponded largely to Pi starvation-induced genes that are highly enriched in P1BS. A minimal promoter containing a multimerised P1BS recapitulates Pi starvation-specific responsiveness. Likewise, mutation of P1BS in the promoter of two Pi starvation-responsive genes impaired their responsiveness to Pi starvation, but not to other stress types. Phylogenetic footprinting confirmed the importance of P1BS and PHR1 in Pi starvation responsiveness and indicated that P1BS acts in concert with other cis motifs. All together, our data show that PHR1 and PHL1 are partially redundant TF acting as central integrators of Pi starvation responses, both specific and generic. In addition, they indicate that transcriptional repression responses are an integral part of adaptive responses to stress.

  10. Expression Analysis of MYC Genes from Tamarix hispida in Response to Different Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Guifeng Liu

    2012-01-01

    Full Text Available The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.

  11. Expression analysis of MYC genes from Tamarix hispida in response to different abiotic stresses.

    Science.gov (United States)

    Ji, Xiaoyu; Wang, Yucheng; Liu, Guifeng

    2012-01-01

    The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA)-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT)-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.

  12. Role of NPR1 dependent and NPR1 independent genes in response to Salicylic acid

    Directory of Open Access Journals (Sweden)

    Neha Agarwal

    2017-10-01

    Full Text Available NPR1 (Nonexpressor of pathogenesis-related gene is a transcription coactivator and central regulator of systemic acquired resistance (SAR pathway. It controls wide range of pathogenesis related genes involved in various defense responses, acts by sensing SAR signal molecule, Salicylic acid (SA. Mutation in NPR1 results in increased susceptibility to pathogen infection and less expression of pathogenesis related genes. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction. For this RNA-seq was performed in Arabidopsis thaliana Col-0 and npr1-1 in response to Salicylic acid. RNA-seq analysis revealed a total of 3811 differentially expressed gene in which 2109 genes are up-regulated and 1702 genes are down-regulated. We have divided these genes in 6 categories SA induced (SI, SA repressed (SR, NPR1 dependent SI (ND-SI, NPR1 dependent SR (ND-SR, NPR1 independent SI (NI-SI, NPR1 independent SR (NI-SR. Further, Gene ontology and MapMan pathway analysis of differentially expressed genes suggested variety of biological processes and metabolic pathways that are enriched during SAR defense pathway. These results contribute to shed light on importance of both NPR1-dependent (ND and NPR1-independent (NI gene acting downstream to Salicylic acid induction in SAR pathway. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction.

  13. Genome-wide identification and expression analysis of the mitogen-activated protein kinase gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yan Yan

    2016-08-01

    Full Text Available Mitogen-activated protein kinases (MAPKs play central roles in plant developmental processes, hormone signaling transduction, and responses to abiotic stress. However, no data are currently available about the MAPK family in cassava, an important tropical crop. Herein, 21 MeMAPK genes were identified from cassava. Phylogenetic analysis indicated that MeMAPKs could be classified into four subfamilies. Gene structure analysis demonstrated that the number of introns in MeMAPK genes ranged from 1 to 10, suggesting large variation among cassava MAPK genes. Conserved motif analysis indicated that all MeMAPKs had typical protein kinase domains. Transcriptomic analysis suggested that MeMAPK genes showed differential expression patterns in distinct tissues and in response to drought stress between wild subspecies and cultivated varieties. Interaction networks and co-expression analyses revealed that crucial pathways controlled by MeMAPK networks may be involved in the differential response to drought stress in different accessions of cassava. Expression of nine selected MAPK genes showed that these genes could comprehensively respond to osmotic, salt, cold, oxidative stressors, and abscisic acid (ABA signaling. These findings yield new insights into the transcriptional control of MAPK gene expression, provide an improved understanding of abiotic stress responses and signaling transduction in cassava, and lead to potential applications in the genetic improvement of cassava cultivars.

  14. The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

    Science.gov (United States)

    Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

    2016-05-19

    Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

  15. Glucocorticoid receptor gene inactivation in dopamine-innervated areas selectively decreases behavioral responses to amphetamine

    Science.gov (United States)

    Parnaudeau, Sébastien; Dongelmans, Marie-louise; Turiault, Marc; Ambroggi, Frédéric; Delbes, Anne-Sophie; Cansell, Céline; Luquet, Serge; Piazza, Pier-Vincenzo; Tronche, François; Barik, Jacques

    2014-01-01

    The meso-cortico-limbic system, via dopamine release, encodes the rewarding and reinforcing properties of natural rewards. It is also activated in response to abused substances and is believed to support drug-related behaviors. Dysfunctions of this system lead to several psychiatric conditions including feeding disorders and drug addiction. These disorders are also largely influenced by environmental factors and in particular stress exposure. Stressors activate the corticotrope axis ultimately leading to glucocorticoid hormone (GCs) release. GCs bind the glucocorticoid receptor (GR) a transcription factor ubiquitously expressed including within the meso-cortico-limbic tract. While GR within dopamine-innervated areas drives cocaine's behavioral responses, its implication in responses to other psychostimulants such as amphetamine has never been clearly established. Moreover, while extensive work has been made to uncover the role of this receptor in addicted behaviors, its contribution to the rewarding and reinforcing properties of food has yet to be investigated. Using mouse models carrying GR gene inactivation in either dopamine neurons or in dopamine-innervated areas, we found that GR in dopamine responsive neurons is essential to properly build amphetamine-induced conditioned place preference and locomotor sensitization. c-Fos quantification in the nucleus accumbens further confirmed defective neuronal activation following amphetamine injection. These diminished neuronal and behavioral responses to amphetamine may involve alterations in glutamate transmission as suggested by the decreased MK801-elicited hyperlocomotion and by the hyporeactivity to glutamate of a subpopulation of medium spiny neurons. In contrast, GR inactivation did not affect rewarding and reinforcing properties of food suggesting that responding for natural reward under basal conditions is preserved in these mice. PMID:24574986

  16. Glucocorticoid receptor gene inactivation in dopamine-innervated areas selectively decreases behavioral responses to amphetamine

    Directory of Open Access Journals (Sweden)

    Sebastien eParnaudeau

    2014-02-01

    Full Text Available The meso-cortico-limbic system, via dopamine release, encodes the rewarding and reinforcing properties of natural rewards. It is also activated in response to abused substances and is believed to support drug-related behaviors. Dysfunctions of this system lead to several psychiatric conditions including feeding disorders and drug addiction. These disorders are also largely influenced by environmental factors and in particular stress exposure. Stressors activate the corticotrope axis ultimately leading to glucocorticoid hormone (GCs release. GCs bind the glucocorticoid receptor (GR a transcription factor ubiquitously expressed including within the meso-cortico-limbic tract. While the GR within dopamine-innervated areas drives cocaine’s behavioral responses, its implication in responses to other psychostimulants such as amphetamine has never been clearly established. Moreover, while extensive work has been made to uncover the role of this receptor in addicted behaviors, its contribution to the rewarding and reinforcing properties of food has yet to be investigated. Using mouse models carrying GR gene inactivation in either dopamine neurons or in dopamine-innervated areas, we found that GR in dopamine responsive neurones is essential to properly build amphetamine-induced conditioned place preference and locomotor sensitization. c-Fos quantification in the nucleus accumbens further confirmed defective neuronal activation following amphetamine injection. These diminished neuronal and behavioral responses to amphetamine may involve alterations in glutamate transmission as suggested by the decreased MK801-elicited hyperlocomotion and by the hyporeactivity to glutamate of a subpopulation of medium spiny neurons. In contrast, GR inactivation did not affect rewarding and reinforcing properties of food suggesting that responding for natural reward under basal conditions is preserved in these mice.

  17. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  18. Cyclic di-GMP regulation of the bvg-repressed genes and the orphan response regulator RisA in Bordetella pertussis

    Science.gov (United States)

    Expression of Bordetella pertussis virulence factors is activated by the BvgAS two-component system. Under modulating growth conditions BvgAS indirectly represses another set of genes through the action of BvgR, a bvg-activated protein. BvgR blocks activation of the response regulator RisA which is ...

  19. Gene expression changes in female zebrafish (Danio rerio) brain in response to acute exposure to methylmercury

    Science.gov (United States)

    Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.

    2011-01-01

    Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of pgenes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.

  20. Dynamic gene expression response to altered gravity in human T cells.

    Science.gov (United States)

    Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver

    2017-07-12

    We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.

  1. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  2. Mechanical stress activates Smad pathway through PKCδ to enhance interleukin-11 gene transcription in osteoblasts.

    Directory of Open Access Journals (Sweden)

    Shinsuke Kido

    Full Text Available BACKGROUND: Mechanical stress rapidly induces ΔFosB expression in osteoblasts, which binds to interleukin (IL-11 gene promoter to enhance IL-11 expression, and IL-11 enhances osteoblast differentiation. Because bone morphogenetic proteins (BMPs also stimulate IL-11 expression in osteoblasts, there is a possibility that BMP-Smad signaling is involved in the enhancement of osteoblast differentiation by mechanical stress. The present study was undertaken to clarify whether mechanical stress affects BMP-Smad signaling, and if so, to elucidate the role of Smad signaling in mechanical stress-induced enhancement of IL-11 gene transcription. METHODOLOGY/PRINCIPAL FINDINGS: Mechanical loading by fluid shear stress (FSS induced phosphorylation of BMP-specific receptor-regulated Smads (BR-Smads, Smad1/5, in murine primary osteoblasts (mPOBs. FSS rapidly phosphorylated Y311 of protein kinase C (PKCδ, and phosphorylated PKCδ interacted with BR-Smads to phosphorylate BR-Smads. Transfection of PKCδ siRNA or Y311F mutant PKCδ abrogated BR-Smads phosphorylation and suppressed IL-11 gene transcription enhanced by FSS. Activated BR-Smads bound to the Smad-binding element (SBE of IL-11 gene promoter and formed complex with ΔFosB/JunD heterodimer via binding to the C-terminal region of JunD. Site-directed mutagenesis in the SBE and the AP-1 site revealed that both SBE and AP-1 sites were required for full activation of IL-11 gene promoter by FSS. CONCLUSIONS/SIGNIFICANCE: These results demonstrate that PKCδ-BR-Smads pathway plays an important role in the intracellular signaling in response to mechanical stress, and that a cross-talk between PKCδ-BR-Smads and ΔFosB/JunD pathways synergistically stimulates IL-11 gene transcription in response to mechanical stress.

  3. Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

    International Nuclear Information System (INIS)

    Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

    2009-01-01

    Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused by these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects

  4. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  5. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens.

    Directory of Open Access Journals (Sweden)

    Hai-Ting Hao

    Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response

  6. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  7. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  8. Transcriptional expression of type I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis

    DEFF Research Database (Denmark)

    Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben

    2011-01-01

    Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...

  9. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  10. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... traditional breeding as well as gene-engineering approa- ches (Ottow et al., ... tolerance, H. ammodendron is one of the main tree species used for ... labeled with DIG-11-dUTP by reverse transcription using. SuperScript III ...

  11. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  12. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-12-07

    Dec 7, 2016 ... ... stress. Hormone ABA treatment induces, whereas GA treatment decreases, RS1 ... Key word: Rice (Oryza sativa L.), submergence, RNA-seq, Sub1A, abiotic stress. ... genes may interact with Sub1A-1 that are necessary for.

  13. Rotavirus nonstructural protein 1 antagonizes innate immune response by interacting with retinoic acid inducible gene I

    Directory of Open Access Journals (Sweden)

    Qin Lan

    2011-12-01

    Full Text Available Abstract Background The nonstructural protein 1 (NSP1 of rotavirus has been reported to block interferon (IFN signaling by mediating proteasome-dependent degradation of IFN-regulatory factors (IRFs and (or the β-transducin repeat containing protein (β-TrCP. However, in addition to these targets, NSP1 may subvert innate immune responses via other mechanisms. Results The NSP1 of rotavirus OSU strain as well as the IRF3 binding domain truncated NSP1 of rotavirus SA11 strain are unable to degrade IRFs, but can still inhibit host IFN response, indicating that NSP1 may target alternative host factor(s other than IRFs. Overexpression of NSP1 can block IFN-β promoter activation induced by the retinoic acid inducible gene I (RIG-I, but does not inhibit IFN-β activation induced by the mitochondrial antiviral-signaling protein (MAVS, indicating that NSP1 may target RIG-I. Immunoprecipitation experiments show that NSP1 interacts with RIG-I independent of IRF3 binding domain. In addition, NSP1 induces down-regulation of RIG-I in a proteasome-independent way. Conclusions Our findings demonstrate that inhibition of RIG-I mediated type I IFN responses by NSP1 may contribute to the immune evasion of rotavirus.

  14. Changes in gene expression and catalase activity in Oryza sativa L. under abiotic stress.

    Science.gov (United States)

    Vighi, I L; Benitez, L C; do Amaral, M N; Auler, P A; Moraes, G P; Rodrigues, G S; da Maia, L C; Pinto, L S; Braga, E J B

    2016-11-03

    Different rice (Oryza sativa L.) genotypes were subjected to high salinity and low temperature (150 mM NaCl and 13°C, respectively) for 0, 6, 24, 48, or 72 h. We evaluated the simultaneous expression of the genes OsCATA, OsCATB, and OsCATC, correlated gene expression with enzyme activity, and verified the regulation of these genes through identification of cis-elements in the promoter region. The hydrogen peroxide content increased in a tolerant genotype and decreased in a sensitive genotype under both stress conditions. Lipid peroxidation increased in the tolerant genotype when exposed to cold, and in the sensitive genotype when exposed to high salinity. Catalase activity significantly increased in both genotypes when subjected to 13°C. In the tolerant genotype, OsCATA and OsCATB were the most responsive to high salinity and cold, while in the sensitive genotype, OsCATA and OsCATC responded positively to saline stress, as did OsCATA and OsCATB to low temperature. Cis-element analysis identified different regulatory sequences in the catalase promoter region of each genotype. The sensitive genotype maintained a better balance between hydrogen oxyacid levels, catalase activity, and lipid peroxidation under low temperature than the resistant genotype. OsCATA and OsCATB were the most responsive in the salt-tolerant genotype to cold, OsCATA and OsCATC were the most responsive to saline stress, and OsCATA and OsCATB were the most responsive to chilling stress in the sensitive genotype. There were positive correlations between catalase activity and OsCATB expression in the tolerant genotype under saline stress and in the sensitive genotype under cold stress.

  15. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  16. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  17. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  18. Enhanced Virulence Gene Activity of Agrobacterium in Muskmelon (Cucumis melo L. cv. ‘Birdie’

    Directory of Open Access Journals (Sweden)

    Abul K.M. MOHIUDDIN

    2011-05-01

    Full Text Available Muskmelon (Cucumis melo L. cultivar ‘Birdie’, was evaluated for its response to the tumorigenic Agrobacterium tumefaciens and the oncogenic A. rhizogenes strains. Stem and petiole of three week-old in vitro-grown muskmelon plants were inoculated with five strains of A. tumefaciens and A. rhizogenes each and observed phenotypic expressions i.e. induction of crown galls and hairy roots. This phenotypic expression was efficaciously increased when virulence gene activity of different strains of two Agrobacterium species was enhanced. Intensive studies on enhancement of virulence gene activity of Agrobacterium found to be correlated to the appropriate light intensity (39.3 μmol m-2 s-1 with a specific concentration of monocyclic phenolic compound, acetosyringone (20 μM. The gene activity was also influenced by several other physical factors e.g. plant tissue type, Agrobacterium species and their strains, and plant tissue-Agrobacterium interaction. Among the different A. tumefaciens strains, LBA4404 showed the best virulence gene activity in both stem and petiole through the formation of higher rate of crown galls. On the other hand, strain 15834 of A. rhizogenes showed better gene activity in stem and 8196 in petiole through the formation of higher rate of hairy roots as well as higher average number of hairy roots. Among the two different types of explants, petiole was more susceptible to both Agrobacterium species. Thus it was concluded that future muskmelon transformation study can efficiently be carried out with LBA4404, 15834 and 8196 strains using petiole explants by adding 20 μM of acetosyringone in the medium.

  19. Function of the auxin-responsive gene TaSAUR75 under salt and drought stress

    Directory of Open Access Journals (Sweden)

    Yuan Guo

    2018-04-01

    Full Text Available Small auxin-upregulated RNAs (SAURs are genes regulated by auxin and environmental factors. In this study, we identified a SAUR gene in wheat, TaSAUR75. Under salt stress, TaSAUR75 is downregulated in wheat roots. Subcellular localization revealed that TaSAUR75 was localized in both the cytoplasm and nucleus. Overexpression of TaSAUR75 increased drought and salt tolerance in Arabidopsis. Transgenic lines showed higher root length and survival rate and higher expression of some stress-responsive genes than control plants under salt and drought stress. Less H2O2 accumulated in transgenic lines than in control plants under drought stress. Our findings reveal a positive regulatory role of the auxin-responsive gene TaSAUR75 in plant responses to drought and salt stress and provide a candidate gene for improvement of abiotic stress tolerance in crop breeding.

  20. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

    Directory of Open Access Journals (Sweden)

    Erik Södersten

    2014-09-01

    Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

  1. LWD–TCP complex activates the morning gene CCA1 in Arabidopsis

    Science.gov (United States)

    Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

    2016-01-01

    A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock. PMID:27734958

  2. LWD-TCP complex activates the morning gene CCA1 in Arabidopsis.

    Science.gov (United States)

    Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

    2016-10-13

    A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock.

  3. WRKY Transcription Factors Involved in Activation of SA Biosynthesis Genes

    Directory of Open Access Journals (Sweden)

    Bol John F

    2011-05-01

    Full Text Available Abstract Background Increased defense against a variety of pathogens in plants is achieved through activation of a mechanism known as systemic acquired resistance (SAR. The broad-spectrum resistance brought about by SAR is mediated through salicylic acid (SA. An important step in SA biosynthesis in Arabidopsis is the conversion of chorismate to isochorismate through the action of isochorismate synthase, encoded by the ICS1 gene. Also AVRPPHB SUSCEPTIBLE 3 (PBS3 plays an important role in SA metabolism, as pbs3 mutants accumulate drastically reduced levels of SA-glucoside, a putative storage form of SA. Bioinformatics analysis previously performed by us identified WRKY28 and WRKY46 as possible regulators of ICS1 and PBS3. Results Expression studies with ICS1 promoter::β-glucuronidase (GUS genes in Arabidopsis thaliana protoplasts cotransfected with 35S::WRKY28 showed that over expression of WRKY28 resulted in a strong increase in GUS expression. Moreover, qRT-PCR analyses indicated that the endogenous ICS1 and PBS3 genes were highly expressed in protoplasts overexpressing WRKY28 or WRKY46, respectively. Electrophoretic mobility shift assays indentified potential WRKY28 binding sites in the ICS1 promoter, positioned -445 and -460 base pairs upstream of the transcription start site. Mutation of these sites in protoplast transactivation assays showed that these binding sites are functionally important for activation of the ICS1 promoter. Chromatin immunoprecipitation assays with haemagglutinin-epitope-tagged WRKY28 showed that the region of the ICS1 promoter containing the binding sites at -445 and -460 was highly enriched in the immunoprecipitated DNA. Conclusions The results obtained here confirm results from our multiple microarray co-expression analyses indicating that WRKY28 and WRKY46 are transcriptional activators of ICS1 and PBS3, respectively, and support this in silico screening as a powerful tool for identifying new components of stress

  4. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response

    Directory of Open Access Journals (Sweden)

    Nasrine Bendjilali

    2017-01-01

    Full Text Available Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen.

  5. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.

    Science.gov (United States)

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J

    2017-01-05

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.

  6. Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes.

    Directory of Open Access Journals (Sweden)

    Sandra M Mathioni

    Full Text Available Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.

  7. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  8. Activation of the human beta interferon gene by the adenovirus type 12 E1B gene

    International Nuclear Information System (INIS)

    Shiroki, K.; Toth, M.

    1988-01-01

    The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT

  9. Transcript accumulation of putative drought responsive genes in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... tories where radioactive labelling is not available by using the silver staining ... ICCV2 were removed from the soil and roots were dipped for 5 h into water with or .... respective PCR product in control and drought-stressed samples will testify to the ..... responsive elements and the dehydration-responsive.

  10. Differential Gene Expression Associated with Honey Bee Grooming Behavior in Response to Varroa Mites.

    Science.gov (United States)

    Hamiduzzaman, Mollah Md; Emsen, Berna; Hunt, Greg J; Subramanyam, Subhashree; Williams, Christie E; Tsuruda, Jennifer M; Guzman-Novoa, Ernesto

    2017-05-01

    Honey bee (Apis mellifera) grooming behavior is an important mechanism of resistance against the parasitic mite Varroa destructor. This research was conducted to study associations between grooming behavior and the expression of selected immune, neural, detoxification, developmental and health-related genes. Individual bees tested in a laboratory assay for various levels of grooming behavior in response to V. destructor were also analyzed for gene expression. Intense groomers (IG) were most efficient in that they needed significantly less time to start grooming and fewer grooming attempts to successfully remove mites from their bodies than did light groomers (LG). In addition, the relative abundance of the neurexin-1 mRNA, was significantly higher in IG than in LG, no groomers (NG) or control (bees without mite). The abundance of poly U binding factor kd 68 and cytochrome p450 mRNAs were significantly higher in IG than in control bees. The abundance of hymenoptaecin mRNA was significantly higher in IG than in NG, but it was not different from that of control bees. The abundance of vitellogenin mRNA was not changed by grooming activity. However, the abundance of blue cheese mRNA was significantly reduced in IG compared to LG or NG, but not to control bees. Efficient removal of mites by IG correlated with different gene expression patterns in bees. These results suggest that the level of grooming behavior may be related to the expression pattern of vital honey bee genes. Neurexin-1, in particular, might be useful as a bio-marker for behavioral traits in bees.

  11. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  12. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  13. Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

    Science.gov (United States)

    Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

    2018-01-01

    The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

  14. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  15. Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

    Directory of Open Access Journals (Sweden)

    Tai Dessmon

    2005-01-01

    Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

  16. Characterizing gene responses to drought stress in fourwing saltbush [Atriplex canescens (Pursh.) Nutt.)

    Science.gov (United States)

    Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon

    1992-01-01

    New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub

  17. Association of Candidate Genes With Submergence Response in Perennial Ryegrass

    Directory of Open Access Journals (Sweden)

    Xicheng Wang

    2017-05-01

    Full Text Available Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT, leaf fresh weight (LFW, leaf dry weight (LDW, and chlorophyll fluorescence (Fv/Fm at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments. Among 26 candidate genes tested by various models, single nucleotide polymorphisms (SNPs in 10 genes showed significant associations with traits including 16 associations for control, 10 for submergence, and 8 for recovery. Under submergence, Lp1-SST encoding sucrose:sucrose 1-fructosyltransferase and LpGA20ox encoding gibberellin 20-oxidase were associated with LFW and LDW, and LpACO1 encoding 1-aminocyclopropane-1-carboxylic acid oxidase was associated with LFW. Associations between Lp1-SST and HT, Lp6G-FFT encoding fructan:fructan 6G-fructosyltransferase and Fv/Fm, LpCAT encoding catalase and HT were also detected under submergence stress. Upon de-submergence, Lp1-SST, Lp6G-FFT, and LpPIP1 encoding plasma membrane intrinsic protein type 1 were associated with LFW or LDW, while LpCBF1b encoding C-repeat binding factor were associated with HT. Nine significant SNPs in Lp1-SST, Lp6G-FFT, LpCAT, and LpACO1 resulted in amino acid changes with five substitutions found in Lp1-SST under submergence or recovery. The results indicated that allelic diversity in genes involved in carbohydrate and antioxidant metabolism, ethylene and gibberellin biosynthesis, and transcript factor could contribute to growth variations in perennial ryegrass under submergence stress and recovery after de-submergence.

  18. Nutritional Effect on Androgen-Response Gene Expression and Prostate Tumor Growth

    National Research Council Canada - National Science Library

    Wang, Zhou

    2001-01-01

    .... The dietary influence on ventral prostate weight does not seem to involve androgen action axis because dietary components did not influence the expression of several androgen-response genes, serum testosterone...

  19. Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M

    2013-03-28

    Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. A novel role for pigment genes in the stress response in rainbow trout (Oncorhynchus mykiss)

    KAUST Repository

    Khan, Uniza Wahid; Ø verli, Ø yvind; Hinkle, Patricia M.; Pasha, Farhan Ahmad; Johansen, Ida Beitnes; Berget, Ingunn; Silva, Patricia I. M.; Kittilsen, Silje; Hö glund, Erik; Omholt, Stig W.; Vå ge, Dag Inge

    2016-01-01

    pigmentation gene, melanocyte stimulating hormone receptor (MC1R), is strongly associated with distinct differences in steroidogenic melanocortin 2 receptor (MC2R) mRNA expression between high- (HR) and low-responsive (LR) rainbow trout (Oncorhynchus mykiss

  1. The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

    Science.gov (United States)

    Yazaki, Junshi; Kikuchi, Shoshi

    2005-01-01

    We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

  2. Association between gene variants and response to buprenorphine maintenance treatment.

    Science.gov (United States)

    Gerra, Gilberto; Somaini, Lorenzo; Leonardi, Claudio; Cortese, Elena; Maremmani, Icro; Manfredini, Matteo; Donnini, Claudia

    2014-01-30

    A variety of studies were addressed to differentiate responders and non-responders to substitution treatment among heroin dependent patients, without conclusive findings. In particular, preliminary pharmacogenetic findings have been reported to predict treatment effectiveness in mental health and substance use disorders. Aim of the present study was to investigate the possible association of buprenorphine (BUP) treatment outcome with gene variants that may affect kappa-opioid receptors and dopamine system function. One hundred and seven heroin addicts (West European, Caucasians) who underwent buprenorphine maintenance treatment were genotyped and classified into two groups (A and B) on the basis of treatment outcome. Non-responders to buprenorphine (group B) have been identified taking into account early drop out, continuous use of heroin, severe behavioral or psychiatric problems, misbehavior and diversion during the 6 months treatment period. No difference was evidenced between responders and non-responders to BUP in the frequency of kappa opioid receptor (OPRK1) 36G>T SNP. The frequency of dopamine transporter (DAT) gene polymorphism (SLC6A3/DAT1), allele 10, was evidently much higher in "non-responder" than in "responder" individuals (64.9% vs. 55.93%) whereas the frequency of the category of other alleles (6, 7 and 11) was higher in responder than in non-responder individuals (11.02% vs. 2.13% respectively). On one hand, the hypothesis that possible gene-related changes in kappa-opioid receptor could consistently affect buprenorphine pharmacological action and clinical effectiveness was not confirmed in our study, at least in relation to the single nucleotide polymorphism 36G>T. On the other hand, the possibility that gene-related dopamine changes could have reduced BUP effectiveness and impaired maintenance treatment outcome was cautiously supported by our findings. DAT1 gene variants such as allele 10, previously reported in association with personality and

  3. Epigenetic modulation of gene expression governs the brain���s response to injury

    OpenAIRE

    Simon, Roger P.

    2015-01-01

    Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is...

  4. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  5. Low Oxygen Tension Enhances Expression of Myogenic Genes When Human Myoblasts Are Activated from G0 Arrest

    DEFF Research Database (Denmark)

    Sellathurai, Jeeva; Nielsen, Joachim; Hejbøl, Eva Kildall

    2016-01-01

    -PCR, immunocytochemistry and western blot. RESULTS AND CONCLUSIONS: We found an increase in proliferation rate of myoblasts when activated at a low oxygen tension (1% O2) compared to 21% O2. In addition, the gene expression studies showed up regulation of the myogenesis related genes PAX3, PAX7, MYOD, MYOG (myogenin), MET......, NCAM, DES (desmin), MEF2A, MEF2C and CDH15 (M-cadherin), however, the fraction of DES and MYOD positive cells was not increased by low oxygen tension, indicating that 1% O2 may not have a functional effect on the myogenic response. Furthermore, the expression of genes involved in the TGFβ, Notch...... and Wnt signaling pathways were also up regulated in low oxygen tension. The differences in gene expression were most pronounced at day one after activation from G0-arrest, thus the initial activation of myoblasts seemed most sensitive to changes in oxygen tension. Protein expression of HES1 and β...

  6. Streptococcus mutans differential gene expression in response to simulated microgravity

    Data.gov (United States)

    National Aeronautics and Space Administration — Astronauts have been previously shown to exhibit decreased salivary lysozyme and increased dental calculus and gingival inflammation in response to space flight host...

  7. Francisella tularensis subsp. tularensis induces a unique pulmonary inflammatory response: role of bacterial gene expression in temporal regulation of host defense responses.

    Directory of Open Access Journals (Sweden)

    Kathie-Anne Walters

    Full Text Available Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4. Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways.

  8. Genes Important for Catalase Activity in Enterococcus faecalis

    Science.gov (United States)

    Baureder, Michael; Hederstedt, Lars

    2012-01-01

    Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595

  9. Vascular endothelial genes that are responsive to tumor necrosis factor-alpha in vitro are expressed in atherosclerotic lesions, including inhibitor of apoptosis protein-1, stannin, and two novel genes

    NARCIS (Netherlands)

    Horrevoets, A. J.; Fontijn, R. D.; van Zonneveld, A. J.; de Vries, C. J.; ten Cate, J. W.; Pannekoek, H.

    1999-01-01

    Activation and dysfunction of endothelial cells play a prominent role in patho-physiological processes such as atherosclerosis. We describe the identification by differential display of 106 cytokine-responsive gene fragments from endothelial cells, activated by monocyte conditioned medium or tumor

  10. Cloning and characterization of the pheromone biosynthesis activating neuropeptide receptor gene in Spodoptera littoralis larvae.

    Science.gov (United States)

    Zheng, Lei; Lytle, Christian; Njauw, Ching-Ni; Altstein, Miriam; Martins-Green, Manuela

    2007-05-15

    In noctuid moths cuticular pigmentation is regulated by the pyrokinin/pheromone biosynthesis activating neuropeptide (PK/PBAN) family, which also mediates a variety of other functions in moths and other insects. Numerous studies have shown that these neuropeptides exert their functions through activation of the PBAN receptor (PBAN-R), with subsequent Ca(2+) influx, followed by either activation of cAMP or direct activation of downstream kinases. Recently, several PBAN-Rs have been identified, all of which are from the pheromone gland of adult female moths, but evidence shows that functional PK/PBAN-Rs can also be expressed in insect larvae, where they mediate melanization and possibly other functions (e.g., diapause). Here, we identified a gene encoding a G-protein-coupled receptor from the 5th instar larval tissue of the moth Spodoptera littoralis. The cDNA of this gene contains an open reading frame with a length of 1050 nucleotides, which translates to a 350-amino acid, 42-kDa protein that shares 92% amino acid identity with Helicoverpa zea and Helicoverpa armigera PBAN-R, 81% with Bombyx mori PBAN-R and 72% with Plutella xylostella PBAN-R. The S. littoralis PBAN-R gene was stably expressed in NIH3T3 cells and transiently in HEK293 cells. We show that it mediates the dose-dependent PBAN-induced intracellular Ca(2+) response and activation of the MAP kinase via a PKC-dependent but Galphai-independent signaling mechanism. Other PK/PBAN family peptides (pheromonotropin and a C-terminally PBAN-derived peptide PBAN(28-33)NH(2)) also triggered MAP kinase activation. This receptor, together with the previously cloned PBAN-R, may facilitate our understanding of the cell-specific responses and functional diversities of this diverse neuropeptide family.

  11. Gene activated by growth factors is related to the oncogene v-jun

    International Nuclear Information System (INIS)

    Ryder, K.; Lau, L.F.; Nathans, D.

    1988-01-01

    The authors have recently identified by cDNA cloning a set of genes that are rapidly activated in cultured mouse cells by protein growth factors. Here they report that the nucleotide sequence of a cDNA (clone 465) derived from one of these immediate early genes (hereafter called jun-B) encodes a protein homologous to that encoded by the avian sarcoma virus 17 oncogene v-jun. Homology between the jun-B and v-jun proteins is in two regions: one near the N terminus and the other at the C terminus. The latter sequence was shown to have regions of sequence similarity to the DNA-binding domain of the yeast transcriptional regulatory protein GCN4 and to the oncogenic protein fos. Southern blots of human, mouse, and chicken DNA demonstrate that jun-B and c-jun are different genes and that there may be other vertebrate genes related to jun-B and c-jun. These findings suggest that there is a jun family of genes encoding related transcriptional regulatory proteins. The jun-B protein, and perhaps other members of the jun family, may play a role in regulating the genomic response to growth factors

  12. AKT phosphorylates H3-threonine 45 to facilitate termination of gene transcription in response to DNA damage

    OpenAIRE

    Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk

    2015-01-01

    Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly ...

  13. Genetic dissection of acute ethanol responsive gene networks in prefrontal cortex: functional and mechanistic implications.

    Directory of Open Access Journals (Sweden)

    Aaron R Wolen

    Full Text Available Individual differences in initial sensitivity to ethanol are strongly related to the heritable risk of alcoholism in humans. To elucidate key molecular networks that modulate ethanol sensitivity we performed the first systems genetics analysis of ethanol-responsive gene expression in brain regions of the mesocorticolimbic reward circuit (prefrontal cortex, nucleus accumbens, and ventral midbrain across a highly diverse family of 27 isogenic mouse strains (BXD panel before and after treatment with ethanol.Acute ethanol altered the expression of ~2,750 genes in one or more regions and 400 transcripts were jointly modulated in all three. Ethanol-responsive gene networks were extracted with a powerful graph theoretical method that efficiently summarized ethanol's effects. These networks correlated with acute behavioral responses to ethanol and other drugs of abuse. As predicted, networks were heavily populated by genes controlling synaptic transmission and neuroplasticity. Several of the most densely interconnected network hubs, including Kcnma1 and Gsk3β, are known to influence behavioral or physiological responses to ethanol, validating our overall approach. Other major hub genes like Grm3, Pten and Nrg3 represent novel targets of ethanol effects. Networks were under strong genetic control by variants that we mapped to a small number of chromosomal loci. Using a novel combination of genetic, bioinformatic and network-based approaches, we identified high priority cis-regulatory candidate genes, including Scn1b, Gria1, Sncb and Nell2.The ethanol-responsive gene networks identified here represent a previously uncharacterized intermediate phenotype between DNA variation and ethanol sensitivity in mice. Networks involved in synaptic transmission were strongly regulated by ethanol and could contribute to behavioral plasticity seen with chronic ethanol. Our novel finding that hub genes and a small number of loci exert major influence over the ethanol

  14. Sphingomonas wittichii Strain RW1 Genome-Wide Gene Expression Shifts in Response to Dioxins and Clay.

    Directory of Open Access Journals (Sweden)

    Benli Chai

    Full Text Available Sphingomonas wittichii strain RW1 (RW1 is one of the few strains that can grow on dibenzo-p-dioxin (DD. We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF, and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes' microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis.

  15. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  16. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    Directory of Open Access Journals (Sweden)

    Davey Jennifer C

    2007-12-01

    Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for

  17. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  18. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Stefanie Staats

    2018-01-01

    Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.

  19. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster.

    Science.gov (United States)

    Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald

    2018-01-11

    In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .

  20. Assessing the Role of ETHYLENE RESPONSE FACTOR Transcriptional Repressors in Salicylic Acid-Mediated Suppression of Jasmonic Acid-Responsive Genes.

    Science.gov (United States)

    Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M

    2017-02-01

    Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. Differential gene expression responses distinguish contact and respiratory sensitizers and nonsensitizing irritants in the local lymph node assay.

    Science.gov (United States)

    Adenuga, David; Woolhiser, Michael R; Gollapudi, B Bhaskar; Boverhof, Darrell R

    2012-04-01

    Genomic approaches have the potential to enhance the specificity and predictive accuracy of existing toxicology endpoints, including those for chemical sensitization. The present study was conducted to determine whether gene expression responses can distinguish contact sensitizers (1-chloro-2,4-dinitrobenzene [DNCB] and hexyl cinnamic aldehyde [HCA]), respiratory sensitizers (ortho-phthalaldehyde and trimellitic anhydride [TMA]), and nonsensitizing irritants (methyl salicylate [MS] and nonanoic acid [NA]) in the local lymph node assay (LLNA). Female Balb/c mice received doses of each chemical as per the standard LLNA dosing regimen on days 1, 2, and 3. Auricular lymph nodes were analyzed for tritiated thymidine ((3)HTdR) incorporation on day 6 and for gene expression responses on days 6 and 10. All chemicals induced dose-dependent increases in stimulation index, which correlated strongly with the number of differentially expressed genes. A majority of genes modulated by the irritants were similarly altered by the sensitizers, consistent with the irritating effects of the sensitizers. However, a select number of responses involved with immune-specific functions, such as dendritic cell activation, were unique to the sensitizers and may offer the ability to distinguish sensitizers from irritants. Genes for the mast cell proteases 1 and 8, Lgals7, Tim2, Aicda, Il4, and Akr1c18 were more strongly regulated by respiratory sensitizers compared with contact sensitizers and may represent potential biomarkers for discriminating between contact and respiratory sensitizers. Collectively, these data suggest that gene expression responses may serve as useful biomarkers to distinguish between respiratory and contact sensitizers and nonsensitizing irritants in the LLNA.

  2. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum.

    Science.gov (United States)

    Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang

    2011-11-01

    Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.

  4. Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

    International Nuclear Information System (INIS)

    Teutschbein, Janka; Haydn, Johannes M; Samans, Birgit; Krause, Michael; Eilers, Martin; Schartl, Manfred; Meierjohann, Svenja

    2010-01-01

    Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase) triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1), early growth response 1 (Egr1), osteopontin (Opn), insulin-like growth factor binding protein 3 (Igfbp3), dual-specificity phosphatase 4 (Dusp4), and tumor-associated antigen L6 (Taal6). Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute new possible molecular players in melanoma development

  5. Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

    Directory of Open Access Journals (Sweden)

    Krause Michael

    2010-07-01

    Full Text Available Abstract Background Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Methods Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Results Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1, early growth response 1 (Egr1, osteopontin (Opn, insulin-like growth factor binding protein 3 (Igfbp3, dual-specificity phosphatase 4 (Dusp4, and tumor-associated antigen L6 (Taal6. Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Conclusion Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute

  6. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  7. Reconstructing a Network of Stress-Response Regulators via Dynamic System Modeling of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Wei-Sheng Wu

    2008-01-01

    Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  8. MED1 independent activation of endogenous target genes by PPARα

    DEFF Research Database (Denmark)

    Grøntved, Lars; Bugge, Anne K.; Roeder, Robert G.

    The mediator complex serves as a transcriptional co-activator complex by acting as a bridge between promoter-bound transcription factors and the preinitiation complex. Genetic and biochemical studies indicate that nuclear receptors recruit the mediator complex through direct interaction with the ......The mediator complex serves as a transcriptional co-activator complex by acting as a bridge between promoter-bound transcription factors and the preinitiation complex. Genetic and biochemical studies indicate that nuclear receptors recruit the mediator complex through direct interaction...... derived from TRAP220 KO mice. Interestingly, rescue experiments in confluent TRAP220 KO MEFs with different versions of MED1 indicate that the LXXLL motif is not necessary for PPARgamma mediated gene activation (Ge et al, MCB published online ahead of print 2007). By analogy, we show here that MED1...... is dispensable for PPARalpha transcriptional activity in proliferating but is necessary in confluent AML-12 cells and TRAP220 KO MEFs. Collectively this indicates that the PPARs might have adopted an alternative mediator recruitment mechanism that is dispensable of direct interaction with MED1 on endogenous...

  9. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response

    Directory of Open Access Journals (Sweden)

    Thomas R. Aunins

    2018-03-01

    Full Text Available Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under

  10. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response.

    Science.gov (United States)

    Aunins, Thomas R; Erickson, Keesha E; Prasad, Nripesh; Levy, Shawn E; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree

    2018-01-01

    Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress

  11. Spaceflight Modifies Escherichia coli Gene Expression in Response to Antibiotic Exposure and Reveals Role of Oxidative Stress Response

    Science.gov (United States)

    Aunins, Thomas R.; Erickson, Keesha E.; Prasad, Nripesh; Levy, Shawn E.; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree

    2018-01-01

    Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress

  12. Regulation of the E. coli SOS response by the lexA gene product

    International Nuclear Information System (INIS)

    Brent, R.

    1983-01-01

    In an Escherichia coli that is growing normally, transcription of many genes is repressed by the product of the lexA gene. If cellular DNA is damaged, proteolytically competent recA protein (recA protease) inactivates lexA protein and these genes are induced. Many of the cellular phenomena observed during the cellular response to DNA damage (the SOS response) are the consequence of the expression of these lexA-prepressed genes. Since the SOS response of E. coli has recently been the subject of a comprehensive review, in this paper I would like to concentrate on some modifications to the picture based on new data. 12 references, 2 figures

  13. Small molecule antagonism of oxysterol-induced Epstein-Barr virus induced gene 2 (EBI2) activation

    DEFF Research Database (Denmark)

    Benned-Jensen, Tau; Madsen, Christian M; Arfelt, Kristine N

    2013-01-01

    The Epstein-Barr virus induced gene 2 (EBI2) was recently identified as the first oxysterol-activated 7TM receptor. EBI2 is essential for B cell trafficking within lymphoid tissues and thus the humoral immune response in general. Here we characterize the antagonism of the non-peptide molecule GSK...

  14. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  15. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  16. Interactions between SNPs affecting inflammatory response genes are associated with multiple myeloma disease risk and survival

    DEFF Research Database (Denmark)

    Nielsen, Kaspar René; Rodrigo-Domingo, Maria; Steffensen, Rudi

    2017-01-01

    The origin of multiple myeloma depends on interactions with stromal cells in the course of normal B-cell differentiation and evolution of immunity. The concept of the present study is that genes involved in MM pathogenesis, such as immune response genes, can be identified by screening for single......3L1 gene promoters. The occurrence of single polymorphisms, haplotypes and SNP-SNP interactions were statistically analyzed for association with disease risk and outcome following high-dose therapy. Identified genes that carried SNPs or haplotypes that were identified as risk or prognostic factors......= .005). The 'risk genes' were analyzed for expression in normal B-cell subsets (N = 6) from seven healthy donors and we found TNFA and IL-6 expressed both in naïve and in memory B cells when compared to preBI, II, immature and plasma cells. The 'prognosis genes' CHI3L1, IL-6 and IL-10 were differential...

  17. Immunomodulatory activity of andrographolide on macrophage activation and specific antibody response

    Science.gov (United States)

    Wang, Wei; Wang, Jing; Dong, Sheng-fu; Liu, Chun-hong; Italiani, Paola; Sun, Shu-hui; Xu, Jing; Boraschi, Diana; Ma, Shi-ping; Qu, Di

    2010-01-01

    Aim: To investigate the immunomodulatory effects of andrographolide on both innate and adaptive immune responses. Methods: Andrographolide (10 μg/mL in vitro or 1 mg/kg in vivo) was used to modulate LPS-induced classical activated (M1) or IL-4-induced alternative activated (M2) macrophages in vitro and humor immune response to HBsAg in vivo. Cytokine gene expression profile (M1 vs M2) was measured by real-time PCR, IL-12/IL-10 level was detected by ELISA, and surface antigen expression was evaluated by flow cytometry, whereas phosphorylation level of ERK 1/2 and AKT was determined by Western blot. The level of anti-HBs antibodies in HBsAg immunized mice was detected by ELISA, and the number of HBsAg specific IL-4-producing splenocyte was enumerated by ELISPOT. Results: Andrographolide treatment in vitro attenuated either LPS or IL-4 induced macrophage activation, inhibited both M1 and M2 cytokines expression and decreased IL-12/IL-10 ratio (the ratio of M1/M2 polarization). Andrographolide down-regulated the expression of mannose receptor (CD206) in IL-4 induced macrophages and major histocompability complex/costimulatory molecules (MHC I, CD40, CD80, CD86) in LPS-induced macrophages. Correspondingly, anti-HBs antibody production and the number of IL-4-producing splenocytes were reduced by in vivo administration of andrographolide. Reduced phosphorylation levels of ERK1/2 and AKT were observed in macrophages treated with andrographolide. Conclusion: Andrographolide can modulate the innate and adaptive immune responses by regulating macrophage phenotypic polarization and Ag-specific antibody production. MAPK and PI3K signaling pathways may participate in the mechanisms of andrographolide regulating macrophage activation and polarization. PMID:20139902

  18. Altered gene activity correlated with long-term memory formation of conditioned taste aversion in Lymnaea.

    Science.gov (United States)

    Azami, Sachiyo; Wagatsuma, Akiko; Sadamoto, Hisayo; Hatakeyama, Dai; Usami, Takeshi; Fujie, Manabu; Koyanagi, Ryo; Azumi, Kaoru; Fujito, Yutaka; Lukowiak, Ken; Ito, Etsuro

    2006-11-15

    The pond snail Lymnaea stagnalis is capable of learning conditioned taste aversion (CTA) and then consolidating that learning into long-term memory (LTM) that persists for at least 1 month. LTM requires de novo protein synthesis and altered gene activity. Changes in gene activity in Lymnaea that are correlated with, much less causative, memory formation have not yet been identified. As a first step toward rectifying this situation, we constructed a cDNA microarray with mRNAs extracted from the central nervous system (CNS) of Lymnaea. We then, using this microarray assay, identified genes whose activity either increased or decreased following CTA memory consolidation. We also identified genes whose expression levels were altered after inhibition of the cyclic AMP response element-binding protein (CREB) that is hypothesized to be a key transcription factor for CTA memory. We found that the molluscan insulin-related peptide II (MIP II) was up-regulated during CTA-LTM, whereas the gene encoding pedal peptide preprohormone (Pep) was down-regulated by CREB2 RNA interference. We next examined mRNAs of MIP II and Pep using real-time RT-PCR with SYBR Green. The MIP II mRNA level in the CNS of snails exhibiting "good" memory for CTA was confirmed to be significantly higher than that from the CNS of snails exhibiting "poor" memory. In contrast, there was no significant difference in expression levels of the Pep mRNA between "good" and "poor" performers. These data suggest that in Lymnaea MIP II may play a role in the consolidation process that forms LTM following CTA training.

  19. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  20. Active teaching methods, studying responses and learning

    DEFF Research Database (Denmark)

    Christensen, Hans Peter; Vigild, Martin Etchells; Thomsen, Erik Vilain

    2010-01-01

    Students’ study strategies when exposed to activating teaching methods are measured, analysed and compared to study strategies in more traditional lecture-based teaching. The resulting learning outcome is discussed.......Students’ study strategies when exposed to activating teaching methods are measured, analysed and compared to study strategies in more traditional lecture-based teaching. The resulting learning outcome is discussed....

  1. Active teaching methods, studying responses and learning

    DEFF Research Database (Denmark)

    Christensen, Hans Peter; Vigild, Martin Etchells; Thomsen, Erik Vilain

    Students’ study strategies when exposed to activating teaching methods are measured, analysed and compared to study strategies in more traditional lecture-based teaching.......Students’ study strategies when exposed to activating teaching methods are measured, analysed and compared to study strategies in more traditional lecture-based teaching....

  2. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  3. Gene transcript profiles of the TIA biosynthetic pathway in response to ethylene and copper reveal their interactive role in modulating TIA biosynthesis in Catharanthus roseus.

    Science.gov (United States)

    Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua

    2015-05-01

    Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the

  4. Association between gene expression profile of the primary tumor and chemotherapy response of metastatic breast cancer

    NARCIS (Netherlands)

    Savci-Heijink, Cemile Dilara; Halfwerk, Hans; Koster, Jan; van de Vijver, Marc Joan

    2017-01-01

    Background: To better predict the likelihood of response to chemotherapy, we have conducted a study comparing the gene expression patterns of primary tumours with their corresponding response to systemic chemotherapy in the metastatic setting. Methods: mRNA expression profiles of breast carcinomas

  5. In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

    Science.gov (United States)

    Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

    2017-02-01

    Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

  6. Skeletal muscle gene expression in response to resistance exercise: sex specific regulation

    Directory of Open Access Journals (Sweden)

    Burant Charles F

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms underlying the sex differences in human muscle morphology and function remain to be elucidated. The sex differences in the skeletal muscle transcriptome in both the resting state and following anabolic stimuli, such as resistance exercise (RE, might provide insight to the contributors of sexual dimorphism of muscle phenotypes. We used microarrays to profile the transcriptome of the biceps brachii of young men and women who underwent an acute unilateral RE session following 12 weeks of progressive training. Bilateral muscle biopsies were obtained either at an early (4 h post-exercise or late recovery (24 h post-exercise time point. Muscle transcription profiles were compared in the resting state between men (n = 6 and women (n = 8, and in response to acute RE in trained exercised vs. untrained non-exercised control muscle for each sex and time point separately (4 h post-exercise, n = 3 males, n = 4 females; 24 h post-exercise, n = 3 males, n = 4 females. A logistic regression-based method (LRpath, following Bayesian moderated t-statistic (IMBT, was used to test gene functional groups and biological pathways enriched with differentially expressed genes. Results This investigation identified extensive sex differences present in the muscle transcriptome at baseline and following acute RE. In the resting state, female muscle had a greater transcript abundance of genes involved in fatty acid oxidation and gene transcription/translation processes. After strenuous RE at the same relative intensity, the time course of the transcriptional modulation was sex-dependent. Males experienced prolonged changes while females exhibited a rapid restoration. Most of the biological processes involved in the RE-induced transcriptional regulation were observed in both males and females, but sex specificity was suggested for several signaling pathways including activation of notch signaling and TGF-beta signaling in females

  7. Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.

    Science.gov (United States)

    Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F

    2016-08-01

    The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment.

  8. Polycomb-group genes sustaining the stem cell activity

    International Nuclear Information System (INIS)

    Takihara, Yoshihiro

    2006-01-01

    Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

  9. Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

    Science.gov (United States)

    Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

    2011-02-01

    Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

  10. Inflammation, gene mutation and photoimmunosuppression in response to UVR-induced oxidative damage contributes to photocarcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Halliday, Gary M. [Dermatology Research Laboratories, Division of Medicine, Melanoma and Skin Cancer Research Institute, Royal Prince Alfred Hospital at the University of Sydney, Sydney, NSW (Australia)]. E-mail: garyh@med.usyd.edu.au

    2005-04-01

    Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans.

  11. Inflammation, gene mutation and photoimmunosuppression in response to UVR-induced oxidative damage contributes to photocarcinogenesis

    International Nuclear Information System (INIS)

    Halliday, Gary M.

    2005-01-01

    Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans

  12. Gene-expression analysis of cold-stress response in the sexually transmitted protist Trichomonas vaginalis.

    Science.gov (United States)

    Fang, Yi-Kai; Huang, Kuo-Yang; Huang, Po-Jung; Lin, Rose; Chao, Mei; Tang, Petrus

    2015-12-01

    Trichomonas vaginalis is the etiologic agent of trichomoniasis, the most common nonviral sexually transmitted disease in the world. This infection affects millions of individuals worldwide annually. Although direct sexual contact is the most common mode of transmission, increasing evidence indicates that T. vaginalis can survive in the external environment and can be transmitted by contaminated utensils. We found that the growth of T. vaginalis under cold conditions is greatly inhibited, but recovers after placing these stressed cells at the normal cultivation temperature of 37 °C. However, the mechanisms by which T. vaginalis regulates this adaptive process are unclear. An expressed sequence tag (EST) database generated from a complementary DNA library of T. vaginalis messenger RNAs expressed under cold-culture conditions (4 °C, TvC) was compared with a previously published normal-cultured EST library (37 °C, TvE) to assess the cold-stress responses of T. vaginalis. A total of 9780 clones were sequenced from the TvC library and were mapped to 2934 genes in the T. vaginalis genome. A total of 1254 genes were expressed in both the TvE and TvC libraries, and 1680 genes were only found in the TvC library. A functional analysis showed that cold temperature has effects on many cellular mechanisms, including increased H2O2 tolerance, activation of the ubiquitin-proteasome system, induction of iron-sulfur cluster assembly, and reduced energy metabolism and enzyme expression. The current study is the first large-scale transcriptomic analysis in cold-stressed T. vaginalis and the results enhance our understanding of this important protist. Copyright © 2014. Published by Elsevier B.V.

  13. Activation of silenced cytokine gene promoters by the synergistic effect of TBP-TALE and VP64-TALE activators.

    Science.gov (United States)

    Anthony, Kim; More, Abhijit; Zhang, Xiaoliu

    2014-01-01

    Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.

  14. Loss of prion protein induces a primed state of type I interferon-responsive genes

    DEFF Research Database (Denmark)

    Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind

    2017-01-01

    The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...

  15. Role of X-ray-inducible genes and proteins in adaptive survival responses

    International Nuclear Information System (INIS)

    Meyers, M.; Schea, R.A.; Petrowski, A.E.; Seabury, H.; McLaughlin, P.W.; Lee, I.; Lee, S.W.; Boothman, D.A.

    1992-01-01

    Certain X-ray-inducible genes and their corresponding protein products, appearing following low priming doses of ionizing radiation may subsequently give rise to an adaptive survival response, ultimately leading to increased radioresistance. Further, this adaptive radioresistance may be due to increased DNA repair (or misrepair) processes. Ultimately, the function of low-dose-induced cDNA clones within the cell is hoped to elucidate to follow the effects of specific gene turn-off on adaptive responses. Future research must determine the various functions of adaptive response gene products so that the beneficial or deleterious consequences of adaptive responses, which increases resistance to ionizing radiation, can be determined. (author). 19 refs., 1 fig

  16. Sex-specific variation in signaling pathways and gene expression patterns in human leukocytes in response to endotoxin and exercise.

    Science.gov (United States)

    Abbasi, Asghar; de Paula Vieira, Rodolfo; Bischof, Felix; Walter, Michael; Movassaghi, Masoud; Berchtold, Nicole C; Niess, Andreas M; Cotman, Carl W; Northoff, Hinnak

    2016-11-10

    While exercise effects on the immune system have received increasing attention in recent years, it remains unclear to what extent gender and fluctuations in sex hormones during menstrual cycle influence immunological responses to exercise. We investigated mRNA changes induced through exhaustive exercise (half-marathon; pre-exercise and post-exercise [30 min, 3 h, 24 h] on whole blood cultures ± lipopolysaccharide [LPS] [1 h]) with a specific focus on sex differences (men vs women in luteal phase) as an extension of our previous study. Inflammation related signaling pathways, TLRs, cytosolic DNA sensing and RIG-I like receptors were differentially activated between sexes in LPS-stimulated cultures. Genes differentially regulated between sexes included TNIP-1, TNIP-3, IL-6, HIVEP1, CXCL3, CCR3, IL-8, and CD69, revealing a bias towards less anti-inflammatory gene regulation in women compared to men. In addition, several genes relevant to brain function (KMO, DDIT4, VEGFA, IGF1R, IGF2R, and FGD4) showed differential activation between sexes. Some of these genes (e.g., KMO in women, DDIT4 in both sexes) potentially constitute neuroprotective mechanisms. These data reveal that the exercise-induced change in gene expression might be gender and menstrual cycle phase dependent.

  17. The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response

    Science.gov (United States)

    Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo

    2008-01-01

    Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430

  18. Activating teaching methods, studying responses and learning

    OpenAIRE

    Christensen, Hans Peter; Vigild, Martin E.; Thomsen, Erik; Szabo, Peter; Horsewell, Andy

    2009-01-01

    Students’ study strategies when exposed to activating teaching methods are measured, analysed and compared to study strategies in more traditional lecture-based teaching. The resulting learning outcome is discussed. Peer Reviewed

  19. Cerebral blood flow response to functional activation

    DEFF Research Database (Denmark)

    Paulson, Olaf B; Hasselbalch, Steen G; Rostrup, Egill

    2010-01-01

    Cerebral blood flow (CBF) and cerebral metabolic rate are normally coupled, that is an increase in metabolic demand will lead to an increase in flow. However, during functional activation, CBF and glucose metabolism remain coupled as they increase in proportion, whereas oxygen metabolism only inc...... the cerebral tissue's increased demand for glucose supply during neural activation with recent evidence supporting a key function for astrocytes in rCBF regulation....

  20. Transcriptome analysis identifies genes involved in ethanol response of Saccharomyces cerevisiae in Agave tequilana juice.

    Science.gov (United States)

    Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri

    2012-08-01

    During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.

  1. Global Analysis of WRKY Genes and Their Response to Dehydration and Salt Stress in Soybean.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Hou, Lei; Zhao, Shuzhen; Zhao, Chuanzhi; Xia, Han; Li, Pengcheng; Zhang, Ye; Bian, Xiaotong; Wang, Xingjun

    2016-01-01

    WRKY proteins are plant specific transcription factors involved in various developmental and physiological processes, especially in biotic and abiotic stress resistance. Although previous studies suggested that WRKY proteins in soybean (Glycine max var. Williams 82) involved in both abiotic and biotic stress responses, the global information of WRKY proteins in the latest version of soybean genome (Wm82.a2v1) and their response to dehydration and salt stress have not been reported. In this study, we identified 176 GmWRKY proteins from soybean Wm82.a2v1 genome. These proteins could be classified into three groups, namely group I (32 proteins), group II (120 proteins), and group III (24 proteins). Our results showed that most GmWRKY genes were located on Chromosome 6, while chromosome 11, 12, and 20 contained the least number of this gene family. More GmWRKY genes were distributed on the ends of chromosomes to compare with other regions. The cis-acting elements analysis suggested that GmWRKY genes were transcriptionally regulated upon dehydration and salt stress. RNA-seq data analysis indicated that three GmWRKY genes responded negatively to dehydration, and 12 genes positively responded to salt stress at 1, 6, and 12 h, respectively. We confirmed by qRT-PCR that the expression of GmWRKY47 and GmWRKY 58 genes was decreased upon dehydration, and the expression of GmWRKY92, 144 and 165 genes was increased under salt treatment.

  2. Induction of senescence and identification of differentially expressed genes in tomato in response to monoterpene.

    Directory of Open Access Journals (Sweden)

    Sumit Ghosh

    Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.

  3. Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

    Science.gov (United States)

    Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

    2013-01-01

    Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

  4. Insights into resistome and stress responses genes in Bubalus bubalis rumen through metagenomic analysis.

    Science.gov (United States)

    Reddy, Bhaskar; Singh, Krishna M; Patel, Amrutlal K; Antony, Ancy; Panchasara, Harshad J; Joshi, Chaitanya G

    2014-10-01

    Buffalo rumen microbiota experience variety of diets and represents a huge reservoir of mobilome, resistome and stress responses. However, knowledge of metagenomic responses to such conditions is still rudimentary. We analyzed the metagenomes of buffalo rumen in the liquid and solid phase of the rumen biomaterial from river buffalo adapted to varying proportion of concentrate to green or dry roughages, using high-throughput sequencing to know the occurrence of antibiotics resistance genes, genetic exchange between bacterial population and environmental reservoirs. A total of 3914.94 MB data were generated from all three treatments group. The data were analysed with Metagenome rapid annotation system tools. At phyla level, Bacteroidetes were dominant in all the treatments followed by Firmicutes. Genes coding for functional responses to stress (oxidative stress and heat shock proteins) and resistome genes (resistance to antibiotics and toxic compounds, phages, transposable elements and pathogenicity islands) were prevalent in similar proportion in liquid and solid fraction of rumen metagenomes. The fluoroquinolone resistance, MDR efflux pumps and Methicillin resistance genes were broadly distributed across 11, 9, and 14 bacterial classes, respectively. Bacteria responsible for phages replication and prophages and phage packaging and rlt-like streptococcal phage genes were mostly assigned to phyla Bacteroides, Firmicutes and proteaobacteria. Also, more reads matching the sigma B genes were identified in the buffalo rumen. This study underscores the presence of diverse mechanisms of adaptation to different diet, antibiotics and other stresses in buffalo rumen, reflecting the proportional representation of major bacterial groups.

  5. Mammalian cytochrome CYP2E1 triggered differential gene regulation in response to trichloroethylene (TCE) in a transgenic poplar.

    Science.gov (United States)

    Kang, Jun Won; Wilkerson, Hui-Wen; Farin, Federico M; Bammler, Theo K; Beyer, Richard P; Strand, Stuart E; Doty, Sharon L

    2010-08-01

    Trichloroethylene (TCE) is an important environmental contaminant of soil, groundwater, and air. Studies of the metabolism of TCE by poplar trees suggest that cytochrome P450 enzymes are involved. Using poplar genome microarrays, we report a number of putative genes that are differentially expressed in response to TCE. In a previous study, transgenic hybrid poplar plants expressing mammalian cytochrome P450 2E1 (CYP2E1) had increased metabolism of TCE. In the vector control plants for this construct, 24 h following TCE exposure, 517 genes were upregulated and 650 genes were downregulated over 2-fold when compared with the non-exposed vector control plants. However, in the transgenic CYP2E1 plant, line 78, 1,601 genes were upregulated and 1,705 genes were downregulated over 2-fold when compared with the non-exposed transgenic CYP2E1 plant. It appeared that the CYP2E1 transgenic hybrid poplar plants overexpressing mammalian CYP2E1 showed a larger number of differentially expressed transcripts, suggesting a metabolic pathway for TCE to metabolites had been initiated by activity of CYP2E1 on TCE. These results suggest that either the over-expression of the CYP2E1 gene or the abundance of TCE metabolites from CYP450 2E1 activity triggered a strong genetic response to TCE. Particularly, cytochrome p450s, glutathione S-transferases, glucosyltransferases, and ABC transporters in the CYP2E1 transgenic hybrid poplar plants were highly expressed compared with in vector controls.

  6. Antenatal maternal long-term hypoxia: acclimatization responses with altered gene expression in ovine fetal carotid arteries.

    Directory of Open Access Journals (Sweden)

    Ravi Goyal

    Full Text Available In humans and other species, long-term hypoxia (LTH during pregnancy can lead to intrauterine growth restriction with reduced body/brain weight, dysregulation of cerebral blood flow (CBF, and other problems. To identify the signal transduction pathways and critical molecules, which may be involved in acclimatization to high altitude LTH, we conducted microarray with advanced bioinformatic analysis on carotid arteries (CA from the normoxic near-term ovine fetus at sea-level and those acclimatized to high altitude for 110+ days during gestation. In response to LTH acclimatization, in fetal CA we identified mRNA from 38 genes upregulated >2 fold (P2-fold (P<0.05. The major genes with upregulated mRNA were SLC1A3, Insulin-like growth factor (IGF binding protein 3, IGF type 2 receptor, transforming growth factor (TGF Beta-3, and genes involved in the AKT and BCL2 signal transduction networks. Most genes with upregulated mRNA have a common motif for Pbx/Knotted homeobox in the promoter region, and Sox family binding sites in the 3' un translated region (UTR. Genes with downregulated mRNA included those involved in the P53 pathway and 5-lipoxygenase activating proteins. The promoter region of all genes with downregulated mRNA, had a common 49 bp region with a binding site for DOT6 and TOD6, components of the RPD3 histone deacetylase complex RPD3C(L. We also identified miRNA complementary to a number of the altered genes. Thus, the present study identified molecules in the ovine fetus, which may play a role in the acclimatization response to high-altitude associated LTH.

  7. PTTG1, A novel androgen responsive gene is required for androgen-induced prostate cancer cell growth and invasion

    International Nuclear Information System (INIS)

    Zhang, Zheng; Jin, Bo; Jin, Yaqiong; Huang, Shengquan; Niu, Xiaohua; Mao, Zebin; Xin, Dianqi

    2017-01-01

    Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that the PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.

  8. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)

    2013-01-01

    textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with

  9. Soybean DREB1/CBF-type transcription factors function in heat and drought as well as cold stress-responsive gene expression.

    Science.gov (United States)

    Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2015-02-01

    Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  10. Expression profiling of AUXIN RESPONSE FACTOR genes during somatic embryogenesis induction in Arabidopsis.

    Science.gov (United States)

    Wójcikowska, Barbara; Gaj, Małgorzata D

    2017-06-01

    Extensive modulation of numerous ARF transcripts in the embryogenic culture of Arabidopsis indicates a substantial role of auxin signaling in the mechanism of somatic embryogenesis induction. Somatic embryogenesis (SE) is induced by auxin in plants and auxin signaling is considered to play a key role in the molecular mechanism that controls the embryogenic transition of plant somatic cells. Accordingly, the expression of AUXIN RESPONSE FACTOR (ARF) genes in embryogenic culture of Arabidopsis was analyzed. The study revealed that 14 of the 22 ARFs were transcribed during SE in Arabidopsis. RT-qPCR analysis indicated that the expression of six ARFs (ARF5, ARF6, ARF8, ARF10, ARF16, and ARF17) was significantly up-regulated, whereas five other genes (ARF1, ARF2, ARF3, ARF11, and ARF18) were substantially down-regulated in the SE-induced explants. The activity of ARFs during SE was also monitored with GFP reporter lines and the ARFs that were expressed in areas of the explants engaged in SE induction were detected. A functional test of ARFs transcribed during SE was performed and the embryogenic potential of the arf mutants and overexpressor lines was evaluated. ARFs with a significantly modulated expression during SE coupled with an impaired embryogenic response of the relevant mutant and/or overexpressor line, including ARF1, ARF2, ARF3, ARF5, ARF6, ARF8, and ARF11 were indicated as possibly being involved in SE induction. The study provides evidence that embryogenic induction strongly depends on ARFs, which are key regulators of the auxin signaling. Some clues on the possible functions of the candidate ARFs, especially ARF5, in the mechanism of embryogenic transition are discussed. The results provide guidelines for further research on the auxin-related functional genomics of SE and the developmental plasticity of somatic cells.

  11. In Silico Analysis of Microarray-Based Gene Expression Profiles Predicts Tumor Cell Response to Withanolides

    Directory of Open Access Journals (Sweden)

    Thomas Efferth

    2012-05-01

    Full Text Available Withania somnifera (L. Dunal (Indian ginseng, winter cherry, Solanaceae is widely used in traditional medicine. Roots are either chewed or used to prepare beverages (aqueous decocts. The major secondary metabolites of Withania somnifera are the withanolides, which are C-28-steroidal lactone triterpenoids. Withania somnifera extracts exert chemopreventive and anticancer activities in vitro and in vivo. The aims of the present in silico study were, firstly, to investigate whether tumor cells develop cross-resistance between standard anticancer drugs and withanolides and, secondly, to elucidate the molecular determinants of sensitivity and resistance of tumor cells towards withanolides. Using IC50 concentrations of eight different withanolides (withaferin A, withaferin A diacetate, 3-azerininylwithaferin A, withafastuosin D diacetate, 4-B-hydroxy-withanolide E, isowithanololide E, withafastuosin E, and withaperuvin and 19 established anticancer drugs, we analyzed the cross-resistance profile of 60 tumor cell lines. The cell lines revealed cross-resistance between the eight withanolides. Consistent cross-resistance between withanolides and nitrosoureas (carmustin, lomustin, and semimustin was also observed. Then, we performed transcriptomic microarray-based COMPARE and hierarchical cluster analyses of mRNA expression to identify mRNA expression profiles predicting sensitivity or resistance towards withanolides. Genes from diverse functional groups were significantly associated with response of tumor cells to withaferin A diacetate, e.g. genes functioning in DNA damage and repair, stress response, cell growth regulation, extracellular matrix components, cell adhesion and cell migration, constituents of the ribosome, cytoskeletal organization and regulation, signal transduction, transcription factors, and others.

  12. Behavioral science and the study of gene-nutrition and gene-physical activity interactions in obesity research.

    Science.gov (United States)

    Faith, Myles S

    2008-12-01

    This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.

  13. Rubisco activity and gene expression of tropical tree species under ...

    African Journals Online (AJOL)

    Young

    2013-05-15

    May 15, 2013 ... Proteomics analysis associated with gene expression of plants reveal .... Consequently, Rubisco enzyme plays a role in assi- milating into ... technique for examining gene expression encoded at the. mRNA level .... Ammonia.

  14. PGC-1alpha is not mandatory for exercise- and training-induced adaptive gene responses in mouse skeletal muscle

    DEFF Research Database (Denmark)

    Leick, Lotte; Wojtaszewski, Jørgen F P; Johansen, Sune T.

    2008-01-01

    The aim of the present study was to test the hypothesis that peroxisome proliferator activated receptor-gamma coactivator (PGC) 1alpha is required for exercise-induced adaptive gene responses in skeletal muscle. Whole body PGC-1alpha knockout (KO) and littermate wild-type (WT) mice performed....... Resting muscles of the PGC-1alpha KO mice had lower ( approximately 20%) cytochrome c (cyt c), cytochrome oxidase (COX) I, and aminolevulinate synthase (ALAS) 1 mRNA and protein levels than WT, but similar levels of AMP-activated protein kinase (AMPK) alpha1, AMPKalpha2, and hexokinase (HK) II compared...

  15. RhoA Activation Sensitizes Cells to Proteotoxic Stimuli by Abrogating the HSF1-Dependent Heat Shock Response

    NARCIS (Netherlands)

    Meijering, Roelien A. M.; Wiersma, Marit; van Marion, Denise M. S.; Zhang, Deli; Hoogstra-Berends, Femke; Dijkhuis, Anne-Jan; Schmidt, Martina; Wieland, Thomas; Kampinga, Harm H.; Henning, Robert H.; Brundel, Bianca J. J. M.

    2015-01-01

    Background The heat shock response (HSR) is an ancient and highly conserved program of stress-induced gene expression, aimed at reestablishing protein homeostasis to preserve cellular fitness. Cells that fail to activate or maintain this protective response are hypersensitive to proteotoxic stress.

  16. Nuclear cGMP-dependent kinase regulates gene expression via activity-dependent recruitment of a conserved histone deacetylase complex.

    Directory of Open Access Journals (Sweden)

    Yan Hao

    2011-05-01

    Full Text Available Elevation of the second messenger cGMP by nitric oxide (NO activates the cGMP-dependent protein kinase PKG, which is key in regulating cardiovascular, intestinal, and neuronal functions in mammals. The NO-cGMP-PKG signaling pathway is also a major therapeutic target for cardiovascular and male reproductive diseases. Despite widespread effects of PKG activation, few molecular targets of PKG are known. We study how EGL-4, the Caenorhabditis elegans PKG ortholog, modulates foraging behavior and egg-laying and seeks the downstream effectors of EGL-4 activity. Using a combination of unbiased forward genetic screen and proteomic analysis, we have identified a conserved SAEG-1/SAEG-2/HDA-2 histone deacetylase complex that is specifically recruited by activated nuclear EGL-4. Gene expression profiling by microarrays revealed >40 genes that are sensitive to EGL-4 activity in a SAEG-1-dependent manner. We present evidence that EGL-4 controls egg laying via one of these genes, Y45F10C.2, which encodes a novel protein that is expressed exclusively in the uterine epithelium. Our results indicate that, in addition to cytoplasmic functions, active EGL-4/PKG acts in the nucleus via a conserved Class I histone deacetylase complex to regulate gene expression pertinent to behavioral and physiological responses to cGMP. We also identify transcriptional targets of EGL-4 that carry out discrete components of the physiological response.

  17. Hypoxia-Inducible Regulation of a Prodrug-Activating Enzyme for Tumor-Specific Gene Therapy

    Directory of Open Access Journals (Sweden)

    Toru Shibata

    2002-01-01

    Full Text Available Previous studies have suggested that tumor hypoxia could be exploited for cancer gene therapy. Using hypoxia-responsive elements derived from the human vascular endothelial growth factor gene, we have generated vectors expressing a bacterial nitroreductase. (20NTR gene that can activate the anticancer prodrug CB1954. Stable transfectants of human HT1080 tumor cells with hypoxia-inducible vectors were established with G418 selection. Hypoxic induction of NTR protein correlated with increased sensitivity to in vitro exposure of HT 1080 cells to the prodrug. Growth delay assays were performed with established tumor xenografts derived from the same cells to detect the in vivo efficacy of CB1954 conversion to its cytotoxic form. Significant antitumor effects were achieved with intraperitoneal injections of CB1954 both in tumors that express NTR constitutively or with a hypoxia-inducible promoter. In addition, respiration of 10% O2 increased tumor hypoxia in vivo and enhanced the antitumor effects. Taken together, these results demonstrate that hypoxia-inducible vectors may be useful for tumor-selective gene therapy, although the problem of delivery of the vector to the tumors, particularly to the hypoxic cells in the tumors, is not addressed by these studies.

  18. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  19. MALDI-TOF mass spectrometry for quantitative gene expression analysis of acid responses in Staphylococcus aureus.

    Science.gov (United States)

    Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild

    2009-07-01

    Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.

  20. Transcriptional regulation of the Hansenula polymorpha GSH2 gene in the response to cadmium ion treatment

    Directory of Open Access Journals (Sweden)

    O. V. Blazhenko

    2014-02-01

    Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring­ a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.

  1. Genome-wide characterization of differentially expressed genes provides insights into regulatory network of heat stress response in radish (Raphanus sativus L.).

    Science.gov (United States)

    Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang

    2018-03-01

    Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.

  2. Detoxification and stress response genes expressed in a western North American bumble bee, Bombus huntii (Hymenoptera: Apidae).

    Science.gov (United States)

    Xu, Junhuan; Strange, James P; Welker, Dennis L; James, Rosalind R

    2013-12-12

    The Hunt bumble bee (Bombus huntii Greene, Hymenoptera: Apidae) is a holometabolous, social insect important as a pollinator in natural and agricultural ecosystems in western North America. Bumble bees spend a significant amount of time foraging on a wide variety of flowering plants, and this activity exposes them to both plant toxins and pesticides, posing a threat to individual and colony survival. Little is known about what detoxification pathways are active in bumble bees, how the expression of detoxification genes changes across life stages, or how the number of detoxification genes expressed in B. huntii compares to other insects. We found B. huntii expressed at least 584 genes associated with detoxification and stress responses. The expression levels of some of these genes, such as those encoding the cytochrome P450s, glutathione S-transferases (GSTs) and glycosidases, vary among different life stages to a greater extent than do other genes. We also found that the number of P450s, GSTs and esterase genes expressed by B. huntii is similar to the number of these genes found in the genomes of other bees, namely Bombus terrestris, Bombus impatiens, Apis mellifera and Megachile rotundata, but many fewer than are found in the fly Drosophila melanogaster. Bombus huntii has transcripts for a large number of detoxification and stress related proteins, including oxidation and reduction enzymes, conjugation enzymes, hydrolytic enzymes, ABC transporters, cadherins, and heat shock proteins. The diversity of genes expressed within some detoxification pathways varies among the life stages and castes, and we typically identified more genes in the adult females than in larvae, pupae, or adult males, for most pathways. Meanwhile, we found the numbers of detoxification and stress genes expressed by B. huntii to be more similar to other bees than to the fruit fly. The low number of detoxification genes, first noted in the honey bee, appears to be a common phenomenon among bees

  3. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.

    Science.gov (United States)

    Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima

    Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  4. Diminished thrombogenic responses by deletion of the Podocalyxin Gene in mouse megakaryocytes.

    Directory of Open Access Journals (Sweden)

    Miguel Pericacho

    Full Text Available Podocalyxin (Podxl is a type I membrane sialoprotein of the CD34 family, originally described in the epithelial glomerular cells of the kidney (podocytes in which it plays an important function. Podxl can also be found in megakaryocytes and platelets among other extrarenal places. The surface exposure of Podxl upon platelet activation suggested it could play some physiological role. To elucidate the function of Podxl in platelets, we generated mice with restricted ablation of the podxl gene in megakaryocytes using the Cre-LoxP gene targeting methodology. Mice with Podxl-null megakaryocytes did not show any apparent phenotypical change and their rates of growth, life span and fertility did not differ from the floxed controls. However, Podxl-null mice showed prolonged bleeding time and decreased platelet aggregation in response to physiological agonists. The number, size-distribution and polyploidy of Podxl-null megakaryocytes were similar to the floxed controls. Podxl-null platelets showed normal content of surface receptors and normal activation by agonists. However, the mice bearing Podxl-null platelets showed a significant retardation in the ferric chloride-induced occlusion of the carotid artery. Moreover, acute thrombosis induced by the i.v. injection of sublethal doses of collagen and phenylephrine produced a smaller fall in the number of circulating platelets in Podxl-null mice than in control mice. In addition, perfusion of uncoagulated blood from Podxl-null mice in parallel flow chamber showed reduced adhesion of platelets and formation of aggregates under high shear stress. It is concluded that platelet Podxl is involved in the control of hemostasis acting as a platelet co-stimulator, likely due to its pro-adhesive properties.

  5. Localization and cloning