T-cell activation and early gene response in dogs.
Directory of Open Access Journals (Sweden)
Sally-Anne Mortlock
Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in
Directory of Open Access Journals (Sweden)
Fernanda M Rodríguez-Tornos
Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.
Rapid and preferential activation of the c-jun gene during the mammalian UV response
International Nuclear Information System (INIS)
Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.
1991-01-01
Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase
Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H
1997-03-14
Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.
Influence of the gene xthA in the activation of SOS response of Escherichia coli
International Nuclear Information System (INIS)
Dominguez M, V.
2013-01-01
The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)
Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P
2018-01-01
Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William
2013-01-01
After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905
Nerve Growth Factor Gene Therapy Activates Neuronal Responses in Alzheimer’s Disease
Tuszynski, Mark H.; Yang, Jennifer H.; Barba, David; U, H S.; Bakay, Roy; Pay, Mary M.; Masliah, Eliezer; Conner, James M.; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H.
2016-01-01
IMPORTANCE Alzheimer’s disease (AD) is the most common neurodegenerative disorder, and lacks effective disease modifying therapies. In 2001 we initiated a clinical trial of Nerve Growth Factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in AD patients. We present post-mortem findings in 10 subjects with survival times ranging from 1 to 10 years post-treatment. OBJECTIVE To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. DESIGN, SETTING, AND PARTICIPANTS 10 patients with early AD underwent NGF gene therapy using either ex vivo or in vivo gene transfer. The brains of all eight patients in the first Phase 1 ex vivo trial and two patients in a subsequent Phase 1 in vivo trial were examined. MAIN OUTCOME MEASURES Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In two cases, NGF protein levels were measured by ELISA. RESULTS Degenerating neurons in the AD brain respond to NGF. All patients exhibited a trophic response to NGF, in the form of axonal sprouting toward the NGF source. Comparing treated and non-treated sides of the brain in three patients that underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P>0.05). Activation of cellular signaling and functional markers were present in two patients that underwent AAV2-mediated NGF gene transfer. Neurons exhibiting tau pathology as well as neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic genes with resulting activation of cell signaling. No adverse pathological effects related to NGF were observed. CONCLUSIONS AND RELEVANCE These findings indicate that
Nerve Growth Factor Gene Therapy: Activation of Neuronal Responses in Alzheimer Disease.
Tuszynski, Mark H; Yang, Jennifer H; Barba, David; U, Hoi-Sang; Bakay, Roy A E; Pay, Mary M; Masliah, Eliezer; Conner, James M; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H
2015-10-01
Alzheimer disease (AD) is the most common neurodegenerative disorder and lacks effective disease-modifying therapies. In 2001, we initiated a clinical trial of nerve growth factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in patients with AD. We present postmortem findings in 10 patients with survival times ranging from 1 to 10 years after treatment. To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. Patients in this anatomicopathological study were enrolled in clinical trials from March 2001 to October 2012 at the University of California, San Diego, Medical Center in La Jolla. Ten patients with early AD underwent NGF gene therapy using ex vivo or in vivo gene transfer. The brains of all 8 patients in the first phase 1 ex vivo trial and of 2 patients in a subsequent phase 1 in vivo trial were examined. Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In 2 patients, NGF protein levels were measured by enzyme-linked immunosorbent assay. Among 10 patients, degenerating neurons in the AD brain responded to NGF. All patients exhibited a trophic response to NGF in the form of axonal sprouting toward the NGF source. Comparing treated and nontreated sides of the brain in 3 patients who underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P < .05). Activation of cellular signaling and functional markers was present in 2 patients who underwent adeno-associated viral vectors (serotype 2)-mediated NGF gene transfer. Neurons exhibiting tau pathology and neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic
Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo
2014-12-01
HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of
Cárdenas-Guerra, Rosa Elena; Figueroa-Angulo, Elisa Elvira; Puente-Rivera, Jonathan; Zamudio-Prieto, Olga; Ortega-López, Jaime
2015-01-01
We focus on the iron response of Trichomonas vaginalis to gene family products such as the cysteine proteinases (CPs) involved in virulence properties. In particular, we examined the effect of iron on the gene expression regulation and function of cathepsin L-like and asparaginyl endopeptidase-like CPs as virulence factors. We addressed some important aspects about CPs genomic organization and we offer possible explanations to the fact that only few members of this large gene family are expressed at the RNA and protein levels and the way to control their proteolytic activity. We also summarized all known iron regulations of CPs at transcriptional, posttranscriptional, and posttranslational levels along with new insights into the possible epigenetic and miRNA processes. PMID:26090464
Development of a radiation-responsive gene expression system
International Nuclear Information System (INIS)
Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko
2013-01-01
We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524
Lee, M O; Liu, Y; Zhang, X K
1995-08-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene
Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K
2001-04-01
Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.
Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K
1993-04-01
The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.
Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki
2011-01-01
The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847
Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K
1993-01-01
The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...
Directory of Open Access Journals (Sweden)
Sandra Hellberg
2016-09-01
Full Text Available Multiple sclerosis (MS is a chronic inflammatory disease of the CNS and has a varying disease course as well as variable response to treatment. Biomarkers may therefore aid personalized treatment. We tested whether in vitro activation of MS patient-derived CD4+ T cells could reveal potential biomarkers. The dynamic gene expression response to activation was dysregulated in patient-derived CD4+ T cells. By integrating our findings with genome-wide association studies, we constructed a highly connected MS gene module, disclosing cell activation and chemotaxis as central components. Changes in several module genes were associated with differences in protein levels, which were measurable in cerebrospinal fluid and were used to classify patients from control individuals. In addition, these measurements could predict disease activity after 2 years and distinguish low and high responders to treatment in two additional, independent cohorts. While further validation is needed in larger cohorts prior to clinical implementation, we have uncovered a set of potentially promising biomarkers.
Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho
2005-12-01
The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.
Directory of Open Access Journals (Sweden)
Stefano Luisa
2005-01-01
Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2
Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.
Directory of Open Access Journals (Sweden)
Idit Hazan
2016-12-01
Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.
Memory responses of jasmonic acid-associated Arabidopsis genes to a repeated dehydration stress.
Liu, Ning; Staswick, Paul E; Avramova, Zoya
2016-11-01
Dehydration stress activates numerous genes co-regulated by diverse signaling pathways. Upon repeated exposures, however, a subset of these genes does not respond maintaining instead transcription at their initial pre-stressed levels ('revised-response' genes). Most of these genes are involved in jasmonic acid (JA) biosynthesis, JA-signaling and JA-mediated stress responses. How these JA-associated genes are regulated to provide different responses to similar dehydration stresses is an enigma. Here, we investigate molecular mechanisms that contribute to this transcriptional behavior. The memory-mechanism is stress-specific: one exposure to dehydration stress or to abscisic acid (ABA) is required to prevent transcription in the second. Both ABA-mediated and JA-mediated pathways are critical for the activation of these genes, but the two signaling pathways interact differently during a single or multiple encounters with dehydration stress. Synthesis of JA during the first (S1) but not the second dehydration stress (S2) accounts for the altered transcriptional responses. We propose a model for these memory responses, wherein lack of MYC2 and of JA synthesis in S2 is responsible for the lack of expression of downstream genes. The similar length of the memory displayed by different memory-type genes suggests biological relevance for transcriptional memory as a gene-regulating mechanism during recurring bouts of drought. © 2016 John Wiley & Sons Ltd.
Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram
2014-01-01
Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.
Host genetic variation influences gene expression response to rhinovirus infection.
Directory of Open Access Journals (Sweden)
Minal Çalışkan
2015-04-01
Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Host genetic variation influences gene expression response to rhinovirus infection.
Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole
2015-04-01
Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Gene-physical activity interactions and their impact on diabetes
DEFF Research Database (Denmark)
Oskari Kilpeläinen, Tuomas; Franks, Paul W
2014-01-01
to an equal bout of physical activity. Individuals with specific genetic profiles are also expected to be more responsive to the beneficial effects of physical activity in the prevention of type 2 diabetes. Identification of such gene-physical activity interactions could give new insights into the biological...... the reader to the recent advances in the genetics of type 2 diabetes, summarize the current evidence on gene-physical activity interactions in relation to type 2 diabetes, and outline how information on gene-physical activity interactions might help improve the prevention and treatment of type 2 diabetes....... Finally, we will discuss the existing and emerging strategies that might enhance our ability to identify and exploit gene-physical activity interactions in the etiology of type 2 diabetes. © 2014 S. Karger AG, Basel....
[Regulation of heat shock gene expression in response to stress].
Garbuz, D G
2017-01-01
Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS
Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M.; Bollinger, Trent K.; Willis, Craig K. R.; Voyles, Jamie; Misra, Vikram
2014-01-01
Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018
Directory of Open Access Journals (Sweden)
Noreen Rapin
Full Text Available Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.
Gene program-specific regulation of PGC-1{alpha} activity
DEFF Research Database (Denmark)
Schmidt, Søren F; Mandrup, Susanne
2011-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...
Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses
Directory of Open Access Journals (Sweden)
Magdalena eMazur
2012-09-01
Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.
Directory of Open Access Journals (Sweden)
Nazli Khajehnasiri
2017-08-01
Full Text Available Abstract Background: The advantageous effects of the regular moderate physical activity (Exercise on reproduction is widely accepted, but until now, the alterations of the expression of hypothalamic arcuate nuclei gene affecting on reproduction axis in response to this type of physical activity are not clear. Therefore, the goal of the present investigation was to study the effect of one –month regular moderate physical activity on neurokinin B gene expression and reproductive axis hormonal changes. Materials and Methods: In the experimental study, fourteen adult male Wistar rats were randomly divided into control and one- month regular moderate exercise groups. After one - month physical activity (20m/min, the arcuate nucleus was isolated from brain and stored in -80 refrigerators for neurokinin B gene expression assay by Real-time PCR method. In addition, serum samples were taken to assess the corticosterone, luteinizing hormone and testosterone levels by ELISA method. Data were analyzed by Independent t-test in SPSS. Results: Neurokinin-B gene expression level was lower in the group which received physical activity than the control group(p<0.05. Also, corticosterone serum concentration was decreased in the physical activity group(p<0.05. By contrast, the physical activity induced luteinizing hormone and Testosterone serum levels evaluation in exersice group compared with control group (p<0.05. Conclusion: Regular moderate physical activity may improve male reproductive performance by reducing the corticosterone hormone level and decreasing neurokinin B expression.
International Nuclear Information System (INIS)
Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar
2015-01-01
Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that
Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena
2017-08-18
Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Mujcic, Hilda; Rzymski, Tomasz; Rouschop, Kasper M.A.; Koritzinsky, Marianne; Milani, Manuela; Harris, Adrian L.; Wouters, Bradly G.
2009-01-01
Background and purpose: Tumour hypoxia contributes to failure of cancer treatment through its ability to protect against therapy and adversely influence tumour biology. In particular, several studies suggest that hypoxia promotes metastasis. Hypoxia-induced cellular changes are mediated by oxygen-sensitive signaling pathways that activate downstream transcription factors. We have investigated the induction and transcriptional regulation of a novel metastasis-associated gene, LAMP3 during hypoxia. Materials and methods: Microarray, quantitative PCR, Western blot analysis and immunohistochemistry were used to investigate hypoxic regulation of LAMP3. The mechanism for LAMP3 induction was investigated using transient RNAi and stable shRNA targeting components of the hypoxic response. Endoplasmic reticulum stress inducing agents, including proteasome inhibitors were assessed for their ability to regulate LAMP3. Results: LAMP3 is strongly induced by hypoxia at both the mRNA and protein levels in a large panel of human tumour cell lines. Induction of LAMP3 occurs as a consequence of the activation of the PERK/eIF2α/ATF4 arm of the unfolded protein response (UPR) and is independent of HIF-1α. LAMP3 is expressed heterogeneously within the microenvironment of tumours, overexpressed in breast cancer, and increases in tumours treated with avastin. Conclusions: These data identify LAMP3 as a novel hypoxia-inducible gene regulated by the UPR. LAMP3 is a new candidate biomarker of UPR activation by hypoxia in tumours and is a potential mediator of hypoxia-induced metastasis.
Activity-regulated genes as mediators of neural circuit plasticity.
Leslie, Jennifer H; Nedivi, Elly
2011-08-01
Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.
Macrophage Expression of Inflammatory Genes in Response to EMCV Infection
Directory of Open Access Journals (Sweden)
Zachary R. Shaheen
2015-08-01
Full Text Available The expression and production of type 1 interferon is the classic cellular response to virus infection. In addition to this antiviral response, virus infection also stimulates the production of proinflammatory mediators. In this review, the pathways controlling the induction of inflammatory genes and the roles that these inflammatory mediators contribute to host defense against viral pathogens will be discussed. Specific focus will be on the role of the chemokine receptor CCR5, as a signaling receptor controlling the activation of pathways leading to virus-induced inflammatory gene expression.
Directory of Open Access Journals (Sweden)
Gökhan Sadi
Full Text Available This study was conducted to elucidate the genome-wide gene expression profile in streptozotocin induced diabetic rat liver tissues in response to resveratrol treatment and to establish differentially expressed transcription regulation networks with microarray technology. In addition to measure the expression levels of several antioxidant and detoxification genes, real-time quantitative polymerase chain reaction (qRT-PCR was also used to verify the microarray results. Moreover, gene and protein expressions as well as enzymatic activities of main antioxidant enzymes; superoxide dismutase (SOD-1 and SOD-2 and glutathione S-transferase (GST-Mu were analyzed. Diabetes altered 273 genes significantly and 90 of which were categorized functionally which suggested that genes in cellular catalytic activities, oxidation-reduction reactions, co-enzyme binding and terpenoid biosynthesis were dominated by up-regulated expression in diabetes. Whereas; genes responsible from cellular carbohydrate metabolism, regulation of transcription, cell signal transduction, calcium independent cell-to-cell adhesion and lipid catabolism were down-regulated. Resveratrol increased the expression of 186 and decreased the expression of 494 genes in control groups. While cellular and extracellular components, positive regulation of biological processes, biological response to stress and biotic stimulants, and immune response genes were up-regulated, genes responsible from proteins present in nucleus and nucleolus were mainly down-regulated. The enzyme assays showed a significant decrease in diabetic SOD-1 and GST-Mu activities. The qRT-PCR and Western-blot results demonstrated that decrease in activity is regulated at gene expression level as both mRNA and protein expressions were also suppressed. Resveratrol treatment normalized the GST activities towards the control values reflecting a post-translational effect. As a conclusion, global gene expression in the liver tissues is
Energy Technology Data Exchange (ETDEWEB)
Dominguez M, V.
2013-07-01
The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)
Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.
Inoue, Masayo; Kaneko, Kunihiko
2013-04-01
Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.
Redox-active antibiotics control gene expression and community behavior in divergent bacteria.
Dietrich, Lars E P; Teal, Tracy K; Price-Whelan, Alexa; Newman, Dianne K
2008-08-29
It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for stress responses, despite the fact that many of these organisms still produce redox-active small molecules, which indicates that redox-active pigments play a role independent of oxidative stress. These compounds had profound effects on the structural organization of colony biofilms in both P. aeruginosa and S. coelicolor, which shows that "secondary metabolites" play important conserved roles in gene expression and development.
Local and global responses in complex gene regulation networks
Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro
2009-04-01
An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.
Discovery of stimulation-responsive immune enhancers with CRISPR activation
Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander
2017-09-01
The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.
Discovery of stimulation-responsive immune enhancers with CRISPR activation
Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander
2017-01-01
The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172
KBERG: KnowledgeBase for Estrogen Responsive Genes
DEFF Research Database (Denmark)
Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam
2007-01-01
Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...
Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.
Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M
2010-10-01
Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response.
International Nuclear Information System (INIS)
Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.
1988-01-01
Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses
Directory of Open Access Journals (Sweden)
Hua-Bing Li
2013-04-01
Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.
Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-02-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.
1994-01-01
Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs
Thiel, Gerald; Rössler, Oliver G
2018-06-05
The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.
Gene expression of corals in response to macroalgal competitors.
Directory of Open Access Journals (Sweden)
Tonya L Shearer
Full Text Available As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora versus the more resistant (M. digitata coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens.
Investigation of the mechanisms by which UV irradiation activates the tyrosinase gene
International Nuclear Information System (INIS)
Bao, Y.
2000-04-01
Tyrosinase, tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2) are the enzymes involved in melanin pigment synthesis. They are expressed specifically in melanocytic cells. UV irradiation is the major physiological stimulant of melanogenesis. Tyrosinase is the rate-limiting enzyme in melanin synthesis and its activity is regulated by UV irradiation in melanocytes. The molecular mechanism underlying the activation of tyrosinase by UV is still not clear. In this thesis, the effects of UV irradiation on tyrosinase, TRP-1 and TRP-2 gene expression in mouse B16 melanoma cells were studied as well as the effects of UV irradiation on the activity of the tyrosinase promoter in mouse, and human melanoma cells. UV irradiation caused an increase in tyrosinase mRNA level, without change in either TRP-1 or TRP-2 mRNA levels, as determined by Northern blot analysis. In order to determine whether UV- induced increase of tyrosinase mRNA expression involved modulation of tyrosinase promoter activity, transient transfection approaches involving a series of constructs containing either chloramphenicol acetyl transferase (CAT) or luciferase reporter genes linked to different lengths of the tyrosinase gene- promoter were used. UV irradiation specifically induced CAT gene expression from both the mouse and the human tyrosinase promoters, suggesting that UV irradiation induced the transcription of the tyrosinase gene. These observations indicated that the promoter region between -250 and -150 bp of the human tyrosinase promoter may contain important cis-regulatory elements involved in the UV response. To localise the cis-regulatory elements responsible for the UV response of the tyrosinase promoter, the 100-bp between -250 bp and -150 bp of the tyrosinase promoter was inserted upstream of a CAT reporter. It was shown that transcription from the 100-bp promoter fragment was activated by UV irradiation. Mutations of a potential cAMP response element (CRE) motif
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays
Badri, Hanène; Monsieurs, Pieter; Coninx, Ilse; Nauts, Robin; Wattiez, Ruddy; Leys, Natalie
2015-01-01
The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA) and Calvin-Benson-Bassham (CBB) cycles, combined with an activation of the pentose phosphate pathway (PPP). For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation resistance of
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays.
Directory of Open Access Journals (Sweden)
Hanène Badri
Full Text Available The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA and Calvin-Benson-Bassham (CBB cycles, combined with an activation of the pentose phosphate pathway (PPP. For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation
Influence of the xonA gene of Escherichia coli in response to radiation
International Nuclear Information System (INIS)
Ponce M, J.; Serment G, J.; Brena V, M.
2003-01-01
The Escherichia coli bacteria has a repair and tolerance system known as SOS that works when there is damage in the DNA. However it is necessary that this damage modifies before the system is activated. For this it has intended to the enzymes that degrade DNA like responsible for generating this modifications. It has already been identified to the product of the gene recJ and according to the results that here are presented that of the gene xonA has similar activity. When both genes fail, not alone the activity SOS is inhibited but rather the mortality increases, for ionizing radiation. The above mentioned reinforces the importance of these genes in the recovery to the damage caused to the genome. (Author)
2013-01-01
Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the
Caarls, Lotte; van der Does, Adriana; Hickman, Richard; Jansen, Wouter; van Verk, Marcel; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-01-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the
Blum, Kenneth; Chen, Thomas J H; Chen, Amanda L H; Madigan, Margaret; Downs, B William; Waite, Roger L; Braverman, Eric R; Kerner, Mallory; Bowirrat, Abdalla; Giordano, John; Henshaw, Harry; Gold, Mark S
2010-03-01
Using fMRI, Menon and Levitin [9] clearly found for the first time that listening to music strongly modulates activity in a network of mesolimbic structures involved in reward processing including the nucleus accumbens (NAc) and the ventral tegmental area (VTA), as well as the hypothalamus, and insula, which are thought to be involved in regulating autonomic and physiological responses to rewarding and emotional stimuli. Importantly, responses in the NAc and VTA were strongly correlated pointing to an association between dopamine release and NAc response to music. Listing to pleasant music induced a strong response and significant activation of the VTA-mediated interaction of the NAc with the hypothalamus, insula, and orbitofrontal cortex. Blum et al. [10] provided the first evidence that the dopamine D2 receptor gene (DRD2) Taq 1 A1 allele significantly associated with severe alcoholism whereby the author's suggested that they found the first "reward gene" located in the mesolimbic system. The enhanced functional and effective connectivity between brain regions mediating reward, autonomic, and cognitive processing provides insight into understanding why listening to music is one of the most rewarding and pleasurable human experiences. However, little is known about why some people have a more or less powerful mesolimbic experience when they are listening to music. It is well-known that music may induce an endorphinergic response that is blocked by naloxone, a known opioid antagonist (Goldstein [19]). Opioid transmission in the NAc is associated with dopamine release in the VTA. Moreover, dopamine release in the VTA is linked to polymorphisms of the DRD2 gene and even attention-deficit hyperactivity disorder (ADHD), whereby carriers of the DRD2 A1 allele show a reduced NAc release of dopamine (DA). Thus it is conjectured that similar mechanisms in terms of adequate dopamine release and subsequent activation of reward circuitry by listening to music might also be
Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni
2004-12-01
Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.
HRGFish: A database of hypoxia responsive genes in fishes
Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo
2017-02-01
Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response.
Guzman, Christine; Conaco, Cecilia
2016-01-01
Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Dose response relationship in anti-stress gene regulatory networks.
Zhang, Qiang; Andersen, Melvin E
2007-03-02
the level of local gains, presence of gain-changing events, and degree of feedforward gene activation, this region can appear as superlinear, sublinear, or even J-shaped. The general dose response transition proposed here was further examined in a complex anti-electrophilic stress pathway, which involves multiple genes, enzymes, and metabolic reactions. This work would help biologists and especially toxicologists to better assess and predict the cellular impact brought about by biological stressors.
Dose response relationship in anti-stress gene regulatory networks.
Directory of Open Access Journals (Sweden)
Qiang Zhang
2007-03-01
, and depending on the level of local gains, presence of gain-changing events, and degree of feedforward gene activation, this region can appear as superlinear, sublinear, or even J-shaped. The general dose response transition proposed here was further examined in a complex anti-electrophilic stress pathway, which involves multiple genes, enzymes, and metabolic reactions. This work would help biologists and especially toxicologists to better assess and predict the cellular impact brought about by biological stressors.
Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors
International Nuclear Information System (INIS)
Ahmed, M.
2003-01-01
Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation
A nucleotide metabolite controls stress-responsive gene expression and plant development.
Directory of Open Access Journals (Sweden)
Hao Chen
Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt
A nucleotide metabolite controls stress-responsive gene expression and plant development
Chen, Hao
2011-10-19
Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target
Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2015-02-01
Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
GENE RESPONSE OF THE GASTROCNEMIUS AND SOLEUS MUSCLES TO AN ACUTE AEROBIC RUN IN RATS
Directory of Open Access Journals (Sweden)
Michael J. McKenzie
2011-06-01
Full Text Available Genes can be activated or inhibited by signals within the tissues in response to an acute bout of exercise. It is unclear how a particular aerobic exercise bout may influence two muscles with similar actions to the activity. Therefore, the purposes of this investigation was to determine the gene response of selected genes involved in the "stress" response of the gastrocnemius (fast-twitch and soleus (slow-twitch muscles to a single two hour aerobic exercise bout in female Sprague-Dawley Rats at the 1 hour time point after the exercise. Exercised rats were run (n=8 for 2 hours at 20 m.min-1 and one hour after the completion of the bout had their soleus (S and gastrocnemius (G muscles removed. Age and timed matched sedentary control rats had both S and G muscles removed also. RNA was isolated from all muscles. Real-time PCR analysis was performed on the following genes: NFκB, TNFα, and Atf3. GAPDH was used as the housekeeping gene for both muscles. S muscle showed more genes altered (n = 52 vs G (n = 26. NFκB gene expression was 0.83 ± 0.14 in the exercised S but was + 1.36 ± 0.58 in the exercised G and was not significantly different between the muscles. TNFα was altered 1.30 ± 0. 34 in the exercised S and 1.36 ± 0.71 in the exercised G and was not significantly different between the muscles. The gene Atf3 was significantly altered at 4.97 ± 1.01 in the exercised S, while it was not significantly altered in the exercised G (0.70 ± 0.55. This study demonstrates that an acute bout of aerobic exercise can alter gene expression to a different extent in both the S and G muscles. It is highly likely that muscle recruitment was a factor which influenced the gene expression in theses muscles. It is interesting to note that some genes were similarly activated in these two muscles but other genes may demonstrate a varied response to the same exercise bout depending on the type of muscle
Directory of Open Access Journals (Sweden)
Stefan Boedi
2016-07-01
Full Text Available Fusarium graminearum is an opportunistic pathogen of cereals where it causes severe yield losses and concomitant mycotoxin contamination of the grains. The pathogen has mixed biotrophic and necrotrophic (saprophytic growth phases during infection and the regulatory networks associated with these phases have so far always been analyzed together. In this study we compared the transcriptomes of fungal cells infecting a living, actively defending plant representing the mixed live style (pathogenic growth on living flowering wheat heads to the response of the fungus infecting identical, but dead plant tissues (cold-killed flowering wheat heads representing strictly saprophytic conditions. We found that the living plant actively suppressed fungal growth and promoted much higher toxin production in comparison to the identical plant tissue without metabolism suggesting that molecules signaling secondary metabolite induction are not pre-existing or not stable in the plant in sufficient amounts before infection. Differential gene expression analysis was used to define gene sets responding to the active or the passive plant as main impact factor and driver for gene expression. We correlated our results to the published F. graminearum transcriptomes, proteomes and secretomes and found that only a limited number of in planta- expressed genes require the living plant for induction but the majority uses simply the plant tissue as signal. Many secondary metabolite (SM gene clusters show a heterogeneous expression pattern within the cluster indicating that different genetic or epigenetic signals govern the expression of individual genes within a physically linked cluster. Our bioinformatic approach also identified fungal genes which were actively repressed by signals derived from the active plant and may thus represent direct targets of the plant defense against the invading pathogen.
Redox-Active Antibiotics Control Gene Expression and Community Behavior in Divergent Bacteria
Dietrich, Lars E. P.; Teal, Tracy K.; Price-Whelan, Alexa; Newman, Dianne K.
2008-01-01
It is thought that bacteria excrete redox-active pigments as antibiotics to inhibit competitors. In Pseudomonas aeruginosa, the endogenous antibiotic pyocyanin activates SoxR, a transcription factor conserved in Proteo- and Actinobacteria. In Escherichia coli, SoxR regulates the superoxide stress response. Bioinformatic analysis coupled with gene expression studies in P. aeruginosa and Streptomyces coelicolor revealed that the majority of SoxR regulons in bacteria lack the genes required for ...
Directory of Open Access Journals (Sweden)
Mohammad Rashed Hossain
2016-05-01
Full Text Available Stress responsive gene expression is commonly profiled in a comparative manner involving different stress conditions or genotypes with contrasting reputation of tolerance/resistance. In contrast, this research exploited a wide natural variation in terms of taxonomy, origin and salt sensitivity in eight genotypes of rice to identify the trait specific patterns of gene expression under salt stress. Genome wide transcptomic responses were interrogated by the weighted continuous morpho-physiological trait responses using modified Significance Analysis of Microarrays. More number of genes was found to be differentially expressed under salt stressed compared to that of under unstressed conditions. Higher numbers of genes were observed to be differentially expressed for the traits shoot Na+/K+, shoot Na+, root K+, biomass and shoot Cl-, respectively. The results identified around sixty genes to be involved in Na+, K+ and anion homeostasis, transport and transmembrane activity under stressed conditions. Gene Ontology (GO enrichment analysis identified 1.36% (578 genes of the entire transcriptome to be involved in the major molecular functions such as signal transduction (>150 genes, transcription factor (81 genes and translation factor activity (62 genes etc. under salt stress. Chromosomal mapping of the genes suggests that majority of the genes are located on chromosomes 1, 2, 3, 6 & 7. The gene network analysis showed that the transcription factors and translation initiation factors formed the major gene networks and are mostly active in nucleus, cytoplasm and mitochondria whereas the membrane and vesicle bound proteins formed a secondary network active in plasma membrane and vacuoles. The novel genes and the genes with unknown functions thus identified provide picture of a synergistic salinity response representing the potentially fundamental mechanisms that are active in the wide natural genetic background of rice and will be of greater use once
Innate immune responses: Crosstalk of signaling and regulation of gene transcription
International Nuclear Information System (INIS)
Zhong Bo; Tien Po; Shu Hongbing
2006-01-01
Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes
Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.
Directory of Open Access Journals (Sweden)
Luciane S Fonseca
Full Text Available Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2 one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.
Directory of Open Access Journals (Sweden)
delphine efaugaret
2014-12-01
Full Text Available The formation of granulomas is associated with the resolution of Q fever, a zoonosis due to Coxiella burnetii; however the molecular mechanisms of granuloma formation remain poorly understood. We generated human granulomas with peripheral blood mononuclear cells and beads coated with C. burnetii, using BCG extracts as controls. A microarray analysis showed dramatic changes in gene expression in granuloma cells of which more than 50% were commonly modulated genes in response to C. burnetii and BCG. They included M1-related genes and genes related to chemotaxis. The inhibition of the chemokines, CCL2 and CCL5, directly interfered with granuloma formation. C. burnetii granulomas also expressed a specific transcriptional profile that was essentially enriched in genes associated with type I interferon response. Our results showed that granuloma formation is associated with a core of transcriptional response based on inflammatory genes. The specific granulomatous response to C. burnetii is characterized by the activation of type I interferon pathway.
Study of the Genes and Mechanism Involved in the Radioadaptive Response
Dasgupta, Pushan R.
2009-01-01
The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor
Gene expression profile of endoscopically active and inactive ulcerative colitis: preliminary data.
Ţieranu, Cristian George; Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Popa, Caterina; Mănuc, Mircea; Ţieranu, Ioana; Preda, Carmen Monica; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel
2017-01-01
Multiple cytokines and chemokines related to immune response, apoptosis and inflammation have been identified as molecules implicated in ulcerative colitis (UC) pathogenesis. The aim of this study was to identify the differences at gene expression level of a panel of candidate genes in mucosa from patients with active UC (UCA), patients in remission (UCR), and normal controls. Eleven individuals were enrolled in the study: eight UC patients (four with active lesions, four with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression profile was evaluated by polymerase chain reaction (PCR) array, investigating 84 genes implicated in apoptosis, inflammation, immune response, cellular adhesion, tissue remodeling and mucous secretion. Seventeen and three genes out of 84 were found significantly differentially expressed in UCA and UCR compared to controls, respectively. In particular, REG1A and CHI3L1 genes reported an up-regulation in UCA with a fold difference above 200. In UCR patients, the levels of CASP1, LYZ and ISG15 were different compared to controls. However, since a significant up-regulation of both CASP1 and LYZ was observed also in the UCA group, only ISG15 levels remained associated to the remission state. ISG15, that plays a key role in the innate immune response, seemed to be specifically associated to the UC remission state. These preliminary data represent a starting point for defining the gene profile of UC in different stages in Romanian population. Identification of genes implicated in UC pathogenesis could be useful to select new therapeutic targets.
Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro
Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard S.; Ravasi, Timothy; Marcondes, Maria Cecilia G.
2017-01-01
BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro
Bortell, Nikki
2017-03-09
BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Avramova, Zoya
2015-07-01
Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. © 2015 The Author The Plant Journal © 2015 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Logemann, E.; Wu ShengCheng; Schröder, J.; Schmelzer, E.; Somssich, I.E.; Hahlbrock, K.
1995-01-01
The effects of UV light or fungal elicitors on plant cells have so far been studied mostly with respect to defense-related gene activation. Here, an inverse correlation of these stimulatory effects with the activities of several cell cycle-related genes is demonstrated. Concomitant with the induction of flavonoid biosynthetic enzymes in UV-irradiated cell suspension cultures of parsley (Petroselinum crispum), total histone synthesis declined to about half the initial rate. A subclass of the histone H3 gene family was selected to demonstrate the close correlation of its expression with cell division, both in intact plants and cultured cells. Using RNA-blot and run-on transcription assays, it was shown that one arbitrarily selected subclass of each of the histone H2A, H2B, H3 and H4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV-irradiated as well as fungal elicitor-treated parsley cells. The timing and extent of repression differed between the two stimuli; the response to light was more transient and smaller in magnitude. These differential responses to light and elicitor were inversely correlated with the induction of phenylalanine ammonia-lyase, a key enzyme of phenylpropanoid metabolism. Essentially the same result was obtained with a defined oligopeptide elicitor, indicating that the same signaling pathway is responsible for defense-related gene activation and cell cycle-related gene repression. A temporary (UV light) or long-lasting (fungal elicitor) cessation of cell culture growth is most likely due to an arrest of cell division which may be a prerequisite for full commitment of the cells to transcriptional activation of full commitment of the cells to transcriptional activation of pathways involved in UV protection or pathogen defense. This conclusion is corroborated by the observation that the histone H3 mRNA level greatly declined around fungal infection sites in young parsley
Energy Technology Data Exchange (ETDEWEB)
Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca [Department of Comparative Biomedicine and Food Science, University of Padova, Viale dell' Universita 16, Legnaro (Padova) (Italy); Marin, Maria Gabriella [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy); Matozzo, Valerio, E-mail: matozzo@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy)
2013-01-15
Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 {mu}g IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both 'IBU concentration' and 'exposure duration' on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.
International Nuclear Information System (INIS)
Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca; Marin, Maria Gabriella; Matozzo, Valerio
2013-01-01
Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 μg IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both “IBU concentration” and “exposure duration” on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Directory of Open Access Journals (Sweden)
Rinath M Jeselsohn
Full Text Available Advancements in molecular biology have unveiled multiple breast cancer promoting pathways and potential therapeutic targets. Large randomized clinical trials remain the ultimate means of validating therapeutic efficacy, but they require large cohorts of patients and are lengthy and costly. A useful approach is to conduct a window of opportunity study in which patients are exposed to a drug pre-surgically during the interval between the core needle biopsy and the definitive surgery. These are non-therapeutic studies and the end point is not clinical or pathological response but rather evaluation of molecular changes in the tumor specimens that can predict response. However, since the end points of the non-therapeutic studies are biologic, it is critical to first define the biologic changes that occur in the absence of treatment. In this study, we compared the molecular profiles of breast cancer tumors at the time of the diagnostic biopsy versus the definitive surgery in the absence of any intervention using the Nanostring nCounter platform. We found that while the majority of the transcripts did not vary between the two biopsies, there was evidence of activation of immune related genes in response to the first biopsy and further investigations of the immune changes after a biopsy in early breast cancer seem warranted.
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Transcriptional feedback regulation of YUCCA genes in response to auxin levels in Arabidopsis.
Suzuki, Masashi; Yamazaki, Chiaki; Mitsui, Marie; Kakei, Yusuke; Mitani, Yuka; Nakamura, Ayako; Ishii, Takahiro; Soeno, Kazuo; Shimada, Yukihisa
2015-08-01
The IPyA pathway, the major auxin biosynthesis pathway, is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels. The phytohormone auxin plays an important role in plant growth and development, and levels of active free auxin are determined by biosynthesis, conjugation, and polar transport. Unlike conjugation and polar transport, little is known regarding the regulatory mechanism of auxin biosynthesis. We discovered that expression of genes encoding indole-3-pyruvic acid (IPyA) pathway enzymes is regulated by elevated or reduced active auxin levels. Expression levels of TAR2, YUC1, YUC2, YUC4, and YUC6 were downregulated in response to synthetic auxins [1-naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D)] exogenously applied to Arabidopsis thaliana L. seedlings. Concomitantly, reduced levels of endogenous indole-3-acetic acid (IAA) were observed. Alternatively, expression of these YUCCA genes was upregulated by the auxin biosynthetic inhibitor kynurenine in Arabidopsis seedlings, accompanied by reduced IAA levels. These results indicate that expression of YUCCA genes is regulated by active auxin levels. Similar results were also observed in auxin-overproduction and auxin-deficient mutants. Exogenous application of IPyA to Arabidopsis seedlings preincubated with kynurenine increased endogenous IAA levels, while preincubation with 2,4-D reduced endogenous IAA levels compared to seedlings exposed only to IPyA. These results suggest that in vivo conversion of IPyA to IAA was enhanced under reduced auxin levels, while IPyA to IAA conversion was depressed in the presence of excess auxin. Based on these results, we propose that the IPyA pathway is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels.
Directory of Open Access Journals (Sweden)
David Haase
Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.
International Nuclear Information System (INIS)
Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.
1987-01-01
Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.
Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime
2014-02-01
Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.
Controlling nuclear JAKs and STATs for specific gene activation by IFNγ
International Nuclear Information System (INIS)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.
2011-01-01
Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The
The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses
Directory of Open Access Journals (Sweden)
Yuling Bai
2018-06-01
Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.
Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies
Directory of Open Access Journals (Sweden)
Andrea Farini
2014-01-01
Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.
Hamby, Kelly A; Kwok, Rosanna S; Zalom, Frank G; Chiu, Joanna C
2013-01-01
Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between 'summer' and 'winter' conditions due to differences in photoperiod and temperature. In the 'summer', D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the 'winter', activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing
Directory of Open Access Journals (Sweden)
Luca Crepaldi
Full Text Available In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE conditions. We discovered that Short Interspersed Elements (SINEs located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs, and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.
Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella
2013-01-01
In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.
Diurnal oscillations of soybean circadian clock and drought responsive genes.
Directory of Open Access Journals (Sweden)
Juliana Marcolino-Gomes
Full Text Available Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i drought stress affects gene expression of circadian clock components and (ii several stress responsive genes display diurnal oscillation in soybeans.
Construction and comparison of gene co-expression networks shows complex plant immune responses
Directory of Open Access Journals (Sweden)
Luis Guillermo Leal
2014-10-01
Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.
Stress, and pathogen response gene expression in modeled microgravity
Sundaresan, Alamelu; Pellis, Neal R.
2006-01-01
Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and
Lee, M O; Liu, Y; Zhang, X K
1995-01-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...
Two-stage gene regulation of the superoxide stress response soxRS system in Escherichia coli.
Nunoshiba, T
1996-01-01
All organisms have adapted to environmental changes by acquiring various functions controlled by gene regulation. In bacteria, a number of specific responses have been found to confer cell survival in various nutrient-limited conditions, and under physiological stresses such as high or low temperature, extreme pH, radiation, and oxidation (for review, see Neidhardt et al., 1987). In this article, I introduce an Escherichia coli (E. coli) global response induced by superoxide stress, the soxRS regulon. The functions controlled by this system consist of a wide variety of enzymes such as manganese-containing SOD (Mn-SOD); glucose 6-phosphate dehydrogenase (G6PD), the DNA repair enzyme endonuclease IV, fumarase C, NADPH:ferredoxin oxidoreductase, and aconitase. This response is positively regulated by a two-stage control system in which SoxR iron-sulfur protein senses exposure to superoxide and nitric oxide, and then activates transcription of the soxS gene, whose product stimulates the expression of the regulon genes. Our recent finding indicates that soxS transcription is initiated in a manner dependent on the rpoS gene encoding RNA polymerase sigma factor, theta s, in response to entering the stationary phase of growth. With this information, mechanisms for prokaryotic coordinating gene expression in response to superoxide stress and in stationary phase are discussed.
2011-01-01
Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599
Directory of Open Access Journals (Sweden)
Lisowska Katarzyna Marta
2011-06-01
Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.
Directory of Open Access Journals (Sweden)
Bin Shan
Full Text Available Heterogeneous surface expression of Thy-1 in fibroblasts modulates inflammation and may thereby modulate injury and repair. As a paradigm, patients with idiopathic pulmonary fibrosis, a disease with pathologic features of chronic inflammation, demonstrate an absence of Thy-1 immunoreactivity within areas of fibrotic activity (fibroblast foci in contrast to the predominant Thy-1 expressing fibroblasts in the normal lung. Likewise, Thy-1 deficient mice display more severe lung fibrosis in response to an inflammatory injury than wildtype littermates. We investigated the role of Thy-1 in the response of fibroblasts to the pro-inflammatory cytokine TNF-alpha. Our study demonstrates distinct profiles of TNF-alpha-activated gene expression in Thy-1 positive (Thy-1+ and negative (Thy-1- subsets of mouse embryonic fibroblasts (MEF. TNF-alpha induced a robust activation of MMP-9, ICAM-1, and the IL-8 promoter driven reporter in Thy-1- MEFs, in contrast to only a modest increase in Thy-1+ counterparts. Consistently, ectopic expression of Thy-1 in Thy-1- MEFs significantly attenuated TNF-alpha-activated gene expression. Mechanistically, TNF-alpha activated Src family kinase (SFK only in Thy-1- MEFs. Blockade of SFK activation abrogated TNF-alpha-activated gene expression in Thy-1- MEFs, whereas restoration of SFK activation rescued the TNF-alpha response in Thy-1+ MEFs. Our findings suggest that Thy-1 down-regulates TNF-alpha-activated gene expression via interfering with SFK- and NF-kappaB-mediated transactivation. The current study provides a novel mechanistic insight to the distinct roles of fibroblast Thy-1 subsets in inflammation.
Thamm, Markus; Scheiner, Ricarda
2014-06-01
Division of labor is a hallmark of social insects. In honey bees, division of labor involves transition of female workers from one task to the next. The most distinct tasks are nursing (providing food for the brood) and foraging (collecting pollen and nectar). The brain mechanisms regulating this form of behavioral plasticity have largely remained elusive. Recently, it was suggested that division of labor is based on nutrition-associated signaling pathways. One highly conserved gene associated with food-related behavior across species is the foraging gene, which encodes a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG). Our analysis of this gene reveals the presence of alternative splicing in the honey bee. One isoform is expressed in the brain. Expression of this isoform is most pronounced in the mushroom bodies, the subesophageal ganglion, and the corpora allata. Division of labor and sucrose responsiveness in honey bees correlate significantly with foraging gene expression in distinct brain regions. Activating PKG selectively increases sucrose responsiveness in nurse bees to the level of foragers, whereas the same treatment does not affect responsiveness to light. These findings demonstrate a direct link between PKG signaling in distinct brain areas and division of labor. Furthermore, they demonstrate that the difference in sensory responsiveness between nurse bees and foragers can be compensated for by activating PKG. Our findings on the function of PKG in regulating specific sensory responsiveness and social organization offer valuable indications for the function of the cGMP/PKG pathway in many other insects and vertebrates. Copyright © 2013 Wiley Periodicals, Inc.
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the
International Nuclear Information System (INIS)
Golubnitchaya-Labudova, O.; Hoefer, M.; Portele, A.; Vacata, V.; Rink, H.; Lubec, G.
1997-01-01
The XRCC1 gene (X-ray repair cross complementing) complements the DNA repair deficiency of the radiation sensitive Chinese hamster ovary (CHO) mutant cell line EM9 but the mechanism of the correction is not elucidated yet. XRCC1 shows substantial homology to the RAG2 gene (recombination activating gene) and we therefore tried to answer the question, whether structural similarities (sequence of a putative recombination activating domain, aa 332-362 for XRCC1 and aa 286-316 in RAG2) would reflect similar functions of the homologous, putative recombination activating domain. PCR experiments revealed that no sequence homologous to the structural part of human XRCC1 was present in cDNA of CHO. Differential display demonstrated two putative recombination activating in the parental CHO line AA8 and one in the radiosensitive mutant EM9. Southern blot experiments showed the presence of several genes with partial homology to human XRCC1. Recombination studies consisted of expressing amplified target domains within chimeric proteins in recA - bacteria and subsequent detection of recombination events by sequencing the recombinant plasmids. Recombination experiments demonstrated recombination activating activity of all putative recombination activating domains amplified from AA8 and EM9 genomes as reflected by deletions within the inserts of the recombinant plasmids. The recombination activating activity of XRCC1 analogues could explain a mechanism responsible for the correction of the DNA repair defect in EM9. (author)
Directory of Open Access Journals (Sweden)
Hui Peng
2014-08-01
Full Text Available Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.
DEFF Research Database (Denmark)
Lallemand, Christophe; Kavrochorianou, Nadia; Steenholdt, Casper
2011-01-01
A cell-based assay has been developed for the quantification of the activity of TNFα antagonists based on human erythroleukemic K562 cells transfected with a NFκB regulated firefly luciferase reporter-gene construct. Both drug activity and anti-drug neutralizing antibodies can be quantified...... with a high degree of precision within 2h, and without interference from cytokines and other factors known to activate NFκB. The assay cells also contain the Renilla luciferase reporter gene under the control of a constitutive promoter that allows TNFα-induced firefly luciferase activity to be normalized...... relative to Renilla luciferase expression. Thus, results are independent of cell number or differences in cell viability, resulting in intra and inter assay coefficients of variation of 10% or less. Normalization of results relative to the expression of an internal standard also provides a means...
Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather
2012-07-01
• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
hence presumably of the GDF8 gene, in both CHO and C2C12 cultured cells. In vitro the MYOD1-A allelic variant could up-regulate the expression of MYOD1 gene. Additionally, we could assess a different response of in vitro gene expression according to cell type used to transfect constructs, suggesting that MyoD activation is regulated by mechanisms that are specific of myoblasts.
Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.
Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang
2018-03-08
The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.
Stat1-independent regulation of gene expression in response to IFN-γ
Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.
2001-01-01
Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994
International Nuclear Information System (INIS)
Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima
2010-01-01
Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment
2012-01-01
Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I
Directory of Open Access Journals (Sweden)
Cribbs David H
2012-07-01
Full Text Available Abstract Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD. Methods In a well-powered microarray study of young (20 to 59 years, aged (60 to 99 years, and AD (74 to 95 years cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%. In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets, with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc receptors and human
LWD–TCP complex activates the morning gene CCA1 in Arabidopsis
Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing
2016-01-01
A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock. PMID:27734958
LWD-TCP complex activates the morning gene CCA1 in Arabidopsis.
Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing
2016-10-13
A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock.
Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S
2017-12-15
Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.
Yamamoto, Kazuhiko; Nihrane, Abdallah; Aglipay, Jason; Sironi, Juan; Arkin, Steven; Lipton, Jeffrey M; Ouchi, Toru; Liu, Johnson M
2008-01-01
Fanconi anemia (FA) predisposes to hematopoietic failure, birth defects, leukemia, and squamous cell carcinoma of the head and neck (HNSCC) and cervix. The FA/BRCA pathway includes 8 members of a core complex and 5 downstream gene products closely linked with BRCA1 or BRCA2. Precancerous lesions are believed to trigger the DNA damage response (DDR), and we focused on the DDR in FA and its putative role as a checkpoint barrier to cancer. In primary fibroblasts with mutations in the core complex FANCA protein, we discovered that basal expression and phosphorylation of ATM (ataxia telangiectasia mutated) and p53 induced by irradiation (IR) or mitomycin C (MMC) were upregulated. This heightened response appeared to be due to increased basal levels of ATM in cultured FANCA-mutant cells, highlighting the new observation that ATM can be regulated at the transcriptional level in addition to its well-established activation by autophosphorylation. Functional analysis of this response using gamma-H2AX foci as markers of DNA double-stranded breaks (DSBs) demonstrated abnormal persistence of only MMC- and not IR-induced foci. Thus, we describe a processing defect that leads to general DDR upregulation but specific persistence of DNA crosslinker-induced damage response foci. Underscoring the significance of these findings, we found resistance to DNA crosslinker-induced cell cycle arrest and apoptosis in a TP53-mutant, patient-derived HNSCC cell line, whereas a lymphoblastoid cell line derived from this same individual was not mutated at TP53 and retained DNA crosslinker sensitivity. Our results suggest that cancer in FA may arise from selection for cells that escape from a chronically activated DDR checkpoint.
Directory of Open Access Journals (Sweden)
Arainga Mariluz
2012-03-01
Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K
2017-06-01
Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.
Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun
2013-01-01
Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338
Directory of Open Access Journals (Sweden)
Andrea D McCue
2012-02-01
Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs
Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C
2009-02-01
Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Directory of Open Access Journals (Sweden)
Kathie-Anne Walters
Full Text Available Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4. Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways.
Krivoruchko, Anastasia; Storey, Kenneth B
2014-10-01
ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.
Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong
2012-03-01
Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.
Faba bean drought responsive gene identification and validation
Directory of Open Access Journals (Sweden)
Megahed H. Ammar
2017-01-01
Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.
Norman-Setterblad, C; Vidal, S; Palva, E T
2000-04-01
We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.
Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses
Directory of Open Access Journals (Sweden)
Kenneth W. Berendzen
2013-04-01
Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.
Boutry, Céline; Delplace, Brigitte; Clippe, André; Fontaine, Laetitia; Hols, Pascal
2013-02-01
Streptococcus includes species that either contain or lack the LexA-like repressor (HdiR) of the classical SOS response. In Streptococcus pneumoniae, a species which belongs to the latter group, SOS response inducers (e.g., mitomycin C [Mc] and fluoroquinolones) were shown to induce natural transformation, leading to the hypothesis that DNA damage-induced competence could contribute to genomic plasticity and stress resistance. Using reporter strains and microarray experiments, we investigated the impact of the SOS response inducers mitomycin C and norfloxacin and the role of HdiR on competence development in Streptococcus thermophilus. We show that both the addition of SOS response inducers and HdiR inactivation have a dual effect, i.e., induction of the expression of SOS genes and reduction of transformability. Reduction of transformability results from two different mechanisms, since HdiR inactivation has no major effect on the expression of competence (com) genes, while mitomycin C downregulates the expression of early and late com genes in a dose-dependent manner. The downregulation of com genes by mitomycin C was shown to take place at the level of the activation of the ComRS signaling system by an unknown mechanism. Conversely, we show that a ComX-deficient strain is more resistant to mitomycin C and norfloxacin in a viability plate assay, which indicates that competence development negatively affects the resistance of S. thermophilus to DNA-damaging agents. Altogether, our results strongly suggest that SOS response activation and competence development are antagonistic processes in S. thermophilus.
Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.
Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H
2009-05-01
Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.
Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas
2015-06-01
Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.
Directory of Open Access Journals (Sweden)
Marinus F van Batenburg
2010-01-01
Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.
Directory of Open Access Journals (Sweden)
Chia-Hung Kao
Full Text Available Chitosan has been widely used in food industry as a weight-loss aid and a cholesterol-lowering agent. Previous studies have shown that chitosan affects metabolic responses and contributes to anti-diabetic, hypocholesteremic, and blood glucose-lowering effects; however, the in vivo targeting sites and mechanisms of chitosan remain to be clarified. In this study, we constructed transgenic mice, which carried the luciferase genes driven by peroxisome proliferator-activated receptor (PPAR, a key regulator of fatty acid and glucose metabolism. Bioluminescent imaging of PPAR transgenic mice was applied to report the organs that chitosan acted on, and gene expression profiles of chitosan-targeted organs were further analyzed to elucidate the mechanisms of chitosan. Bioluminescent imaging showed that constitutive PPAR activities were detected in brain and gastrointestinal tract. Administration of chitosan significantly activated the PPAR activities in brain and stomach. Microarray analysis of brain and stomach showed that several pathways involved in lipid and glucose metabolism were regulated by chitosan. Moreover, the expression levels of metabolism-associated genes like apolipoprotein B (apoB and ghrelin genes were down-regulated by chitosan. In conclusion, these findings suggested the feasibility of PPAR bioluminescent imaging-guided transcriptomic analysis on the evaluation of chitosan-affected metabolic responses in vivo. Moreover, we newly identified that downregulated expression of apoB and ghrelin genes were novel mechanisms for chitosan-affected metabolic responses in vivo.
Dkhil, Mohamed A; Metwaly, Mahmoud S; Al-Quraishy, Saleh; Sherif, Nour E; Delic, Denis; Al Omar, Suliman Y; Wunderlich, Frank
2015-04-01
Plant-based natural products are promising sources for identifying novel agents with potential anti-Eimeria activity. This study explores possible effects of berberine on Eimeria papillata infections in the jejunum of male Swiss albino mice. Berberine chloride, when daily administered to mice during infection, impairs intracellular development and multiplication of E. papillata, evidenced as 60% reduction of maximal fecal output of oocysts on day 5 p.i. Concomitantly, berberine attenuates the inflammatory response, evidenced as decreased messenger RNA (mRNA) expression of IL-1β, IL-6, TNFα, IFNγ, and iNOS, as well as the oxidative stress response, evidenced as impaired increase in malondialdehyde, nitrate, and H2O2 and as prevented decrease in glutathione and catalase activity. Berberine also alters gene expression in the infected jejunum. On day 5 p.i., mRNA expression of 29 genes with annotated functions is more than 10-fold upregulated and that of 14 genes downregulated. Berberine downregulates the genes Xaf1, Itgb3bp, and Faim3 involved in apoptotic processes and upregulates genes involved in innate immune responses, as e.g., Colec11, Saa2, Klra8, Clec1b, and Crtam, especially the genes Cpa3, Fcer1a, and Mcpt1, Mcpt2, and Mcpt4 involved in mast cell activity. Additionally, 18 noncoding lincRNA species are differentially expressed more than 10-fold under berberine. Our data suggest that berberine induces hosts to exert anti-Eimeria activity by attenuating the inflammatory and oxidative stress response, by impairing apoptotic processes, and by activating local innate immune responses and epigenetic mechanisms in the host jejunum. Berberine has the potential as an anti-Eimeria food additive in animal farming.
Directory of Open Access Journals (Sweden)
Xiangshu Dong
Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a
Directory of Open Access Journals (Sweden)
Hettne Kristina M
2013-01-01
Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.
Changes in gene expression and catalase activity in Oryza sativa L. under abiotic stress.
Vighi, I L; Benitez, L C; do Amaral, M N; Auler, P A; Moraes, G P; Rodrigues, G S; da Maia, L C; Pinto, L S; Braga, E J B
2016-11-03
Different rice (Oryza sativa L.) genotypes were subjected to high salinity and low temperature (150 mM NaCl and 13°C, respectively) for 0, 6, 24, 48, or 72 h. We evaluated the simultaneous expression of the genes OsCATA, OsCATB, and OsCATC, correlated gene expression with enzyme activity, and verified the regulation of these genes through identification of cis-elements in the promoter region. The hydrogen peroxide content increased in a tolerant genotype and decreased in a sensitive genotype under both stress conditions. Lipid peroxidation increased in the tolerant genotype when exposed to cold, and in the sensitive genotype when exposed to high salinity. Catalase activity significantly increased in both genotypes when subjected to 13°C. In the tolerant genotype, OsCATA and OsCATB were the most responsive to high salinity and cold, while in the sensitive genotype, OsCATA and OsCATC responded positively to saline stress, as did OsCATA and OsCATB to low temperature. Cis-element analysis identified different regulatory sequences in the catalase promoter region of each genotype. The sensitive genotype maintained a better balance between hydrogen oxyacid levels, catalase activity, and lipid peroxidation under low temperature than the resistant genotype. OsCATA and OsCATB were the most responsive in the salt-tolerant genotype to cold, OsCATA and OsCATC were the most responsive to saline stress, and OsCATA and OsCATB were the most responsive to chilling stress in the sensitive genotype. There were positive correlations between catalase activity and OsCATB expression in the tolerant genotype under saline stress and in the sensitive genotype under cold stress.
A TAD further: exogenous control of gene activation.
Mapp, Anna K; Ansari, Aseem Z
2007-01-23
Designer molecules that can be used to impose exogenous control on gene transcription, artificial transcription factors (ATFs), are highly desirable as mechanistic probes of gene regulation, as potential therapeutic agents, and as components of cell-based devices. Recently, several advances have been made in the design of ATFs that activate gene transcription (activator ATFs), including reports of small-molecule-based systems and ATFs that exhibit potent activity. However, the many open mechanistic questions about transcriptional activators, in particular, the structure and function of the transcriptional activation domain (TAD), have hindered rapid development of synthetic ATFs. A compelling need thus exists for chemical tools and insights toward a more detailed portrait of the dynamic process of gene activation.
Cre-dependent DNA recombination activates a STING-dependent innate immune response
Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit
2016-01-01
Abstract Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376
Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard; Ravasi, Timothy; Marcondes, Maria
2017-01-01
Abstract Background Astrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use. Methods We developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders. Results We identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes. Conclusions Gene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Farace, Giovanni; Fernandez, Olivier; Jacquens, Lucile; Coutte, François; Krier, François; Jacques, Philippe; Clément, Christophe; Barka, Essaid Ait; Jacquard, Cédric; Dorey, Stéphan
2015-02-01
Non-self-recognition of microorganisms partly relies on the perception of microbe-associated molecular patterns (MAMPs) and leads to the activation of an innate immune response. Bacillus subtilis produces three main families of cyclic lipopeptides (LPs), namely surfactins, iturins and fengycins. Although LPs are involved in induced systemic resistance (ISR) activation, little is known about defence responses induced by these molecules and their involvement in local resistance to fungi. Here, we showed that purified surfactin, mycosubtilin (iturin family) and plipastatin (fengycin family) are perceived by grapevine plant cells. Although surfactin and mycosubtilin stimulated grapevine innate immune responses, they differentially activated early signalling pathways and defence gene expression. By contrast, plipastatin perception by grapevine cells only resulted in early signalling activation. Gene expression analysis suggested that mycosubtilin activated salicylic acid (SA) and jasmonic acid (JA) signalling pathways, whereas surfactin mainly induced an SA-regulated response. Although mycosubtilin and plipastatin displayed direct antifungal activity, only surfactin and mycosubtilin treatments resulted in a local long-lasting enhanced tolerance to the necrotrophic fungus Botrytis cinerea in grapevine leaves. Moreover, challenge with specific strains overproducing surfactin and mycosubtilin led to a slightly enhanced stimulation of the defence response compared with the LP-non-producing strain of B. subtilis. Altogether, our results provide the first comprehensive view of the involvement of LPs from B. subtilis in grapevine plant defence and local resistance against the necrotrophic pathogen Bo. cinerea. Moreover, this work is the first to highlight the ability of mycosubtilin to trigger an immune response in plants. © 2014 BSPP AND JOHN WILEY & SONS LTD.
Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma
International Nuclear Information System (INIS)
Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van
2005-01-01
Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype
Nagaraju, Kanneboyina; Ghimbovschi, Svetlana; Rayavarapu, Sree; Phadke, Aditi; Rider, Lisa G; Hoffman, Eric P; Miller, Frederick W
2016-09-01
To identify muscle gene expression patterns that predict rituximab responses and assess the effects of rituximab on muscle gene expression in PM and DM. In an attempt to understand the molecular mechanism of response and non-response to rituximab therapy, we performed Affymetrix gene expression array analyses on muscle biopsy specimens taken before and after rituximab therapy from eight PM and two DM patients in the Rituximab in Myositis study. We also analysed selected muscle-infiltrating cell phenotypes in these biopsies by immunohistochemical staining. Partek and Ingenuity pathway analyses assessed the gene pathways and networks. Myeloid type I IFN signature genes were expressed at higher levels at baseline in the skeletal muscle of rituximab responders than in non-responders, whereas classic non-myeloid IFN signature genes were expressed at higher levels in non-responders at baseline. Also, rituximab responders have a greater reduction of the myeloid and non-myeloid type I IFN signatures than non-responders. The decrease in the type I IFN signature following administration of rituximab may be associated with the decreases in muscle-infiltrating CD19(+) B cells and CD68(+) macrophages in responders. Our findings suggest that high levels of myeloid type I IFN gene expression in skeletal muscle predict responses to rituximab in PM/DM and that rituximab responders also have a greater decrease in the expression of these genes. These data add further evidence to recent studies defining the type I IFN signature as both a predictor of therapeutic responses and a biomarker of myositis disease activity. Published by Oxford University Press on behalf British Society for Rheumatology 2016. This work is written by US Government employees and is in the public domain in the US.
Computational method for discovery of estrogen responsive genes
DEFF Research Database (Denmark)
Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar
2004-01-01
Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...
Network-based association of hypoxia-responsive genes with cardiovascular diseases
International Nuclear Information System (INIS)
Wang, Rui-Sheng; Oldham, William M; Loscalzo, Joseph
2014-01-01
Molecular oxygen is indispensable for cellular viability and function. Hypoxia is a stress condition in which oxygen demand exceeds supply. Low cellular oxygen content induces a number of molecular changes to activate regulatory pathways responsible for increasing the oxygen supply and optimizing cellular metabolism under limited oxygen conditions. Hypoxia plays critical roles in the pathobiology of many diseases, such as cancer, heart failure, myocardial ischemia, stroke, and chronic lung diseases. Although the complicated associations between hypoxia and cardiovascular (and cerebrovascular) diseases (CVD) have been recognized for some time, there are few studies that investigate their biological link from a systems biology perspective. In this study, we integrate hypoxia genes, CVD genes, and the human protein interactome in order to explore the relationship between hypoxia and cardiovascular diseases at a systems level. We show that hypoxia genes are much closer to CVD genes in the human protein interactome than that expected by chance. We also find that hypoxia genes play significant bridging roles in connecting different cardiovascular diseases. We construct a hypoxia-CVD bipartite network and find several interesting hypoxia-CVD modules with significant gene ontology similarity. Finally, we show that hypoxia genes tend to have more CVD interactors in the human interactome than in random networks of matching topology. Based on these observations, we can predict novel genes that may be associated with CVD. This network-based association study gives us a broad view of the relationships between hypoxia and cardiovascular diseases and provides new insights into the role of hypoxia in cardiovascular biology. (paper)
Essack, Magbubah
2012-10-26
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.
2012-01-01
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
International Nuclear Information System (INIS)
Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.
1988-01-01
Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene
International Nuclear Information System (INIS)
Soto, Armando; DelRaso, Nicholas J.; Schlager, John J.; Chan, Victor T.
2008-01-01
Renal toxicity can commonly occur after exposure to xenobiotics, pharmaceutical agents or environmental pollutants. Changes in the gene expression in kidney parenchymal cells that precede and/or accompany renal injury may be hallmark critical events in the onset of pathologic changes of renal functions. Over the last several years, transcriptomic analysis has evolved to enable simultaneous analysis of the expression profiles of tens of thousands of genes in response to various endogenous and exogenous stimuli. In this study, we investigated gene expression changes in the kidney after acute exposure to a nephrotoxin, D-serine, which targets the proximal tubule of the kidney. Male F-344 rats injected intraperitoneally with a single dose of D-serine (5, 20, 50, 200 or 500 mg/kg), and gene expression profiles in the kidney were determined using the Affymetrix RAE230A gene arrays at 96 h post-dosing. D-Serine treatment resulted in the up- and down-regulation of 1158 and 749 genes, respectively, over the entire dose range based on the intersection of the results of t-test, p < 0.01 over two consecutive doses, and ANOVA with Bonferonni correction for multiple testing. Interestingly, both the up-and down-regulated genes show a unified dose response pattern as revealed in the self-organized map clustering analysis using the expression profiles of the 1907 differentially expressed genes as input data. There appears to be minimal changes in the expression level of these genes in the dose range of 5-50 mg/kg, while the most prominent changes were observed at the highest doses tested, i.e. 200 and 500 mg/kg. Pathway analysis of the differentially expressed genes showed perturbation of a large number of biological processes/pathways after D-serine exposure. Among the up-regulated pathways are actin cytoskeleton biogenesis and organization, apoptosis, cell cycle regulation, chromatin assembly, excision repair of damaged DNA, DNA replication and packaging, protein biosynthesis
Fomenko, Dmitri E.; Koc, Ahmet; Agisheva, Natalia; Jacobsen, Michael; Kaya, Alaattin; Malinouski, Mikalai; Rutherford, Julian C.; Siu, Kam-Leung; Jin, Dong-Yan; Winge, Dennis R.; Gladyshev, Vadim N.
2011-01-01
Hydrogen peroxide is thought to regulate cellular processes by direct oxidation of numerous cellular proteins, whereas antioxidants, most notably thiol peroxidases, are thought to reduce peroxides and inhibit H2O2 response. However, thiol peroxidases have also been implicated in activation of transcription factors and signaling. It remains unclear if these enzymes stimulate or inhibit redox regulation and whether this regulation is widespread or limited to a few cellular components. Herein, we found that Saccharomyces cerevisiae cells lacking all eight thiol peroxidases were viable and withstood redox stresses. They transcriptionally responded to various redox treatments, but were unable to activate and repress gene expression in response to H2O2. Further studies involving redox transcription factors suggested that thiol peroxidases are major regulators of global gene expression in response to H2O2. The data suggest that thiol peroxidases sense and transfer oxidative signals to the signaling proteins and regulate transcription, whereas a direct interaction between H2O2 and other cellular proteins plays a secondary role. PMID:21282621
Loboda, Andrey; Nebozhyn, Michael; Klinghoffer, Rich; Frazier, Jason; Chastain, Michael; Arthur, William; Roberts, Brian; Zhang, Theresa; Chenard, Melissa; Haines, Brian; Andersen, Jannik; Nagashima, Kumiko; Paweletz, Cloud; Lynch, Bethany; Feldman, Igor; Dai, Hongyue; Huang, Pearl; Watters, James
2010-06-30
Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90%) sensitivity but relatively low (50%) specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical utility in lung and breast tumors.
Directory of Open Access Journals (Sweden)
Paweletz Cloud
2010-06-01
Full Text Available Abstract Background Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. Methods We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. Results The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90% sensitivity but relatively low (50% specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. Conclusions These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical
Directory of Open Access Journals (Sweden)
Yan Yan
2016-08-01
Full Text Available Mitogen-activated protein kinases (MAPKs play central roles in plant developmental processes, hormone signaling transduction, and responses to abiotic stress. However, no data are currently available about the MAPK family in cassava, an important tropical crop. Herein, 21 MeMAPK genes were identified from cassava. Phylogenetic analysis indicated that MeMAPKs could be classified into four subfamilies. Gene structure analysis demonstrated that the number of introns in MeMAPK genes ranged from 1 to 10, suggesting large variation among cassava MAPK genes. Conserved motif analysis indicated that all MeMAPKs had typical protein kinase domains. Transcriptomic analysis suggested that MeMAPK genes showed differential expression patterns in distinct tissues and in response to drought stress between wild subspecies and cultivated varieties. Interaction networks and co-expression analyses revealed that crucial pathways controlled by MeMAPK networks may be involved in the differential response to drought stress in different accessions of cassava. Expression of nine selected MAPK genes showed that these genes could comprehensively respond to osmotic, salt, cold, oxidative stressors, and abscisic acid (ABA signaling. These findings yield new insights into the transcriptional control of MAPK gene expression, provide an improved understanding of abiotic stress responses and signaling transduction in cassava, and lead to potential applications in the genetic improvement of cassava cultivars.
Zheng, Lei; Liu, Guifeng; Meng, Xiangnan; Liu, Yujia; Ji, Xiaoyu; Li, Yanbang; Nie, Xianguang; Wang, Yucheng
2013-07-01
WRKY transcription factors are involved in various biological processes, such as development, metabolism and responses to stress. However, their exact roles in abiotic stress tolerance are largely unknown. Here, we demonstrated a working model for the function of a WRKY gene (ThWRKY4) from Tamarix hispida in the stress response. ThWRKY4 is highly induced by abscisic acid (ABA), salt and drought in the early period of stress (stress for 3, 6, or 9 h), which can be regulated by ABF (ABRE binding factors) and Dof (DNA binding with one finger), and also can be crossregulated by other WRKYs and autoregulated as well. Overexpression of ThWRKY4 conferred tolerance to salt, oxidative and ABA treatment in transgenic plants. ThWRKY4 can improve the tolerance to salt and ABA treatment by improving activities of superoxide dismutase and peroxidase, decreasing levels of O2 (-) and H2O2, reducing electrolyte leakage, keeping the loss of chlorophyll, and protecting cells from death. Microarray analyses showed that overexpression of ThWRKY4 in Arabidopsis leads to 165 and 100 genes significantly up- and downregulated, respectively. Promoter scanning analysis revealed that ThWRKY4 regulates the gene expression via binding to W-box motifs present in their promoter regions. This study shows that ThWRKY4 functions as a transcription factor to positively modulate abiotic stress tolerances, and is involved in modulating reactive oxygen species.
Nimmanee, Panjaphorn; Tam, Emily W T; Woo, Patrick C Y; Vanittanakom, Pramote; Vanittanakom, Nongnuch
2017-04-01
Stress-activated MAPK pathways are systems used to regulate the stress adaptation of most fungi. It has been shown that in Talaromyces marneffei (Penicillium marneffei), a pathogenic dimorphic fungus, the sakA gene is involved, not only in tolerance against oxidative and heat stresses, but also in playing a role in asexual development, yeast cell generation in vitro and survival inside macrophage cell lines. In this study, the role of the T. marneffei sakA gene on the nitrosative stress response and the regulation of gene expression were investigated. The susceptibility of the sakA mutant to NaNO2 was investigated using drop dilution assay and the expression of genes of interest were determined by RT-PCR, comparing them to the wild-type and complemented strains. The results demonstrated that the T. marneffei sakA gene played a role in the stress response to NaNO2, the expression of genes functioning in conidial development (brlA, abaA and wetA) and red pigment biosynthesis (pks3, rp1, rp2 and rp3). These findings suggest that T. marneffei sakA is broadly involved in a wide variety of cell activities, including stress response, cell morphogenesis, asexual development and pigmentation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cellular Stress Response Gene Expression During Upper and Lower Body High Intensity Exercises.
Kochanowicz, Andrzej; Sawczyn, Stanisław; Niespodziński, Bartłomiej; Mieszkowski, Jan; Kochanowicz, Kazimierz; Żychowska, Małgorzata
2017-01-01
The aim was to compare the effect of upper and lower body high-intensity exercise on chosen genes expression in athletes and non-athletes. Fourteen elite male artistic gymnasts (EAG) aged 20.6 ± 3.3 years and 14 physically active men (PAM) aged 19.9 ± 1.0 years performed lower and upper body 30 s Wingate Tests. Blood samples were collected before, 5 and 30 minutes after each effort to assess gene expression via PCR. Significantly higher mechanical parameters after lower body exercise was observed in both groups, for relative power (8.7 ± 1.2 W/kg in gymnasts, 7.2 ± 1.2 W/kg in controls, p = 0.01) and mean power (6.7 ± 0.7 W/kg in gymnasts, 5.4 ± 0.8 W/kg in controls, p = 0.01). No differences in lower versus upper body gene expression were detected for all tested genes as well as between gymnasts and physical active man. For IL-6 m-RNA time-dependent effect was observed. Because of no significant differences in expression of genes associated with cellular stress response the similar adaptive effect to exercise may be obtained so by lower and upper body exercise.
Institute of Scientific and Technical Information of China (English)
ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)
2002-01-01
Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.
Directory of Open Access Journals (Sweden)
Regla Bustos
2010-09-01
Full Text Available Plants respond to different stresses by inducing or repressing transcription of partially overlapping sets of genes. In Arabidopsis, the PHR1 transcription factor (TF has an important role in the control of phosphate (Pi starvation stress responses. Using transcriptomic analysis of Pi starvation in phr1, and phr1 phr1-like (phl1 mutants and in wild type plants, we show that PHR1 in conjunction with PHL1 controls most transcriptional activation and repression responses to phosphate starvation, regardless of the Pi starvation specificity of these responses. Induced genes are enriched in PHR1 binding sequences (P1BS in their promoters, whereas repressed genes do not show such enrichment, suggesting that PHR1(-like control of transcriptional repression responses is indirect. In agreement with this, transcriptomic analysis of a transgenic plant expressing PHR1 fused to the hormone ligand domain of the glucocorticoid receptor showed that PHR1 direct targets (i.e., displaying altered expression after GR:PHR1 activation by dexamethasone in the presence of cycloheximide corresponded largely to Pi starvation-induced genes that are highly enriched in P1BS. A minimal promoter containing a multimerised P1BS recapitulates Pi starvation-specific responsiveness. Likewise, mutation of P1BS in the promoter of two Pi starvation-responsive genes impaired their responsiveness to Pi starvation, but not to other stress types. Phylogenetic footprinting confirmed the importance of P1BS and PHR1 in Pi starvation responsiveness and indicated that P1BS acts in concert with other cis motifs. All together, our data show that PHR1 and PHL1 are partially redundant TF acting as central integrators of Pi starvation responses, both specific and generic. In addition, they indicate that transcriptional repression responses are an integral part of adaptive responses to stress.
Kroes, R A; Abravaya, K; Seidenfeld, J; Morimoto, R I
1991-01-01
Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or beta-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes. Images PMID:2052560
Bathige, S D N K; Umasuthan, Navaneethaiyer; Whang, Ilson; Lim, Bong-Soo; Won, Seung Hwan; Lee, Jehee
2014-08-01
The membrane-attack complex/perforin (MACPF) domain-containing proteins play an important role in the innate immune response against invading microbial pathogens. In the current study, a member of the MACPF domain-containing proteins, macrophage expressed gene-1 (MPEG1) encoding 730 amino acids with the theoretical molecular mass of 79.6 kDa and an isoelectric point (pI) of 6.49 was characterized from disk abalone Haliotis discus discus (AbMPEG1). We found that the characteristic MACPF domain (Val(131)-Tyr(348)) and transmembrane segment (Ala(669)-Ile(691)) of AbMPEG1 are located in the N- and C-terminal ends of the protein, respectively. Ortholog comparison revealed that AbMPEG1 has the highest sequence identity with its pink abalone counterpart, while sequences identities of greater than 90% were observed with MPEG1 members from other abalone species. Likewise, the furin cleavage site KRRRK was highly conserved in all abalone species, but not in other species investigated. We identified an intron-less genomic sequence within disk abalone AbMPEG1, which was similar to other mammalian, avian, and reptilian counterparts. Transcription factor binding sites, which are important for immune responses, were identified in the 5'-flanking region of AbMPEG1. qPCR revealed AbMPEG1 transcripts are present in every tissues examined, with the highest expression level occurring in mantle tissue. Significant up-regulation of AbMPEG1 transcript levels was observed in hemocytes and gill tissues following challenges with pathogens (Vibrio parahemolyticus, Listeria monocytogenes and viral hemorrhagic septicemia virus) as well as pathogen-associated molecular patterns (PAMPs: lipopolysaccharides and poly I:C immunostimulant). Finally, the antibacterial activity of the MACPF domain was characterized against Gram-negative and -positive bacteria using a recombinant peptide. Taken together, these results indicate that the biological significance of the AbMPEG1 gene includes a role in
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald
2018-01-11
In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .
Directory of Open Access Journals (Sweden)
Stefanie Staats
2018-01-01
Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Horrevoets, A. J.; Fontijn, R. D.; van Zonneveld, A. J.; de Vries, C. J.; ten Cate, J. W.; Pannekoek, H.
1999-01-01
Activation and dysfunction of endothelial cells play a prominent role in patho-physiological processes such as atherosclerosis. We describe the identification by differential display of 106 cytokine-responsive gene fragments from endothelial cells, activated by monocyte conditioned medium or tumor
Kenyon, Amy; Gavriouchkina, Daria; Zorman, Jernej; Chong-Morrison, Vanessa; Napolitani, Giorgio; Cerundolo, Vincenzo; Sauka-Spengler, Tatjana
2018-04-06
A complex network of inflammatory genes is closely linked to somatic cell transformation and malignant disease. Immune cells and their associated molecules are responsible for detecting and eliminating cancer cells as they establish themselves as the precursors of a tumour. By the time a patient has a detectable solid tumour, cancer cells have escaped the initial immune response mechanisms. Here, we describe the development of a double binary zebrafish model that enables regulatory programming of the myeloid cells as they respond to oncogene-activated melanocytes to be explored, focussing on the initial phase when cells become the precursors of cancer. A hormone-inducible binary system allows for temporal control of expression of different Ras oncogenes ( NRas Q61K , HRas G12V and KRas G12V ) in melanocytes, leading to proliferation and changes in morphology of the melanocytes. This model was coupled to binary cell-specific biotagging models allowing in vivo biotinylation and subsequent isolation of macrophage or neutrophil nuclei for regulatory profiling of their active transcriptomes. Nuclear transcriptional profiling of neutrophils, performed as they respond to the earliest precursors of melanoma in vivo , revealed an intricate landscape of regulatory factors that may promote progression to melanoma, including Serpinb1l4, Fgf1, Fgf6, Cathepsin H, Galectin 1 and Galectin 3. The model presented here provides a powerful platform to study the myeloid response to the earliest precursors of melanoma. © 2018. Published by The Company of Biologists Ltd.
Genistein-induced alterations of radiation-responsive gene expression
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F.; Landauer, M.R. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
In order to clarify the molecular mechanism of radioprotection and understand biological dosimetry in the presence of medical countermeasure-radioprotectants, their effects on ionizing radiation (IR)-responsive molecular biomarkers must be examined. We used genistein in a radiation model system and measured gene expression by multiplex QRT-PCR assay in drug-treated healthy human blood cultures. Genistein has been demonstrated to be a radiosensitizer of malignant cells and a radioprotector against IR-induced lethality in a mouse model. Whole-blood cultures were supplemented with 50, 100, and 200{mu}M concentrations of genistein, 16 h prior to receiving a 2-Gy ({sup 60}Co-{gamma} rays, 10 cGy/min) dose of IR. Total RNA was isolated from whole blood 24 h postirradiation for assessments. Combination treatments of genistein and IR resulted in no significant genistein effects on ddb2 and bax downstream transcripts to p53, or proliferating cell-nuclear antigen, pcna, necessary for DNA synthesis and cell-cycle progression. Use of these radiation-responsive targets would be recommended for dose-assessment applications. We also observed decreased expression of pro-survival transcript, bcl-2. Genistein and IR-increased expression of cdkn1a and gadd45a, showing that genistein also stimulates p53 transcriptional activity. These results confirm published molecular signatures for genistein in numerous in vitro models. Evaluation of gene biomarkers may be further exploited for devising novel radiation countermeasure and/or therapeutic strategies.
Directory of Open Access Journals (Sweden)
Sandra M Mathioni
Full Text Available Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.
Ryan, James C; Morey, Jeanine S; Bottein, Marie-Yasmine Dechraoui; Ramsdell, John S; Van Dolah, Frances M
2010-08-26
Ciguatoxins (CTXs) are polyether marine neurotoxins and potent activators of voltage-gated sodium channels. This toxin is carried by multiple reef-fish species and human consumption of ciguatoxins can result in an explosive gastrointestinal/neurologic illness. This study characterizes the global transcriptional response in mouse brain to a symptomatic dose of the highly toxic Pacific ciguatoxin P-CTX-1 and additionally compares this data to transcriptional profiles from liver and whole blood examined previously. Adult male C57/BL6 mice were injected with 0.26 ng/g P-CTX-1 while controls received only vehicle. Animals were sacrificed at 1, 4 and 24 hrs and transcriptional profiling was performed on brain RNA with Agilent whole genome microarrays. RT-PCR was used to independently validate gene expression and the web tool DAVID was used to analyze gene ontology (GO) and molecular pathway enrichment of the gene expression data. A pronounced 4°C hypothermic response was recorded in these mice, reaching a minimum at 1 hr and lasting for 8 hrs post toxin exposure. Ratio expression data were filtered by intensity, fold change and p-value, with the resulting data used for time course analysis, K-means clustering, ontology classification and KEGG pathway enrichment. Top GO hits for this gene set included acute phase response and mono-oxygenase activity. Molecular pathway analysis showed enrichment for complement/coagulation cascades and metabolism of xenobiotics. Many immediate early genes such as Fos, Jun and Early Growth Response isoforms were down-regulated although others associated with stress such as glucocorticoid responsive genes were up-regulated. Real time PCR confirmation was performed on 22 differentially expressed genes with a correlation of 0.9 (Spearman's Rho, p < 0.0001) with microarray results. Many of the genes differentially expressed in this study, in parallel with the hypothermia, figure prominently in protection against neuroinflammation. Pathologic
An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis
Directory of Open Access Journals (Sweden)
Hongyan eGuo
2015-05-01
Full Text Available Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid, a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice.
Directory of Open Access Journals (Sweden)
Deyholos Michael K
2006-10-01
Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent
Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response
Directory of Open Access Journals (Sweden)
Nasrine Bendjilali
2017-01-01
Full Text Available Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen.
Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.
Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J
2017-01-05
Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.
Wang, Cheng; Yu, Jie; Kallen, Caleb B
2008-01-01
The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.
International Nuclear Information System (INIS)
Ussuf, K.K.; Laxmi, N.H.; Nair, P.M.
1996-01-01
Hydroxyproline rich glycoprotein (HRGP) gene is induced in both control and gamma irradiated potato tubers after wounding. The enhanced RNA synthesis in response to wounding correlated well with the accumulation of both HRGP gene transcripts and protein. Initially, the level of HRGP gene expression in gamma irradiated potatoes in response to wounding was 30% more than the corresponding controls. After post irradiation storage of 3-5 weeks, HRGP gene expression in response to wounding was significantly lower than the unirradiated samples. This low level of HRGP gene expression in irradiated potatoes was partially retrieved by 5 mM Ca 2+ treatment. Prior treatment with trifluoperazine, a calcium channel blocker resulted in 35% reduction in wound induced HRGP gene expression in control potatoes, further providing evidence for the involvement of Ca 2+ dependency for HRGP gene activation. A comparative study on in vivo protein phosphorylation induced by wounding in control and irradiated potatoes exhibited significant differences. A good correlation was observed in the modulation of phosphorylation and HRGP gene expression by Ca 2+ in irradiated potatoes. Wound induced signal transduction system and subsequent Ca 2+ dependent protein phosphorylation for the activation of HRGP gene is affected in potatoes after gamma irradiation, thus impairing the wound healing process adversely. (author). 25 refs., 5 figs
Directory of Open Access Journals (Sweden)
Dingfeng Wang
Full Text Available Isaria cateniannulata is a very important and virulent entomopathogenic fungus that infects many insect pest species. Although I. cateniannulata is commonly exposed to extreme environmental temperature conditions, little is known about its molecular response mechanism to temperature stress. Here, we sequenced and de novo assembled the transcriptome of I. cateniannulata in response to high and low temperature stresses using Illumina RNA-Seq technology. Our assembly encompassed 17,514 unigenes (mean length = 1,197 bp, in which 11,445 unigenes (65.34% showed significant similarities to known sequences in NCBI non-redundant protein sequences (Nr database. Using digital gene expression analysis, 4,483 differentially expressed genes (DEGs were identified after heat treatment, including 2,905 up-regulated genes and 1,578 down-regulated genes. Under cold stress, 1,927 DEGs were identified, including 1,245 up-regulated genes and 682 down-regulated genes. The expression patterns of 18 randomly selected candidate DEGs resulting from quantitative real-time PCR (qRT-PCR were consistent with their transcriptome analysis results. Although DEGs were involved in many pathways, we focused on the genes that were involved in endocytosis: In heat stress, the pathway of clathrin-dependent endocytosis (CDE was active; however at low temperature stresses, the pathway of clathrin-independent endocytosis (CIE was active. Besides, four categories of DEGs acting as temperature sensors were observed, including cell-wall-major-components-metabolism-related (CWMCMR genes, heat shock protein (Hsp genes, intracellular-compatible-solutes-metabolism-related (ICSMR genes and glutathione S-transferase (GST. These results enhance our understanding of the molecular mechanisms of I. cateniannulata in response to temperature stresses and provide a valuable resource for the future investigations.
Keifer, Joyce
2017-02-11
Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.
Expression of Bordetella pertussis virulence factors is activated by the BvgAS two-component system. Under modulating growth conditions BvgAS indirectly represses another set of genes through the action of BvgR, a bvg-activated protein. BvgR blocks activation of the response regulator RisA which is ...
Wagner, R Doug; Johnson, Shemedia J
2012-06-20
Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic
Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression
International Nuclear Information System (INIS)
Teodorov, E.; Ferrari, M.F.R.; Fior-Chadi, D.R.; Camarini, R.; Felício, L.F.
2012-01-01
The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female
Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression
Energy Technology Data Exchange (ETDEWEB)
Teodorov, E. [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, São Paulo, SP (Brazil); Ferrari, M.F.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Fior-Chadi, D.R. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Camarini, R. [Departamento de Farmacologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil); Felício, L.F. [Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP (Brazil)
2012-06-01
The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female
Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression
Directory of Open Access Journals (Sweden)
E. Teodorov
2012-10-01
Full Text Available The periaqueductal gray (PAG has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc or 0.9% saline (up to 1 mL/kg and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05 because a lower percentage of kappa group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR. A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05 and lactating female rats (P < 0.01, with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in
Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells
Directory of Open Access Journals (Sweden)
Yoshiaki Tabuchi
2013-11-01
Full Text Available Although low-intensity pulsed ultrasound (LIPUS has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2 did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down, which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells.
TaWRKY68 responses to biotic stresses are revealed by the orthologous genes from major cereals
Directory of Open Access Journals (Sweden)
Bo Ding
2014-01-01
Full Text Available WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies onWRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary,TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis
GST(phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses
Institute of Scientific and Technical Information of China (English)
CHEN Shihua; CHEN Xin; DOU Weihong; WANG Liang; YIN Haibo; GUO Shanli
2016-01-01
Reactive oxygen species (ROS) scavengers,including ascorbate peroxidase,superoxide dismutase,catalase and peroxidase,are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses.In this study,we cloned an 866 bp GST(phi) gene in Lemna minor and investigated its characteristics,expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers.GST(phi) gene expression patterns were similar to those of other scavengers of ROS.This suggests that GST(phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.
GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses
Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli
2016-03-01
Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Dynamic gene expression response to altered gravity in human T cells.
Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver
2017-07-12
We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.
HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses
International Nuclear Information System (INIS)
Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan
2004-01-01
Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus
PPARα gene expression is up-regulated by LXR and PXR activators in the small intestine
International Nuclear Information System (INIS)
Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro
2008-01-01
LXR, PXR, and PPARα are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPARα gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPARα in the mouse small intestine
Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
International Nuclear Information System (INIS)
Teutschbein, Janka; Haydn, Johannes M; Samans, Birgit; Krause, Michael; Eilers, Martin; Schartl, Manfred; Meierjohann, Svenja
2010-01-01
Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase) triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1), early growth response 1 (Egr1), osteopontin (Opn), insulin-like growth factor binding protein 3 (Igfbp3), dual-specificity phosphatase 4 (Dusp4), and tumor-associated antigen L6 (Taal6). Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute new possible molecular players in melanoma development
Directory of Open Access Journals (Sweden)
Krause Michael
2010-07-01
Full Text Available Abstract Background Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Methods Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Results Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1, early growth response 1 (Egr1, osteopontin (Opn, insulin-like growth factor binding protein 3 (Igfbp3, dual-specificity phosphatase 4 (Dusp4, and tumor-associated antigen L6 (Taal6. Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Conclusion Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute
Distinguishing the rates of gene activation from phenotypic variations.
Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun
2015-06-18
Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which regime a considered gene regulatory network is in from their phenotypic variations. We studied a gene expression model with positive feedbacks when genetic switching rates vary over a wide range. With the goal of providing a method to distinguish the regime of the switching rates, we first focus on understanding the essential dynamics of gene expression system in different cases. In the regime of slow switching rates, we found that the effective dynamics can be reduced to independent evolutions on two separate layers corresponding to gene activation and inactivation states, and the transitions between two layers are rare events, after which the system goes mainly along deterministic ODE trajectories on a particular layer to reach new steady states. The energy landscape in this regime can be well approximated by using Gaussian mixture model. In the regime of intermediate switching rates, we analyzed the mean switching time to investigate the stability of the system in different parameter ranges. We also discussed the case of fast switching rates from the viewpoint of transition state theory. Based on the obtained results, we made a proposal to distinguish these three regimes in a simulation experiment. We identified the intermediate regime from the fact that the strength of cellular memory is lower than the other two cases, and the fast and slow regimes can be distinguished by their different perturbation-response behavior with respect to the switching rates perturbations. We proposed a
Peroxisome Proliferator-Activated Receptor Alpha Target Genes
Directory of Open Access Journals (Sweden)
Maryam Rakhshandehroo
2010-01-01
Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.
Role of X-ray-inducible genes and proteins in adaptive survival responses
International Nuclear Information System (INIS)
Meyers, M.; Schea, R.A.; Petrowski, A.E.; Seabury, H.; McLaughlin, P.W.; Lee, I.; Lee, S.W.; Boothman, D.A.
1992-01-01
Certain X-ray-inducible genes and their corresponding protein products, appearing following low priming doses of ionizing radiation may subsequently give rise to an adaptive survival response, ultimately leading to increased radioresistance. Further, this adaptive radioresistance may be due to increased DNA repair (or misrepair) processes. Ultimately, the function of low-dose-induced cDNA clones within the cell is hoped to elucidate to follow the effects of specific gene turn-off on adaptive responses. Future research must determine the various functions of adaptive response gene products so that the beneficial or deleterious consequences of adaptive responses, which increases resistance to ionizing radiation, can be determined. (author). 19 refs., 1 fig
Directory of Open Access Journals (Sweden)
Ryan James C
2010-08-01
Full Text Available Abstract Background Ciguatoxins (CTXs are polyether marine neurotoxins and potent activators of voltage-gated sodium channels. This toxin is carried by multiple reef-fish species and human consumption of ciguatoxins can result in an explosive gastrointestinal/neurologic illness. This study characterizes the global transcriptional response in mouse brain to a symptomatic dose of the highly toxic Pacific ciguatoxin P-CTX-1 and additionally compares this data to transcriptional profiles from liver and whole blood examined previously. Adult male C57/BL6 mice were injected with 0.26 ng/g P-CTX-1 while controls received only vehicle. Animals were sacrificed at 1, 4 and 24 hrs and transcriptional profiling was performed on brain RNA with Agilent whole genome microarrays. RT-PCR was used to independently validate gene expression and the web tool DAVID was used to analyze gene ontology (GO and molecular pathway enrichment of the gene expression data. Results A pronounced 4°C hypothermic response was recorded in these mice, reaching a minimum at 1 hr and lasting for 8 hrs post toxin exposure. Ratio expression data were filtered by intensity, fold change and p-value, with the resulting data used for time course analysis, K-means clustering, ontology classification and KEGG pathway enrichment. Top GO hits for this gene set included acute phase response and mono-oxygenase activity. Molecular pathway analysis showed enrichment for complement/coagulation cascades and metabolism of xenobiotics. Many immediate early genes such as Fos, Jun and Early Growth Response isoforms were down-regulated although others associated with stress such as glucocorticoid responsive genes were up-regulated. Real time PCR confirmation was performed on 22 differentially expressed genes with a correlation of 0.9 (Spearman's Rho, p Conclusions Many of the genes differentially expressed in this study, in parallel with the hypothermia, figure prominently in protection against
Directory of Open Access Journals (Sweden)
Cheng Wang
Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.
Toyota, Kenji; Williams, Timothy D; Sato, Tomomi; Tatarazako, Norihisa; Iguchi, Taisen
2017-03-01
The freshwater zooplankton Daphnia magna has been extensively employed in chemical toxicity tests such as OECD Test Guidelines 202 and 211. Previously, it has been demonstrated that the treatment of juvenile hormones (JHs) or their analogues to female daphnids can induce male offspring production. Based on this finding, a rapid screening method for detection of chemicals with JH-activity was recently developed using adult D. magna. This screening system determines whether a chemical has JH-activity by investigating the male offspring inducibility. Although this is an efficient high-throughput short-term screening system, much remains to be discovered about JH-responsive pathways in the ovary, and whether different JH-activators act via the same mechanism. JH-responsive genes in the ovary including developing oocytes are still largely undescribed. Here, we conducted comparative microarray analyses using ovaries from Daphnia magna treated with fenoxycarb (Fx; artificial JH agonist) or methyl farnesoate (MF; a putative innate JH in daphnids) to elucidate responses to JH agonists in the ovary, including developing oocytes, at a JH-sensitive period for male sex determination. We demonstrate that induction of hemoglobin genes is a well-conserved response to JH even in the ovary, and a potential adverse effect of JH agonist is suppression of vitellogenin gene expression, that might cause reduction of offspring number. This is the first report demonstrating different transcriptomics profiles from MF and an artificial JH agonist in D. magna ovary, improving understanding the tissue-specific mode-of-action of JH. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Zhang, Zheng; Jin, Bo; Jin, Yaqiong; Huang, Shengquan; Niu, Xiaohua; Mao, Zebin; Xin, Dianqi
2017-01-01
Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that the PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.
Directory of Open Access Journals (Sweden)
Peng Zhang
2014-03-01
Full Text Available Hypoxia-inducible factors (HIFs play key roles in the cellular response to hypoxia. It is widely accepted that whereas HIF-1 and HIF-2 function as transcriptional activators, HIF-3 inhibits HIF-1/2α action. Contrary to this idea, we show that zebrafish Hif-3α has strong transactivation activity. Hif-3α is degraded under normoxia. Mutation of P393, P493, and L503 inhibits this oxygen-dependent degradation. Transcriptomics and chromatin immunoprecipitation analyses identify genes that are regulated by Hif-3α, Hif-1α, or both. Under hypoxia or when overexpressed, Hif-3α binds to its target gene promoters and upregulates their expression. Dominant-negative inhibition and knockdown of Hif-3α abolish hypoxia-induced Hif-3α-promoter binding and gene expression. Hif-3α not only mediates hypoxia-induced growth and developmental retardation but also possesses hypoxia-independent activities. Importantly, transactivation activity is conserved and human HIF-3α upregulates similar genes in human cells. These findings suggest that Hif-3 is an oxygen-dependent transcription factor and activates a distinct transcriptional response to hypoxia.
Phenylalanine ammonia-lyase (PAL) gene activity in response to ...
African Journals Online (AJOL)
Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...
Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.
Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L
2017-08-01
Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.
Directory of Open Access Journals (Sweden)
Yan Hao
2011-05-01
Full Text Available Elevation of the second messenger cGMP by nitric oxide (NO activates the cGMP-dependent protein kinase PKG, which is key in regulating cardiovascular, intestinal, and neuronal functions in mammals. The NO-cGMP-PKG signaling pathway is also a major therapeutic target for cardiovascular and male reproductive diseases. Despite widespread effects of PKG activation, few molecular targets of PKG are known. We study how EGL-4, the Caenorhabditis elegans PKG ortholog, modulates foraging behavior and egg-laying and seeks the downstream effectors of EGL-4 activity. Using a combination of unbiased forward genetic screen and proteomic analysis, we have identified a conserved SAEG-1/SAEG-2/HDA-2 histone deacetylase complex that is specifically recruited by activated nuclear EGL-4. Gene expression profiling by microarrays revealed >40 genes that are sensitive to EGL-4 activity in a SAEG-1-dependent manner. We present evidence that EGL-4 controls egg laying via one of these genes, Y45F10C.2, which encodes a novel protein that is expressed exclusively in the uterine epithelium. Our results indicate that, in addition to cytoplasmic functions, active EGL-4/PKG acts in the nucleus via a conserved Class I histone deacetylase complex to regulate gene expression pertinent to behavioral and physiological responses to cGMP. We also identify transcriptional targets of EGL-4 that carry out discrete components of the physiological response.
Directory of Open Access Journals (Sweden)
Woods Donald E
2009-12-01
Full Text Available Abstract Background Rhamnolipids are surface active molecules composed of rhamnose and β-hydroxydecanoic acid. These biosurfactants are produced mainly by Pseudomonas aeruginosa and have been thoroughly investigated since their early discovery. Recently, they have attracted renewed attention because of their involvement in various multicellular behaviors. Despite this high interest, only very few studies have focused on the production of rhamnolipids by Burkholderia species. Results Orthologs of rhlA, rhlB and rhlC, which are responsible for the biosynthesis of rhamnolipids in P. aeruginosa, have been found in the non-infectious Burkholderia thailandensis, as well as in the genetically similar important pathogen B. pseudomallei. In contrast to P. aeruginosa, both Burkholderia species contain these three genes necessary for rhamnolipid production within a single gene cluster. Furthermore, two identical, paralogous copies of this gene cluster are found on the second chromosome of these bacteria. Both Burkholderia spp. produce rhamnolipids containing 3-hydroxy fatty acid moieties with longer side chains than those described for P. aeruginosa. Additionally, the rhamnolipids produced by B. thailandensis contain a much larger proportion of dirhamnolipids versus monorhamnolipids when compared to P. aeruginosa. The rhamnolipids produced by B. thailandensis reduce the surface tension of water to 42 mN/m while displaying a critical micelle concentration value of 225 mg/L. Separate mutations in both rhlA alleles, which are responsible for the synthesis of the rhamnolipid precursor 3-(3-hydroxyalkanoyloxyalkanoic acid, prove that both copies of the rhl gene cluster are functional, but one contributes more to the total production than the other. Finally, a double ΔrhlA mutant that is completely devoid of rhamnolipid production is incapable of swarming motility, showing that both gene clusters contribute to this phenotype. Conclusions Collectively, these
Mazzoni, C; Santori, F; Saliola, M; Falcone, C
2000-01-01
KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.
Directory of Open Access Journals (Sweden)
Claudio Scafoglio
Full Text Available Checkpoint kinase 2 (Chk2 is a major regulator of DNA damage response and can induce alternative cellular responses: cell cycle arrest and DNA repair or programmed cell death. Here, we report the identification of a new role of Chk2 in transcriptional regulation that also contributes to modulating the balance between survival and apoptosis following DNA damage. We found that Chk2 interacts with members of the NCoR/SMRT transcriptional co-regulator complexes and serves as a functional component of the repressor complex, being required for recruitment of SMRT on the promoter of pro-apoptotic genes upon DNA damage. Thus, the co-repressor SMRT exerts a critical protective action against genotoxic stress-induced caspase activation, repressing a functionally important cohort of pro-apoptotic genes. Amongst them, SMRT is responsible for basal repression of Wip1, a phosphatase that de-phosphorylates and inactivates Chk2, thus affecting a feedback loop responsible for licensing the correct timing of Chk2 activation and the proper execution of the DNA repair process.
Directory of Open Access Journals (Sweden)
James eReynolds
2015-03-01
Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.
Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato
2017-09-01
Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.
Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph
2015-06-15
High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita
2017-01-01
Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27 + CD21 - ) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27 + CD21 + ) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses ( APRIL, BTK, BLIMP1 ) and
Activation of the cellular unfolded protein response by recombinant adeno-associated virus vectors.
Directory of Open Access Journals (Sweden)
Balaji Balakrishnan
Full Text Available The unfolded protein response (UPR is a stress-induced cyto-protective mechanism elicited towards an influx of large amount of proteins in the endoplasmic reticulum (ER. In the present study, we evaluated if AAV manipulates the UPR pathways during its infection. We first examined the role of the three major UPR axes, namely, endoribonuclease inositol-requiring enzyme-1 (IRE1α, activating transcription factor 6 (ATF6 and PKR-like ER kinase (PERK in AAV infected cells. Total RNA from mock or AAV infected HeLa cells were used to determine the levels of 8 different ER-stress responsive transcripts from these pathways. We observed a significant up-regulation of IRE1α (up to 11 fold and PERK (up to 8 fold genes 12-48 hours after infection with self-complementary (scAAV2 but less prominent with single-stranded (ssAAV2 vectors. Further studies demonstrated that scAAV1 and scAAV6 also induce cellular UPR in vitro, with AAV1 vectors activating the PERK pathway (3 fold while AAV6 vectors induced a significant increase on all the three major UPR pathways [6-16 fold]. These data suggest that the type and strength of UPR activation is dependent on the viral capsid. We then examined if transient inhibition of UPR pathways by RNA interference has an effect on AAV transduction. siRNA mediated silencing of PERK and IRE1α had a modest effect on AAV2 and AAV6 mediated gene expression (∼1.5-2 fold in vitro. Furthermore, hepatic gene transfer of scAAV2 vectors in vivo, strongly elevated IRE1α and PERK pathways (2 and 3.5 fold, respectively. However, when animals were pre-treated with a pharmacological UPR inhibitor (metformin during scAAV2 gene transfer, the UPR signalling and its subsequent inflammatory response was attenuated concomitant to a modest 2.8 fold increase in transgene expression. Collectively, these data suggest that AAV vectors activate the cellular UPR pathways and their selective inhibition may be beneficial during AAV mediated gene transfer.
Enhanced Virulence Gene Activity of Agrobacterium in Muskmelon (Cucumis melo L. cv. ‘Birdie’
Directory of Open Access Journals (Sweden)
Abul K.M. MOHIUDDIN
2011-05-01
Full Text Available Muskmelon (Cucumis melo L. cultivar ‘Birdie’, was evaluated for its response to the tumorigenic Agrobacterium tumefaciens and the oncogenic A. rhizogenes strains. Stem and petiole of three week-old in vitro-grown muskmelon plants were inoculated with five strains of A. tumefaciens and A. rhizogenes each and observed phenotypic expressions i.e. induction of crown galls and hairy roots. This phenotypic expression was efficaciously increased when virulence gene activity of different strains of two Agrobacterium species was enhanced. Intensive studies on enhancement of virulence gene activity of Agrobacterium found to be correlated to the appropriate light intensity (39.3 μmol m-2 s-1 with a specific concentration of monocyclic phenolic compound, acetosyringone (20 μM. The gene activity was also influenced by several other physical factors e.g. plant tissue type, Agrobacterium species and their strains, and plant tissue-Agrobacterium interaction. Among the different A. tumefaciens strains, LBA4404 showed the best virulence gene activity in both stem and petiole through the formation of higher rate of crown galls. On the other hand, strain 15834 of A. rhizogenes showed better gene activity in stem and 8196 in petiole through the formation of higher rate of hairy roots as well as higher average number of hairy roots. Among the two different types of explants, petiole was more susceptible to both Agrobacterium species. Thus it was concluded that future muskmelon transformation study can efficiently be carried out with LBA4404, 15834 and 8196 strains using petiole explants by adding 20 μM of acetosyringone in the medium.
Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds
International Nuclear Information System (INIS)
Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.
2009-01-01
Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused by these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects
Immunoglobulin gene usage in the human anti-pathogen response.
Newkirk, M M; Rioux, J D
1995-09-01
The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)
Ma, Qi-Jun; Sun, Mei-Hong; Lu, Jing; Liu, Ya-Jing; Hu, Da-Gang; Hao, Yu-Jin
2017-08-01
Sugars play important roles in plant growth and development, crop yield and quality, as well as responses to abiotic stresses. Abscisic acid (ABA) is a multifunctional hormone. However, the exact mechanism by which ABA regulates sugar accumulation is largely unknown in plants. Here, we tested the expression profile of several sugar transporter and amylase genes in response to ABA treatment. MdSUT2 and MdAREB2 were isolated and genetically transformed into apple ( Malus domestica ) to investigate their roles in ABA-induced sugar accumulation. The MdAREB2 transcription factor was found to bind to the promoters of the sugar transporter and amylase genes and activate their expression. Both MdAREB2 and MdSUT2 transgenic plants produced more soluble sugars than controls. Furthermore, MdAREB2 promoted the accumulation of sucrose and soluble sugars in an MdSUT2 -dependent manner. Our results demonstrate that the ABA-responsive transcription factor MdAREB2 directly activates the expression of amylase and sugar transporter genes to promote soluble sugar accumulation, suggesting a mechanism by which ABA regulates sugar accumulation in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Renesh Bedre
Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Directory of Open Access Journals (Sweden)
Pek Siew Lim
2016-03-01
Full Text Available T cell activation involves the recognition of a foreign antigen complexed to the major histocompatibility complex on the antigen presenting T cell to the T cell receptor. This leads to activation of signaling pathways, which ultimately leads to induction of key cytokine genes responsible for eradication of foreign antigens. We used the mouse EL4 T cell as a model system to study genes that are induced as a result of T cell activation using phorbol myristate acetate (PMA and calcium ionomycin (I as stimuli. We were also interested to examine the importance of new protein synthesis in regulating the expression of genes involved in T cell activation. Thus we have pre-treated mouse EL4 T cells with cycloheximide, a protein synthesis inhibitor, and left the cells unstimulated or stimulated with PMA/I for 4 h. We performed microarray expression profiling of these cells to correlate the gene expression with chromatin state of T cells upon T cell activation [1]. Here, we detail further information and analysis of the microarray data, which shows that T cell activation leads to differential expression of genes and inducible genes can be further classified as primary and secondary response genes based on their protein synthesis dependency. The data is available in the Gene Expression Omnibus under accession number GSE13278. Keywords: EL4 T cell, Microarray, T cell activation, Inducible genes
Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M
2014-04-16
The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.
Directory of Open Access Journals (Sweden)
Shuyi Zhang
2010-03-01
Full Text Available The ability to reside and proliferate in macrophages is characteristic of several infectious agents that are of major importance to public health, including the intracellular parasites Trypanosoma cruzi (the etiological agent of Chagas disease and Leishmania species (etiological agents of Kala-Azar and cutaneous leishmaniasis. Although recent studies have elucidated some of the ways macrophages respond to these pathogens, the relationships between activation programs elicited by these pathogens and the macrophage activation programs elicited by bacterial pathogens and cytokines have not been delineated.To provide a global perspective on the relationships between macrophage activation programs and to understand how certain pathogens circumvent them, we used transcriptional profiling by genome-wide microarray analysis to compare the responses of mouse macrophages following exposure to the intracellular parasites T. cruzi and Leishmania mexicana, the bacterial product lipopolysaccharide (LPS, and the cytokines IFNG, TNF, IFNB, IL-4, IL-10, and IL-17. We found that LPS induced a classical activation state that resembled macrophage stimulation by the Th1 cytokines IFNG and TNF. However, infection by the protozoan pathogen L. mexicana produced so few transcriptional changes that the infected macrophages were almost indistinguishable from uninfected cells. T. cruzi activated macrophages produced a transcriptional signature characterized by the induction of interferon-stimulated genes by 24 h post-infection. Despite this delayed IFN response by T. cruzi, the transcriptional response of macrophages infected by the kinetoplastid pathogens more closely resembled the transcriptional response of macrophages stimulated by the cytokines IL-4, IL-10, and IL-17 than macrophages stimulated by Th1 cytokines.This study provides global gene expression data for a diverse set of biologically significant pathogens and cytokines and identifies the relationships between
K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)
2013-01-01
textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with
E2F1 activation is responsible for pituitary adenomas induced by HMGA2 gene overexpression
Directory of Open Access Journals (Sweden)
Fusco Alfredo
2006-08-01
Full Text Available Abstract The High Mobility Group protein HMGA2 is a nuclear architectural factor that plays a critical role in a wide range of biological processes including regulation of gene expression, embryogenesis and neoplastic transformation. Several studies are trying to identify the mechanisms by which HMGA2 protein is involved in each of these activities, and only recently some new significant insights are emerging from the study of transgenic and knock-out mice. Overexpression of HMGA2 gene leads to the onset of prolactin and GH-hormone induced pituitary adenomas in mice, suggesting a critical role of this protein in pituitary tumorigenesis. This was also confirmed in the human pathology by the finding that HMGA2 amplification and/or overexpression is present in human prolactinomas. This review focuses on recent data that explain the mechanism by which HMGA2 induces the development of pituitary adenomas in mice. This mechanism entails the activation of the E2F1 protein by the HMGA2-mediated displacement of HDAC1 from pRB protein.
Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua
2014-01-01
Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.
Gene expression profiling in cells with enhanced gamma-secretase activity.
Directory of Open Access Journals (Sweden)
Alexandra I Magold
2009-09-01
Full Text Available Processing by gamma-secretase of many type-I membrane protein substrates triggers signaling cascades by releasing intracellular domains (ICDs that, following nuclear translocation, modulate the transcription of different genes regulating a diverse array of cellular and biological processes. Because the list of gamma-secretase substrates is growing quickly and this enzyme is a cancer and Alzheimer's disease therapeutic target, the mapping of gamma-secretase activity susceptible gene transcription is important for sharpening our view of specific affected genes, molecular functions and biological pathways.To identify genes and molecular functions transcriptionally affected by gamma-secretase activity, the cellular transcriptomes of Chinese hamster ovary (CHO cells with enhanced and inhibited gamma-secretase activity were analyzed and compared by cDNA microarray. The functional clustering by FatiGO of the 1,981 identified genes revealed over- and under-represented groups with multiple activities and functions. Single genes with the most pronounced transcriptional susceptibility to gamma-secretase activity were evaluated by real-time PCR. Among the 21 validated genes, the strikingly decreased transcription of PTPRG and AMN1 and increased transcription of UPP1 potentially support data on cell cycle disturbances relevant to cancer, stem cell and neurodegenerative diseases' research. The mapping of interactions of proteins encoded by the validated genes exclusively relied on evidence-based data and revealed broad effects on Wnt pathway members, including WNT3A and DVL3. Intriguingly, the transcription of TERA, a gene of unknown function, is affected by gamma-secretase activity and was significantly altered in the analyzed human Alzheimer's disease brain cortices.Investigating the effects of gamma-secretase activity on gene transcription has revealed several affected clusters of molecular functions and, more specifically, 21 genes that hold significant
Lim, Pek Siew; Hardy, Kristine; Peng, Kaiman; Shannon, Frances M
2016-03-01
T cell activation involves the recognition of a foreign antigen complexed to the major histocompatibility complex on the antigen presenting T cell to the T cell receptor. This leads to activation of signaling pathways, which ultimately leads to induction of key cytokine genes responsible for eradication of foreign antigens. We used the mouse EL4 T cell as a model system to study genes that are induced as a result of T cell activation using phorbol myristate acetate (PMA) and calcium ionomycin (I) as stimuli. We were also interested to examine the importance of new protein synthesis in regulating the expression of genes involved in T cell activation. Thus we have pre-treated mouse EL4 T cells with cycloheximide, a protein synthesis inhibitor, and left the cells unstimulated or stimulated with PMA/I for 4 h. We performed microarray expression profiling of these cells to correlate the gene expression with chromatin state of T cells upon T cell activation [1]. Here, we detail further information and analysis of the microarray data, which shows that T cell activation leads to differential expression of genes and inducible genes can be further classified as primary and secondary response genes based on their protein synthesis dependency. The data is available in the Gene Expression Omnibus under accession number GSE13278.
Regulation of the E. coli SOS response by the lexA gene product
International Nuclear Information System (INIS)
Brent, R.
1983-01-01
In an Escherichia coli that is growing normally, transcription of many genes is repressed by the product of the lexA gene. If cellular DNA is damaged, proteolytically competent recA protein (recA protease) inactivates lexA protein and these genes are induced. Many of the cellular phenomena observed during the cellular response to DNA damage (the SOS response) are the consequence of the expression of these lexA-prepressed genes. Since the SOS response of E. coli has recently been the subject of a comprehensive review, in this paper I would like to concentrate on some modifications to the picture based on new data. 12 references, 2 figures
Gene expression patterns of the coral Acropora millepora in response to contact with macroalgae
Shearer, T. L.; Rasher, D. B.; Snell, T. W.; Hay, M. E.
2012-12-01
Contact with macroalgae often causes coral mortality, but the roles of abrasion versus shading versus allelopathy in these interactions are rarely clear, and effects on gene expression are unknown. Identification of gene expression changes within corals in response to contact with macroalgae can provide insight into the mode of action of allelochemicals, as well as reveal transcriptional strategies of the coral that mitigate damage from this competitive interaction, enabling the coral to survive. Gene expression responses of the coral Acropora millepora after long-term (20 days) direct contact with macroalgae ( Chlorodesmis fastigiata, Dictyota bartayresiana, Galaxaura filamentosa, and Turbinaria conoides) and short-term (1 and 24 h) exposure to C. fastigiata thalli and their hydrophobic extract were assessed. After 20 days of exposure, T. conoides thalli elicited no significant change in visual bleaching or zooxanthellae PSII quantum yield within A. millepora nubbins, but stimulated the greatest alteration in gene expression of all treatments. Chlorodesmis fastigiata, D. bartayresiana, and G. filamentosa caused significant visual bleaching of coral nubbins and reduced the PSII quantum yield of associated zooxanthellae after 20 days, but elicited fewer changes in gene expression relative to T. conoides at day 20. To evaluate initial molecular processes leading to reduction of zooxanthella PSII quantum yield, visual bleaching, and coral death, short-term exposures to C. fastigiata thalli and hydrophobic extracts were conducted; these interactions revealed protein degradation and significant changes in catalytic and metabolic activity within 24 h of contact. These molecular responses are consistent with the hypothesis that allelopathic interactions lead to alteration of signal transduction and an imbalance between reactive oxidant species production and antioxidant capabilities within the coral holobiont. This oxidative imbalance results in rapid protein degradation
Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J
2013-05-01
Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.
Donovan, Marissa R; Marr, Michael T
2016-09-02
Maintaining protein homeostasis is critical for survival at the cellular and organismal level (Morimoto, R. I. (2011) Cold Spring Harb. Symp. Quant. Biol. 76, 91-99). Cells express a family of molecular chaperones, the heat shock proteins, during times of oxidative stress to protect against proteotoxicity. We have identified a second stress responsive transcription factor, dFOXO, that works alongside the heat shock transcription factor to activate transcription of both the small heat shock protein and the large heat shock protein genes. This expression likely protects cells from protein misfolding associated with oxidative stress. Here we identify the regions of the Hsp70 promoter essential for FOXO-dependent transcription using in vitro methods and find a physiological role for FOXO-dependent expression of heat shock proteins in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Sellathurai, Jeeva; Nielsen, Joachim; Hejbøl, Eva Kildall
2016-01-01
-PCR, immunocytochemistry and western blot. RESULTS AND CONCLUSIONS: We found an increase in proliferation rate of myoblasts when activated at a low oxygen tension (1% O2) compared to 21% O2. In addition, the gene expression studies showed up regulation of the myogenesis related genes PAX3, PAX7, MYOD, MYOG (myogenin), MET......, NCAM, DES (desmin), MEF2A, MEF2C and CDH15 (M-cadherin), however, the fraction of DES and MYOD positive cells was not increased by low oxygen tension, indicating that 1% O2 may not have a functional effect on the myogenic response. Furthermore, the expression of genes involved in the TGFβ, Notch...... and Wnt signaling pathways were also up regulated in low oxygen tension. The differences in gene expression were most pronounced at day one after activation from G0-arrest, thus the initial activation of myoblasts seemed most sensitive to changes in oxygen tension. Protein expression of HES1 and β...
Adenuga, David; Woolhiser, Michael R; Gollapudi, B Bhaskar; Boverhof, Darrell R
2012-04-01
Genomic approaches have the potential to enhance the specificity and predictive accuracy of existing toxicology endpoints, including those for chemical sensitization. The present study was conducted to determine whether gene expression responses can distinguish contact sensitizers (1-chloro-2,4-dinitrobenzene [DNCB] and hexyl cinnamic aldehyde [HCA]), respiratory sensitizers (ortho-phthalaldehyde and trimellitic anhydride [TMA]), and nonsensitizing irritants (methyl salicylate [MS] and nonanoic acid [NA]) in the local lymph node assay (LLNA). Female Balb/c mice received doses of each chemical as per the standard LLNA dosing regimen on days 1, 2, and 3. Auricular lymph nodes were analyzed for tritiated thymidine ((3)HTdR) incorporation on day 6 and for gene expression responses on days 6 and 10. All chemicals induced dose-dependent increases in stimulation index, which correlated strongly with the number of differentially expressed genes. A majority of genes modulated by the irritants were similarly altered by the sensitizers, consistent with the irritating effects of the sensitizers. However, a select number of responses involved with immune-specific functions, such as dendritic cell activation, were unique to the sensitizers and may offer the ability to distinguish sensitizers from irritants. Genes for the mast cell proteases 1 and 8, Lgals7, Tim2, Aicda, Il4, and Akr1c18 were more strongly regulated by respiratory sensitizers compared with contact sensitizers and may represent potential biomarkers for discriminating between contact and respiratory sensitizers. Collectively, these data suggest that gene expression responses may serve as useful biomarkers to distinguish between respiratory and contact sensitizers and nonsensitizing irritants in the LLNA.
Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang
2018-03-01
Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.
Directory of Open Access Journals (Sweden)
Ang Cui
Full Text Available Gene expression-based signatures help identify pathways relevant to diseases and treatments, but are challenging to construct when there is a diversity of disease mechanisms and treatments in patients with complex diseases. To overcome this challenge, we present a new application of an in silico gene expression deconvolution method, ISOpure-S1, and apply it to identify a common gene expression signature corresponding to response to treatment in 33 juvenile idiopathic arthritis (JIA patients. Using pre- and post-treatment gene expression profiles only, we found a gene expression signature that significantly correlated with a reduction in the number of joints with active arthritis, a measure of clinical outcome (Spearman rho = 0.44, p = 0.040, Bonferroni correction. This signature may be associated with a decrease in T-cells, monocytes, neutrophils and platelets. The products of most differentially expressed genes include known biomarkers for JIA such as major histocompatibility complexes and interleukins, as well as novel biomarkers including α-defensins. This method is readily applicable to expression datasets of other complex diseases to uncover shared mechanistic patterns in heterogeneous samples.
Oxytocin receptor gene variation predicts subjective responses to MDMA.
Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet
2016-12-01
3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.
Meijering, Roelien A. M.; Wiersma, Marit; van Marion, Denise M. S.; Zhang, Deli; Hoogstra-Berends, Femke; Dijkhuis, Anne-Jan; Schmidt, Martina; Wieland, Thomas; Kampinga, Harm H.; Henning, Robert H.; Brundel, Bianca J. J. M.
2015-01-01
Background The heat shock response (HSR) is an ancient and highly conserved program of stress-induced gene expression, aimed at reestablishing protein homeostasis to preserve cellular fitness. Cells that fail to activate or maintain this protective response are hypersensitive to proteotoxic stress.
Gene expression in epithelial cells in response to pneumovirus infection
Directory of Open Access Journals (Sweden)
Rosenberg Helene F
2001-05-01
Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.
Directory of Open Access Journals (Sweden)
Michelle T Juarez
2011-12-01
Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating
Directory of Open Access Journals (Sweden)
Hirata Yoko
2010-11-01
Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a
Cao, Li; Xu, Jianhong; Wu, Guang; Li, Mingxing; Jiang, Jiandong; He, Jian; Li, Shunpeng; Hong, Qing
2013-09-15
Dehalogenation is an important mechanism for degrading and detoxifying halogenated aromatics in microbes. However, the biochemical and molecular mechanisms of dehalogenation of 3,5,6-trichloro-2-pyridinol (TCP) are still unknown. In this study, a novel 6012 bp gene cluster was cloned from TCP-degrading strain P2, which was responsible for the dehalogenation of TCP. The cluster included a monooxygenase gene (tcpA1), a flavin reductase gene (tcpB1), tcpR1, orf1 and orf2. TcpA1 and TcpB1 were indispensable for the dehalogenation of TCP. They worked together to catalyze the dehalogenation of three chlorine of TCP, and generated a more readily biodegradable product of 3,6-dihydroxypyridine-2,5-dione. TcpA1 displayed the highest activity against TCP at 40°C and at pH 8.0. Cu(2+), Zn(2+), and Hg(2+) significantly inhibited enzyme activity. To the best of our knowledge, this is the first report on a gene cluster responsible for TCP degradation. Copyright © 2013 Elsevier B.V. All rights reserved.
A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury
International Nuclear Information System (INIS)
Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya
1997-01-01
Purpose: The intracellular adhesion molecule (ICAM-1) binds and activates inflammatory cells and thereby contributes to the pathogenesis of tissue injury. To characterize a model for radiation-induction of tissue injury, we studied radiation-mediated lung injury in mice deficient in the ICAM-1 gene. To study the mechanisms of x-ray mediated ICAM induction, we studied transcriptional activation of the ICAM promoter and nuclear protein binding to the 5' untranslated region of the ICAM gene. Methods: Immunohistochemistry and immunofluorescence were used to study the histologic pattern of ICAM expression in irradiated tissue. The ICAM-1 knockout mice were bred with wild type mice to create heterozygous mice with attenuated ICAM expression. ICAM -/-, ICAM+/- and ICAM +/+ mice were treated with thoracic irradiation and lung sections were stained for leukocyte common antigen (CD45) to study inflammation. To study the mechanism of x-ray induction of ICAM, we linked the 5' untranslated region of the ICAM gene to the luciferase reporter gene and delated DNA segments from the promoter to determine which elements are required for induction. We performed electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells to study transcription factor activation. Results: Immunohistochemistry showed dose and time dependent increases in ICAM protein expression in irradiated lungs which was prolonged as compared to endothelial cells in vitro. The histologic pattern of ICAM expression was in the capillary endothelium and was distinct from the pattern of expression of other radiation-inducible adhesion molecules. ICAM knockout mice had no ICAM expression and no inflammatory cell accumulation in the irradiated lung. ICAM+/+ mice developed leukocyte adhesion to irradiated endothelium within hours of irradiation and radiation pneumonitis 5 to 6 weeks later. The DNA sequence between -981 and -769 (relative to start codon) contains two 16-base pair repeats, each
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang
2013-11-01
Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.
Gene expression in IFN-g-activated murine macrophages
Directory of Open Access Journals (Sweden)
Pereira C.A.
2004-01-01
Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.
Directory of Open Access Journals (Sweden)
Antonia Y. Tetteh
2014-01-01
Full Text Available Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se0, but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3 treatment and then used quantitative real-time PCR (qRT-PCR to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Yazaki, Junshi; Kikuchi, Shoshi
2005-01-01
We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.
International Nuclear Information System (INIS)
Vadas, M.A.
1982-01-01
A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy
Directory of Open Access Journals (Sweden)
Amanda Swain
2016-09-01
Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.
Immunomodulatory activity of andrographolide on macrophage activation and specific antibody response
Wang, Wei; Wang, Jing; Dong, Sheng-fu; Liu, Chun-hong; Italiani, Paola; Sun, Shu-hui; Xu, Jing; Boraschi, Diana; Ma, Shi-ping; Qu, Di
2010-01-01
Aim: To investigate the immunomodulatory effects of andrographolide on both innate and adaptive immune responses. Methods: Andrographolide (10 μg/mL in vitro or 1 mg/kg in vivo) was used to modulate LPS-induced classical activated (M1) or IL-4-induced alternative activated (M2) macrophages in vitro and humor immune response to HBsAg in vivo. Cytokine gene expression profile (M1 vs M2) was measured by real-time PCR, IL-12/IL-10 level was detected by ELISA, and surface antigen expression was evaluated by flow cytometry, whereas phosphorylation level of ERK 1/2 and AKT was determined by Western blot. The level of anti-HBs antibodies in HBsAg immunized mice was detected by ELISA, and the number of HBsAg specific IL-4-producing splenocyte was enumerated by ELISPOT. Results: Andrographolide treatment in vitro attenuated either LPS or IL-4 induced macrophage activation, inhibited both M1 and M2 cytokines expression and decreased IL-12/IL-10 ratio (the ratio of M1/M2 polarization). Andrographolide down-regulated the expression of mannose receptor (CD206) in IL-4 induced macrophages and major histocompability complex/costimulatory molecules (MHC I, CD40, CD80, CD86) in LPS-induced macrophages. Correspondingly, anti-HBs antibody production and the number of IL-4-producing splenocytes were reduced by in vivo administration of andrographolide. Reduced phosphorylation levels of ERK1/2 and AKT were observed in macrophages treated with andrographolide. Conclusion: Andrographolide can modulate the innate and adaptive immune responses by regulating macrophage phenotypic polarization and Ag-specific antibody production. MAPK and PI3K signaling pathways may participate in the mechanisms of andrographolide regulating macrophage activation and polarization. PMID:20139902
Directory of Open Access Journals (Sweden)
Kristian Ovaska
Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.
A core filamentation response network in Candida albicans is restricted to eight genes.
Directory of Open Access Journals (Sweden)
Ronny Martin
Full Text Available Although morphological plasticity is a central virulence trait of Candida albicans, the number of filament-associated genes and the interplay of mechanisms regulating their expression remain unknown. By correlation-based network modeling of the transcriptional response to different defined external stimuli for morphogenesis we identified a set of eight genes with highly correlated expression patterns, forming a core filamentation response. This group of genes included ALS3, ECE1, HGT2, HWP1, IHD1 and RBT1 which are known or supposed to encode for cell- wall associated proteins as well as the Rac1 guanine nucleotide exchange factor encoding gene DCK1 and the unknown function open reading frame orf19.2457. The validity of network modeling was confirmed using a dataset of advanced complexity that describes the transcriptional response of C. albicans during epithelial invasion as well as comparing our results with other previously published transcriptome studies. Although the set of core filamentation response genes was quite small, several transcriptional regulators are involved in the control of their expression, depending on the environmental condition.
Gene Transfer in Eukaryotic Cells Using Activated Dendrimers
Dennig, Jörg
Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.
A rice gene of de novo origin negatively regulates pathogen-induced defense response.
Directory of Open Access Journals (Sweden)
Wenfei Xiao
Full Text Available How defense genes originated with the evolution of their specific pathogen-responsive traits remains an important problem. It is generally known that a form of duplication can generate new genes, suggesting that a new gene usually evolves from an ancestral gene. However, we show that a new defense gene in plants may evolve by de novo origination, resulting in sophisticated disease-resistant functions in rice. Analyses of gene evolution showed that this new gene, OsDR10, had homologs only in the closest relative, Leersia genus, but not other subfamilies of the grass family; therefore, it is a rice tribe-specific gene that may have originated de novo in the tribe. We further show that this gene may evolve a highly conservative rice-specific function that contributes to the regulation difference between rice and other plant species in response to pathogen infections. Biologic analyses including gene silencing, pathologic analysis, and mutant characterization by transformation showed that the OsDR10-suppressed plants enhanced resistance to a broad spectrum of Xanthomonas oryzae pv. oryzae strains, which cause bacterial blight disease. This enhanced disease resistance was accompanied by increased accumulation of endogenous salicylic acid (SA and suppressed accumulation of endogenous jasmonic acid (JA as well as modified expression of a subset of defense-responsive genes functioning both upstream and downstream of SA and JA. These data and analyses provide fresh insights into the new biologic and evolutionary processes of a de novo gene recruited rapidly.
Acute toxicity and gene responses induced by endosulfan in zebrafish (Danio rerio embryos
Directory of Open Access Journals (Sweden)
Young-Sun Moon
2016-10-01
Full Text Available Endosulfan has been listed as a persistent organic pollutant, and is frequently found in agricultural environments during monitoring processes owing to its heavy use and persistent characteristics. This study was conducted to understand the effects of endosulfan on the development of zebrafish (Danio rerio embryos by exposing them to a specific range of endosulfan concentrations. Exposing zebrafish embryos to endosulfan for 96 h yielded no acute toxicity until the concentration reached 1500 μg L−1, whereas malformed zebrafish larvae developed severely curved spines and shortened tails. About 50% of zebrafish larvae were malformed when exposed to 600 μg L−1 of endosulfan. Comparative gene expression using real-time quantitative polymerase chain reaction was assessed using endosulfan-exposed zebrafish embryos. CYP1A and CYP3A were significantly enhanced in response to endosulfan treatment. Two genes, acacb and fasn, encoding acetyl-CoA carboxylase b and fatty acid synthase proteins, respectively, were also up-regulated after treating zebrafish embryos with endosulfan. These genes are also involved in fatty acid biosynthesis. The genes encoding vitellogenin and Hsp70 increased in a concentration-dependent manner in embryos. Finally, biochemical studies showed that acetylcholinesterase activity was reduced, whereas glutathione S-transferase and carboxylesterase activities were enhanced in zebrafish embryos after endosulfan treatment. These biochemical and molecular biological differences might be used for tools to determine contamination of endosulfan in the aquatic environment.
Directory of Open Access Journals (Sweden)
Paola De Feudis
2000-05-01
Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.
Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome
Directory of Open Access Journals (Sweden)
Tai Dessmon
2005-01-01
Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario
2017-04-01
Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are
Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes
Directory of Open Access Journals (Sweden)
Siré Christelle
2008-03-01
Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and
Mucosal CCR1 gene expression as a marker of molecular activity in Crohn's disease: preliminary data.
Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Ţieranu, Eugen Nicolae; Popa, Caterina; Mănuc, Mircea; Preda, Carmen Monica; Ţieranu, Ioana; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel
2017-01-01
A series of mechanisms of immune response, inflammation and apoptosis have been demonstrated to contribute to the appearance and evolution of Crohn's disease (CD) through the overexpression of several cytokines and chemokines in a susceptible host. The aim of this study was to identify the differences in gene expression profiles analyzing a panel of candidate genes in the mucosa from patients with active CD (CD-A), patients in remission (CD-R), and normal controls. Nine individuals were enrolled in the study: six CD patients (three with active lesions, three with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression levels of 84 genes previously associated with CD were evaluated by polymerase chain reaction (PCR) array. Ten genes out of 84 were found significantly differentially expressed in CD-A (CCL11, CCL25, DEFA5, GCG, IL17A, LCN2, REG1A, STAT3, MUC1, CCR1) and eight genes in CD-R (CASP1, IL23A, STAT1, STAT3, TNF, CCR1, CCL5, and HSP90B1) when compared to controls. A quantitative gene expression analysis revealed that CCR1 gene was more expressed in CD-A than in CD-R. Our data suggest that CCR1 gene may be a putative marker of molecular activity of Crohn's disease. Following these preliminary data, a confirmation in larger cohort studies could represent a useful method in order to identify new therapeutic targets.
MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).
He, Qiuling; Zhu, Shuijin; Zhang, Baohong
2014-09-01
MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.
The landscape of human genes involved in the immune response to parasitic worms
Directory of Open Access Journals (Sweden)
Fumagalli Matteo
2010-08-01
Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.
Small molecule antagonism of oxysterol-induced Epstein-Barr virus induced gene 2 (EBI2) activation
DEFF Research Database (Denmark)
Benned-Jensen, Tau; Madsen, Christian M; Arfelt, Kristine N
2013-01-01
The Epstein-Barr virus induced gene 2 (EBI2) was recently identified as the first oxysterol-activated 7TM receptor. EBI2 is essential for B cell trafficking within lymphoid tissues and thus the humoral immune response in general. Here we characterize the antagonism of the non-peptide molecule GSK...
Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru
2016-03-02
hormone marker genes identified in this study will be useful to plant pathologists who use Brachypodium as a model pathosystem, because the timing of their transcriptional activation matches that of the disease resistance response. Our results using Brachypodium also suggest that monocots share a characteristic immune system, defined as the common defence system, that is different from that of dicots.
Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua
2015-05-01
Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; Castro Junior, Gilberto de
2015-01-01
Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC.
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; de Castro, Gilberto
2015-01-01
Abstract Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC. PMID:26398757
2017-02-01
affecting the function of Fanconi Anemia (FA) genes ( FANCA /B/C/D2/E/F/G/I/J/L/M, PALB2) or DNA damage response genes involved in HR 5 (ATM, ATR...Award Number: W81XWH-10-1-0585 TITLE: A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors...To) 15 July 2010 – 2 Nov.2016 4. TITLE AND SUBTITLE A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP
Gene activated by growth factors is related to the oncogene v-jun
International Nuclear Information System (INIS)
Ryder, K.; Lau, L.F.; Nathans, D.
1988-01-01
The authors have recently identified by cDNA cloning a set of genes that are rapidly activated in cultured mouse cells by protein growth factors. Here they report that the nucleotide sequence of a cDNA (clone 465) derived from one of these immediate early genes (hereafter called jun-B) encodes a protein homologous to that encoded by the avian sarcoma virus 17 oncogene v-jun. Homology between the jun-B and v-jun proteins is in two regions: one near the N terminus and the other at the C terminus. The latter sequence was shown to have regions of sequence similarity to the DNA-binding domain of the yeast transcriptional regulatory protein GCN4 and to the oncogenic protein fos. Southern blots of human, mouse, and chicken DNA demonstrate that jun-B and c-jun are different genes and that there may be other vertebrate genes related to jun-B and c-jun. These findings suggest that there is a jun family of genes encoding related transcriptional regulatory proteins. The jun-B protein, and perhaps other members of the jun family, may play a role in regulating the genomic response to growth factors
Differential response of two somatolactin genes to zinc or estrogen in pituitary of Cyprinus carpio.
Valenzuela, G E; Perez, A; Navarro, M; Romero, A; Figueroa, J; Kausel, G
2015-05-01
Environmental changes affect gene expression that we addressed in the pituitary, a central regulatory organ at the interface between the central nervous system and the endocrine system. With the aim to reveal effects of changes in the aquatic environment on the expression of hypothalamo-hypophyseal factors, we characterized somatolactin (SL) in Cyprinus carpio. SL, a fish specific pituitary hormone belonging to the prolactin (PRL) superfamily, is involved in background adaptation, osmoregulation, reproduction and fatty acid metabolism. Two sl genes, α and β, were discovered in carp and transcripts of both were detected in pituitaries. Clearly, expression of slα and slβ was modulated significantly in pituitary of male adult carp in response to treatment with ZnCl2 (Zn), but only slβ responded to 17β-estrogen (E2), relative to control carp as shown by RT-qPCR analyses. Furthermore, the amount of mRNA of related factors was assessed revealing variable effects on prl, growth hormone (gh), and factors involved in sl regulation: the pituitary transcription factor pit1 and hypothalamic pituitary adenylase cyclase activating peptide (pacap). In parallel, the physiological response of the experimental animals to Zn or E2 was confirmed by showing a significant increase of metallothionein (mt) or vitellogenin (vg) gene expression in liver, classical sentinels for exposure to heavy metal or estrogens. These data suggest that the sl genes seem to be involved in the response to Zn, as well as to estrogen, and could contribute to evaluate biological relevant changes in the aquatic environment. Copyright © 2014 Elsevier Inc. All rights reserved.
Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S
2005-07-15
A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.
Directory of Open Access Journals (Sweden)
Hai-Ting Hao
Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response
Zheng, Lei; Lytle, Christian; Njauw, Ching-Ni; Altstein, Miriam; Martins-Green, Manuela
2007-05-15
In noctuid moths cuticular pigmentation is regulated by the pyrokinin/pheromone biosynthesis activating neuropeptide (PK/PBAN) family, which also mediates a variety of other functions in moths and other insects. Numerous studies have shown that these neuropeptides exert their functions through activation of the PBAN receptor (PBAN-R), with subsequent Ca(2+) influx, followed by either activation of cAMP or direct activation of downstream kinases. Recently, several PBAN-Rs have been identified, all of which are from the pheromone gland of adult female moths, but evidence shows that functional PK/PBAN-Rs can also be expressed in insect larvae, where they mediate melanization and possibly other functions (e.g., diapause). Here, we identified a gene encoding a G-protein-coupled receptor from the 5th instar larval tissue of the moth Spodoptera littoralis. The cDNA of this gene contains an open reading frame with a length of 1050 nucleotides, which translates to a 350-amino acid, 42-kDa protein that shares 92% amino acid identity with Helicoverpa zea and Helicoverpa armigera PBAN-R, 81% with Bombyx mori PBAN-R and 72% with Plutella xylostella PBAN-R. The S. littoralis PBAN-R gene was stably expressed in NIH3T3 cells and transiently in HEK293 cells. We show that it mediates the dose-dependent PBAN-induced intracellular Ca(2+) response and activation of the MAP kinase via a PKC-dependent but Galphai-independent signaling mechanism. Other PK/PBAN family peptides (pheromonotropin and a C-terminally PBAN-derived peptide PBAN(28-33)NH(2)) also triggered MAP kinase activation. This receptor, together with the previously cloned PBAN-R, may facilitate our understanding of the cell-specific responses and functional diversities of this diverse neuropeptide family.
Wang, X Q; Liu, A X; Guerrero, A; Liu, J; Yu, X Q; Deng, P; Ma, L; Baird, S M; Smith, L; Li, X D; Lu, S E
2016-03-01
To identify the taxonomy of tobacco rhizosphere-isolated strain Lyc2 and investigate the mechanisms of the antifungal activities, focusing on antimicrobials gene clusters identification and function analysis. Multilocus sequence typing and 16S rRNA analyses indicated that strain Lyc2 belongs to Burkholderia pyrrocinia. Bioassay results indicated strain Lyc2 showed significant antifungal activities against a broad range of plant and animal fungal pathogens and control efficacy on seedling damping off disease of cotton. A 55·2-kb gene cluster which was homologous to ocf gene clusters in Burkholderia contaminans MS14 was confirmed to be responsible for antifungal activities by random mutagenesis; HPLC was used to verify the production of antifungal compounds. Multiple antibiotic and secondary metabolized biosynthesis gene clusters predicated by antiSMASH revealed the broad spectrum of antimicrobials activities of the strain. Our results revealed the mechanisms of antifungal activities of strain Lyc2 and expand our knowledge about production of occidiofungin in the bacteria Burkholderia. Understanding the mechanisms of antifungal activities of strain Lyc2 has contributed to discovery of new antibiotics and expand our knowledge of production of occidiofungin in the bacteria Burkholderia. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Sonia Podvin
Full Text Available By virtue of its ability to regulate the composition of cerebrospinal fluid (CSF, the choroid plexus (CP is ideally suited to instigate a rapid response to traumatic brain injury (TBI by producing growth regulatory proteins. For example, Esophageal Cancer Related Gene-4 (Ecrg4 is a tumor suppressor gene that encodes a hormone-like peptide called augurin that is present in large concentrations in CP epithelia (CPe. Because augurin is thought to regulate senescence, neuroprogenitor cell growth and differentiation in the CNS, we evaluated the kinetics of Ecrg4 expression and augurin immunoreactivity in CPe after CNS injury. Adult rats were injured with a penetrating cortical lesion and alterations in augurin immunoreactivity were examined by immunohistochemistry. Ecrg4 gene expression was characterized by in situ hybridization. Cell surface augurin was identified histologically by confocal microscopy and biochemically by sub-cellular fractionation. Both Ecrg4 gene expression and augurin protein levels were decreased 24-72 hrs post-injury but restored to uninjured levels by day 7 post-injury. Protein staining in the supraoptic nucleus of the hypothalamus, used as a control brain region, did not show a decrease of auguin immunoreactivity. Ecrg4 gene expression localized to CPe cells, and augurin protein to the CPe ventricular face. Extracellular cell surface tethering of 14 kDa augurin was confirmed by cell surface fractionation of primary human CPe cells in vitro while a 6-8 kDa fragment of augurin was detected in conditioned media, indicating release from the cell surface by proteolytic processing. In rat CSF however, 14 kDa augurin was detected. We hypothesize the initial release and proteolytic processing of augurin participates in the activation phase of injury while sustained Ecrg4 down-regulation is dysinhibitory during the proliferative phase. Accordingly, augurin would play a constitutive inhibitory function in normal CNS while down
Leighton, Laura J; Zhao, Qiongyi; Li, Xiang; Dai, Chuanyang; Marshall, Paul R; Liu, Sha; Wang, Yi; Zajaczkowski, Esmi L; Khandelwal, Nitin; Kumar, Arvind; Bredy, Timothy W; Wei, Wei
2018-01-15
Epigenetic regulation of activity-induced gene expression involves multiple levels of molecular interaction, including histone and DNA modifications, as well as mechanisms of DNA repair. Here we demonstrate that the genome-wide deposition of inhibitor of growth family member 1 (ING1), which is a central epigenetic regulatory protein, is dynamically regulated in response to activity in primary cortical neurons. ING1 knockdown leads to decreased expression of genes related to synaptic plasticity, including the regulatory subunit of calcineurin, Ppp3r1. In addition, ING1 binding at a site upstream of the transcription start site (TSS) of Ppp3r1 depends on yet another group of neuroepigenetic regulatory proteins, the Piwi-like family, which are also involved in DNA repair. These findings provide new insight into a novel mode of activity-induced gene expression, which involves the interaction between different epigenetic regulatory mechanisms traditionally associated with gene repression and DNA repair. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kehua Wang
2017-06-01
Full Text Available Perennial ryegrass (Lolium perenne is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants.
Gersbach, Charles A; Perez-Pinera, Pablo
2014-08-01
New technologies have recently been developed to control the expression of human genes in their native genomic context by engineering synthetic transcription factors that can be targeted to any DNA sequence. The ability to precisely regulate any gene as it occurs naturally in the genome provides a means to address a variety of diseases and disorders. This approach also circumvents some of the traditional challenges of gene therapy. In this editorial, we review the technologies that have enabled targeted human gene activation, including the engineering of transcription factors based on zinc finger proteins, transcription activator-like effectors and the CRISPR/Cas9 system. Additionally, we highlight examples in which these methods have been developed for therapeutic applications and discuss challenges and opportunities.
Snapshot of iron response in Shewanella oneidensis by gene network reconstruction
Energy Technology Data Exchange (ETDEWEB)
Yang, Yunfeng; Harris, Daniel P.; Luo, Feng; Xiong, Wenlu; Joachimiak, Marcin; Wu, Liyou; Dehal, Paramvir; Jacobsen, Janet; Yang, Zamin; Palumbo, Anthony V.; Arkin, Adam P.; Zhou, Jizhong
2008-10-09
Background: Iron homeostasis of Shewanella oneidensis, a gamma-proteobacterium possessing high iron content, is regulated by a global transcription factor Fur. However, knowledge is incomplete about other biological pathways that respond to changes in iron concentration, as well as details of the responses. In this work, we integrate physiological, transcriptomics and genetic approaches to delineate the iron response of S. oneidensis. Results: We show that the iron response in S. oneidensis is a rapid process. Temporal gene expression profiles were examined for iron depletion and repletion, and a gene co-expression network was reconstructed. Modules of iron acquisition systems, anaerobic energy metabolism and protein degradation were the most noteworthy in the gene network. Bioinformatics analyses suggested that genes in each of the modules might be regulated by DNA-binding proteins Fur, CRP and RpoH, respectively. Closer inspection of these modules revealed a transcriptional regulator (SO2426) involved in iron acquisition and ten transcriptional factors involved in anaerobic energy metabolism. Selected genes in the network were analyzed by genetic studies. Disruption of genes encoding a putative alcaligin biosynthesis protein (SO3032) and a gene previously implicated in protein degradation (SO2017) led to severe growth deficiency under iron depletion conditions. Disruption of a novel transcriptional factor (SO1415) caused deficiency in both anaerobic iron reduction and growth with thiosulfate or TMAO as an electronic acceptor, suggesting that SO1415 is required for specific branches of anaerobic energy metabolism pathways. Conclusions: Using a reconstructed gene network, we identified major biological pathways that were differentially expressed during iron depletion and repletion. Genetic studies not only demonstrated the importance of iron acquisition and protein degradation for iron depletion, but also characterized a novel transcriptional factor (SO1415) with a
Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid
International Nuclear Information System (INIS)
Pi Jingbo; Zhang Qiang; Woods, Courtney G.; Wong, Victoria; Collins, Sheila; Andersen, Melvin E.
2008-01-01
Hypochlorous acid (HOCl), a potent oxidant generated when chlorine gas reacts with water, is important in the pathogenesis of many disorders. Transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism that serves to maintain intracellular redox homeostasis and limit oxidative damage. In the present study, the effect of HOCl on Nrf2 activation was investigated in macrophages, one of the target cells of chlorine gas exposure. Exposure of RAW 264.7 macrophages to HOCl resulted in increased protein levels of Nrf2 in nuclear extractions, as well as a time- and dose-dependent increase in the expression of Nrf2 target genes, including heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 (NQO-1), glutamate cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GS). Additionally, intracellular glutathione (GSH), which is the prime scavenger for HOCl in cells, decreased within the first hour of HOCl exposure. The decline was followed by a GSH rebound that surpassed the initial basal levels by up to 4-fold. This reversal in GSH levels closely correlated with the gene expression profile of GCLC and GS. To study the mechanisms of Nrf2 activation in response to HOCl exposure, we examined the effects of several antioxidants on Nrf2-mediated response. Pretreatment with cell-permeable catalase, N-acetyl-L-cysteine or GSH-monoethyl ester markedly reduced expression of NQO-1 and GCLC under HOCl challenge conditions, suggesting intracellular ROS-scavenging capacity affects HOCl-induced Nrf2 activation. Importantly, pre-activation of Nrf2 with low concentrations of pro-oxidants protected the cells against HOCl-induced cell damage. Taken together, we provide direct evidence that HOCl activates Nrf2-mediated antioxidant response, which protects cells from oxidative damage
Haines, Mackenzie; McKinley-Barnard, Sarah K; Andre, Thomas L; Gann, Josh J; Hwang, Paul S; Willoughby, Darryn S
2018-03-01
This study sought to determine if the differences in serum estradiol we have previously observed to occur during the mid-follicular (MF) and mid-luteal (ML) phases of the female menstrual cycle could be attributed to estrogen-induced receptor activation and subsequent effects on myogenic-related genes which may otherwise impact muscle regeneration in response to eccentric exercise. Twenty-two physically-active females (20.9 ± 1.4 years, 63.5 ± 9.0 kg, 1.65 ± 0.08 m) underwent an eccentric exercise bout of the knee extensors during the MF and ML phases of their 28-day menstrual cycle. Prior to (PRE), at 6 (6HRPOST), and 24 (24HRPOST) hours post-exercise for each session, participants had muscle biopsies obtained. Skeletal muscle estradiol and estrogen receptor-α (ER-α) content and ER-DNA binding were determined with ELISA. Real-time PCR was used to assess ER-α, Myo-D, and cyclin D1 mRNA expression. Data were analyzed utilizing a 2 x 3 repeated measures univariate analyses of variance (ANOVA) for each criterion variable (p ≤ .05). Skeletal muscle estradiol levels were not significantly impacted by either menstrual phase (p > 0.05); however, both ER-α mRNA and protein were significantly increased during MF (p < 0.05). ER-DNA binding and Myo-D mRNA expression increased significantly in both menstrual phases in response to exercise but were not different from one another; however, cyclin D1 mRNA expression was significantly greater during MF. This study demonstrates that skeletal muscle ER-α activation in response to eccentric exercise up-regulates myogenic-related gene expression independent of serum estradiol levels occurring during the human menstrual cycle.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids
Virulent Type A Francisella tularensis actively suppresses cytokine responses in human monocytes
Gillette, Devyn D.; Curry, Heather M.; Cremer, Thomas; Ravneberg, David; Fatehchand, Kavin; Shah, Prexy A.; Wewers, Mark D.; Schlesinger, Larry S.; Butchar, Jonathan P.; Tridandapani, Susheela; Gavrilin, Mikhail A.
2014-01-01
Background: Human monocyte inflammatory responses differ between virulent and attenuated Francisella infection. Results: A mixed infection model showed that the virulent F. tularensis Schu S4 can attenuate inflammatory cytokine responses to the less virulent F. novicida in human monocytes. Conclusion: F. tularensis dampens inflammatory response by an active process. Significance: This suppression may contribute to enhanced pathogenicity of F. tularensis. Francisella tularensis is a Gram-negative facultative bacterium that can cause the disease tularemia, even upon exposure to low numbers of bacteria. One critical characteristic of Francisella is its ability to dampen or subvert the host immune response. Previous work has shown that monocytes infected with highly virulent F. tularensis subsp. tularensis strain Schu S4 responded with a general pattern of quantitatively reduced pro-inflammatory signaling pathway genes and cytokine production in comparison to those infected with the less virulent related F. novicida. However, it has been unclear whether the virulent Schu S4 was merely evading or actively suppressing monocyte responses. By using mixed infection assays with F. tularensis and F. novicida, we show that F. tularensis actively suppresses monocyte pro-inflammatory responses. Additional experiments show that this suppression occurs in a dose-dependent manner and is dependent upon the viability of F. tularensis. Importantly, F. tularensis was able to suppress pro-inflammatory responses to earlier infections with F. novicida. These results lend support that F. tularensis actively dampens human monocyte responses and this likely contributes to its enhanced pathogenicity. PMID:24783062
Virulent Type A Francisella tularensis actively suppresses cytokine responses in human monocytes
Directory of Open Access Journals (Sweden)
Devyn D Gilette
2014-04-01
Full Text Available Francisella tularensis is a Gram-negative facultative bacterium that can cause the disease tularemia, even upon exposure to low numbers of bacteria. One critical characteristic of Francisella is its ability to dampen or subvert the host immune response. Previous work has shown that monocytes infected with highly virulent F. tularensis subsp. tularensis strain Schu S4 responded with a general pattern of quantitatively reduced pro-inflammatory signaling pathway genes and cytokine production in comparison to those infected with the less virulent related F. novicida. However, it has been unclear whether the virulent Schu S4 was merely evading or actively suppressing monocyte responses. By using mixed infection assays with F. tularensis and F. novicida, we show that F. tularensis actively suppresses monocyte pro-inflammatory responses. Additional experiments show that this suppression occurs in a dose-dependent manner and is dependent upon the viability of F. tularensis. Importantly, F. tularensis was able to suppress pro-inflammatory responses to earlier infections with F. novicida. These results lend support that F. tularensis actively dampens human monocyte responses and this likely contributes to its enhanced pathogenicity.
Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.
Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M
2013-03-28
Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data
DEFF Research Database (Denmark)
Kannan, Soumya; Sams, Thomas; Maury, Jérôme
2018-01-01
activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...
Cheng, Xiao-Yu; Li, Yang-Yang; Huang, Cheng; Li, Jun; Yao, Hong-Wei
2017-04-04
Current drug therapy fails to reduce lung destruction of chronic obstructive pulmonary disease (COPD). AMP-activated protein kinase (AMPK) has emerged as an important integrator of signals that control energy balance and lipid metabolism. However, there are no studies regarding the role of AMPK in reducing inflammatory responses and cellular senescence during the development of emphysema. Therefore, we hypothesize that AMPK reduces inflammatroy responses, senescence, and lung injury. To test this hypothesis, human bronchial epithelial cells (BEAS-2B) and small airway epithelial cells (SAECs) were treated with cigarette smoke extract (CSE) in the presence of a specific AMPK activator (AICAR, 1 mM) and inhibitor (Compound C, 5 μM). Elastase injection was performed to induce mouse emphysema, and these mice were treated with a specific AMPK activator metformin as well as Compound C. AICAR reduced, whereas Compound C increased CSE-induced increase in IL-8 and IL-6 release and expression of genes involved in cellular senescence. Knockdown of AMPKα1/α2 increased expression of pro-senescent genes (e.g., p16, p21, and p66shc) in BEAS-2B cells. Prophylactic administration of an AMPK activator metformin (50 and 250 mg/kg) reduced while Compound C (4 and 20 mg/kg) aggravated elastase-induced airspace enlargement, inflammatory responses and cellular senescence in mice. This is in agreement with therapeutic effect of metformin (50 mg/kg) on airspace enlargement. Furthermore, metformin prophylactically protected against but Compound C further reduced mitochondrial proteins SOD2 and SIRT3 in emphysematous lungs. In conclusion, AMPK reduces abnormal inflammatory responses and cellular senescence, which implicates as a potential therapeutic target for COPD/emphysema.
The 'warrior gene' and the Mãori people: the responsibility of the geneticists.
Perbal, Laurence
2013-09-01
The 'gene of' is a teleosemantic expression that conveys a simplistic and linear relationship between a gene and a phenotype. Throughout the 20th century, geneticists studied these genes of traits. The studies were often polemical when they concerned human traits: the 'crime gene', 'poverty gene', 'IQ gene', 'gay gene' or 'gene of alcoholism'. Quite recently, a controversy occurred in 2006 in New Zealand that started with the claim that a 'warrior gene' exists in the Mãori community. This claim came from a geneticist working on the MAOA gene. This article is interested in the responsibility of that researcher regarding the origin of the controversy. Several errors were made: overestimation of results, abusive use of the 'gene of' kind of expression, poor communication with the media and a lack of scientific culture. The issues of the debate were not taken into account sufficiently, either from the political, social, ethical or even the genetic points of view. After more than 100 years of debates around 'genes of' all kinds (here, the 'warrior gene'), geneticists may not hide themselves behind the media when a controversy occurs. Responsibilities have to be assumed. © 2012 John Wiley & Sons Ltd.
Expression analysis of MYC genes from Tamarix hispida in response to different abiotic stresses.
Ji, Xiaoyu; Wang, Yucheng; Liu, Guifeng
2012-01-01
The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA)-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT)-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.
Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.
Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi
2018-01-01
The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.
Shen, Congxiang; Liu, Yanhui; Wen, Zhong; Yang, Keke; Li, Guanxue; Zhang, Shenhua; Zhang, Xinyu
2015-06-23
To explore the influence and mechanism of PinX1 gene on the chemotherapy sensitivity of nasopharyngeal carcinoma cells in response to Cisplatin. Transfected nasopharyngeal carcinoma 5-8F cell lines with pCDH-CMV-PinX1-copGFP vector constructed by lentivirus to generate Lenti-PinX1-5-8F cells containing PinX1 gene, using Lenti-Ctrl-5-8F cell (blank vector without PinX1 gene was used to transfect 5-8F cell lines) and 5-8F cell as controls. Expression of PinX1 gene, telomerase activity, the inhibition of cancer cells proliferation, combined anticancer effect with Cisplatin and the expression of lung resistance protein (LRP) and Bcl-2 were detected with fluorescent quantitation polymerase chain reaction (PCR), flow cytometry, thiazolyl blue (MTT) method, areole test, Western blot and drug sensitivity test, respectively, in four groups (Lenti-PinX1-5-8F cell + Cisplatin, Lenti-PinX1-5-8F cell, Cisplatin and 5-8F cell) so as to explore the influence and mechanism of PinX1 gene on the chemotherapy sensitivity of nasopharyngeal carcinoma cells in response to Cisplatin. The telomerase activity in Lenti-PinX1-5-8F cell (0.146 ± 0.004) was lower than those in the other two control cells (Lenti-Ctrl-5-8F cell: 0.967 ± 0.016, 5-8F cell: 1.000 ± 0.034, both P Cisplatin after lower level telomerase activity induced by PinX1 gene. Proliferation index (PI) (%) in Lenti-PinX1-5-8F cell + Cisplatin (14.39 ± 3.66) was also less than the other groups (Lenti-PinX1-5-8F cell, Cisplatin and 5-8F cell groups, 32.97 ± 3.00, 31.18 ± 4.24 and 47.19 ± 4.19, all P Cisplatin, which may be mediated by the down-regulation of telomerase activity and the inhibition of LRP and Bcl-2 gene in nasopharyngeal carcinoma cells.
Directory of Open Access Journals (Sweden)
Shinsuke Kido
Full Text Available BACKGROUND: Mechanical stress rapidly induces ΔFosB expression in osteoblasts, which binds to interleukin (IL-11 gene promoter to enhance IL-11 expression, and IL-11 enhances osteoblast differentiation. Because bone morphogenetic proteins (BMPs also stimulate IL-11 expression in osteoblasts, there is a possibility that BMP-Smad signaling is involved in the enhancement of osteoblast differentiation by mechanical stress. The present study was undertaken to clarify whether mechanical stress affects BMP-Smad signaling, and if so, to elucidate the role of Smad signaling in mechanical stress-induced enhancement of IL-11 gene transcription. METHODOLOGY/PRINCIPAL FINDINGS: Mechanical loading by fluid shear stress (FSS induced phosphorylation of BMP-specific receptor-regulated Smads (BR-Smads, Smad1/5, in murine primary osteoblasts (mPOBs. FSS rapidly phosphorylated Y311 of protein kinase C (PKCδ, and phosphorylated PKCδ interacted with BR-Smads to phosphorylate BR-Smads. Transfection of PKCδ siRNA or Y311F mutant PKCδ abrogated BR-Smads phosphorylation and suppressed IL-11 gene transcription enhanced by FSS. Activated BR-Smads bound to the Smad-binding element (SBE of IL-11 gene promoter and formed complex with ΔFosB/JunD heterodimer via binding to the C-terminal region of JunD. Site-directed mutagenesis in the SBE and the AP-1 site revealed that both SBE and AP-1 sites were required for full activation of IL-11 gene promoter by FSS. CONCLUSIONS/SIGNIFICANCE: These results demonstrate that PKCδ-BR-Smads pathway plays an important role in the intracellular signaling in response to mechanical stress, and that a cross-talk between PKCδ-BR-Smads and ΔFosB/JunD pathways synergistically stimulates IL-11 gene transcription in response to mechanical stress.
DEFF Research Database (Denmark)
Christensen, Jan Pravsgaard; Marker, O; Thomsen, Allan Randrup
1994-01-01
) was followed by measurement of footpad swelling. Ten days after virus inoculation, the animals were sacrificed and spleen virus titer together with splenic Tc activity was measured. With regard to all three parameters a continuous distribution was observed in this backcross population. However, using cutoff...... values based on parental and F1 animals tested in parallel, 11/30 animals were assigned Tc responders, 23/30 DTH responders and 10/30 cleared virus with maximal efficiency. Comparison of responder status with regard to the different parameters revealed a strong correlation between Tc responsiveness...... and the ability to clear virus. Amongst Tc low responders a correlation between DTH reactivity and virus clearance was observed. Taken together, these results indicate that non-MHC genes affect virus clearance through regulation of the antiviral T-cell response, especially the virus-specific Tc response. However...
Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian
2013-01-01
We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.
Directory of Open Access Journals (Sweden)
Peter Schierack
Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.
Xiao, Yun-yi; Chen, Jian-ye; Kuang, Jiang-fei; Shan, Wei; Xie, Hui; Jiang, Yue-ming; Lu, Wang-jin
2013-05-01
The involvement of ethylene response factor (ERF) transcription factor (TF) in the transcriptional regulation of ethylene biosynthesis genes during fruit ripening remains largely unclear. In this study, 15 ERF genes, designated as MaERF1-MaERF15, were isolated and characterized from banana fruit. These MaERFs were classified into seven of the 12 known ERF families. Subcellular localization showed that MaERF proteins of five different subfamilies preferentially localized to the nucleus. The 15 MaERF genes displayed differential expression patterns and levels in peel and pulp of banana fruit, in association with four different ripening treatments caused by natural, ethylene-induced, 1-methylcyclopropene (1-MCP)-delayed, and combined 1-MCP and ethylene treatments. MaERF9 was upregulated while MaERF11 was downregulated in peel and pulp of banana fruit during ripening or after treatment with ethylene. Furthermore, yeast-one hybrid (Y1H) and transient expression assays showed that the potential repressor MaERF11 bound to MaACS1 and MaACO1 promoters to suppress their activities and that MaERF9 activated MaACO1 promoter activity. Interestingly, protein-protein interaction analysis revealed that MaERF9 and -11 physically interacted with MaACO1. Taken together, these results suggest that MaERFs are involved in banana fruit ripening via transcriptional regulation of or interaction with ethylene biosynthesis genes.
Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S
1996-01-01
we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.
Dimer formation and transcription activation in the sporulation response regulator Spo0A.
Lewis, Richard J; Scott, David J; Brannigan, James A; Ladds, Joanne C; Cervin, Marguerite A; Spiegelman, George B; Hoggett, James G; Barák, Imrich; Wilkinson, Anthony J
2002-02-15
The response regulator Spo0A is the master control element in the initiation of sporulation in Bacillus subtilis. Like many other multi-domain response regulators, the latent activity of the effector, C-terminal domain is stimulated by phosphorylation on a conserved aspartic acid residue in the regulatory, N-terminal domain. If a threshold concentration of phosphorylated Spo0A is achieved, the transcription of genes required for sporulation is activated, whereas the genes encoding stationary phase sentinels are repressed, and sporulation proceeds. Despite detailed genetic, biochemical and structural characterisation, it is not understood how the phosphorylation signal in the receiver domain is transduced into DNA binding and transcription activation in the distal effector domain. An obstacle to our understanding of Spo0A function is the uncertainty concerning changes in quaternary structure that accompany phosphorylation. Here we have revisited this question and shown unequivocally that Spo0A forms dimers upon phosphorylation and that the subunit interactions in the dimer are mediated principally by the receiver domain. Purified dimers of two mutants of Spo0A, in which the phosphorylatable aspartic acid residue has been substituted, activate transcription from the spoIIG promoter in vitro, whereas monomers do not. This suggests that dimers represent the activated form of Spo0A. Copyright 2002 Elsevier Science Ltd.
Directory of Open Access Journals (Sweden)
Abdelsadik Ahmed
2010-04-01
Full Text Available Abstract Background Epithelial and especially mucosal immunity represents the first line of defence against the plethora of potential pathogens trying to invade via the gastrointestinal tract. The salivary glands of the fruit fly are an indispensable part of the gastrointestinal tract, but their contribution to the mucosal immunity has almost completely been neglected. Our major goal was to elucidate if the fly's salivary glands are able to mount an immune response and what the major characteristics of this immune response are. Results Ectopic activation of the IMD-pathway within the salivary gland cells is able to induce an immune response, indicating that the salivary glands are indeed immune competent. This reaction is characterized by the concurrent expression of numerous antimicrobial peptide genes. In addition, ectopic activation of the salivary gland's immune response induces morphological changes such as dwarfism throughout all developmental stages and a significantly decreased length of the salivary glands themselves. DNA-microarray analyses of the reaction revealed a complex pattern of up- and downregulated genes. Gene ontology analyses of regulated genes revealed a significant increase in genes associated with ribosomal and proteasomal function. On the other hand, genes coding for peptide receptors and some potassium channels are downregulated. In addition, the comparison of the transcriptional events induced following IMD-activation in the trachea and the salivary glands shows also only a small overlap, indicating that the general IMD-activated core transcriptome is rather small and that the tissue specific component of this response is dominating. Among the regulated genes, those that code for signaling associated protease activity are significantly modulated. Conclusions The salivary glands are immune-competent and they contribute to the overall intestinal immune system. Although they produce antimicrobial peptides, their overall
Kang, Jun Won; Wilkerson, Hui-Wen; Farin, Federico M; Bammler, Theo K; Beyer, Richard P; Strand, Stuart E; Doty, Sharon L
2010-08-01
Trichloroethylene (TCE) is an important environmental contaminant of soil, groundwater, and air. Studies of the metabolism of TCE by poplar trees suggest that cytochrome P450 enzymes are involved. Using poplar genome microarrays, we report a number of putative genes that are differentially expressed in response to TCE. In a previous study, transgenic hybrid poplar plants expressing mammalian cytochrome P450 2E1 (CYP2E1) had increased metabolism of TCE. In the vector control plants for this construct, 24 h following TCE exposure, 517 genes were upregulated and 650 genes were downregulated over 2-fold when compared with the non-exposed vector control plants. However, in the transgenic CYP2E1 plant, line 78, 1,601 genes were upregulated and 1,705 genes were downregulated over 2-fold when compared with the non-exposed transgenic CYP2E1 plant. It appeared that the CYP2E1 transgenic hybrid poplar plants overexpressing mammalian CYP2E1 showed a larger number of differentially expressed transcripts, suggesting a metabolic pathway for TCE to metabolites had been initiated by activity of CYP2E1 on TCE. These results suggest that either the over-expression of the CYP2E1 gene or the abundance of TCE metabolites from CYP450 2E1 activity triggered a strong genetic response to TCE. Particularly, cytochrome p450s, glutathione S-transferases, glucosyltransferases, and ABC transporters in the CYP2E1 transgenic hybrid poplar plants were highly expressed compared with in vector controls.
Velki, Mirna; Meyer-Alert, Henriette; Seiler, Thomas-Benjamin; Hollert, Henner
2017-12-01
The zebrafish as a test organism enables the investigation of effects on a wide range of biological levels from molecular level to the whole-organism level. The use of fish embryos represents an attractive model for studies aimed at understanding toxic mechanisms and the environmental risk assessment of chemicals. In the present study, a zebrafish (Danio rerio) in vivo model was employed in order to assess the effects of two commonly used pesticides, the insecticide diazinon and the herbicide diuron, on zebrafish early life stages. Since it was previously established that diazinon and diuron cause effects at the whole-organism level, this study assessed the suborganismic responses to exposure to these pesticides and the enzymatic responses (biochemical level) and the gene expression changes (molecular level) were analyzed. Different exposure scenarios were employed and the following endpoints measured: acetylcholinesterase (AChE), carboxylesterase (CES), ethoxyresorufin-O-deethylase (EROD), glutathione-S-transferase (GST), catalase (CAT) and glutathione peroxidase (GPx) activities; and gene expressions of the corresponding genes: acetylcholinesterase (ache), carboxylesterase (ces2), cytochrome P450 (cyp1a), glutathione-S-transferase (gstp1), catalase (cat), glutathione peroxidase (gpx1a) and additionally glutathione reductase (gsr). Significant changes at both the biochemical and the molecular level were detected. In addition, different sensitivities of different developmental stages of zebrafish were determined and partial recovery of the enzyme activity 48h after the end of the exposure was observed. The observed disparity between gene expression changes and alterations in enzyme activities points to the necessity of monitoring changes at different levels of biological organization. Different exposure scenarios, together with a comparison of the responses at the biochemical and molecular level, provide valuable data on the effects of diazinon and diuron on low
Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M
2008-03-25
Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.
Directory of Open Access Journals (Sweden)
Wei-Sheng Wu
2008-01-01
Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.
Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2011-12-01
In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.
Faith, Myles S
2008-12-01
This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.
Kobayashi, Takanori; Itai, Reiko Nakanishi; Senoura, Takeshi; Oikawa, Takaya; Ishimaru, Yasuhiro; Ueda, Minoru; Nakanishi, Hiromi; Nishizawa, Naoko K
2016-07-01
Under low iron availability, plants induce the expression of various genes involved in iron uptake and translocation at the transcriptional level. This iron deficiency response is affected by various plant hormones, but the roles of jasmonates in this response are not well-known. We investigated the involvement of jasmonates in rice iron deficiency responses. High rates of jasmonate-inducible genes were induced during the very early stages of iron deficiency treatment in rice roots. Many jasmonate-inducible genes were also negatively regulated by the ubiquitin ligases OsHRZ1 and OsHRZ2 and positively regulated by the transcription factor IDEF1. Ten out of 35 genes involved in jasmonate biosynthesis and signaling were rapidly induced at 3 h of iron deficiency treatment, and this induction preceded that of known iron deficiency-inducible genes involved in iron uptake and translocation. Twelve genes involved in jasmonate biosynthesis and signaling were also upregulated in HRZ-knockdown roots. Endogenous concentrations of jasmonic acid and jasmonoyl isoleucine tended to be rapidly increased in roots in response to iron deficiency treatment, whereas these concentrations were higher in HRZ-knockdown roots under iron-sufficient conditions. Analysis of the jasmonate-deficient cpm2 mutant revealed that jasmonates repress the expression of many iron deficiency-inducible genes involved in iron uptake and translocation under iron sufficiency, but this repression is partly canceled under an early stage of iron deficiency. These results indicate that jasmonate signaling is activated during the very early stages of iron deficiency, which is partly regulated by IDEF1 and OsHRZs.
Directory of Open Access Journals (Sweden)
Michael A Petrie
Full Text Available Skeletal muscle exercise regulates several important metabolic genes in humans. We know little about the effects of environmental stress (heat and mechanical stress (vibration on skeletal muscle. Passive mechanical stress or systemic heat stress are often used in combination with many active exercise programs. We designed a method to deliver a vibration stress and systemic heat stress to compare the effects with active skeletal muscle contraction.The purpose of this study is to examine whether active mechanical stress (muscle contraction, passive mechanical stress (vibration, or systemic whole body heat stress regulates key gene signatures associated with muscle metabolism, hypertrophy/atrophy, and inflammation/repair.Eleven subjects, six able-bodied and five with chronic spinal cord injury (SCI participated in the study. The six able-bodied subjects sat in a heat stress chamber for 30 minutes. Five subjects with SCI received a single dose of limb-segment vibration or a dose of repetitive electrically induced muscle contractions. Three hours after the completion of each stress, we performed a muscle biopsy (vastus lateralis or soleus to analyze mRNA gene expression.We discovered repetitive active muscle contractions up regulated metabolic transcription factors NR4A3 (12.45 fold, PGC-1α (5.46 fold, and ABRA (5.98 fold; and repressed MSTN (0.56 fold. Heat stress repressed PGC-1α (0.74 fold change; p < 0.05; while vibration induced FOXK2 (2.36 fold change; p < 0.05. Vibration similarly caused a down regulation of MSTN (0.74 fold change; p < 0.05, but to a lesser extent than active muscle contraction. Vibration induced FOXK2 (p < 0.05 while heat stress repressed PGC-1α (0.74 fold and ANKRD1 genes (0.51 fold; p < 0.05.These findings support a distinct gene regulation in response to heat stress, vibration, and muscle contractions. Understanding these responses may assist in developing regenerative rehabilitation interventions to improve muscle cell
Directory of Open Access Journals (Sweden)
Zorica Zivkovic
2009-01-01
Full Text Available The genus Anaplasma (Rickettsiales: Anaplasmataceae includes obligate tick-transmitted intracellular organisms, Anaplasma phagocytophilum and Anaplasma marginale that multiply in both vertebrate and tick host cells. Recently, we showed that A. marginale affects the expression of tick genes that are involved in tick survival and pathogen infection and multiplication. However, the gene expression profile in A. phagocytophilum-infected tick cells is currently poorly characterized. The objectives of this study were to characterize tick gene expression profile in Ixodes scapularis ticks and cultured ISE6 cells in response to infection with A. phagocypthilum and to compare tick gene expression responses in A. phagocytophilum- and A. marginale-infected tick cells by microarray and real-time RT-PCR analyses. The results of these studies demonstrated modulation of tick gene expression by A. phagocytophilum and provided evidence of different gene expression responses in tick cells infected with A. phagocytophilum and A. marginale. These differences in Anaplasma-tick interactions may reflect differences in pathogen life cycle in the tick cells.
Directory of Open Access Journals (Sweden)
Abdelwahed Chtarto
Full Text Available Stimulation of resident cells by NF-κB activating cytokines is a central element of inflammatory and degenerative disorders of the central nervous system (CNS. This disease-mediated NF-κB activation could be used to drive transgene expression selectively in affected cells, using adeno-associated virus (AAV-mediated gene transfer. We have constructed a series of AAV vectors expressing GFP under the control of different promoters including NF-κB -responsive elements. As an initial screen, the vectors were tested in vitro in HEK-293T cells treated with TNF-α. The best profile of GFP induction was obtained with a promoter containing two blocks of four NF-κB -responsive sequences from the human JCV neurotropic polyoma virus promoter, fused to a new tight minimal CMV promoter, optimally distant from each other. A therapeutical gene, glial cell line-derived neurotrophic factor (GDNF cDNA under the control of serotype 1-encapsidated NF-κB -responsive AAV vector (AAV-NF was protective in senescent cultures of mouse cortical neurons. AAV-NF was then evaluated in vivo in the kainic acid (KA-induced status epilepticus rat model for temporal lobe epilepsy, a major neurological disorder with a central pathophysiological role for NF-κB activation. We demonstrate that AAV-NF, injected in the hippocampus, responded to disease induction by mediating GFP expression, preferentially in CA1 and CA3 neurons and astrocytes, specifically in regions where inflammatory markers were also induced. Altogether, these data demonstrate the feasibility to use disease-activated transcription factor-responsive elements in order to drive transgene expression specifically in affected cells in inflammatory CNS disorders using AAV-mediated gene transfer.
Expression Analysis of MYC Genes from Tamarix hispida in Response to Different Abiotic Stresses
Directory of Open Access Journals (Sweden)
Guifeng Liu
2012-01-01
Full Text Available The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.
Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP)
International Nuclear Information System (INIS)
Li, Ming V.; Chen, Weiqin; Harmancey, Romain N.; Nuotio-Antar, Alli M.; Imamura, Minako; Saha, Pradip; Taegtmeyer, Heinrich; Chan, Lawrence
2010-01-01
Carbohydrate response element binding protein (ChREBP) is a Mondo family transcription factor that activates a number of glycolytic and lipogenic genes in response to glucose stimulation. We have previously reported that high glucose can activate the transcriptional activity of ChREBP independent of the protein phosphatase 2A (PP2A)-mediated increase in nuclear entry and DNA binding. Here, we found that formation of glucose-6-phosphate (G-6-P) is essential for glucose activation of ChREBP. The glucose response of GAL4-ChREBP is attenuated by D-mannoheptulose, a potent hexokinase inhibitor, as well as over-expression of glucose-6-phosphatase (G6Pase); kinetics of activation of GAL4-ChREBP can be modified by exogenously expressed GCK. Further metabolism of G-6-P through the two major glucose metabolic pathways, glycolysis and pentose-phosphate pathway, is not required for activation of ChREBP; over-expression of glucose-6-phosphate dehydrogenase (G6PD) diminishes, whereas RNAi knockdown of the enzyme enhances, the glucose response of GAL4-ChREBP, respectively. Moreover, the glucose analogue 2-deoxyglucose (2-DG), which is phosphorylated by hexokinase, but not further metabolized, effectively upregulates the transcription activity of ChREBP. In addition, over-expression of phosphofructokinase (PFK) 1 and 2, synergistically diminishes the glucose response of GAL4-ChREBP. These multiple lines of evidence support the conclusion that G-6-P mediates the activation of ChREBP.
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
Mutual information and the fidelity of response of gene regulatory models
International Nuclear Information System (INIS)
Tabbaa, Omar P; Jayaprakash, C
2014-01-01
We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M
2004-02-01
The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.
Directory of Open Access Journals (Sweden)
Clara Pons
Full Text Available Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding
Pons, Clara; Martí, Cristina; Forment, Javier; Crisosto, Carlos H; Dandekar, Abhaya M; Granell, Antonio
2014-01-01
Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding strategies to better
Directory of Open Access Journals (Sweden)
Benli Chai
Full Text Available Sphingomonas wittichii strain RW1 (RW1 is one of the few strains that can grow on dibenzo-p-dioxin (DD. We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF, and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes' microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis.
International Nuclear Information System (INIS)
Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun
2006-01-01
PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Mapping of brain activity by automated volume analysis of immediate early genes
Renier, Nicolas; Adams, Eliza L.; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E.; Kadiri, Lolahon; Venkataraju, Kannan Umadevi; Zhou, Yu; Wang, Victoria X.; Tang, Cheuk Y.; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc
2016-01-01
Summary Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization and quantification of the activity of all neurons across the entire brain, which has not to date been achieved in the mammalian brain. We introduce a pipeline for high speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to Haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Lastly, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available. PMID:27238021
International Nuclear Information System (INIS)
Grether-Beck, S.; Olaizola-Horn, S.; Schmitt, H.; Grewe, M.
1996-01-01
UVA radiation is the major component of the UV solar spectrum that reaches the earth, and the therapeutic application of UVA radiation is increasing in medicine. Analysis of the cellular effects of UVA radiation has revealed that exposure of human cells to UVA radiation at physiological doses leads to increased gene expression and that this UVA response is primarily mediated through the generation of singlet oxygen. In this study, the mechanisms by which UVA radiation induces transcriptional activation of the human intercellular adhesion molecule 1 (ICAM-1) were examined. UVA radiation was capable of inducing activation of the human ICAM-1 promoter and increasing OCAM-1 mRNA and protein expression. These UVA radiation effects were inhibited by singlet oxygen quenchers, augmented by enhancement of singlet oxygen life-time, and mimicked in unirradiated cells by a singlet oxygen-generating system. UVA radiation as well as singlet oxygen-induced ICAM-1 promoter activation required activation of the transcription factor AP-2. Accordingly, both stimuli activated AP-2, and deletion of the putative AP-2-binding site abrogated ICAM-1 promoter activation in this system. This study identified the AP-2 site as the UVA radiation- and singlet oxygen-responsive element of the human ICAM-1 gene. The capacity of UVA radiation and/or singlet oxygen to induce human gene expression through activation of AP-2 indicates a previously unrecognized role of this transcription factor in the mammalian stress response. 38 refs., 3 figs., 3 tabs
Responses of human cells to ZnO nanoparticles: a gene transcription study†
Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.
2013-01-01
The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377
Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D
2007-06-01
Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.
Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium).
Xia, Xiaolong; Shao, Yafeng; Jiang, Jiafu; Ren, Liping; Chen, Fadi; Fang, Weimin; Guan, Zhiyong; Chen, Sumei
2014-12-02
Chrysanthemum is an important ornamental plant all over the world. It is easily attacked by aphid, Macrosiphoniella sanbourni. The molecular mechanisms of plant defense responses to aphid are only partially understood. Here, we investigate the gene expression changes in response to aphid feeding in chrysanthemum leaf by RNA-Seq technology. Three libraries were generated from pooled leaf tissues of Chrysanthemum morifolium 'nannongxunzhang' that were collected at different time points with (Y) or without (CK) aphid infestations and mock puncture treatment (Z), and sequenced using an Illumina HiSeqTM 2000 platform. A total of 7,363,292, 7,215,860 and 7,319,841 clean reads were obtained in library CK, Y and Z, respectively. The proportion of clean reads was >97.29% in each library. Approximately 76.35% of the clean reads were mapped to a reference gene database including all known chrysanthemum unigene sequences. 1,157, 527 and 340 differentially expressed genes (DEGs) were identified in the comparison of CK-VS-Y, CK-VS-Z and Z-VS-Y, respectively. These DEGs were involved in phytohormone signaling, cell wall biosynthesis, photosynthesis, reactive oxygen species (ROS) pathway and transcription factor regulatory networks, and so on. Changes in gene expression induced by aphid feeding are shown to be multifaceted. There are various forms of crosstalk between different pathways those genes belonging to, which would allow plants to fine-tune its defense responses.
Directory of Open Access Journals (Sweden)
Gabriel Lima Lopes
2015-08-01
Full Text Available AbstractLung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21, first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs. Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC.
Nieva, Claudia; Busk, Peter K; Domínguez-Puigjaner, Eva; Lumbreras, Victoria; Testillano, Pilar S; Risueño, Maria-Carmen; Pagès, Montserrat
2005-08-01
The plant hormone abscisic acid regulates gene expression in response to growth stimuli and abiotic stress. Previous studies have implicated members of the bZIP family of transcription factors as mediators of abscisic acid dependent gene expression through the ABRE cis-element. Here, we identify two new maize bZIP transcription factors, EmBP-2 and ZmBZ-1 related to EmBP-1 and OsBZ-8 families. They are differentially expressed during embryo development; EmBP-2 is constitutive, whereas ZmBZ-1 is abscisic acid-inducible and accumulates during late embryogenesis. Both factors are nuclear proteins that bind to ABREs and activate transcription of the abscisic acid-inducible gene rab28 from maize. EmBP-2 and ZmBZ-1 are phosphorylated by protein kinase CK2 and phosphorylation alters their DNA binding properties. Our data suggest that EmBP-2 and ZmBZ-1 are involved in the expression of abscisic acid inducible genes such as rab28 and their activity is modulated by ABA and by phosphorylation.
Directory of Open Access Journals (Sweden)
Ravi Goyal
Full Text Available In humans and other species, long-term hypoxia (LTH during pregnancy can lead to intrauterine growth restriction with reduced body/brain weight, dysregulation of cerebral blood flow (CBF, and other problems. To identify the signal transduction pathways and critical molecules, which may be involved in acclimatization to high altitude LTH, we conducted microarray with advanced bioinformatic analysis on carotid arteries (CA from the normoxic near-term ovine fetus at sea-level and those acclimatized to high altitude for 110+ days during gestation. In response to LTH acclimatization, in fetal CA we identified mRNA from 38 genes upregulated >2 fold (P2-fold (P<0.05. The major genes with upregulated mRNA were SLC1A3, Insulin-like growth factor (IGF binding protein 3, IGF type 2 receptor, transforming growth factor (TGF Beta-3, and genes involved in the AKT and BCL2 signal transduction networks. Most genes with upregulated mRNA have a common motif for Pbx/Knotted homeobox in the promoter region, and Sox family binding sites in the 3' un translated region (UTR. Genes with downregulated mRNA included those involved in the P53 pathway and 5-lipoxygenase activating proteins. The promoter region of all genes with downregulated mRNA, had a common 49 bp region with a binding site for DOT6 and TOD6, components of the RPD3 histone deacetylase complex RPD3C(L. We also identified miRNA complementary to a number of the altered genes. Thus, the present study identified molecules in the ovine fetus, which may play a role in the acclimatization response to high-altitude associated LTH.
Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya
2014-05-01
Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DeSmet, Marsha L; Fleet, James C
2017-10-01
High vitamin D status is associated with reduced colon cancer risk but these studies ignore the diversity in the molecular etiology of colon cancer. RAS activating mutations are common in colon cancer and they activate pro-proliferative signaling pathways. We examined the impact of RAS activating mutations on 1,25 dihydroxyvitamin D (1,25(OH) 2 D)-mediated gene expression in cultured colon and intestinal cell lines. Transient transfection of Caco-2 cells with a constitutively active mutant K-RAS (G12 V) significantly reduced 1,25(OH) 2 D-induced activity of both a human 25-hydroxyvitamin D, 24 hydroxyase (CYP24A1) promoter-luciferase and an artificial 3X vitamin D response element (VDRE) promoter-luciferase reporter gene. Young Adult Mouse Colon (YAMC) and Rat Intestinal Epithelial (RIE) cell lines with stable expression of mutant H-RAS had suppressed 1,25(OH) 2 D-mediated induction of CYP24A1 mRNA. The RAS effects were associated with lower Vitamin D receptor (VDR) mRNA and protein levels in YAMC and RIE cells and they could be partially reversed by VDR overexpression. RAS-mediated suppression of VDR levels was not due to either reduced VDR mRNA stability or increased VDR gene methylation. However, chromatin accessibility to the VDR gene at the proximal promoter (-300bp), an enhancer region at -6kb, and an enhancer region located in exon 3 was significantly reduced in RAS transformed YAMC cells (YAMC-RAS). These data show that constitutively active RAS signaling suppresses 1,25(OH) 2 D-mediated gene transcription in colon epithelial cells by reducing VDR gene transcription but the mechanism for this suppression is not yet known. These data suggest that cancers with RAS-activating mutations may be less responsive to vitamin D mediated treatment or chemoprevention. Copyright © 2017 Elsevier Ltd. All rights reserved.
Differential Effect of Active Smoking on Gene Expression in Male and Female Smokers
Paul, Sunirmal; Amundson, Sally A
2015-01-01
Smoking is the second leading cause of preventable death in the United States. Cohort epidemiological studies have demonstrated that women are more vulnerable to cigarette-smoking induced diseases than their male counterparts, however, the molecular basis of these differences has remained unknown. In this study, we explored if there were differences in the gene expression patterns between male and female smokers, and how these patterns might reflect different sex-specific responses to the stress of smoking. Using whole genome microarray gene expression profiling, we found that a substantial number of oxidant related genes were expressed in both male and female smokers, however, smoking-responsive genes did indeed differ greatly between male and female smokers. Gene set enrichment analysis (GSEA) against reference oncogenic signature gene sets identified a large number of oncogenic pathway gene-sets that were significantly altered in female smokers compared to male smokers. In addition, functional annotation with Ingenuity Pathway Analysis (IPA) identified smoking-correlated genes associated with biological functions in male and female smokers that are directly relevant to well-known smoking related pathologies. However, these relevant biological functions were strikingly overrepresented in female smokers compared to male smokers. IPA network analysis with the functional categories of immune and inflammatory response gene products suggested potential interactions between smoking response and female hormones. Our results demonstrate a striking dichotomy between male and female gene expression responses to smoking. This is the first genome-wide expression study to compare the sex-specific impacts of smoking at a molecular level and suggests a novel potential connection between sex hormone signaling and smoking-induced diseases in female smokers. PMID:25621181
International Nuclear Information System (INIS)
Taylor, Cormac T.; Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T.; Ryan, Silke
2014-01-01
Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key
Energy Technology Data Exchange (ETDEWEB)
Taylor, Cormac T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland); Ryan, Silke, E-mail: silke.ryan@ucd.ie [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland)
2014-05-16
Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key
Kumagai, Takeshi; Aratsu, Yusuke; Sugawara, Ryosuke; Sasaki, Takamitsu; Miyairi, Shinichi; Nagata, Kiyoshi
2016-04-01
Ban-Lan-Gen is the common name for the dried roots of indigo plants, including Polygonum tinctorium, Isatis indigotica, Isatis tinctoria, and Strobilanthes cusia. Ban-Lan-Gen is frequently used as an anti-inflammatory and an anti-viral for the treatment of hepatitis, influenza, and various types of inflammation. One of the cytochrome P450 (CYP) enzymes, CYP3A4, is responsible for the metabolism of a wide variety of xenobiotics, including an estimated 60% of all clinically used drugs. In this study, we investigated the effect of Ban-Lan-Gen on the transcriptional activation of the CYP3A4 gene. Ban-Lan-Gen extract increased CYP3A4 gene reporter activity in a dose-dependent manner. Indirubin, one of the biologically active ingredients in the Ban-Lan-Gen, also dose-dependently increased CYP3A4 gene reporter activity. Expression of short hairpin RNA for the human pregnane X receptor (hPXR-shRNA) inhibited CYP3A4 gene reporter activity, and overexpression of human PXR increased indirubin- and rifampicin-induced CYP3A4 gene reporter activity. Furthermore, indirubin induced CYP3A4 mRNA expression in HepG2 cells. Taken together, these results indicate that indirubin, a component of Ban-Lan-Gen, activated CYP3A4 gene transcription through the activation of the human PXR. Copyright © 2016. Published by Elsevier Ltd.
Function of the auxin-responsive gene TaSAUR75 under salt and drought stress
Directory of Open Access Journals (Sweden)
Yuan Guo
2018-04-01
Full Text Available Small auxin-upregulated RNAs (SAURs are genes regulated by auxin and environmental factors. In this study, we identified a SAUR gene in wheat, TaSAUR75. Under salt stress, TaSAUR75 is downregulated in wheat roots. Subcellular localization revealed that TaSAUR75 was localized in both the cytoplasm and nucleus. Overexpression of TaSAUR75 increased drought and salt tolerance in Arabidopsis. Transgenic lines showed higher root length and survival rate and higher expression of some stress-responsive genes than control plants under salt and drought stress. Less H2O2 accumulated in transgenic lines than in control plants under drought stress. Our findings reveal a positive regulatory role of the auxin-responsive gene TaSAUR75 in plant responses to drought and salt stress and provide a candidate gene for improvement of abiotic stress tolerance in crop breeding.
Directory of Open Access Journals (Sweden)
Paules Richard S
2007-11-01
Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying
Pelosof, Lorraine C; Davis, Paul H; Zhang, Zhi; Zhang, Xiaochun; Stanley, Samuel L
2006-03-01
The liver has the remarkable ability to respond to injury with repair and regeneration. The protozoan parasite Entamoeba histolytica is the major cause of liver abscess worldwide. We report a transcriptional analysis of the response of mouse liver to E. histolytica infection, the first study looking at acute liver infection by a non-viral pathogen. Focusing on early time points, we identified 764 genes with altered transcriptional levels in amebic liver abscess. The response to infection is rapid and complex, with concurrent increased expression of genes linked to host defence through IL-1, TLR2, or interferon-induced pathways, liver regeneration via activation of IL-6 pathways, and genes associated with programmed cell death possibly through TNFalpha or Fas pathways. A comparison of amebic liver infection with the liver response to partial hepatectomy or toxins reveals striking similarities between amebic liver abscess and non-infectious injury in key components of the liver regeneration pathways. However, the response in amebic liver abscess is biased towards apoptosis when compared with acute liver injury from hepatectomy, toxins, or other forms of liver infection. E. histolytica infection of the liver simultaneously activates inflammatory, regenerative and apoptotic pathways, but the sum of these early responses is biased towards programmed cell death.
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Conservation of the response regulator gene gacA in Pseudomonas species
Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.
2003-01-01
The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains
Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection
Directory of Open Access Journals (Sweden)
Yiming Wang
2014-12-01
Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.
Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang
2011-11-01
Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.
Anthony, Kim; More, Abhijit; Zhang, Xiaoliu
2014-01-01
Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.
A novel strategy to activate cytoprotective genes in the injured brain
International Nuclear Information System (INIS)
Zhao, Jing; Redell, John B.; Moore, Anthony N.; Dash, Pramod K.
2011-01-01
Highlights: → A strategy to increase cytoprotective gene expression in injured tissue is outlined. → A peptide containing a DEETGE motif can increase Nrf2 responsive genes in vivo. → Gene expression in injured brains requires a calpain cleavage site. → This peptide decreases BBB compromise when infused pre- or post-brain injury. → Cleavage sites for disease-specific proteases could be used to treat that condition. -- Abstract: The transcription factor nuclear factor E2-related factor 2 (Nrf2) regulates the expression of multiple cytoprotective genes that have been shown to offer protection in response to a number of insults. The present study describes a novel strategy to increase expression of Nrf2-responsive genes in brain injured mice. Under normal conditions, the adapter protein Kelch-like ECH-associated protein 1 (Keap1) binds to Nrf2 and promotes its proteosomal degradation in the cytoplasm. The amino acid sequence DEETGE, located at amino acid 77-82 of Nrf2, is critical for Nrf2-Keap1 interaction, and synthetic peptides containing this sequence can be used to disrupt the complex in vitro. We observed that intracerebroventricular (i.c.v.) infusion of a peptide containing the DEETGE sequence along with the cell transduction domain of the HIV-TAT protein (TAT-DEETGE) into brain-injured mice did not increase the mRNA levels for Nrf2-driven genes. However, when a calpain cleavage sequence was introduced between the TAT sequence and the DEETGE sequence, the new peptide (TAT-CAL-DEETGE) increased the mRNA levels of these genes. Increased gene expression was not observed when the TAT-CAL-DEETGE peptide was injected into uninjured animals. Furthermore, injection of TAT-CAL-DEETGE peptides before or after brain injury reduced blood-brain barrier compromise, a prominent secondary pathology that negatively influences outcome. The present strategy to increase Nrf2-responsive gene expression can be adapted to treat other insults or diseases based on their
Induction of Th1 type response by DNA vaccinations with N, M, and E genes against SARS-CoV in mice
International Nuclear Information System (INIS)
Jin Huali; Xiao Chong; Chen Ze; Kang Youmin; Ma Yijie; Zhu Kaichun; Xie Qifa; Tu Yixian; Yu Yang; Wang Bin
2005-01-01
Vaccination against the SARS-CoV infection is an attractive means to control the spread of viruses in public. In this study, we employed a DNA vaccine technology with the levamisole, our newly discovered chemical adjuvant, to generate Th1 type of response. To avoid the enhancement antibody issue, genes encoding the nucleocapsid, membrane, and envelope protein of SARS-CoV were cloned and their expressions in mammalian cells were determined. After the intramuscular introduction into animals, we observed that the constructs of the E, M, and N genes could induce high levels of specific antibodies, T cell proliferations, IFN-γ, DTH responses, and in vivo cytotoxic T cells activities specifically against SARS-CoV antigens. The highest immune responses were generated by the construct encoding the nucleocapsid protein. The results suggest that the N, M, and E genes could be used as the targets to prevent SARS-CoV infection in the DNA vaccine development
Moderation of antidepressant response by the serotonin transporter gene
DEFF Research Database (Denmark)
Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca
2009-01-01
Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...
Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song
2018-02-09
Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.
Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale
2016-08-01
Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Massive activation of archaeal defense genes during viral infection.
Quax, Tessa E F; Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob; Prangishvili, David
2013-08-01
Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo.
Directory of Open Access Journals (Sweden)
Chevalier Frédéric
2012-01-01
Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Directory of Open Access Journals (Sweden)
Thomas R. Aunins
2018-03-01
Full Text Available Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under
Aunins, Thomas R; Erickson, Keesha E; Prasad, Nripesh; Levy, Shawn E; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree
2018-01-01
Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress
Aunins, Thomas R.; Erickson, Keesha E.; Prasad, Nripesh; Levy, Shawn E.; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree
2018-01-01
Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress
Directory of Open Access Journals (Sweden)
Samuel Mohammed Chekabab
Full Text Available Enterohemorrhagic Escherichia coli (EHEC, an emerging food- and water-borne hazard, is highly pathogenic to humans. In the environment, EHEC must survive phosphate (Pi limitation. The response to such Pi starvation is an induction of the Pho regulon including the Pst system that senses Pi variation. The interplay between the virulence of EHEC, Pho-Pst system and environmental Pi remains unknown. To understand the effects of Pi deprivation on the molecular mechanisms involved in EHEC survival and virulence under Pho regulon control, we undertook transcriptome profiling of the EDL933 wild-type strain grown under high Pi and low Pi conditions and its isogenic ΔphoB mutant grown in low Pi conditions. The differentially expressed genes included 1067 Pi-dependent genes and 603 PhoB-dependent genes. Of these 131 genes were both Pi and PhoB-dependent. Differentially expressed genes that were selected included those involved in Pi homeostasis, cellular metabolism, acid stress, oxidative stress and RpoS-dependent stress responses. Differentially expressed virulence systems included the locus of enterocyte effacement (LEE encoding the type-3 secretion system (T3SS and its effectors, as well as BP-933W prophage encoded Shiga toxin 2 genes. Moreover, PhoB directly regulated LEE and stx2 gene expression through binding to specific Pho boxes. However, in Pi-rich medium, constitutive activation of the Pho regulon decreased LEE gene expression and reduced adherence to HeLa cells. Together, these findings reveal that EHEC has evolved a sophisticated response to Pi limitation involving multiple biochemical strategies that contribute to its ability to respond to variations in environmental Pi and to coordinating the virulence response.
Directory of Open Access Journals (Sweden)
Xue Luo
2016-04-01
Full Text Available Objectives: The objective of the present study was to observe the effects of 50 Hz magnetic fields (MFs on the immune function of splenic lymphocytes in mice. Material and Methods: Twenty male Kunming mice (6 weeks old, weighing 18– 25 g, were randomly divided into sham exposure (N = 10 and 500 μT MFs (N = 10 groups. The mice in the MFs group were exposed to 500 μT MFs for 8 h daily (5 days/week for up to 60 days. In vitro study was carried out to examine the effects of 50 Hz MFs on the expression of inflammatory factor genes and a cluster of differentiation 69 (CD69 in mouse prime splenic lymphocytes activated by para-Methoxyamphetamine (PMA and ionomycin. In the in vitro experiments, lymphocytes were isolated from the spleen of 10 healthy Kunming mice, the cells were cultured in the Roswell Park Memorial Institute 1640 medium (RPMI-1640 and exposed to 0 μT, 250 μT, 500 μT, or 1 mT MFs in an incubator under 5% carbon dioxide (CO2 at 37°C for 6 h. The levels of interleukin-2 (IL-2, IL-4, interferon-gamma (IFN-γ, GATA binding protein 3 (GATA-3 and T cell-specific T-box transcription factor (T-bet were assessed by the real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR, respectively. The expression of CD69 was checked using the flow cytometry. Results: Under our experimental conditions, body weight of the mice exposed to occupational, extremely low frequency- electromagnetic fields (ELF-EMFs significantly decreased on day 20 and day 30. There were no significant changes observed in vivo in spleen weight, splenic coefficient, splenic histology profile and cytokine production in spleen tissues. Our in vitro experiments showed that 50 Hz MFs had no effect on the expression of these genes and CD69 to primary splenic cells. Conclusions: In conclusion, under the applied experimental conditions, occupational exposure to 50 Hz magnetic field did not alter responses of inflammatory genes and activation of splenic
Yamaguchi, Akemi; Kohra, Shinya; Ishibashi, Hiroshi; Arizono, Koji; Tominaga, Nobuaki
2008-01-01
Menadione, a synthetic vitamin K3, exhibits anti-estrogenic activity on in vitro assay. However, the in vivo anti-estrogenic effects of menadione have not been determined, while correlations between biological effects and structural changes are unclear. Thus, we investigated the in vivo anti-estrogenic activity of menadione under fluorescent light and dark conditions. Suppression of the hepatic estrogen response genes vitellogenin1 (VTG1), VTG2 and estrogen receptor-α (ER-α) was used as an in...
Verma, Puja; Tapadia, Madhu G
2015-08-01
In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sumit Ghosh
Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.
Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis
2013-01-01
Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759
Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses
Directory of Open Access Journals (Sweden)
Redon Emma
2008-07-01
Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
International Nuclear Information System (INIS)
Yokoyama, Mayo; Johkura, Kohei; Sato, Takehiko
2014-01-01
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H 2 O 2 -added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H 2 O 2 ) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H 2 O 2 . As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H 2 O 2 -medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H 2 O 2 -medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H 2 O 2 -medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN and FOS, were detected and notably elevated in
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
Energy Technology Data Exchange (ETDEWEB)
Yokoyama, Mayo, E-mail: yokoyama@plasma.ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Johkura, Kohei, E-mail: kohei@shinshu-u.ac.jp [Department of Histology and Embryology, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Sato, Takehiko, E-mail: sato@ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan)
2014-08-08
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H{sub 2}O{sub 2}-added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H{sub 2}O{sub 2}) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H{sub 2}O{sub 2}. As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H{sub 2}O{sub 2}-medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H{sub 2}O{sub 2}-medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H{sub 2}O{sub 2}-medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN
Energy Technology Data Exchange (ETDEWEB)
Ponce M, J.; Serment G, J.; Brena V, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)
2003-07-01
The Escherichia coli bacteria has a repair and tolerance system known as SOS that works when there is damage in the DNA. However it is necessary that this damage modifies before the system is activated. For this it has intended to the enzymes that degrade DNA like responsible for generating this modifications. It has already been identified to the product of the gene recJ and according to the results that here are presented that of the gene xonA has similar activity. When both genes fail, not alone the activity SOS is inhibited but rather the mortality increases, for ionizing radiation. The above mentioned reinforces the importance of these genes in the recovery to the damage caused to the genome. (Author)
Guzowski, John F; Miyashita, Teiko; Chawla, Monica K; Sanderson, Jennifer; Maes, Levi I; Houston, Frank P; Lipa, Peter; McNaughton, Bruce L; Worley, Paul F; Barnes, Carol A
2006-01-24
The ability of neurons to alter their transcriptional programs in response to synaptic input is of fundamental importance to the neuroplastic mechanisms underlying learning and memory. Because of technical limitations of conventional gene detection methods, the current view of activity-dependent neural transcription derives from experiments in which neurons are assumed quiescent until a signaling stimulus is given. The present study was designed to move beyond this static model by examining how earlier episodes of neural activity influence transcription of the immediate-early gene Arc. Using a sensitive FISH method that detects primary transcript at genomic alleles, the proportion of hippocampal CA1 neurons that activate transcription of Arc RNA was constant at approximately 40% in response to both a single novel exploration session and daily sessions repeated over 9 days. This proportion is similar to the percentage of active neurons defined electrophysiologically. However, this close correspondence was disrupted in rats exposed briefly, but repeatedly, to the same environment within a single day. Arc transcription in CA1 neurons declined dramatically after as few as four 5-min sessions, despite stable electrophysiological activity during all sessions. Additional experiments indicate that the decrement in Arc transcription occurred at the cellular, rather than synaptic level, and was not simply linked to habituation to novelty. Thus, the neural genomic response is governed by recent, but not remote, cell firing history in the behaving animal. This state-dependence of neuronal transcriptional coupling provides a mechanism of metaplasticity and may regulate capacity for synaptic modification in neural networks.
Epigenetic modulation of gene expression governs the brain's response to injury.
Simon, Roger P
2016-06-20
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain's response to injury. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Azami, Sachiyo; Wagatsuma, Akiko; Sadamoto, Hisayo; Hatakeyama, Dai; Usami, Takeshi; Fujie, Manabu; Koyanagi, Ryo; Azumi, Kaoru; Fujito, Yutaka; Lukowiak, Ken; Ito, Etsuro
2006-11-15
The pond snail Lymnaea stagnalis is capable of learning conditioned taste aversion (CTA) and then consolidating that learning into long-term memory (LTM) that persists for at least 1 month. LTM requires de novo protein synthesis and altered gene activity. Changes in gene activity in Lymnaea that are correlated with, much less causative, memory formation have not yet been identified. As a first step toward rectifying this situation, we constructed a cDNA microarray with mRNAs extracted from the central nervous system (CNS) of Lymnaea. We then, using this microarray assay, identified genes whose activity either increased or decreased following CTA memory consolidation. We also identified genes whose expression levels were altered after inhibition of the cyclic AMP response element-binding protein (CREB) that is hypothesized to be a key transcription factor for CTA memory. We found that the molluscan insulin-related peptide II (MIP II) was up-regulated during CTA-LTM, whereas the gene encoding pedal peptide preprohormone (Pep) was down-regulated by CREB2 RNA interference. We next examined mRNAs of MIP II and Pep using real-time RT-PCR with SYBR Green. The MIP II mRNA level in the CNS of snails exhibiting "good" memory for CTA was confirmed to be significantly higher than that from the CNS of snails exhibiting "poor" memory. In contrast, there was no significant difference in expression levels of the Pep mRNA between "good" and "poor" performers. These data suggest that in Lymnaea MIP II may play a role in the consolidation process that forms LTM following CTA training.
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response
Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo
2008-01-01
Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430
Directory of Open Access Journals (Sweden)
Nils Klüver
Full Text Available Acetylcholinesterase (AChE inhibitors are widely used as pesticides and drugs. Their primary effect is the overstimulation of cholinergic receptors which results in an improper muscular function. During vertebrate embryonic development nerve activity and intracellular downstream events are critical for the regulation of muscle fiber formation. Whether AChE inhibitors and related neurotoxic compounds also provoke specific changes in gene transcription patterns during vertebrate development that allow them to establish a mechanistic link useful for identification of developmental toxicity pathways has, however, yet not been investigated. Therefore we examined the transcriptomic response of a known AChE inhibitor, the organophosphate azinphos-methyl (APM, in zebrafish embryos and compared the response with two non-AChE inhibiting unspecific control compounds, 1,4-dimethoxybenzene (DMB and 2,4-dinitrophenol (DNP. A highly specific cluster of APM induced gene transcripts was identified and a subset of strongly regulated genes was analyzed in more detail. The small heat shock protein hspb11 was found to be the most sensitive induced gene in response to AChE inhibitors. Comparison of expression in wildtype, ache and sop(fixe mutant embryos revealed that hspb11 expression was dependent on the nicotinic acetylcholine receptor (nAChR activity. Furthermore, modulators of intracellular calcium levels within the whole embryo led to a transcriptional up-regulation of hspb11 which suggests that elevated intracellular calcium levels may regulate the expression of this gene. During early zebrafish development, hspb11 was specifically expressed in muscle pioneer cells and Hspb11 morpholino-knockdown resulted in effects on slow muscle myosin organization. Our findings imply that a comparative toxicogenomic approach and functional analysis can lead to the identification of molecular mechanisms and specific marker genes for potential neurotoxic compounds.
Directory of Open Access Journals (Sweden)
Aaron R Wolen
Full Text Available Individual differences in initial sensitivity to ethanol are strongly related to the heritable risk of alcoholism in humans. To elucidate key molecular networks that modulate ethanol sensitivity we performed the first systems genetics analysis of ethanol-responsive gene expression in brain regions of the mesocorticolimbic reward circuit (prefrontal cortex, nucleus accumbens, and ventral midbrain across a highly diverse family of 27 isogenic mouse strains (BXD panel before and after treatment with ethanol.Acute ethanol altered the expression of ~2,750 genes in one or more regions and 400 transcripts were jointly modulated in all three. Ethanol-responsive gene networks were extracted with a powerful graph theoretical method that efficiently summarized ethanol's effects. These networks correlated with acute behavioral responses to ethanol and other drugs of abuse. As predicted, networks were heavily populated by genes controlling synaptic transmission and neuroplasticity. Several of the most densely interconnected network hubs, including Kcnma1 and Gsk3β, are known to influence behavioral or physiological responses to ethanol, validating our overall approach. Other major hub genes like Grm3, Pten and Nrg3 represent novel targets of ethanol effects. Networks were under strong genetic control by variants that we mapped to a small number of chromosomal loci. Using a novel combination of genetic, bioinformatic and network-based approaches, we identified high priority cis-regulatory candidate genes, including Scn1b, Gria1, Sncb and Nell2.The ethanol-responsive gene networks identified here represent a previously uncharacterized intermediate phenotype between DNA variation and ethanol sensitivity in mice. Networks involved in synaptic transmission were strongly regulated by ethanol and could contribute to behavioral plasticity seen with chronic ethanol. Our novel finding that hub genes and a small number of loci exert major influence over the ethanol
Li, Baohai
2012-10-12
Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.
Li, Baohai; Li, Qing; Xiong, Liming; Kronzucker, Herbert J.; Krä mer, Ute; Shi, Weiming
2012-01-01
Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.
PKC activation induces inflammatory response and cell death in human bronchial epithelial cells.
Directory of Open Access Journals (Sweden)
Hyunhee Kim
Full Text Available A variety of airborne pathogens can induce inflammatory responses in airway epithelial cells, which is a crucial component of host defence. However, excessive inflammatory responses and chronic inflammation also contribute to different diseases of the respiratory system. We hypothesized that the activation of protein kinase C (PKC is one of the essential mechanisms of inflammatory response in airway epithelial cells. In the present study, we stimulated human bronchial lung epithelial (BEAS-2B cells with the phorbol ester Phorbol 12, 13-dibutyrate (PDBu, and examined gene expression profile using microarrays. Microarray analysis suggests that PKC activation induced dramatic changes in gene expression related to multiple cellular functions. The top two interaction networks generated from these changes were centered on NFκB and TNF-α, which are two commonly known pathways for cell death and inflammation. Subsequent tests confirmed the decrease in cell viability and an increase in the production of various cytokines. Interestingly, each of the increased cytokines was differentially regulated at mRNA and/or protein levels by different sub-classes of PKC isozymes. We conclude that pathological cell death and cytokine production in airway epithelial cells in various situations may be mediated through PKC related signaling pathways. These findings suggest that PKCs can be new targets for treatment of lung diseases.
Energy Technology Data Exchange (ETDEWEB)
Ozden, Sibel, E-mail: stopuz@istanbul.edu.tr [Department of Pharmaceutical Toxicology, Faculty of Pharmacy, Istanbul University, Istanbul (Turkey); Turgut Kara, Neslihan [Department of Molecular Biology and Genetics, Faculty of Science, Istanbul University, Istanbul (Turkey); Sezerman, Osman Ugur [Department of Biostatistics and Medical Informatics, Acibadem University, Istanbul (Turkey); Durasi, İlknur Melis [Biological Sciences and Bioengineering, Faculty of Engineering and Natural Sciences, Sabancı University, Istanbul (Turkey); Chen, Tao [Department of Toxicology, School of Public Health, Soochow University, Suzhou (China); Demirel, Goksun; Alpertunga, Buket [Department of Pharmaceutical Toxicology, Faculty of Pharmacy, Istanbul University, Istanbul (Turkey); Chipman, J. Kevin [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); Mally, Angela [Department of Toxicology, University of Würzburg, Würzburg (Germany)
2015-12-01
Altered expression of tumor suppressor genes and oncogenes, which is regulated in part at the level of DNA methylation, is an important event involved in non-genotoxic carcinogenesis. This may serve as a marker for early detection of non-genotoxic carcinogens. Therefore, we evaluated the effects of non-genotoxic hepatocarcinogens, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), hexachlorobenzene (HCB), methapyrilene (MPY) and male rat kidney carcinogens, d-limonene, p-dichlorobenzene (DCB), chloroform and ochratoxin A (OTA) on global and CpG island promoter methylation in their respective target tissues in rats. No significant dose-related effects on global DNA hypomethylation were observed in tissues of rats compared to vehicle controls using LC–MS/MS in response to short-term non-genotoxic carcinogen exposure. Initial experiments investigating gene-specific methylation using methylation-specific PCR and bisulfite sequencing, revealed partial methylation of p16 in the liver of rats treated with HCB and TCDD. However, no treatment related effects on the methylation status of Cx32, e-cadherin, VHL, c-myc, Igfbp2, and p15 were observed. We therefore applied genome-wide DNA methylation analysis using methylated DNA immunoprecipitation combined with microarrays to identify alterations in gene-specific methylation. Under the conditions of our study, some genes were differentially methylated in response to MPY and TCDD, whereas d-limonene, DCB and chloroform did not induce any methylation changes. 90-day OTA treatment revealed enrichment of several categories of genes important in protein kinase activity and mTOR cell signaling process which are related to OTA nephrocarcinogenicity. - Highlights: • Studied non-genotoxic carcinogens caused no change on global DNA hypomethylation. • d-Limonene, DCB and chloroform did not show any genome-wide methylation changes. • Some genes were differentially methylated in response to MPY, TCDD and OTA. • Protein kinase activity
International Nuclear Information System (INIS)
Ozden, Sibel; Turgut Kara, Neslihan; Sezerman, Osman Ugur; Durasi, İlknur Melis; Chen, Tao; Demirel, Goksun; Alpertunga, Buket; Chipman, J. Kevin; Mally, Angela
2015-01-01
Altered expression of tumor suppressor genes and oncogenes, which is regulated in part at the level of DNA methylation, is an important event involved in non-genotoxic carcinogenesis. This may serve as a marker for early detection of non-genotoxic carcinogens. Therefore, we evaluated the effects of non-genotoxic hepatocarcinogens, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), hexachlorobenzene (HCB), methapyrilene (MPY) and male rat kidney carcinogens, d-limonene, p-dichlorobenzene (DCB), chloroform and ochratoxin A (OTA) on global and CpG island promoter methylation in their respective target tissues in rats. No significant dose-related effects on global DNA hypomethylation were observed in tissues of rats compared to vehicle controls using LC–MS/MS in response to short-term non-genotoxic carcinogen exposure. Initial experiments investigating gene-specific methylation using methylation-specific PCR and bisulfite sequencing, revealed partial methylation of p16 in the liver of rats treated with HCB and TCDD. However, no treatment related effects on the methylation status of Cx32, e-cadherin, VHL, c-myc, Igfbp2, and p15 were observed. We therefore applied genome-wide DNA methylation analysis using methylated DNA immunoprecipitation combined with microarrays to identify alterations in gene-specific methylation. Under the conditions of our study, some genes were differentially methylated in response to MPY and TCDD, whereas d-limonene, DCB and chloroform did not induce any methylation changes. 90-day OTA treatment revealed enrichment of several categories of genes important in protein kinase activity and mTOR cell signaling process which are related to OTA nephrocarcinogenicity. - Highlights: • Studied non-genotoxic carcinogens caused no change on global DNA hypomethylation. • d-Limonene, DCB and chloroform did not show any genome-wide methylation changes. • Some genes were differentially methylated in response to MPY, TCDD and OTA. • Protein kinase activity
Molecular responses and expression analysis of genes in a ...
African Journals Online (AJOL)
Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...
Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi
2017-01-29
Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.
Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima
Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Jacky Y Suen
Full Text Available Protease-Activated Receptor-2 (PAR2 has been implicated through genetic knockout mice with cytokine regulation and arthritis development. Many studies have associated PAR2 with inflammatory conditions (arthritis, airways inflammation, IBD and key events in tumor progression (angiogenesis, metastasis, but they have relied heavily on the use of single agonists to identify physiological roles for PAR2. However such probes are now known not to be highly selective for PAR2, and thus precisely what PAR2 does and what mechanisms of downstream regulation are truly affected remain obscure. Effects of PAR2 activation on gene expression in Human Embryonic Kidney cells (HEK293, a commonly studied cell line in PAR2 research, were investigated here by comparing 19,000 human genes for intersecting up- or down-regulation by both trypsin (an endogenous protease that activates PAR2 and a PAR2 activating hexapeptide (2f-LIGRLO-NH(2. Among 2,500 human genes regulated similarly by both agonists, there were clear associations between PAR2 activation and cellular metabolism (1,000 genes, the cell cycle, the MAPK pathway, HDAC and sirtuin enzymes, inflammatory cytokines, and anti-complement function. PAR-2 activation up-regulated four genes more than 5 fold (DUSP6, WWOX, AREG, SERPINB2 and down-regulated another six genes more than 3 fold (TXNIP, RARG, ITGB4, CTSD, MSC and TM4SF15. Both PAR2 and PAR1 activation resulted in up-regulated expression of several genes (CD44, FOSL1, TNFRSF12A, RAB3A, COPEB, CORO1C, THBS1, SDC4 known to be important in cancer. This is the first widespread profiling of specific activation of PAR2 and provides a valuable platform for better understanding key mechanistic roles of PAR2 in human physiology. Results clearly support the development of both antagonists and agonists of human PAR2 as potential disease modifying therapeutic agents.
RNA-Guided Activation of Pluripotency Genes in Human Fibroblasts
DEFF Research Database (Denmark)
Xiong, Kai; Zhou, Yan; Blichfeld, Kristian Aabo
2017-01-01
-associated protein 9 (dCas9)-VP64 (CRISPRa) alone, or a combination of dCas9-VP64 and MS2-P65-HSF1 [synergistic activation mediator (SAM) system] mediated activation of five pluripotency genes: KLF4 (K), LIN28 (L), MYC (M), OCT4 (O), and SOX2 (S) in human cells (HEK293T, HeLa, HepG2, and primary fibroblasts...... could be obtained from these SAM fibroblasts. In conclusion, our study showed that CRISPR/Cas9-based ATFs are potent to activate and maintain transcription of endogenous human pluripotent genes. However, future improvements of the system are still required to improve activation efficiency and cellular...
Directory of Open Access Journals (Sweden)
Charanpreet eKaur
2015-09-01
Full Text Available Methylglyoxal (MG is a toxic metabolite produced primarily as a byproduct of glycolysis. Being a potent glycating agent, it can readily bind macromolecules like DNA, RNA or proteins, modulating their expression and activity. In plants, despite the known inhibitory effects of MG on growth and development, still limited information is available about the molecular mechanisms and response pathways elicited upon elevation in MG levels. To gain insight into the molecular basis of MG response, we have investigated changes in global gene expression profiles in rice upon exposure to exogenous MG using GeneChip microarrays. Initially, growth of rice seedlings was monitored in response to increasing MG concentrations which could retard plant growth in a dose-dependent manner. Upon exposure to 10 mM concentration of MG, a total of 1685 probe sets were up- or down-regulated by more than 1.5-fold in shoot tissues within 16 h. These were classified into ten functional categories. The genes involved in signal transduction such as, protein kinases and transcription factors, were significantly over-represented in the perturbed transcriptome, of which several are known to be involved in abiotic and biotic stress response indicating a cross-talk between MG-responsive and stress-responsive signal transduction pathways. Through in silico studies, we could predict 7-8 bp long conserved motif as a possible MG-responsive element (MGRE in the 1 kb upstream region of genes that were more than ten-fold up- or down-regulated in the analysis. Since several perturbations were found in signaling cascades in response to MG, we hereby suggest that it plays an important role in signal transduction probably acting as a stress signal molecule.
Directory of Open Access Journals (Sweden)
Buro Lauren J
2010-09-01
Full Text Available Abstract Background Signal transducer and activator of transcription (STAT activation of gene expression is both rapid and transient, and when properly executed it affects growth, differentiation, homeostasis and the immune response, but when dysregulated it contributes to human disease. Transcriptional activation is regulated by alterations to the chromatin template. However, the role of histone modification at gene loci that are activated for transcription in response to STAT signaling is poorly defined. Results Using chromatin immunoprecipitation, we profiled several histone modifications during STAT1 activation of the interferon regulatory factor 1 gene (IRF1. Methylated lysine histone proteins H3K4me2, H3K4me3, H3K79me3, H3K36me3 and monoubiquitinated histone ubH2B are dynamic and correlate with interferon (IFNγ induction of STAT1 activity. Chemical inhibition of H3K4 methylation downregulates IRF1 transcription and decreases RNA polymerase II (Pol II occupancy at the IRF1 promoter. MEN1, a component of a complex proteins associated with Set1 (COMPASS-like complex and the hBRE1 component, RNF20, are localized to IRF1 in the uninduced state and are further recruited when IRF1 is activated. RNAi-mediated depletion of RNF20 lowers both ubH2B and H3K4me3, but surprisingly, upregulates IFNγ induced IRF1 transcription. The dynamics of phosphorylation in the C-terminal domain (CTD of Pol II are disrupted during gene activation as well. Conclusions H2B monoubiquitination promotes H3K4 methylation, but the E3 ubiquitin ligase, RNF20, is repressive of inducible transcription at the IRF1 gene locus, suggesting that ubH2B can, directly or indirectly, affect Pol II CTD phosphorylation cycling to exert control on ongoing transcription.
Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.
Directory of Open Access Journals (Sweden)
Josefin Skogsberg
2008-03-01
Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.
Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.
Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano
2017-10-01
The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.
Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.
Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D
2005-04-15
Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage.
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
Stochastic biological response to radiation. Comprehensive analysis of gene expression
International Nuclear Information System (INIS)
Inoue, Tohru; Hirabayashi, Yoko
2012-01-01
Authors explain that the radiation effect on biological system is stochastic along the law of physics, differing from chemical effect, using instances of Cs-137 gamma-ray (GR) and benzene (BZ) exposures to mice and of resultant comprehensive analyses of gene expression. Single GR irradiation is done with Gamma Cell 40 (CSR) to C57BL/6 or C3H/He mouse at 0, 0.6 and 3 Gy. BE is given orally at 150 mg/kg/day for 5 days x 2 weeks. Bone marrow cells are sampled 1 month after the exposure. Comprehensive gene expression is analyzed by Gene Chip Mouse Genome 430 2.0 Array (Affymetrix) and data are processed by programs like case normalization, statistics, network generation, functional analysis etc. GR irradiation brings about changes of gene expression, which are classifiable in common genes variable commonly on the dose change and stochastic genes variable stochastically within each dose: e.g., with Welch-t-test, significant differences are between 0/3 Gy (dose-specific difference, 455 pbs (probe set), in stochastic 2113 pbs), 0/0.6 Gy (267 in 1284 pbs) and 0.6/3 Gy (532 pbs); and with one-way analysis of variation (ANOVA) and hierarchial/dendrographic analyses, 520 pbs are shown to involve the dose-dependent 226 and dose-specific 294 pbs. It is also shown that at 3 Gy, expression of common genes are rather suppressed, including those related to the proliferation/apoptosis of B/T cells, and of stochastic genes, related to cell division/signaling. Ven diagram of the common genes of above 520 pbs, stochastic 2113 pbs at 3 Gy and 1284 pbs at 0.6 Gy shows the overlapping genes 29, 2 and 4, respectively, indicating only 35 pbs are overlapping in total. Network analysis of changes by GR shows the rather high expression of genes around hub of cAMP response element binding protein (CREB) at 0.6 Gy, and rather variable expression around CREB hub/suppressed expression of kinesin hub at 3 Gy; in the network by BZ exposure, unchanged or low expression around p53 hub and suppression
Directory of Open Access Journals (Sweden)
David J. Burks
2016-12-01
Full Text Available The Auxin Response Factor (ARF family of transcription factors is an important regulator of environmental response and symbiotic nodulation in the legume Medicago truncatula. While previous studies have identified members of this family, a recent spurt in gene expression data coupled with genome update and reannotation calls for a reassessment of the prevalence of ARF genes and their interaction networks in M. truncatula. We performed a comprehensive analysis of the M. truncatula genome and transcriptome that entailed search for novel ARF genes and the co-expression networks. Our investigation revealed 8 novel M. truncatula ARF (MtARF genes, of the total 22 identified, and uncovered novel gene co-expression networks as well. Furthermore, the topological clustering and single enrichment analysis of several network models revealed the roles of individual members of the MtARF family in nitrogen regulation, nodule initiation, and post-embryonic development through a specialized protein packaging and secretory pathway. In summary, this study not just shines new light on an important gene family, but also provides a guideline for identification of new members of gene families and their functional characterization through network analyses.
Directory of Open Access Journals (Sweden)
Toni Jernfors
2018-01-01
Full Text Available Exposure to ionizing radiation (IR from radionuclides released into the environment can damage DNA. An expected response to exposure to environmental radionuclides, therefore, is initiation of DNA damage response (DDR pathways. Increased DNA damage is a characteristic of many organisms exposed to radionuclides but expression of DDR genes of wildlife inhabiting an area contaminated by radionuclides is poorly understood. We quantified expression of five central DDR genes Atm, Mre11, p53, Brca1, and p21 in the livers of the bank vole Myodes glareolus that inhabited areas within the Chernobyl Exclusion Zone (CEZ that differed in levels of ambient radioactivity, and also from control areas outside the CEZ (i.e., sites with no detectable environmental radionuclides in Ukraine. Expression of these DDR genes did not significantly differ between male and female bank voles, nor among sites within the CEZ. We found a near two-fold upregulation in the DDR initiators Mre11 and Atm in animals collected from the CEZ compared with samples from control sites. As Atm is an important regulator of oxidative stress, our data suggest that antioxidant activity may be a key component of the defense against exposure to environmental radioactivity.
Directory of Open Access Journals (Sweden)
Alexander A. Dolskiy
2017-01-01
Full Text Available Fragile X syndrome is the most common cause of inherited intellectual disability in humans. It is a result of CGG repeat expansion in the 5′ untranslated region (5′ UTR of the FMR1 gene. This gene encodes the FMRP protein that is involved in neuronal development. Repeat expansion leads to heterochromatinization of the promoter, gene silencing, and the subsequent absence of FMRP. To date, there is no specific therapy for the syndrome. All treatments in clinic practice provide symptomatic therapy. The development of drug therapy for Fragile X syndrome treatment is connected with the search for inhibitors of enzymes that are responsible for heterochromatinization. Here, we report a weak transcriptional activity of the FMR1 gene and the absence of FMRP protein after Fragile X syndrome cell lines treatment with two FDA approved inhibitors of histone deacetylases, romidepsin and vorinostat. We demonstrate that romidepsin, an inhibitor of class I histone deacetylases, does not activate FMR1 expression in patient cell cultures, whereas vorinostat, an inhibitor of classes I and II histone deacetylases, activates a low level of FMR1 expression in some patient cell lines.
Reddy, Bhaskar; Singh, Krishna M; Patel, Amrutlal K; Antony, Ancy; Panchasara, Harshad J; Joshi, Chaitanya G
2014-10-01
Buffalo rumen microbiota experience variety of diets and represents a huge reservoir of mobilome, resistome and stress responses. However, knowledge of metagenomic responses to such conditions is still rudimentary. We analyzed the metagenomes of buffalo rumen in the liquid and solid phase of the rumen biomaterial from river buffalo adapted to varying proportion of concentrate to green or dry roughages, using high-throughput sequencing to know the occurrence of antibiotics resistance genes, genetic exchange between bacterial population and environmental reservoirs. A total of 3914.94 MB data were generated from all three treatments group. The data were analysed with Metagenome rapid annotation system tools. At phyla level, Bacteroidetes were dominant in all the treatments followed by Firmicutes. Genes coding for functional responses to stress (oxidative stress and heat shock proteins) and resistome genes (resistance to antibiotics and toxic compounds, phages, transposable elements and pathogenicity islands) were prevalent in similar proportion in liquid and solid fraction of rumen metagenomes. The fluoroquinolone resistance, MDR efflux pumps and Methicillin resistance genes were broadly distributed across 11, 9, and 14 bacterial classes, respectively. Bacteria responsible for phages replication and prophages and phage packaging and rlt-like streptococcal phage genes were mostly assigned to phyla Bacteroides, Firmicutes and proteaobacteria. Also, more reads matching the sigma B genes were identified in the buffalo rumen. This study underscores the presence of diverse mechanisms of adaptation to different diet, antibiotics and other stresses in buffalo rumen, reflecting the proportional representation of major bacterial groups.
BRAIN NETWORKS. Correlated gene expression supports synchronous activity in brain networks.
Richiardi, Jonas; Altmann, Andre; Milazzo, Anna-Clare; Chang, Catie; Chakravarty, M Mallar; Banaschewski, Tobias; Barker, Gareth J; Bokde, Arun L W; Bromberg, Uli; Büchel, Christian; Conrod, Patricia; Fauth-Bühler, Mira; Flor, Herta; Frouin, Vincent; Gallinat, Jürgen; Garavan, Hugh; Gowland, Penny; Heinz, Andreas; Lemaître, Hervé; Mann, Karl F; Martinot, Jean-Luc; Nees, Frauke; Paus, Tomáš; Pausova, Zdenka; Rietschel, Marcella; Robbins, Trevor W; Smolka, Michael N; Spanagel, Rainer; Ströhle, Andreas; Schumann, Gunter; Hawrylycz, Mike; Poline, Jean-Baptiste; Greicius, Michael D
2015-06-12
During rest, brain activity is synchronized between different regions widely distributed throughout the brain, forming functional networks. However, the molecular mechanisms supporting functional connectivity remain undefined. We show that functional brain networks defined with resting-state functional magnetic resonance imaging can be recapitulated by using measures of correlated gene expression in a post mortem brain tissue data set. The set of 136 genes we identify is significantly enriched for ion channels. Polymorphisms in this set of genes significantly affect resting-state functional connectivity in a large sample of healthy adolescents. Expression levels of these genes are also significantly associated with axonal connectivity in the mouse. The results provide convergent, multimodal evidence that resting-state functional networks correlate with the orchestrated activity of dozens of genes linked to ion channel activity and synaptic function. Copyright © 2015, American Association for the Advancement of Science.
Casey, Janet; Pichichero, Michael
2016-01-01
Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644
Directory of Open Access Journals (Sweden)
Olivier J Becherel
2013-04-01
Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.
PF4-HIT antibody (KKO) complexes activate broad innate immune and inflammatory responses.
Haile, Lydia A; Rao, Roshni; Polumuri, Swamy K; Arepally, Gowthami M; Keire, David A; Verthelyi, Daniela; Sommers, Cynthia D
2017-11-01
Heparin-induced thrombocytopenia (HIT) is an immune-mediated complication of heparin anticoagulation therapy resulting in thrombocytopenia frequently accompanied by thrombosis. Current evidence suggests that HIT is associated with antibodies developed in response to multi-molecular complexes formed by platelet factor 4 (PF4) bound to heparin or cell surface glycosaminoglycans. These antibody complexes activate platelets and monocytes typically through FcγRIIA receptors increasing the production of PF4, inflammatory mediators, tissue factor and thrombin. The influence of underlying events in HIT including complex-induced pro-inflammatory cell activation and structural determinants leading to local inflammatory responses are not fully understood. The stoichiometry and complex component requirements were determined by incubating fresh peripheral blood mononuclear cells (PBMC) with different concentrations of unfractionated heparin (H), low molecular weight heparin (LMWH), PF4- and anti-PF4-H complex antibodies (KKO). Cytokine mRNA or protein were measured by qRT-PCR or Meso Scale Discovery technology, respectively. Gene expression profile analysis for 594 genes was performed using Nanostring technology and analyzed using Ingenuity Pathway Analysis software. The data show that antibodies magnify immune responses induced in PBMCs by PF4 alone or in complex with heparin or LMWH. We propose that following induction of HIT antibodies by heparin-PF4 complexes, binding of the antibodies to PF4 is sufficient to induce a local pro-inflammatory response which may play a role in the progression of HIT. In vitro assays using PBMCs may be useful in characterizing local inflammatory and innate immune responses induced by HIT antibodies in the presence of PF4 and different sources of heparins. The findings and conclusions in this article are solely the responsibility of the authors and are not being formally disseminated by the Food and Drug Administration. Thus, they should not be
The Role of Osteopontin and Its Gene on Glucocorticoid Response in Myasthenia Gravis
Directory of Open Access Journals (Sweden)
Yanchen Xie
2017-05-01
Full Text Available Biomarkers that assess treatment response for patients with the autoimmune disorder, myasthenia gravis (MG, have not been evaluated to a significant extent. We hypothesized the pro-inflammatory cytokine, osteopontin (OPN, may be associated with variability of response to glucocorticoids (GCs in patients with MG. A cohort of 250 MG patients treated with standardized protocol of GCs was recruited, and plasma OPN and polymorphisms of its gene, secreted phosphoprotein 1 (SPP1, were evaluated. Mean OPN levels were higher in patients compared to healthy controls. Carriers of rs11728697*T allele (allele definition: one of two or more alternative forms of a gene were more frequent in the poorly GC responsive group compared to the GC responsive group indicating an association of rs11728697*T allele with GC non-responsiveness. One risk haplotype (AGTACT was identified associated with GC non-responsiveness compared with GC responsive MG group. Genetic variations of SPP1 were found associated with the response to GC among MG patients.
Liao, Dehua; Chen, Xiao; Chen, Aiqun; Wang, Huimin; Liu, Jianjian; Liu, Junli; Gu, Mian; Sun, Shubin; Xu, Guohua
2015-04-01
In plants, the GH3 gene family is widely considered to be involved in a broad range of plant physiological processes, through modulation of hormonal homeostasis. Multiple GH3 genes have been functionally characterized in several plant species; however, to date, limited works to study the GH3 genes in tomato have been reported. Here, we characterize the expression and regulatory profiles of six tomato GH3 genes, SlGH3.2, SlGH3.3, SlGH3.4, SlGH3.7, SlGH3.9 and SlGH3.15, in response to different phytohormone applications and arbuscular mycorrhizal (AM) fungal colonization. All six GH3 genes showed inducible responses to external IAA, and three members were significantly up-regulated in response to AM symbiosis. In particular, SlGH3.4, the transcripts of which were barely detectable under normal growth conditions, was strongly activated in the IAA-treated and AM fungal-colonized roots. A comparison of the SlGH3.4 expression in wild-type plants and M161, a mutant with a defect in AM symbiosis, confirmed that SlGH3.4 expression is highly correlated to mycorrhizal colonization. Histochemical staining demonstrated that a 2,258 bp SlGH3.4 promoter fragment could drive β-glucuronidase (GUS) expression strongly in root tips, steles and cortical cells of IAA-treated roots, but predominantly in the fungal-colonized cells of mycorrhizal roots. A truncated 654 bp promoter failed to direct GUS expression in IAA-treated roots, but maintained the symbiosis-induced activity in mycorrhizal roots. In summary, our results suggest that a mycorrhizal signaling pathway that is at least partially independent of the auxin signaling pathway has evolved for the co-regulation of the auxin- and mycorrhiza-activated GH3 genes in plants. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Guillermo Reboledo
2015-09-01
Full Text Available The moss Physcomitrella patens is a suitable model plant to analyze the activation of defense mechanisms after pathogen assault. In this study, we show that Colletotrichum gloeosporioides isolated from symptomatic citrus fruit infects P. patens and cause disease symptoms evidenced by browning and maceration of tissues. After C. gloeosporioides infection, P. patens reinforces the cell wall by the incorporation of phenolic compounds and induces the expression of a Dirigent-protein-like encoding gene that could lead to the formation of lignin-like polymers. C. gloeosporioides-inoculated protonemal cells show cytoplasmic collapse, browning of chloroplasts and modifications of the cell wall. Chloroplasts relocate in cells of infected tissues toward the initially infected C. gloeosporioides cells. P. patens also induces the expression of the defense genes PAL and CHS after fungal colonization. P. patens reporter lines harboring the auxin-inducible promoter from soybean (GmGH3 fused to β-glucuronidase revealed an auxin response in protonemal tissues, cauloids and leaves of C. gloeosporioides-infected moss tissues, indicating the activation of auxin signaling. Thus, P. patens is an interesting plant to gain insight into defense mechanisms that have evolved in primitive land plants to cope with microbial pathogens.
Directory of Open Access Journals (Sweden)
Maria Maqueda
Full Text Available Gene expression (GE analyses on blood samples from marathon and half-marathon runners have reported significant impacts on the immune and inflammatory systems. An ultra-marathon trail (UMT represents a greater effort due to its more testing conditions. For the first time, we report the genome-wide GE profiling in a group of 16 runners participating in an 82 km UMT competition. We quantified their differential GE profile before and after the race using HuGene2.0st microarrays (Affymetrix Inc., California, US. The results obtained were decomposed by means of an independent component analysis (ICA targeting independent expression modes. We observed significant differences in the expression levels of 5,084 protein coding genes resulting in an overrepresentation of 14% of the human biological pathways from the Kyoto Encyclopedia of Genes and Genomes database. These were mainly clustered on terms related with protein synthesis repression, altered immune system and infectious diseases related mechanisms. In a second analysis, 27 out of the 196 transcriptional regulators (TRs included in the Open Regulatory Annotation database were overrepresented. Among these TRs, we identified transcription factors from the hypoxia-inducible factors (HIF family EPAS1 (p< 0.01 and HIF1A (p<0.001, and others jointly described in the gluconeogenesis program such as HNF4 (p< 0.001, EGR1 (p<0.001, CEBPA (p< 0.001 and a highly specific TR, YY1 (p<0.01. The five independent components, obtained from ICA, further revealed a down-regulation of 10 genes distributed in the complex I, III and V from the electron transport chain. This mitochondrial activity reduction is compatible with HIF-1 system activation. The vascular endothelial growth factor (VEGF pathway, known to be regulated by HIF, also emerged (p<0.05. Additionally, and related to the brain rewarding circuit, the endocannabinoid signalling pathway was overrepresented (p<0.05.
Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S
2011-02-01
Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.
Directory of Open Access Journals (Sweden)
Johan Øvrevik
2015-07-01
Full Text Available Inflammation is considered to play a central role in a diverse range of disease outcomes associated with exposure to various types of inhalable particulates. The initial mechanisms through which particles trigger cellular responses leading to activation of inflammatory responses are crucial to clarify in order to understand what physico-chemical characteristics govern the inflammogenic activity of particulate matter and why some particles are more harmful than others. Recent research suggests that molecular triggering mechanisms involved in activation of proinflammatory genes and onset of inflammatory reactions by particles or soluble particle components can be categorized into direct formation of reactive oxygen species (ROS with subsequent oxidative stress, interaction with the lipid layer of cellular membranes, activation of cell surface receptors, and direct interactions with intracellular molecular targets. The present review focuses on the immediate effects and responses in cells exposed to particles and central down-stream signaling mechanisms involved in regulation of proinflammatory genes, with special emphasis on the role of oxidant and non-oxidant triggering mechanisms. Importantly, ROS act as a central second-messenger in a variety of signaling pathways. Even non-oxidant mediated triggering mechanisms are therefore also likely to activate downstream redox-regulated events.
Mössner, R; Schumacher, A; Wagner, M; Lennertz, L; Steinbrecher, A; Quednow, Boris B; Rujescu, D; Rietschel, M; Maier, W
2012-01-01
Genetic factors determining the response to antipsychotic treatment in schizophrenia are poorly understood. A new schizophrenia susceptibility gene, the zinc-finger gene ZNF804A, has recently been identified. To assess the pharmacogenetic importance of this gene, we treated 144 schizophrenia patients and assessed the response of positive and negative symptoms by PANSS. Patients homozygous for the ZNF804A risk allele for schizophrenia (rs1344706 AA) showed poorer improvement of positive sympto...
Hypoxia-Inducible Regulation of a Prodrug-Activating Enzyme for Tumor-Specific Gene Therapy
Directory of Open Access Journals (Sweden)
Toru Shibata
2002-01-01
Full Text Available Previous studies have suggested that tumor hypoxia could be exploited for cancer gene therapy. Using hypoxia-responsive elements derived from the human vascular endothelial growth factor gene, we have generated vectors expressing a bacterial nitroreductase. (20NTR gene that can activate the anticancer prodrug CB1954. Stable transfectants of human HT1080 tumor cells with hypoxia-inducible vectors were established with G418 selection. Hypoxic induction of NTR protein correlated with increased sensitivity to in vitro exposure of HT 1080 cells to the prodrug. Growth delay assays were performed with established tumor xenografts derived from the same cells to detect the in vivo efficacy of CB1954 conversion to its cytotoxic form. Significant antitumor effects were achieved with intraperitoneal injections of CB1954 both in tumors that express NTR constitutively or with a hypoxia-inducible promoter. In addition, respiration of 10% O2 increased tumor hypoxia in vivo and enhanced the antitumor effects. Taken together, these results demonstrate that hypoxia-inducible vectors may be useful for tumor-selective gene therapy, although the problem of delivery of the vector to the tumors, particularly to the hypoxic cells in the tumors, is not addressed by these studies.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Directory of Open Access Journals (Sweden)
Katherine M. Buckley
2017-10-01
Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
DEPTOR regulates vascular endothelial cell activation and proinflammatory and angiogenic responses.
Bruneau, Sarah; Nakayama, Hironao; Woda, Craig B; Flynn, Evelyn A; Briscoe, David M
2013-09-05
The maintenance of normal tissue homeostasis and the prevention of chronic inflammatory disease are dependent on the active process of inflammation resolution. In endothelial cells (ECs), proinflammation results from the activation of intracellular signaling responses and/or the inhibition of endogenous regulatory/pro-resolution signaling networks that, to date, are poorly defined. In this study, we find that DEP domain containing mTOR interacting protein (DEPTOR) is expressed in different microvascular ECs in vitro and in vivo, and using a small interfering RNA (siRNA) knockdown approach, we find that it regulates mammalian target of rapamycin complex 1 (mTORC1), extracellular signal-regulated kinase 1/2, and signal transducer and activator of transcription 1 activation in part through independent mechanisms. Moreover, using limited gene arrays, we observed that DEPTOR regulates EC activation including mRNA expression of the T-cell chemoattractant chemokines CXCL9, CXCL10, CXCL11, CX3CL1, CCL5, and CCL20 and the adhesion molecules intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 (P < .05). DEPTOR siRNA-transfected ECs also bound increased numbers of peripheral blood mononuclear cells (P < .005) and CD3+ T cells (P < .005) in adhesion assays in vitro and had increased migration and angiogenic responses in spheroid sprouting (P < .01) and wound healing (P < .01) assays. Collectively, these findings define DEPTOR as a critical upstream regulator of EC activation responses and suggest that it plays an important role in endogenous mechanisms of anti-inflammation and pro-resolution.
Machado, Vilmar; Serrano, Jose; Galián, Jose
2016-01-01
The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.
Parnaudeau, Sébastien; Dongelmans, Marie-louise; Turiault, Marc; Ambroggi, Frédéric; Delbes, Anne-Sophie; Cansell, Céline; Luquet, Serge; Piazza, Pier-Vincenzo; Tronche, François; Barik, Jacques
2014-01-01
The meso-cortico-limbic system, via dopamine release, encodes the rewarding and reinforcing properties of natural rewards. It is also activated in response to abused substances and is believed to support drug-related behaviors. Dysfunctions of this system lead to several psychiatric conditions including feeding disorders and drug addiction. These disorders are also largely influenced by environmental factors and in particular stress exposure. Stressors activate the corticotrope axis ultimately leading to glucocorticoid hormone (GCs) release. GCs bind the glucocorticoid receptor (GR) a transcription factor ubiquitously expressed including within the meso-cortico-limbic tract. While GR within dopamine-innervated areas drives cocaine's behavioral responses, its implication in responses to other psychostimulants such as amphetamine has never been clearly established. Moreover, while extensive work has been made to uncover the role of this receptor in addicted behaviors, its contribution to the rewarding and reinforcing properties of food has yet to be investigated. Using mouse models carrying GR gene inactivation in either dopamine neurons or in dopamine-innervated areas, we found that GR in dopamine responsive neurons is essential to properly build amphetamine-induced conditioned place preference and locomotor sensitization. c-Fos quantification in the nucleus accumbens further confirmed defective neuronal activation following amphetamine injection. These diminished neuronal and behavioral responses to amphetamine may involve alterations in glutamate transmission as suggested by the decreased MK801-elicited hyperlocomotion and by the hyporeactivity to glutamate of a subpopulation of medium spiny neurons. In contrast, GR inactivation did not affect rewarding and reinforcing properties of food suggesting that responding for natural reward under basal conditions is preserved in these mice. PMID:24574986
Directory of Open Access Journals (Sweden)
Sebastien eParnaudeau
2014-02-01
Full Text Available The meso-cortico-limbic system, via dopamine release, encodes the rewarding and reinforcing properties of natural rewards. It is also activated in response to abused substances and is believed to support drug-related behaviors. Dysfunctions of this system lead to several psychiatric conditions including feeding disorders and drug addiction. These disorders are also largely influenced by environmental factors and in particular stress exposure. Stressors activate the corticotrope axis ultimately leading to glucocorticoid hormone (GCs release. GCs bind the glucocorticoid receptor (GR a transcription factor ubiquitously expressed including within the meso-cortico-limbic tract. While the GR within dopamine-innervated areas drives cocaine’s behavioral responses, its implication in responses to other psychostimulants such as amphetamine has never been clearly established. Moreover, while extensive work has been made to uncover the role of this receptor in addicted behaviors, its contribution to the rewarding and reinforcing properties of food has yet to be investigated. Using mouse models carrying GR gene inactivation in either dopamine neurons or in dopamine-innervated areas, we found that GR in dopamine responsive neurones is essential to properly build amphetamine-induced conditioned place preference and locomotor sensitization. c-Fos quantification in the nucleus accumbens further confirmed defective neuronal activation following amphetamine injection. These diminished neuronal and behavioral responses to amphetamine may involve alterations in glutamate transmission as suggested by the decreased MK801-elicited hyperlocomotion and by the hyporeactivity to glutamate of a subpopulation of medium spiny neurons. In contrast, GR inactivation did not affect rewarding and reinforcing properties of food suggesting that responding for natural reward under basal conditions is preserved in these mice.
Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk
2015-01-01
Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly ...
Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults
International Nuclear Information System (INIS)
Navarro, Anna; Faria, Melissa; Barata, Carlos; Pina, Benjamin
2011-01-01
Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.
Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults
Energy Technology Data Exchange (ETDEWEB)
Navarro, Anna; Faria, Melissa; Barata, Carlos [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain); Pina, Benjamin, E-mail: bpcbmc@cid.csic.e [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain)
2011-01-15
Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.
Energy Technology Data Exchange (ETDEWEB)
Yang, Ji Hye; Shin, Bo Yeon; Han, Jae Yun; Kim, Mi Gwang; Wi, Ji Eun [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Kim, Young Woo; Cho, Il Je; Kim, Sang Chan [Medical Research Center for Globalization of Herbal Formulation, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715 (Korea, Republic of); Shin, Sang Mi [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of)
2014-01-15
Isorhamentin is a 3′-O-methylated metabolite of quercetin, and has been reported to have anti-inflammatory and anti-proliferative effects. However, the effects of isorhamnetin on Nrf2 activation and on the expressions of its downstream genes in hepatocytes have not been elucidated. Here, we investigated whether isorhamnetin has the ability to activate Nrf2 and induce phase II antioxidant enzyme expression, and to determine the protective role of isorhamnetin on oxidative injury in hepatocytes. In HepG2 cells, isorhamnetin increased the nuclear translocation of Nrf2 in a dose- and time-dependent manner, and consistently, increased antioxidant response element (ARE) reporter gene activity and the protein levels of hemeoxygenase (HO-1) and of glutamate cysteine ligase (GCL), which resulted in intracellular GSH level increases. The specific role of Nrf2 in isorhamnetin-induced Nrf2 target gene expression was verified using an ARE-deletion mutant plasmid and Nrf2-knockout MEF cells. Deletion of the ARE in the promoter region of the sestrin2 gene, which is recently identified as the Nrf2 target gene by us, abolished the ability of isorhamnetin to increase luciferase activity. In addition, Nrf2 deficiency completely blocked the ability of isorhamnetin to induce HO-1 and GCL. Furthermore, isorhamnetin pretreatment blocked t-BHP-induced ROS production and reversed GSH depletion by t-BHP and consequently, due to reduced ROS levels, decreased t-BHP-induced cell death. In addition isorhamnetin increased ERK1/2, PKCδ and AMPK phosphorylation. Finally, we showed that Nrf2 deficiency blocked the ability of isorhamnetin to protect cells from injury induced by t-BHP. Taken together, our results demonstrate that isorhamnetin is efficacious in protecting hepatocytes against oxidative stress by Nrf2 activation and in inducing the expressions of its downstream genes. - Highlights: • We investigated the effect of isorhamnetin on Nrf2 activation. • Isorhamnetin increased Nrf2
Directory of Open Access Journals (Sweden)
Tetu Bernard
2008-02-01
Full Text Available Abstract Background Chemotherapy (CT resistance in ovarian cancer (OC is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155, following treatment with 10,0 μM cisplatin, 2,5 μM paclitaxel or 5,0 μM topotecan for 72 hours. Results Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism, signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes, cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Conclusion Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular
Directory of Open Access Journals (Sweden)
Mo-bin Cheng
2014-12-01
Full Text Available Histone lysine (K residues, which are modified by methyl- and acetyl-transferases, diversely regulate RNA synthesis. Unlike the ubiquitously activating effect of histone K acetylation, the effects of histone K methylation vary with the number of methyl groups added and with the position of these groups in the histone tails. Histone K demethylases (KDMs counteract the activity of methyl-transferases and remove methyl group(s from specific K residues in histones. KDM3A (also known as JHDM2A or JMJD1A is an H3K9me2/1 demethylase. KDM3A performs diverse functions via the regulation of its associated genes, which are involved in spermatogenesis, metabolism, and cell differentiation. However, the mechanism by which the activity of KDM3A is regulated is largely unknown. Here, we demonstrated that mitogen- and stress-activated protein kinase 1 (MSK1 specifically phosphorylates KDM3A at Ser264 (p-KDM3A, which is enriched in the regulatory regions of gene loci in the human genome. p-KDM3A directly interacts with and is recruited by the transcription factor Stat1 to activate p-KDM3A target genes under heat shock conditions. The demethylation of H3K9me2 at the Stat1 binding site specifically depends on the co-expression of p-KDM3A in the heat-shocked cells. In contrast to heat shock, IFN-γ treatment does not phosphorylate KDM3A via MSK1, thereby abrogating its downstream effects. To our knowledge, this is the first evidence that a KDM can be modified via phosphorylation to determine its specific binding to target genes in response to thermal stress.
Gene expression profile of the fibrotic response in the peritoneal cavity.
Le, S J; Gongora, M; Zhang, B; Grimmond, S; Campbell, G R; Campbell, J H; Rolfe, B E
2010-01-01
The cellular response to materials implanted in the peritoneal cavity has been utilised to produce tissue for grafting to hollow smooth muscle organs (blood vessels, bladder, uterus and vas deferens). To gain insight into the regulatory mechanisms involved in encapsulation of a foreign object, and subsequent differentiation of encapsulating cells, the present study used microarray technology and real-time RT-PCR to identify the temporal changes in gene expression associated with tissue development. Immunohistochemical analysis showed that 3-7 days post-implantation of foreign objects (cubes of boiled egg white) into rats, they were encapsulated by tissue comprised primarily of haemopoietic (CD45(+)) cells, mainly macrophages (CD68(+), CCR1(+)). By day 14, tissue capsule cells no longer expressed CD68, but were positive for myofibroblast markers alpha-smooth muscle (SM) actin and SM22. In accordance with these results, gene expression data showed that early capsule (days 3-7) development was dominated by the expression of monocyte/macrophage-specific genes (CD14, CSF-1, CSF-1R, MCP-1) and pro-inflammatory mediators such as transforming growth factor (TGF-beta). As tissue capsule development progressed (days 14-21), myofibroblast-associated and pro-fibrotic genes (associated with TGF-beta and Wnt/beta-catenin signalling pathways, including Wnt 4, TGFbetaRII, connective tissue growth factor (CTGF), SMADs-1, -2, -4 and collagen-1 subunits) were significantly up-regulated. The up-regulation of genes associated with Cardiovascular and Skeletal and Muscular System Development at later time-points suggests the capacity of cells within the tissue capsule for further differentiation to smooth muscle, and possibly other cell types. The identification of key regulatory pathways and molecules associated with the fibrotic response to implanted materials has important applications not only for optimising tissue engineering strategies, but also to control deleterious fibrotic
Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.
2011-01-01
Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of p0.01, 79 genes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.
Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong
2017-09-11
Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.
Putative resistance genes in the CitEST database
Directory of Open Access Journals (Sweden)
Simone Guidetti-Gonzalez
2007-01-01
Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.
Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon
2013-04-01
To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.
Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki
2004-01-01
The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894
Lim, Pek Siew; Hardy, Kristine; Peng, Kaiman; Shannon, Frances M.
2015-01-01
T cell activation involves the recognition of a foreign antigen complexed to the major histocompatibility complex on the antigen presenting T cell to the T cell receptor. This leads to activation of signaling pathways, which ultimately leads to induction of key cytokine genes responsible for eradication of foreign antigens. We used the mouse EL4 T cell as a model system to study genes that are induced as a result of T cell activation using phorbol myristate acetate (PMA) and calcium ionomycin...
Baebler, Š; Witek, K; Petek, M; Stare, K; Tušek-Žnidarič, M; Pompe-Novak, M; Renaut, J; Szajko, K; Strzelczyk-Żyta, D; Marczewski, W; Morgiewicz, K; Gruden, K; Hennig, J
2014-03-01
The purpose of the study was to investigate the role of salicylic acid (SA) signalling in Ny-1-mediated hypersensitive resistance (HR) of potato (Solanum tuberosum L.) to Potato virus Y (PVY). The responses of the Ny-1 allele in the Rywal potato cultivar and transgenic NahG-Rywal potato plants that do not accumulate SA were characterized at the cytological, biochemical, transcriptome, and proteome levels. Analysis of noninoculated and inoculated leaves revealed that HR lesions started to develop from 3 d post inoculation and completely restricted the virus spread. At the cytological level, features of programmed cell death in combination with reactive oxygen species burst were observed. In response to PVY infection, SA was synthesized de novo. The lack of SA accumulation in the NahG plants led to the disease phenotype due to unrestricted viral spreading. Grafting experiments show that SA has a critical role in the inhibition of PVY spreading in parenchymal tissue, but not in vascular veins. The whole transcriptome analysis confirmed the central role of SA in orchestrating Ny-1-mediated responses and showed that the absence of SA leads to significant changes at the transcriptome level, including a delay in activation of expression of genes known to participate in defence responses. Moreover, perturbations in the expression of hormonal signalling genes were detected, shown as a switch from SA to jasmonic acid/ethylene signalling. Viral multiplication in the NahG plants was accompanied by downregulation of photosynthesis genes and activation of multiple energy-producing pathways.
Evolutionary relationships between miRNA genes and their activity.
Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue
2012-12-22
The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.
Abbasi, Asghar; de Paula Vieira, Rodolfo; Bischof, Felix; Walter, Michael; Movassaghi, Masoud; Berchtold, Nicole C; Niess, Andreas M; Cotman, Carl W; Northoff, Hinnak
2016-11-10
While exercise effects on the immune system have received increasing attention in recent years, it remains unclear to what extent gender and fluctuations in sex hormones during menstrual cycle influence immunological responses to exercise. We investigated mRNA changes induced through exhaustive exercise (half-marathon; pre-exercise and post-exercise [30 min, 3 h, 24 h] on whole blood cultures ± lipopolysaccharide [LPS] [1 h]) with a specific focus on sex differences (men vs women in luteal phase) as an extension of our previous study. Inflammation related signaling pathways, TLRs, cytosolic DNA sensing and RIG-I like receptors were differentially activated between sexes in LPS-stimulated cultures. Genes differentially regulated between sexes included TNIP-1, TNIP-3, IL-6, HIVEP1, CXCL3, CCR3, IL-8, and CD69, revealing a bias towards less anti-inflammatory gene regulation in women compared to men. In addition, several genes relevant to brain function (KMO, DDIT4, VEGFA, IGF1R, IGF2R, and FGD4) showed differential activation between sexes. Some of these genes (e.g., KMO in women, DDIT4 in both sexes) potentially constitute neuroprotective mechanisms. These data reveal that the exercise-induced change in gene expression might be gender and menstrual cycle phase dependent.
Carucci, Nicoletta; Cacci, Emanuele; Nisi, Paola S; Licursi, Valerio; Paul, Yu-Lee; Biagioni, Stefano; Negri, Rodolfo; Rugg-Gunn, Peter J; Lupo, Giuseppe
2017-04-01
During vertebrate neural development, positional information is largely specified by extracellular morphogens. Their distribution, however, is very dynamic due to the multiple roles played by the same signals in the developing and adult neural tissue. This suggests that neural progenitors are able to modify their competence to respond to morphogen signalling and autonomously maintain positional identities after their initial specification. In this work, we take advantage of in vitro culture systems of mouse neural stem/progenitor cells (NSPCs) to show that NSPCs isolated from rostral or caudal regions of the mouse neural tube are differentially responsive to retinoic acid (RA), a pivotal morphogen for the specification of posterior neural fates. Hoxb genes are among the best known RA direct targets in the neural tissue, yet we found that RA could promote their transcription only in caudal but not in rostral NSPCs. Correlating with these effects, key RA-responsive regulatory regions in the Hoxb cluster displayed opposite enrichment of activating or repressing histone marks in rostral and caudal NSPCs. Finally, RA was able to strengthen Hoxb chromatin activation in caudal NSPCs, but was ineffective on the repressed Hoxb chromatin of rostral NSPCs. These results suggest that the response of NSPCs to morphogen signalling across the rostrocaudal axis of the neural tube may be gated by the epigenetic configuration of target patterning genes, allowing long-term maintenance of intrinsic positional values in spite of continuously changing extrinsic signals.
Ascorbic acid deficiency activates cell death and disease resistance responses in Arabidopsis.
Pavet, Valeria; Olmos, Enrique; Kiddle, Guy; Mowla, Shaheen; Kumar, Sanjay; Antoniw, John; Alvarez, María E; Foyer, Christine H
2005-11-01
Programmed cell death, developmental senescence, and responses to pathogens are linked through complex genetic controls that are influenced by redox regulation. Here we show that the Arabidopsis (Arabidopsis thaliana) low vitamin C mutants, vtc1 and vtc2, which have between 10% and 25% of wild-type ascorbic acid, exhibit microlesions, express pathogenesis-related (PR) proteins, and have enhanced basal resistance against infections caused by Pseudomonas syringae. The mutants have a delayed senescence phenotype with smaller leaf cells than the wild type at maturity. The vtc leaves have more glutathione than the wild type, with higher ratios of reduced glutathione to glutathione disulfide. Expression of green fluorescence protein (GFP) fused to the nonexpressor of PR protein 1 (GFP-NPR1) was used to detect the presence of NPR1 in the nuclei of transformed plants. Fluorescence was observed in the nuclei of 6- to 8-week-old GFP-NPR1 vtc1 plants, but not in the nuclei of transformed GFP-NPR1 wild-type plants at any developmental stage. The absence of senescence-associated gene 12 (SAG12) mRNA at the time when constitutive cell death and basal resistance were detected confirms that elaboration of innate immune responses in vtc plants does not result from activation of early senescence. Moreover, H2O2-sensitive genes are not induced at the time of systemic acquired resistance execution. These results demonstrate that ascorbic acid abundance modifies the threshold for activation of plant innate defense responses via redox mechanisms that are independent of the natural senescence program.
Gene expression response to EWS–FLI1 in mouse embryonic cartilage
Directory of Open Access Journals (Sweden)
Miwa Tanaka
2014-12-01
Full Text Available Ewing's sarcoma is a rare bone tumor that affects children and adolescents. We have recently succeeded to induce Ewing's sarcoma-like small round cell tumor in mice by expression of EWS–ETS fusion genes in murine embryonic osteochondrogenic progenitors. The Ewing's sarcoma precursors are enriched in embryonic superficial zone (eSZ cells of long bone. To get insights into the mechanisms of Ewing's sarcoma development, gene expression profiles between EWS–FLI1-sensitive eSZ cells and EWS–FLI1-resistant embryonic growth plate (eGP cells were compared using DNA microarrays. Gene expression of eSZ and eGP cells (total, 30 samples was evaluated with or without EWS–FLI1 expression 0, 8 or 48 h after gene transduction. Our data provide useful information for gene expression responses to fusion oncogenes in human sarcoma.
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Directory of Open Access Journals (Sweden)
Aili Li
Full Text Available Hydrogen peroxide (H(2O(2 plays important roles in plant biotic and abiotic stress responses. However, the effect of H(2O(2 stress on the bread wheat transcriptome is still lacking. To investigate the cellular and metabolic responses triggered by H(2O(2, we performed an mRNA tag analysis of wheat seedlings under 10 mM H(2O(2 treatment for 6 hour in one powdery mildew (PM resistant (PmA and two susceptible (Cha and Han lines. In total, 6,156, 6,875 and 3,276 transcripts were found to be differentially expressed in PmA, Han and Cha respectively. Among them, 260 genes exhibited consistent expression patterns in all three wheat lines and may represent a subset of basal H(2O(2 responsive genes that were associated with cell defense, signal transduction, photosynthesis, carbohydrate metabolism, lipid metabolism, redox homeostasis, and transport. Among genes specific to PmA, 'transport' activity was significantly enriched in Gene Ontology analysis. MapMan classification showed that, while both up- and down- regulations were observed for auxin, abscisic acid, and brassinolides signaling genes, the jasmonic acid and ethylene signaling pathway genes were all up-regulated, suggesting H(2O(2-enhanced JA/Et functions in PmA. To further study whether any of these genes were involved in wheat PM response, 19 H(2O(2-responsive putative defense related genes were assayed in wheat seedlings infected with Blumeria graminis f. sp. tritici (Bgt. Eight of these genes were found to be co-regulated by H(2O(2 and Bgt, among which a fatty acid desaturase gene TaFAD was then confirmed by virus induced gene silencing (VIGS to be required for the PM resistance. Together, our data presents the first global picture of the wheat transcriptome under H(2O(2 stress and uncovers potential links between H(2O(2 and Bgt responses, hence providing important candidate genes for the PM resistance in wheat.
Baik, Myunggi; Nam, Yoon Seok; Piao, Min Yu; Kang, Hyeok Joong; Park, Seung Ju; Lee, Jae-Hyuk
2016-03-01
Growth hormone (GH) signal is mediated by signal transducer and activator of transcription 5 (STAT5), which controls hepatic lipid metabolism. Nonalcoholic fatty liver disease (NAFLD) is clinically associated with a deficiency in GH. This study was performed to understand the role of local STAT5 signaling on hepatic lipid and glucose metabolism utilizing liver-specific STAT5 gene deletion (STAT5 LKO) mice under both normal diet and high-fat diet (HFD) feeding conditions. STAT5 LKO induced hepatic steatosis under HFD feeding, while this change was not observed in mice on normal diet. STAT5 LKO caused hyperglycemia, hyperinsulinemia, hyperleptinemia and elevated free fatty acid and cholesterol concentrations under HFD feeding but induced only hyperglycemia on normal diet. At the molecular level, STAT5 LKO up-regulated the expression of genes involved in lipid uptake (CD36), very low-density lipoprotein receptor (VLDLR), lipogenic stearoyl-CoA desaturase and adipogenic peroxisome proliferator-activated receptor gamma, in both diet groups. In response to HFD feeding, further increases in CD36 and VLDLR expression were found in STAT5 LKO mice. In conclusion, our study suggests that low STAT5 signaling on normal diet predisposes STAT5 LKO mice to early development of fatty liver by hyperglycemia and activation of lipid uptake and adipogenesis. A deficiency in STAT5 signaling under HFD feeding deregulates hepatic and body glucose and lipid metabolism, leading to the development of hepatic steatosis. Our study indicates that low STAT5 signaling, due to low GH secretion, may increase a chance for NAFLD development in elderly people. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Nogueira, Patricia; Pacheco, Mario; Lourdes Pereira, M.; Mendo, Sonia; Rotchell, Jeanette M.
2010-01-01
The responses of Dicentrarchus labrax and Liza aurata to aquatic pollution were assessed in a contaminated coastal lagoon, using both traditional and novel biomarkers combined. DNA damage, assessed by comet assay, was higher in both fish species from the contaminated sites, whereas levels of cytochrome P450 1A1 gene expression were not significantly altered. The liver histopathological analysis also revealed significant lesions in fish from contaminated sites. Alterations in ras and xpf genes were analysed and additional pollutant-responsive genes were identified. While no alterations were found in ras gene, a downregulation of xpf gene was observed in D. labrax from a contaminated site. Suppression subtractive hybridization applied to D. labrax collected at a contaminated site, revealed altered expression in genes involved in energy metabolism, immune system activity and antioxidant response. The approach and results reported herein demonstrate the utility of anchoring traditional biomarker responses alongside novel biomarker responses. - Novel molecular biomarkers of aquatic environmental contamination in fish.
Molecular responses and expression analysis of genes in a ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Loss of prion protein induces a primed state of type I interferon-responsive genes
DEFF Research Database (Denmark)
Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind
2017-01-01
The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
International Nuclear Information System (INIS)
Rigaud, O.; Kazmaier, M.
2000-01-01
The monitoring system of the DNA integrity of an irradiated cell does not satisfy oneself to recruit the enzymes allowing the repair of detected damages. It sends an alarm signal whom transmission leads to the activation of specific genes in charge of stopping the cell cycle, the time to make the repair works, or to lead to the elimination of a too much damaged cell. Among the numerous genes participating to the monitoring of cell response to irradiation, the target genes of the mammalian P53 protein are particularly studied. Caretaker of the genome, this protein play a central part in the cell response to ionizing radiations. this response is less studied among plants. A way to tackle it is to be interested in the radioinduced genes identification in the vegetal cell, while taking advantage of knowledge got in the animal field. The knowledge of the complete genome of the arabette (arabidopsis thaliana), the model plant and the arising of new techniques allow to lead this research at a previously unknown rhythm in vegetal biology. (N.C.)
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Karthikeyan Selvarasu
2017-10-01
Full Text Available Cancer is a complex and progressive multi-step disorder that results from the transformation of normal cells to malignant derivatives. Several oncogenic signaling pathways are involved in this transformation. PPARG (Peroxisome proliferator-activated receptor gamma mediated transcription and signaling is involved in few cancers. We have investigated the PPARG in gastric tumors. The objective of the present study was to investigate the PPARG mediated transcriptional response in gastric tumors. Gene-set based and pathway focused gene-set enrichment analysis of available PPARG signatures in gastric tumor mRNA profiles shows that PPARG mediated transcription is highly activated in intestinal sub-type of gastric tumors. Further, we have derived the PPARG associated genes in gastric cancer and their expression was identified for the association with the better survival of the patients. Analysis of the PPARG associated genes reveals their involvement in mitotic cell cycle process, chromosome organization and nuclear division. Towards identifying the association with other oncogenic signaling process, E2F regulated genes were found associated with PPARG mediated transcription. The current results reveal the possible stratification of gastric tumors based on the PPARG gene expression and the possible development of PPARG targeted gastric cancer therapeutics. The identified PPARG regulated genes were identified to be targetable by pioglitazone and rosiglitazone. The identification of PPARG genes also in the normal stomach tissues reveal the possible involvement of these genes in the normal physiology of stomach and needs to be investigated.
Ma, Jianchao; Lu, Jing; Xu, Jianmei; Duan, Bingbing; He, Xiaodong; Liu, Jianquan
2015-01-01
WRKY transcription factors play important roles in plant development and responses to various stresses in plants. However, little is known about the evolution of the WRKY genes in the desert poplar species Populus euphratica, which is highly tolerant of salt stress. In this study, we identified 107 PeWRKY genes from the P. euphratica genome and examined their evolutionary relationships with the WRKY genes of the salt-sensitive congener Populus trichocarpa. Ten PeWRKY genes are specific to P. euphratica, and five of these showed altered expression under salt stress. Furthermore, we found that two pairs of orthologs between the two species showed evidence of positive evolution, with dN/dS ratios>1 (nonsynonymous/synonymous substitutions), and both of them altered their expression in response to salinity stress. These findings suggested that both the development of new genes and positive evolution in some orthologs of the WRKY gene family may have played an important role in the acquisition of high salt tolerance by P. euphratica.
Directory of Open Access Journals (Sweden)
Penelope Koraka
2018-03-01
Full Text Available Rabies is an important neglected disease, characterized by invariably fatal encephalitis. Several studies focus on understanding the pathogenic mechanisms of the prototype lyssavirus rabies virus (RABV infection, and little is known about the pathogenesis of rabies caused by other lyssaviruses. We sought to characterize the host response to Duvenhage virus infection and compare it with responses observed during RABV infection by gene expression profiling of brains of mice with the respective infections. We found in both infections differentially expressed genes leading to increased expression of type I interferons (IFNs, chemokines, and proinflammatory cytokines. In addition several genes of the IFN signaling pathway are up-regulated, indicating a strong antiviral response and activation of the negative feedback mechanism to limit type I IFN responses. Furthermore we provide evidence that in the absence of significant neuronal apoptotic death, cell death of neurons is mediated via the pyroptotic pathway in both infections. Taken together, we have identified several genes and/or pathways for both infections that could be used to explore novel approaches for intervention strategies against rabies.
Raya-González, Javier; López-Bucio, Jesús Salvador; Prado-Rodríguez, José Carlos; Ruiz-Herrera, León Francisco; Guevara-García, Ángel Arturo; López-Bucio, José
2017-09-01
Arabidopsis med12 and med13 mutants exhibit shoot and root phenotypes related to an altered auxin homeostasis. Sucrose supplementation reactivates both cell division and elongation in primary roots as well as auxin-responsive and stem cell niche gene expression in these mutants. An analysis of primary root growth of WT, med12, aux1-7 and med12 aux1 single and double mutants in response to sucrose and/or N-1-naphthylphthalamic acid (NPA) placed MED12 upstream of auxin transport for the sugar modulation of root growth. The MEDIATOR (MED) complex plays diverse functions in plant development, hormone signaling and biotic and abiotic stress tolerance through coordination of transcription. Here, we performed genetic, developmental, molecular and pharmacological analyses to characterize the role of MED12 and MED13 on the configuration of root architecture and its relationship with auxin and sugar responses. Arabidopsis med12 and med13 single mutants exhibit shoot and root phenotypes consistent with altered auxin homeostasis including altered primary root growth, lateral root development, and root hair elongation. MED12 and MED13 were required for activation of cell division and elongation in primary roots, as well as auxin-responsive and stem cell niche gene expression. Remarkably, most of these mutant phenotypes were rescued by supplying sucrose to the growth medium. The growth response of primary roots of WT, med12, aux1-7 and med12 aux1 single and double mutants to sucrose and application of auxin transport inhibitor N-1-naphthylphthalamic acid (NPA) revealed the correlation of med12 phenotype with the activity of the auxin intake permease and suggests that MED12 acts upstream of AUX1 in the root growth response to sugar. These data provide compelling evidence that MEDIATOR links sugar sensing to auxin transport and distribution during root morphogenesis.
Epigenetic modulation of gene expression governs the brain’s response to injury
Simon, Roger P.
2016-01-01
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain’s response to injury. PMID:26739198
Wang, Z; Halbert, C L; Lee, D; Butts, T; Tapscott, S J; Storb, R; Miller, A D
2014-04-01
Animal and human gene therapy studies utilizing AAV vectors have shown that immune responses to AAV capsid proteins can severely limit transgene expression. The main source of capsid antigen is that associated with the AAV vectors, which can be reduced by stringent vector purification. A second source of AAV capsid proteins is that expressed from cap genes aberrantly packaged into AAV virions during vector production. This antigen source can be eliminated by the use of a cap gene that is too large to be incorporated into an AAV capsid, such as a cap gene containing a large intron (captron gene). Here, we investigated the effects of elimination of cap gene transfer and of vector purification by CsCl gradient centrifugation on AAV vector immunogenicity and expression following intramuscular injection in dogs. We found that both approaches reduced vector immunogenicity and that combining the two produced the lowest immune responses and highest transgene expression. This combined approach enabled the use of a relatively mild immunosuppressive regimen to promote robust micro-dystrophin gene expression in Duchenne muscular dystrophy-affected dogs. Our study shows the importance of minimizing AAV cap gene impurities and indicates that this improvement in AAV vector production may benefit human applications.
Nutritional Effect on Androgen-Response Gene Expression and Prostate Tumor Growth
National Research Council Canada - National Science Library
Wang, Zhou
2001-01-01
.... The dietary influence on ventral prostate weight does not seem to involve androgen action axis because dietary components did not influence the expression of several androgen-response genes, serum testosterone...
Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N
2008-12-01
Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.
Kim, Sunyoung; Gross, David S.
2013-01-01
The evolutionarily conserved Mediator complex is central to the regulation of gene transcription in eukaryotes because it serves as a physical and functional interface between upstream regulators and the Pol II transcriptional machinery. Nonetheless, its role appears to be context-dependent, and the detailed mechanism by which it governs the expression of most genes remains unknown. Here we investigate Mediator involvement in HSP (heat shock protein) gene regulation in the yeast Saccharomyces cerevisiae. We find that in response to thermal upshift, subunits representative of each of the four Mediator modules (Head, Middle, Tail, and Kinase) are rapidly, robustly, and selectively recruited to the promoter regions of HSP genes. Their residence is transient, returning to near-background levels within 90 min. Hsf1 (heat shock factor 1) plays a central role in recruiting Mediator, as indicated by the fact that truncation of either its N- or C-terminal activation domain significantly reduces Mediator occupancy, whereas removal of both activation domains abolishes it. Likewise, ablation of either of two Mediator Tail subunits, Med15 or Med16, reduces Mediator recruitment to HSP promoters, whereas deletion of both abolishes it. Accompanying the loss of Mediator, recruitment of RNA polymerase II is substantially diminished. Interestingly, Mediator antagonizes Hsf1 occupancy of non-induced promoters yet facilitates enhanced Hsf1 association with activated ones. Collectively, our observations indicate that Hsf1, via its dual activation domains, recruits holo-Mediator to HSP promoters in response to acute heat stress through cooperative physical and/or functional interactions with the Tail module. PMID:23447536
Directory of Open Access Journals (Sweden)
M Fathi
2016-11-01
Full Text Available Introduction: Myocyte Enhancer Factor 2 (mef2 gene relates with multiple myogenic transcriptional factors that induces activation Muscle-specific genes. MEF2 contributes in muscular cells development and differentiation as well as in fibers transition in response to stimulants. Therefore, the aim of this study was to evaluate the effect of one bout of resistance exercise (RE on mef2 gene expression in fast and slow skeletal muscles of Wistar male rats. Methods: For this experimental study, 15 rats from Pasteur Institute were prepared and housed under natural conditions (temperature, light/dark (12:12 cycle, with ad libitum access to food and water and then randomly divided assigned to RE (n=10 and control groups (n=5; the RE group performed one RE session. 3 and 6 hours following, the rats were anaesthetized and sacrificed, then the soleus and Extensor digitorum longus (EDL muscles were removed. determine mef2 gene expression rate, the Quantitative Real time RT-PCR was used. Data were analyzed by one sample and independent samples t test. Results: In EDL muscle, in response to one RE session, the mef2 gene expression increased non significantly at 3 hour (p=0/093 and increased significantly (p=/008 at 6 hour after exercise, but in soleus muscle, the mef2 gene expression decreased significantly at 3 hour (p=0/01, and at 6 hour after RE session there was no observed significant change (p=0.247. Conclusion: Mef2 expression gene is differently changes in muscle fibers, which are likely associated with changes in fiber type in response to resistance exercise.
Directory of Open Access Journals (Sweden)
Evi Berchtold
Full Text Available Several methods predict activity changes of transcription factors (TFs from a given regulatory network and measured expression data. But available gene regulatory networks are incomplete and contain many condition-dependent regulations that are not relevant for the specific expression measurement. It is not known which combination of active TFs is needed to cause a change in the expression of a target gene. A method to systematically evaluate the inferred activity changes is missing. We present such an evaluation strategy that indicates for how many target genes the observed expression changes can be explained by a given set of active TFs. To overcome the problem that the exact combination of active TFs needed to activate a gene is typically not known, we assume a gene to be explained if there exists any combination for which the predicted active TFs can possibly explain the observed change of the gene. We introduce the i-score (inconsistency score, which quantifies how many genes could not be explained by the set of activity changes of TFs. We observe that, even for these minimal requirements, published methods yield many unexplained target genes, i.e. large i-scores. This holds for all methods and all expression datasets we evaluated. We provide new optimization methods to calculate the best possible (minimal i-score given the network and measured expression data. The evaluation of this optimized i-score on a large data compendium yields many unexplained target genes for almost every case. This indicates that currently available regulatory networks are still far from being complete. Both the presented Act-SAT and Act-A* methods produce optimal sets of TF activity changes, which can be used to investigate the difficult interplay of expression and network data. A web server and a command line tool to calculate our i-score and to find the active TFs associated with the minimal i-score is available from https://services.bio.ifi.lmu.de/i-score.
Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun
2017-08-17
Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.
Djami-Tchatchou, A T; Ntushelo, K
2017-01-01
Pectobacterium carotovorum subsp. carotovorum (Pcc) is a soft rot bacterium which upon entry into the plant macerates plant tissues by producing plant cell wall degrading enzymes. It has a wide host range which includes carrot, potato, tomato, leafy greens, squash and other cucurbits, onion, green peppers and cassava. During plant-microbe interactions, one of the ways of plant response to pathogen infection is through the small RNA silencing mechanism. Under pathogen attack the plant utilizes microRNAs to regulate gene expression by means of mediating gene silencing at transcriptional and post-transcriptional level. This study aims to assess for the first time, the expression profile of some stress-responsive miRNA and differential expression pattern of their target genes in Arabidopsis thaliana inoculated with Pcc. Leaves of five weeks old Arabidopsis thaliana plants were infected with Pcc and the quantitative real time-PCR, was used to investigate after 0, 24, 48 and 72 h post infection, the expression profiling of the stress-responsive miRNAs which include: miR156, miR159, miR169, miR393, miR396 miR398, miR399 and miR408 along with their target genes which include: Squamosa promoter-binding-like protein, myb domain protein 101, nuclear factor Y subunit A8, concanavalin A-like lectin protein kinase, growth regulating factor 4, copper superoxide dismutase, ubiquitin-protein ligase and plantacyanin respectively. The findings showed that the overexpression of 6 miRNAs at 24, 48 and 72 h after infection resulted in the repression of their target genes and the expression of 2 miRNAs didn't affect their target genes. These results provide the first indication of the miRNAs role in response to the infection of Pcc in A. thaliana and open new vistas for a better understanding of miRNA regulation of plant response to Pcc.
Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.
Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F
2016-08-01
The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment.
Meta-analysis of the effect of overexpression of CBF/DREB family genes on drought stress response
Transcription factors C-repeat/dehydration-responsive element binding proteins (CBF/DREB) play an important role in plant response to abiotic stresses. Over-expression of various CBF/DREB genes in diverse plants have been reported, but inconsistency of gene donor, recipient genus, parameters used i...
Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex
Directory of Open Access Journals (Sweden)
Okada Yasukazu
2010-04-01
Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.
Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M
1993-01-01
The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.
Directory of Open Access Journals (Sweden)
Tsuey-Ming Chen
2016-03-01
Full Text Available The Leydig tumor cell line, MA-10, expresses the luteinizing hormone receptor, a G protein-coupled receptor that, when activated with luteinizing hormone or chorionic gonadotropin (CG, stimulates cAMP production and subsequent steroidogenesis, notably progesterone. These cells also respond to epidermal growth factor (EGF and phorbol esters with increased steroid biosynthesis. In order to probe the intracellular pathways along with heterologous receptor down-regulation and cellular desensitization, cells were preincubated with EGF or phorbol esters and then challenged with CG, EGF, dibutryl-cyclic AMP, and a phorbol ester. Relative receptor numbers, steroid biosynthesis, and expression of the early response genes, JUNB and c-FOS, were measured. It was found that in all cases but one receptor down-regulation and decreased progesterone production were closely coupled under the conditions used; the exception involved preincubation of the cells with EGF followed by addition of CG where the CG-mediated stimulation of steroidogenesis was considerably lower than the level of receptor down-regulation. In a number of instances JUNB and c-FOS expression paralleled the decreases in receptor number and progesterone production, while in some cases these early response genes were affected little if at all by the changes in receptor number. This finding may indicate that even low levels of activated signaling kinases, e.g. protein kinase A, protein kinase C, or receptor tyrosine kinase, may suffice to yield good expression of JUNB and c-FOS, or it may suggest alternative pathways for regulating expression of these two early response genes.
Directory of Open Access Journals (Sweden)
Sung-Suk Suh
2014-10-01
Full Text Available Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs. In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly, based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells.
Suh, Sung-Suk; Hwang, Jinik; Park, Mirye; Seo, Hyo Hyun; Kim, Hyoung-Shik; Lee, Jeong Hun; Moh, Sang Hyun; Lee, Taek-Kyun
2014-01-01
Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs). In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly), based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH) assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE) and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells. PMID:25317535
Directory of Open Access Journals (Sweden)
Erik Södersten
2014-09-01
Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.
Epigenetic modulation of gene expression governs the brain���s response to injury
Simon, Roger P.
2015-01-01
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is...
Study on radiation-inducible genes
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Park, Hae Jun; Song, Hyu Npa
2012-01-15
Radiation-inducible genes of E. coli, which is a model strain for bacterial study, and Salmonella, which is a typical strain for pathogenic bacteria were compared through omic analysis. Heat shock response genes and prophage genes were induced by radiation in Salmonella, not in E. coli. Among prophage genes tested, STM2628 showed the highest activation by radiation, and approximately 1 kb promoter region was turned out to be necessary for radiation response. To screen an artificial promoter showing activation by 2 Gy, the high-throughput screening method using fluorescent MUG substrate was established. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. To do this, a tumor-targeting hfq Salmonella mutant strain was constructed, and we found that its virulence decreased. For outward secretion of anticancer protein produced inside bacteria, the signal peptide of SspH1 was determined and the signal peptide was proven to be able to secrete an anticancer protein. Tumor xenograft mouse model was secured, which can be used for efficiency evaluation of bacterial tumor therapy.
Study on radiation-inducible genes
International Nuclear Information System (INIS)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Park, Hae Jun; Song, Hyu Npa
2012-01-01
Radiation-inducible genes of E. coli, which is a model strain for bacterial study, and Salmonella, which is a typical strain for pathogenic bacteria were compared through omic analysis. Heat shock response genes and prophage genes were induced by radiation in Salmonella, not in E. coli. Among prophage genes tested, STM2628 showed the highest activation by radiation, and approximately 1 kb promoter region was turned out to be necessary for radiation response. To screen an artificial promoter showing activation by 2 Gy, the high-throughput screening method using fluorescent MUG substrate was established. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. To do this, a tumor-targeting hfq Salmonella mutant strain was constructed, and we found that its virulence decreased. For outward secretion of anticancer protein produced inside bacteria, the signal peptide of SspH1 was determined and the signal peptide was proven to be able to secrete an anticancer protein. Tumor xenograft mouse model was secured, which can be used for efficiency evaluation of bacterial tumor therapy
Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael
2008-04-16
The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.
Directory of Open Access Journals (Sweden)
Andrade-Garda José
2008-04-01
Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.
Directory of Open Access Journals (Sweden)
Yuqing Niu
2018-01-01
Full Text Available Banana Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc is one of the most destructive soil-borne diseases. In this study, young tissue-cultured plantlets of banana (Musa spp. AAA cultivars differing in Foc susceptibility were used to reveal their differential responses to this pathogen using digital gene expression (DGE. Data were evaluated by various bioinformatic tools (Venn diagrams, gene ontology (GO annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analyses and immunofluorescence labelling method to support the identification of gene candidates determining the resistance of banana against Foc. Interestingly, we have identified MaWRKY50 as an important gene involved in both constitutive and induced resistance. We also identified new genes involved in the resistance of banana to Foc, including several other transcription factors (TFs, pathogenesis-related (PR genes and some genes related to the plant cell wall biosynthesis or degradation (e.g., pectinesterases, β-glucosidases, xyloglucan endotransglucosylase/hydrolase and endoglucanase. The resistant banana cultivar shows activation of PR-3 and PR-4 genes as well as formation of different constitutive cell barriers to restrict spreading of the pathogen. These data suggest new mechanisms of banana resistance to Foc.
The Tyrosyl-DNA Phosphodiesterase 1β (Tdp1β Gene Discloses an Early Response to Abiotic Stresses
Directory of Open Access Journals (Sweden)
Maria Elisa Sabatini
2017-11-01
Full Text Available Tyrosyl-DNA phosphodiesterase 1 (Tdp1 is involved in DNA repair pathways as it mends the topoisomerase I—DNA covalent complexes. In plants, a small Tdp1 gene family, composed by Tdp1α and Tdp1β genes, was identified, but the roles of these genes in abiotic stress responses are not fully understood. To investigate their specific stress response patterns, the present study made use of bioinformatic and molecular tools to look into the Tdp1β gene function, so far described only in the plant kingdom, and compare it with Tdp1α gene coding for the canonical, highly conserved α isoform. The expression profiles of Tdp1α and Tdp1β genes were examined under abiotic stress conditions (cold, heat, high osmolarity, salt, and UV-B in two model species, Arabidopsis thaliana and Medicago truncatula. The two isoforms of topoisomerase I (TOP1α and TOP1β were also taken into consideration in view of their known roles in DNA metabolism and cell proliferation. Data relative to gene expression in Arabidopsis were retrieved from the AtGenExpress microarray dataset, while quantitative Real-Time PCR was carried out to evaluate the stress response in M. truncatula cell cultures. These analyses revealed that Tdp1β gene expression was enhanced during the first hour of treatment, whereas Tdp1α enhanced expression succeeded at subsequent timepoints. In agreement with the gene-specific responses to abiotic stress conditions, the promoter regions of Tdp1α and Tdp1β genes are well equipped with stress-related cis-elements. An in-depth bioinformatic characterization of the HIRAN motif, a distinctive feature of the Tdp1β protein, showed its wide distribution in chromatin remodeling and DNA repair proteins. The reported data suggests that Tdp1β functions in the early response to abiotic stresses.
Nakashima, Kazuo; Fujita, Yasunari; Katsura, Koji; Maruyama, Kyonoshin; Narusaka, Yoshihiro; Seki, Motoaki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2006-01-01
ABA-responsive elements (ABREs) are cis-acting elements and basic leucine zipper (bZIP)-type ABRE-binding proteins (AREBs) are transcriptional activators that function in the expression of RD29B in vegetative tissue of Arabidopsis in response to abscisic acid (ABA) treatment. Dehydration-responsive elements (DREs) function as coupling elements of ABRE in the expression of RD29A in response to ABA. Expression analysis using abi3 and abi5 mutants showed that ABI3 and ABI5 play important roles in the expression of RD29B in seeds. Base-substitution analysis showed that two ABREs function strongly and one ABRE coupled with DRE functions weakly in the expression of RD29A in embryos. In a transient transactivation experiment, ABI3, ABI5 and AREB1 activated transcription of a GUS reporter gene driven by the RD29B promoter strongly but these proteins activated the transcription driven by the RD29A promoter weakly. In 35S::ABI3 Arabidopsis plants, the expression of RD29B was up-regulated strongly, but that of RD29A was up-regulated weakly. These results indicate that the expression of RD29B having ABREs in the promoter is up-regulated strongly by ABI3, whereas that of RD29A having one ABRE coupled with DREs in the promoter is up-regulated weakly by ABI3. We compared the expression of 7000 Arabidopsis genes in response to ABA treatment during germination and in the vegetative growth stage, and that in 35S::ABI3 plants using a full-length cDNA microarray. The expression of ABI3- and/or ABA-responsive genes and cis-elements in the promoters are discussed.
Montes, Pedro; Ruiz-Sánchez, Elizabeth; Calvillo, Minerva; Rojas, Patricia
2016-09-01
Depending on genetic predisposition, prenatal stress may result in vulnerability or resilience to develop psychiatric disorders in adulthood. Nurr1 is an immediate early gene, important in the brain for the stress response. We tested the hypothesis that prenatal stress and the decrease of hippocampal Nurr1 alter offspring behavioral responses in the forced swimming test (FST). Pregnant Wistar rats were exposed to restraint stress (45 min, thrice daily) from gestation day 14. Prenatally stressed (PS) and non-prenatally stressed (NPS) male offspring were treated bilaterally with a Nurr1 antisense oligodeoxynucleotide (ODN; or control) into the hippocampus at 97 d of age. After 1 h, the rats were exposed to the FST (acute stressor) to analyze their behavioral responses. Thirty minutes after the FST, we analyzed the gene expression of Nurr1, Bdnf and Nr3c1 (genes for Nurr1, brain-derived neurotrophic factor (BDNF) and glucocorticoid receptor (GR), respectively) in the hippocampus, prefrontal cortex (PFC) and hypothalamus. Results showed that the decrease of hippocampal Nurr1 after the antisense ODN in adult NPS rats induces immobility (indicating depressive-like behavior). The PS adult rats, including the group with decreased hippocampal Nurr1, presented low immobility in the FST. This low immobility was concordant with maintenance of Nurr1 and Bdnf expression levels in the three analyzed brain regions; Nr3c1 gene expression was also maintained in the PFC and hypothalamus. These findings suggest that Nurr1 and associated genes could participate in the brain modifications induced by prenatal stress, allowing active coping (resilience) with acute stress in adulthood.
Liu, Xiaoming; Yang, Jiasheng; Zhang, Yi; Fang, Yun; Wang, Fayou; Wang, Jun; Zheng, Xiaoqi; Yang, Jialiang
2016-03-01
We have studied drug-response associated (DRA) gene expressions by applying a systems biology framework to the Cancer Cell Line Encyclopedia data. More than 4,000 genes are inferred to be DRA for at least one drug, while the number of DRA genes for each drug varies dramatically from almost 0 to 1,226. Functional enrichment analysis shows that the DRA genes are significantly enriched in genes associated with cell cycle and plasma membrane. Moreover, there might be two patterns of DRA genes between genders. There are significantly shared DRA genes between male and female for most drugs, while very little DRA genes tend to be shared between the two genders for a few drugs targeting sex-specific cancers (e.g., PD-0332991 for breast cancer and ovarian cancer). Our analyses also show substantial difference for DRA genes between young and old samples, suggesting the necessity of considering the age effects for personalized medicine in cancers. Lastly, differential module and key driver analyses confirm cell cycle related modules as top differential ones for drug sensitivity. The analyses also reveal the role of TSPO, TP53, and many other immune or cell cycle related genes as important key drivers for DRA network modules. These key drivers provide new drug targets to improve the sensitivity of cancer therapy.
A gene expression profile indicative of early stage HER2 targeted therapy response.
O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert
2013-07-01
Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.
Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri
2012-08-01
During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.
Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao
2014-01-24
Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jinlong Zhang
2016-12-01
Full Text Available Soil alkalinity is a major abiotic constraint to crop productivity and quality. Wild soybean (Glycine soja is considered to be more stress-tolerant than cultivated soybean (G. max, and has considerable genetic variation for increasing alkalinity tolerance of soybean. In this study, we analyzed the transcriptome profile in the roots of an alkalinity tolerant wild soybean variety N24852 at 12 and 24 h after 90 mM NaHCO3 stress by RNA-sequencing. Compared with the controls, a total of 449 differentially expressed genes (DEGs were identified, including 95 and 140 up-regulated genes, and 108 and 135 down-regulated genes at 12 and 24 h after NaHCO3 treatment, respectively. Quantitative RT-PCR analysis of 14 DEGs showed a high consistency with their expression profiles by RNA-sequencing. Gene Ontology (GO terms related to transcription factors and transporters were significantly enriched in the up-regulated genes at 12 and 24 h after NaHCO3 stress, respectively. Nuclear Factor Y subunit A (NF-YA transcription factors were enriched at 12 h after NaHCO3 stress, and high percentages of basic helix-loop-helix (bHLH, ethylene-responsive factor (ERF, Trihelix and zinc finger (C2H2, C3H transcription factors were found at both 12 and 24 h after NaHCO3 stress. Genes related to ion transporters such as ABC transporter, aluminum activated malate transporter (ALMT, glutamate receptor (GLR, nitrate transporter (NRT / proton dependent oligopeptide (POT family, and S-type anion channel (SLAH were enriched in up-regulated DEGs at 24 h after NaHCO3 treatment, implying their roles in maintaining ion homeostasis in soybean roots under alkalinity. KEGG pathway enrichment analysis showed phenylpropanoid biosynthesis and phenylalanine metabolism pathways might participate in soybean response to alkalinity. This study provides a foundation to further investigate the functions of NaHCO3 stress-responsive genes and the molecular basis of soybean tolerance to alkalinity.
Directory of Open Access Journals (Sweden)
Xavier Capó
2015-01-01
Full Text Available We studied the effects of diet supplementation with docosahexaenoic (DHA and in vitro vitamin C (VitC at physiological concentrations on oxidative and inflammatory neutrophil response to phorbol myristate acetate (PMA. Fifteen male footballers ingested a beverage enriched with DHA or a placebo for 8 weeks in a randomized double-blind study. Neutrophils were isolated from blood samples collected in basal conditions at the end of nutritional intervention. Neutrophils were cultured for 2 hours at 37°C in (a control media, (b media with PMA, and (c media with PMA + VitC. PMA induces neutrophil degranulation with increased extracellular myeloperoxidase and catalase activities, nitric oxide production, expression of the inflammatory genes cyclooxygenase-2, nuclear factor κβ, interleukin 8 and tumor necrosis factor α, and interleukin 6 production. DHA diet supplementation boosts the exit of CAT from neutrophils but moderates the degranulation of myeloperoxidase granules induced by PMA. VitC facilitates azurophilic degranulation of neutrophils and increases gene expression of myeloperoxidase induced by PMA. VitC and DHA diet supplementation prevent PMA effects on inflammatory gene expression, although together they do not produce additional effects. DHA diet supplementation enhances antioxidant defences and anti-inflammatory neutrophil response to in vitro PMA activation. VitC facilitates neutrophil degranulation but prevents an inflammatory response to PMA.
International Nuclear Information System (INIS)
Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong
2005-01-01
The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)
Identification of heat-responsive genes in carnation (Dianthus caryophyllus L. by RNA-seq
Directory of Open Access Journals (Sweden)
Xueli eWan
2015-07-01
Full Text Available Carnation (Dianthus caryophyllus L. is an important flower crop, having substantial commercial value as a cut-flower due to the long vase-life and wide array of flower colours and forms. Standard carnation varieties perform well under cool climates but are very susceptible to high temperatures which adversely affect the yield and the quality of the cut-flowers. Despite several studies of carnation contributing to the number of expressed sequence tags (ESTs, transcriptomic information of this species remains very limited, particularly regarding abiotic stress-related genes. Here, transcriptome analysis was performed to generate expression profiles of heat stress (HS-responsive genes in carnation. We sequenced a cDNA library constructed with mixed RNA from carnation leaves subjected to 42oC HS (0, 0.5, 1 and 2 h and 46oC HS (0.5, 1 and 2 h, and obtained 45,604,882 high quality paired-end reads. After de novo assembly and quantitative assessment, 99,255 contigs were generated with an average length of 1053bp. We then obtained functional annotations by aligning contigs with public protein databases including NR, SwissProt, KEGG and COG. Using the above carnation transcriptome as the reference, we compared the effects of high temperature treatments (42oC: duration 0.5, 2 or 12h delivered to aseptic carnation seedlings, relative to untreated controls, using the FPKM metric. Overall, 11,471 genes were identified which showed a significant response to one or more of the three HS treatment times. In addition, based on GO and metabolic pathway enrichment analyses, a series of candidate genes involved in thermo-tolerance responses were selected and characterized. This study represents the first expression profiling analysis of D. caryophyllus under heat stress treatments. Numerous genes were found to be induced in response to HS, the study of which may advance our understanding of heat response of carnation.
Directory of Open Access Journals (Sweden)
Nancy Bueno Figueiredo
2014-01-01
Full Text Available It has been well established that estrogen plays an important role in the progression and treatment of breast cancer. However, the role of triiodothyronine (T3 remains controversial. We have previously shown its capacity to stimulate the development of positive estrogen receptor breast carcinoma, induce the expression of genes (PR, TGF-alpha normally stimulated by estradiol (E2, and suppress genes (TGF-beta normally inhibited by E2. Since T3 regulates growth hormones, metabolism, and differentiation, it is important to verify its action on other genes normally induced by E2. Therefore, we used DNA microarrays to compare gene expression patterns in MCF-7 breast adenocarcinoma cells treated with E2 and T3. Several genes were modulated by both E2 and T3 in MCF-7 cells (Student’s t-test, P 2.0, pFDR < 0.05. We confirmed our microarray results by real-time PCR. Our findings reveal that certain genes in MCF-7 cells can be regulated by both E2 and T3.
Valdés, Ana Elisa; Overnäs, Elin; Johansson, Henrik; Rada-Iglesias, Alvaro; Engström, Peter
2012-11-01
Plants perceiving drought activate multiple responses to improve survival, including large-scale alterations in gene expression. This article reports on the roles in the drought response of two Arabidopsis thaliana homeodomain-leucine zipper class I genes; ATHB7 and ATHB12, both strongly induced by water-deficit and abscisic acid (ABA). ABA-mediated transcriptional regulation of both genes is shown to depend on the activity of protein phosphatases type 2C (PP2C). ATHB7 and ATHB12 are, thus, targets of the ABA signalling mechanism defined by the PP2Cs and the PYR/PYL family of ABA receptors, with which the PP2C proteins interact. Our results from chromatin immunoprecipitation and gene expression analyses demonstrate that ATHB7 and ATHB12 act as positive transcriptional regulators of PP2C genes, and thereby as negative regulators of abscisic acid signalling. In support of this notion, our results also show that ATHB7 and ATHB12 act to repress the transcription of genes encoding the ABA receptors PYL5 and PYL8 in response to an ABA stimulus. In summary, we demonstrate that ATHB7 and ATHB12 have essential functions in the primary response to drought, as mediators of a negative feedback effect on ABA signalling in the plant response to water deficit.
Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.
2013-01-01
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027
Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B
2013-12-06
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.
Viral oncogene-induced DNA damage response is activated in Kaposi sarcoma tumorigenesis.
Directory of Open Access Journals (Sweden)
Sonja Koopal
2007-09-01
Full Text Available Kaposi sarcoma is a tumor consisting of Kaposi sarcoma herpesvirus (KSHV-infected tumor cells that express endothelial cell (EC markers and viral genes like v-cyclin, vFLIP, and LANA. Despite a strong link between KSHV infection and certain neoplasms, de novo virus infection of human primary cells does not readily lead to cellular transformation. We have studied the consequences of expression of v-cyclin in primary and immortalized human dermal microvascular ECs. We show that v-cyclin, which is a homolog of cellular D-type cyclins, induces replicative stress in ECs, which leads to senescence and activation of the DNA damage response. We find that antiproliferative checkpoints are activated upon KSHV infection of ECs, and in early-stage but not late-stage lesions of clinical Kaposi sarcoma specimens. These are some of the first results suggesting that DNA damage checkpoint response also functions as an anticancer barrier in virally induced cancers.
Krivoruchko, Anastasia; Storey, Kenneth B
2013-02-01
Red-eared slider turtles, Trachemys scripta elegans, can survive for several weeks without oxygen when submerged in cold water. We hypothesized that anaerobiosis is aided by adaptive up-regulation of the unfolded protein response (UPR), a stress-responsive pathway that is activated by accumulation of unfolded proteins in the endoplasmic reticulum (ER) and functions to restore ER homeostasis. RT-PCR, western immunoblotting and DNA-binding assays were used to quantify the responses and/or activation status of UPR-responsive genes and proteins in turtle tissues after animal exposure to 5 or 20 h of anoxic submergence at 4 °C. The phosphorylation state of protein kinase-like ER kinase (PERK) (a UPR-regulated kinase) and eukaryotic initiation factor 2 (eIF2α) increased by 1.43-2.50 fold in response to anoxia in turtle heart, kidney, and liver. Activation of the PERK-regulated transcription factor, activating transcription factor 4 (ATF4), during anoxia was documented by elevated atf4 transcripts and total ATF4 protein (1.60-2.43 fold), increased nuclear ATF4 content, and increased DNA-binding activity (1.44-2.32 fold). ATF3 and GADD34 (downstream targets of ATF4) also increased by 1.38-3.32 fold in heart and liver under anoxia, and atf3 transcripts were also elevated in heart. Two characteristic chaperones of the UPR, GRP78, and GRP94, also responded positively to anoxia with strong increases in both the transcript and protein levels. The data demonstrate that the UPR is activated in turtle heart, kidney, and liver in response to anoxia, suggesting that this pathway mediates an integrated stress response to protect tissues during oxygen deprivation.
Directory of Open Access Journals (Sweden)
Barloy-Hubler Frédérique
2008-12-01
Full Text Available Abstract Background Oxidative stress is a common stress encountered by living organisms and is due to an imbalance between intracellular reactive oxygen and nitrogen species (ROS, RNS and cellular antioxidant defence. To defend themselves against ROS/RNS, bacteria possess a subsystem of detoxification enzymes, which are classified with regard to their substrates. To identify such enzymes in prokaryotic genomes, different approaches based on similarity, enzyme profiles or patterns exist. Unfortunately, several problems persist in the annotation, classification and naming of these enzymes due mainly to some erroneous entries in databases, mistake propagation, absence of updating and disparity in function description. Description In order to improve the current annotation of oxidative stress subsystems, an innovative platform named OxyGene has been developed. It integrates an original database called OxyDB, holding thoroughly tested anchor-based signatures associated to subfamilies of oxidative stress enzymes, and a new anchor-driven annotator, for ab initio detection of ROS/RNS response genes. All complete Bacterial and Archaeal genomes have been re-annotated, and the results stored in the OxyGene repository can be interrogated via a Graphical User Interface. Conclusion OxyGene enables the exploration and comparative analysis of enzymes belonging to 37 detoxification subclasses in 664 microbial genomes. It proposes a new classification that improves both the ontology and the annotation of the detoxification subsystems in prokaryotic whole genomes, while discovering new ORFs and attributing precise function to hypothetical annotated proteins. OxyGene is freely available at: http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software
Directory of Open Access Journals (Sweden)
Liz J. Valente
2016-03-01
Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.
Directory of Open Access Journals (Sweden)
Henrik Bjørn Nielsen
2007-08-01
Full Text Available The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental factors including treatments, mutations and pathogen infections. Similarly, drugs may be discovered by the relationship between the transcript profiles effectuated or impacted by a candidate drug and by the target disease. The integration of such data enables systems biology to predict the interplay between experimental factors affecting a biological system. Unfortunately, direct comparisons of gene expression profiles obtained in independent, publicly available microarray experiments are typically compromised by substantial, experiment-specific biases. Here we suggest a novel yet conceptually simple approach for deriving 'Functional Association(s by Response Overlap' (FARO between microarray gene expression studies. The transcriptional response is defined by the set of differentially expressed genes independent from the magnitude or direction of the change. This approach overcomes the limited comparability between studies that is typical for methods that rely on correlation in gene expression. We apply FARO to a compendium of 242 diverse Arabidopsis microarray experimental factors, including phyto-hormones, stresses and pathogens, growth conditions/stages, tissue types and mutants. We also use FARO to confirm and further delineate the functions of Arabidopsis MAP kinase 4 in disease and stress responses. Furthermore, we find that a large, well-defined set of genes responds in opposing directions to different stress conditions and predict the effects of different stress combinations. This demonstrates the usefulness of our approach for exploiting public microarray data to derive biologically meaningful associations between experimental factors. Finally, our
Directory of Open Access Journals (Sweden)
Christopher Ian Cazzonelli
2014-10-01
Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.