WorldWideScience

Sample records for response elements subsequent

  1. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  2. Mental imagery affects subsequent automatic defense responses

    Muriel A Hagenaars

    2015-06-01

    Full Text Available Automatic defense responses promote survival and appropriate action under threat. They have also been associated with the development of threat-related psychiatric syndromes. Targeting such automatic responses during threat may be useful in populations with frequent threat exposure. Here, two experiments explored whether mental imagery as a pre-trauma manipulation could influence fear bradycardia (a core characteristic of freezing during subsequent analogue trauma (affective picture viewing. Image-based interventions have proven successful in the treatment of threat-related disorders, and are easily applicable. In Experiment 1 43 healthy participants were randomly assigned to an imagery script condition. Participants executed a passive viewing task with blocks of neutral, pleasant and unpleasant pictures after listening to an auditory script that was either related (with a positive or a negative outcome or unrelated to the unpleasant pictures from the passive viewing task. Heart rate was assessed during script listening and during passive viewing. Imagining negative related scripts resulted in greater bradycardia (neutral-unpleasant contrast than imagining positive scripts, especially unrelated. This effect was replicated in Experiment 2 (N = 51, again in the neutral-unpleasant contrast. An extra no-script condition showed that bradycardia was not induced by the negative related script, but rather that a positive script attenuated bradycardia. These preliminary results might indicate reduced vigilance after unrelated positive events. Future research should replicate these findings using a larger sample. Either way, the findings show that highly automatic defense behavior can be influenced by relatively simple mental imagery manipulations.

  3. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  4. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  5. Rapid IV Versus Oral Rehydration: Responses to Subsequent Exercise Heat Stress

    Kenefick, Robert W; O'Moore, Kathleen M; Mahood, Nicholas V; Castellani, John W

    2006-01-01

    This study sought to determine the effect of rapid intravenous (IV) versus oral (ORAL) rehydration immediately after dehydration, on cardiovascular, thermoregulatory, and perceptual responses during subsequent exercise in the heat.

  6. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  7. 40 CFR 35.6570 - Use of the same engineer during subsequent phases of response.

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Use of the same engineer during... Agreement § 35.6570 Use of the same engineer during subsequent phases of response. (a) If the public notice... CERCLA remedial response Cooperative Agreement may use the engineer procured to conduct any or all of the...

  8. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  9. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    Ullrich, R.L.

    1975-01-01

    The possible mechanistic relationships between the early inflammatory response and subsequent fibrosis seen after radiation exposure was studied in rats were given single x ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The results suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses. (U.S.)

  10. Response to intravenous fentanyl infusion predicts subsequent response to transdermal fentanyl.

    Hayashi, Norihito; Kanai, Akifumi; Suzuki, Asaha; Nagahara, Yuki; Okamoto, Hirotsugu

    2016-04-01

    Prediction of the response to transdermal fentanyl (FENtd) before its use for chronic pain is desirable. We tested the hypothesis that the response to intravenous fentanyl infusion (FENiv) can predict the response to FENtd, including the analgesic and adverse effects. The study subjects were 70 consecutive patients with chronic pain. The response to fentanyl at 0.1 mg diluted in 50 ml of physiological saline and infused over 30 min was tested. This was followed by treatment with FENtd (Durotep MT patch 2.1 mg) at a dose of 12.5 µg/h for 2 weeks. Pain intensity before and after FENiv and 2 weeks after FENtd, and the response to treatment, were assessed by the numerical rating scale (NRS), clinical global impression-improvement scale (CGI-I), satisfaction scale (SS), and adverse effects. The NRS score decreased significantly from 7 (4-9) [median (range)] at baseline to 3 (0-8) after FENiv (p 0.04, each). The analgesic and side effects after intravenous fentanyl infusion can be used to predict the response to short-term transdermal treatment with fentanyl.

  11. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  12. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    Ullrich, R.L.

    1975-01-01

    This study was designed to examine possible mechanistic relationships between the early inflammatory response and the subsequent fibrosis seen after radiation exposure. Anesthetized Rochester ex-Wistar rats were given single x-ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The data suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that (1) both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and (2) a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses

  13. The effects of early experience on subsequent feeding responses in the Tegu, Tupinambis teguixin (Squamata : Teiidae).

    Punzo, F

    2003-01-01

    The purpose of this study was to assess the effects of early feeding experiences on subsequent responses to prey in the tegu, Tupinambis teguixin. Five-day old lizards were exposed to the odors of various prey and control substances on cotton-tipped applicators with the tongue-flick attack score (TFAS) chosen as the dependent variable. Each lizard was exposed to four stimuli: two controls (deionised water and cologne), and extracts from a mouse Mus musculus, and a lizard Ameiva ameiva, in a repeated measures, randomized block design, receiving one stimulus training session / day over a 40-day period. Tongue-flicks directed toward the applicator were counted over a 1 min period as well as the amount of time that elapsed from the first tongue flick to any bite that may have occurred. Live neonatal mice (but not A. ameiva), offered on a weekly basis, were used as a food source for tegus over a 10-month period. After 10 months, tegus were exposed to applicators containing control odors as well as those containing extracts from mice and lizards (A. ameiva). Mouse extracts elicited significantly higher TFAS as compared to those elicited by A. ameiva or control odors, suggesting that prey odors encountered in the environment shortly after hatching can influence prey preferences by these lizards later in life. These results also indicate that tegu lizards can learn to use specific odor cues associated with naturally occurring prey as releasers for subsequent hunting behaviors.

  14. Effect of household pet ownership on infant immune response and subsequent sensitization

    Angela Simpson

    2010-08-01

    Full Text Available Angela SimpsonManchester Academic Health Science Centre, NIHR Translational Research Facility in Respiratory Medicine, University Hospital of South Manchester NHS Foundation Trust, Manchester, UKAbstract: Sensitization to pets is a major risk factor for asthma. There are many reports on the relationship between household pets, sensitization to the pet, and sensitization to other allergens, often with conflicting results. Pet ownership is not random, and household pets are associated with exposures other than pet allergens. We will review some of the evidence regarding the effects of household pets on infant immune responses, focusing on data from birth cohort studies. It remains unclear precisely why some children develop specific sensitizations to pets whilst others do not in the face of equivalent exposures, but it is likely to be due to gene-environment interactions. Further long-term follow-up of children in whom neonatal and infant immune responses have been measured is necessary to understand how these events occur and how they relate to subsequent disease.Keywords: pets, sensitization, immune response

  15. Exposure of neonates to Respiratory Syncytial Virus is critical in determining subsequent airway response in adults

    Daly Melissa

    2006-08-01

    Full Text Available Abstract Background Respiratory syncytial virus (RSV is the most common cause of acute bronchiolitis in infants and the elderly. Furthermore, epidemiological data suggest that RSV infection during infancy is a potent trigger of subsequent wheeze and asthma development. However, the mechanism by which RSV contributes to asthma is complex and remains largely unknown. A recent study indicates that the age of initial RSV infection is a key factor in determining airway response to RSV rechallenge. We hypothesized that severe RSV infection during neonatal development significantly alters lung structure and the pulmonary immune micro-environment; and thus, neonatal RSV infection is crucial in the development of or predisposition to allergic inflammatory diseases such as asthma. Methods To investigate this hypothesis the present study was conducted in a neonatal mouse model of RSV-induced pulmonary inflammation and airway dysfunction. Seven-day-old mice were infected with RSV (2 × 105 TCID50/g body weight and allowed to mature to adulthood. To determine if neonatal RSV infection predisposed adult animals to enhanced pathophysiological responses to allergens, these mice were then sensitized and challenged with ovalbumin. Various endpoints including lung function, histopathology, cytokine production, and cellularity in bronchoalveolar lavage were examined. Results RSV infection in neonates alone led to inflammatory airway disease characterized by airway hyperreactivity, peribronchial and perivascular inflammation, and subepithelial fibrosis in adults. If early RSV infection was followed by allergen exposure, this pulmonary phenotype was exacerbated. The initial response to neonatal RSV infection resulted in increased TNF-α levels in bronchoalveolar lavage. Interestingly, increased levels of IL-13 and mucus hyperproduction were observed almost three months after the initial infection with RSV. Conclusion Neonatal RSV exposure results in long term

  16. Difference in neural response to social exclusion observation and subsequent altruism between adolescents and adults.

    Tousignant, Béatrice; Eugène, Fanny; Sirois, Katia; Jackson, Philip L

    2017-04-13

    Empathy and prosocial behaviors toward peers promote successful social development and creation of significant long-term relationships, but surprisingly little is known about the maturation of these skills during the period of adolescence. As the majority of studies have used questionnaires or pain observation paradigms, it remains unknown whether the empathic response of adolescents differs from that of adults in a paradigm that is closer to everyday life. In the current study, fMRI was used to examine the neural correlates of social exclusion observation and subsequent prosocial behavior in 20 adolescents (aged 12-17 years) and 20 adults (aged 22-30 years) while playing a ball-tossing game with what they believed to be real individuals. Observing someone being excluded compared to observing equal inclusion of all players elicited a significantly higher activation of the IFG (pars triangularis) in adults compared to adolescents. When given the opportunity to directly help the excluded player during the game, adolescents showed significantly less prosocial behavior than adults, which was underpinned by a significantly lower activity in the right temporoparietal junction, medial/dorsomedial prefrontal cortex and fusiform face area. These findings might indicate that adolescents have a lower propensity to take the victim's perspective and share his or her distress when witnessing social exclusion, which leads to a lower altruistic motivation to help. The factors that could generate what can be interpreted as a downward modulation of empathy during adolescence are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Energetics demands and physiological responses to boxing match and subsequent recovery.

    Nassib, Sabri; Hammoudi-Nassib, Sarra; Chtara, Mokhtar; Mkaouer, Bessem; Maaouia, Ghazwa; Bezrati-Benayed, Ikram; Chamari, Karim

    2017-01-01

    Determining the physiological profile of athletes in boxing match is important for defining aspects of physical performance that are important to competitive performance. Therefore, examination of the energy pathway of high-level boxers' athletes can be very helpful for optimizing training and then improving boxing physical fitness and performance. The aim of the present study was to assess the physiological and cardiovascular responses during boxing matches and subsequent recovery. Fifteen male international level boxers (mean age 19.56±3.6 years; mean body mass 72.46±11.86 kg; mean height 176.50±7.22 cm) participated in this study. Blood samples were drawn from the antecubital vein before and after the boxing matches (T1: pre-match rest measure around 11:00 a.m., T2: measure at 3 minutes of post-match recovery; T3: measure at 60 minutes of recovery; T4: measure at 24 hours post-match - the match started around 11:30 a.m.). An analysis of glucose, triglycerides, lactate, cholesterol, creatinine, uric-acid, high density lipoprotein, and low density lipoprotein concentrations was performed for each sample. Participants did perform a maximal incremental test to measure maximal heart rate (HRmax). Heart rate responses to the matches were measured and expressed in percentage of HRmax. The average HR recorded during the match corresponded to 93±3.26% of HRmax. The levels of glucose, lactate, and cholesterol increased significantly from T1 to T2. Likewise, creatinine levels increased significantly from T1 to T2 and T3. However, the cholesterol level decreased significantly at T3 in comparison with T1. Moreover, 24-hour post-match creatinine levels were significantly lower and triglyceride levels were significantly higher compared with T1. The main results of this study revealed that the boxing matches stress the lipid metabolism system during boxing and post-match (for at least 24 hours) even if it is widely recognized boxing being mainly composed of repeated short

  18. A comparison of sample preparation strategies for biological tissues and subsequent trace element analysis using LA-ICP-MS.

    Bonta, Maximilian; Török, Szilvia; Hegedus, Balazs; Döme, Balazs; Limbeck, Andreas

    2017-03-01

    Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) is one of the most commonly applied methods for lateral trace element distribution analysis in medical studies. Many improvements of the technique regarding quantification and achievable lateral resolution have been achieved in the last years. Nevertheless, sample preparation is also of major importance and the optimal sample preparation strategy still has not been defined. While conventional histology knows a number of sample pre-treatment strategies, little is known about the effect of these approaches on the lateral distributions of elements and/or their quantities in tissues. The technique of formalin fixation and paraffin embedding (FFPE) has emerged as the gold standard in tissue preparation. However, the potential use for elemental distribution studies is questionable due to a large number of sample preparation steps. In this work, LA-ICP-MS was used to examine the applicability of the FFPE sample preparation approach for elemental distribution studies. Qualitative elemental distributions as well as quantitative concentrations in cryo-cut tissues as well as FFPE samples were compared. Results showed that some metals (especially Na and K) are severely affected by the FFPE process, whereas others (e.g., Mn, Ni) are less influenced. Based on these results, a general recommendation can be given: FFPE samples are completely unsuitable for the analysis of alkaline metals. When analyzing transition metals, FFPE samples can give comparable results to snap-frozen tissues. Graphical abstract Sample preparation strategies for biological tissues are compared with regard to the elemental distributions and average trace element concentrations.

  19. The influence of alloying elements on the hot-dip aluminizing process and on the subsequent high-temperature oxidation

    Glasbrenner, H.; Nold, E.; Voss, Z.

    1997-01-01

    For hot dip aluminizing HDA an Al melt was doped with one of the elements Mo, W or Nb with a nominal composition of about 1 wt%. In case of W, the nominal composition was achieved, not so for Mo and Nb. The influence of these elements on the coating formed and on the following oxidation process was investigated. Hot dip aluminizing was carried out at 800 C for 5 min under dry Ar atmosphere. The oxidation experiments were performed at 950 C for 24 h in air. Compared to the HDA processes with pure Al, the addition of the alloying elements lead to thinner intermetallic layers. A change in the oxidation behavior was observed as well concerning the suppression of internal oxidation and the formation of dense and close oxide scales. (orig.)

  20. Ascaris suum infection negatively affects the response to a Mycoplasma hyopneumoniae vaccination and subsequent challenge infection in pigs

    It is vital to understand the possible mechanisms that may impair optimal vaccine efficacy. The hypothesis posed in this study was that a concurrent Ascaris suum infection of pigs vaccinated with a Mycoplasma hyopneumoniae (Mh) vaccine would modulate the protective immune response to a subsequent ch...

  1. Early perception of medication benefit predicts subsequent antipsychotic response in schizophrenia: "the consumer has a point" revisited.

    Ascher-Svanum, Haya; Weiden, Peter; Nyhuis, Allen W; Faries, Douglas E; Stauffer, Virginia; Kollack-Walker, Sara; Kinon, Bruce J

    2014-07-01

    An easy-to-administer tool for predicting response to antipsychotic treatment could improve the acute management of patients with schizophrenia. We assessed whether a patient's perception of medication benefit early in treatment could predict subsequent response or nonresponse to continued use of the same treatment. This post hoc analysis used data from a randomized, open-label trial of antipsychotics for treatment of schizophrenia in which attitudes about medication adherence were assessed after two weeks of antipsychotic treatment using the Rating of Medication Influences (ROMI) scale. The analysis included 439 patients who had Positive and Negative Syndrome Scale (PANSS) and ROMI scale data at Weeks 2 and 8. Scores on the ROMI subscale Perceived Medication Benefit factor were used to predict subsequent antipsychotic response at Week 8, defined as a .20% reduction from baseline on the PANSS. Logistic regression was used to identify a cut-off score for the Perceived Medication Benefit factor that could accurately identify antipsychotic responders vs. nonresponders at Week 8. A score of .2.75 (equal to a mean subscale score of .11.00) on the ROMI scale Perceived Medication Benefit factor at Week 2 predicted response at Week 8 with high specificity (72%) and negative predictive value (70%), moderate sensitivity (44%) and positive predictive value (47%), and with a 38% misclassification rate. A brief assessment of the patient's perception of medication benefit at two weeks into treatment appears to be a good predictor of subsequent response and nonresponse after eight weeks of treatment with the same antipsychotic.

  2. Delayed system response times affect immediate physiology and the dynamics of subsequent button press behavior.

    Kohrs, Christin; Hrabal, David; Angenstein, Nicole; Brechmann, André

    2014-11-01

    System response time research is an important issue in human-computer interactions. Experience with technical devices and general rules of human-human interactions determine the user's expectation, and any delay in system response time may lead to immediate physiological, emotional, and behavioral consequences. We investigated such effects on a trial-by-trial basis during a human-computer interaction by measuring changes in skin conductance (SC), heart rate (HR), and the dynamics of button press responses. We found an increase in SC and a deceleration of HR for all three delayed system response times (0.5, 1, 2 s). Moreover, the data on button press dynamics was highly informative since subjects repeated a button press with more force in response to delayed system response times. Furthermore, the button press dynamics could distinguish between correct and incorrect decisions and may thus even be used to infer the uncertainty of a user's decision. Copyright © 2014 Society for Psychophysiological Research.

  3. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  4. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  5. Influence of prior intense exercise and cold water immersion in recovery for performance and physiological response during subsequent exercise

    Christensen, Peter Møller; Bangsbo, Jens

    2016-01-01

    ) and the influence from prior intense exercise on subsequent performance and physiological response to moderate and maximal exercise with and without the use of cold water immersion (CWI) in recovery (part B). In part A, performance times during eight World championships for male track cyclists were extracted from...... min preceded by an identical warm-up period in both a control setting (CON) and using cold water immersion in recovery (CWI; 15 min at 15°C). Performance was lowered (P

  6. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  7. Canine postradiation histamine levels and subsequent response to Compound 48/80

    Cockerham, L.G.; Doyle, T.F.; Donlon, M.A.; Helgeson, E.A.

    1984-01-01

    Radiation-induced hypotension in the beagle is accompanied by increased intestinal blood flow (IBF) and hematocrit (HCT). This study was performed to correlate these radiation-induced changes with plasma histamine (PH) levels following radiation. The histamine (H) levels were monitored in the systemic arterial circulation (SA) and the hepatic portal vein (HPV) before and after radiation. To examine the effect of radiation on the mobilization of total body H stores, Compound 48/80 was given I.V., and H responses were monitored in both control and radiated animals. Data obtained indicated that 100 Gy, whole-body, gamma-radiation produced a decrease in systemic mean blood pressure (BP), an increase in IBF and an increase in HCT. Concurrently, the mean PH/SA values increased and the PH/HPV levels decreased. Compound 48/80 produced a marked increase in PH levels in both control and radiated animals however, the levels found in the radiated animals were consistently lower than those in the controls, although not statistically different. This implies that H may mediate these observed intestinal responses and that the mobility of histamine is decreased in radiated animals. 19 references

  8. Area and depth of surfactant-induced corneal injury predicts extent of subsequent ocular responses.

    Jester, J V; Petroll, W M; Bean, J; Parker, R D; Carr, G J; Cavanagh, H D; Maurer, J K

    1998-12-01

    To correlate area and depth of initial corneal injury induced by surfactants of differing type and irritant properties with corneal responses and outcome in the same animals over time by using in vivo confocal microscopy (CM). Six groups of six adult rabbits were treated with anionic, cationic, and nonionic surfactants that caused different levels of ocular irritation. Test materials included slight irritants: 5% sodium lauryl sulfate (SLS), polyoxyethylene glycol monoalkyl ether (POE), and 5% 3-isotridecyloxypropyl-bis(polyoxyethylene) ammonium chloride (ITDOP); mild irritants: 5% 3-decyloxypropyl-bis(polyoxyethylene) amine (DOP) and sodium linear alkylbenzene sulfonate (LAS); and a moderate irritant: a proprietary detergent (DTRGT). Ten microliters surfactant were directly applied to the cornea of one eye of each rabbit. Ten untreated rabbits served as control subjects. Area and depth of initial injury was determined by using in vivo CM to measure epithelial thickness, epithelial cell size, corneal thickness, and depth of stromal injury in four corneal regions at 3 hours and at day 1. Area and depth of corneal responses to injury were evaluated at various times from days 3 through 35 by macroscopic grading and quantitative confocal microscopy through-focusing (CMTF). In vivo CM revealed corneal injury with slight irritants to be restricted to the epithelium, whereas the mild and moderate irritants caused complete epithelial cell loss with increasing anterior stromal damage: DOP < LAS < DTRGT. With the slight ocular irritants there was little or no change in corneal thickness or the CMTF intensity profiles. Three hours after treatment, mild and moderate ocular irritants caused a significant increase in corneal thickness, which peaked at day 1 with DOP (483.3+/-80.1 microm) and LAS (572.3+/-60.0 microm) and day 3 with DTRGT (601.4+/-68.7 microm); returning to normal (similar to control values) by day 7 with DOP and day 35 with LAS and DTRGT. The CMTF intensity

  9. Silibinin induces mitochondrial NOX4-mediated endoplasmic reticulum stress response and its subsequent apoptosis

    Kim, Sang-Hun; Kim, Kwang-Youn; Yu, Sun-Nyoung; Seo, Young-Kyo; Chun, Sung-Sik; Yu, Hak-Sun; Ahn, Soon-Cheol

    2016-01-01

    Silibinin, a biologically active compound of milk thistle, has chemopreventive effects on cancer cell lines. Recently it was reported that silibinin inhibited tumor growth through activation of the apoptotic signaling pathway. Although various evidences showed multiple signaling pathways of silibinin in apoptosis, there were no reports to address the clear mechanism of ROS-mediated pathway in prostate cancer PC-3 cells. Several studies suggested that reactive oxygen species (ROS) play an important role in various signaling cascades, but the primary source of ROS was currently unclear. The effect of silibinin was investigated on cell growth of prostate cell lines by MTT assay. We examined whether silibinin induced apoptosis through production of ROS using flow cytometry. Expression of apoptosis-, endoplasmic reticulum (ER)-related protein and gene were determined by western blotting and RT-PCR, respectively. Results showed that silibinin triggered mitochondrial ROS production through NOX4 expression and finally led to induce apoptosis. In addition, mitochondrial ROS caused ER stress through disruption of Ca 2+ homeostasis. Co-treatment of ROS inhibitor reduced the silibinin-induced apoptosis through the inhibition of NOX4 expression, resulting in reduction of both Ca 2+ level and ER stress response. Taken together, silibinin induced mitochondrial ROS-dependent apoptosis through NOX4, which is associated with disruption of Ca 2+ homeostasis and ER stress response. Therefore, the regulation of NOX4, mitochondrial ROS producer, could be a potential target for the treatment of prostate cancer. The online version of this article (doi:10.1186/s12885-016-2516-6) contains supplementary material, which is available to authorized users

  10. Insulin secretion and signaling in response to dietary restriction and subsequent re-alimentation in cattle.

    Keogh, Kate; Kenny, David A; Kelly, Alan K; Waters, Sinéad M

    2015-08-01

    The objectives of this study were to examine systemic insulin response to a glucose tolerance test (GTT) and transcript abundance of genes of the insulin signaling pathway in skeletal muscle, during both dietary restriction and re-alimentation-induced compensatory growth. Holstein Friesian bulls were blocked to one of two groups: 1) restricted feed allowance for 125 days (period 1) (RES, n = 15) followed by ad libitum feeding for 55 days (period 2) or 2) ad libitum access to feed throughout (periods 1 and 2) (ADLIB, n = 15). On days 90 and 36 of periods 1 and 2, respectively, a GTT was performed. M. longissimus dorsi biopsies were harvested from all bulls on days 120 and 15 of periods 1 and 2, respectively, and RNA-Seq analysis was performed. RES displayed a lower growth rate during period 1 (RES: 0.6 kg/day, ADLIB: 1.9 kg/day; P alimentation (RES: 2.5 kg/day, ADLIB: 1.4 kg/day; P alimentation (P > 0.05). Genes differentially expressed in the insulin signaling pathway suggested a greater sensitivity to insulin in skeletal muscle, with pleiotropic effects of insulin signaling interrupted during dietary restriction. Collectively, these results indicate increased sensitivity to glucose clearance and skeletal muscle insulin signaling during dietary restriction; however, no overall role for insulin was apparent in expressing compensatory growth. Copyright © 2015 the American Physiological Society.

  11. Impaired hypoxic ventilatory response following neonatal sustained and subsequent chronic intermittent hypoxia in rats.

    Mayer, C A; Ao, J; Di Fiore, J M; Martin, R J; MacFarlane, P M

    2013-06-15

    Neonatal chronic intermittent hypoxia (CIH) enhances the ventilatory sensitivity to acute hypoxia (acute hypoxic ventilatory response, HVR), whereas sustained hypoxia (SH) can have the opposite effect. Therefore, we investigated whether neonatal rats pre-treated with SH prior to CIH exhibit a modified HVR. Rat pups were exposed to CIH (5% O2/5min, 8h/day) between 6 and 15 days of postnatal age (P6-15) after pre-treatment with either normoxia or SH (11% O2; P1-5). Using whole-body plethysmography, the acute (5min, 10% O2) HVR at P16 (1 day post-CIH) was unchanged following CIH (67.9±6.7% above baseline) and also SH (58.8±10.5%) compared to age-matched normoxic rats (54.7±6.3%). In contrast, the HVR was attenuated (16.5±6.0%) in CIH exposed rats pre-treated with SH. These data suggest that while neonatal SH and CIH alone have little effect on the magnitude of the acute HVR, their combined effects impose a synergistic disturbance to postnatal development of the HVR. These data could provide important insight into the consequences of not maintaining adequate levels of oxygen saturation during the early neonatal period, especially in vulnerable preterm infants susceptible to frequent bouts of hypoxemic events (CIH) that are commonly associated with apnea of prematurity. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  13. Effects of elevated CO2 on litter chemistry and subsequent invertebrate detritivore feeding responses.

    Matthew W Dray

    Full Text Available Elevated atmospheric CO2 can change foliar tissue chemistry. This alters leaf litter palatability to macroinvertebrate detritivores with consequences for decomposition, nutrient turnover, and food-web structure. Currently there is no consensus on the link between CO2 enrichment, litter chemistry, and macroinvertebrate-mediated leaf decomposition. To identify any unifying mechanisms, we presented eight invertebrate species from aquatic and terrestrial ecosystems with litter from Alnus glutinosa (common alder or Betula pendula (silver birch trees propagated under ambient (380 ppm or elevated (ambient +200 ppm CO2 concentrations. Alder litter was largely unaffected by CO2 enrichment, but birch litter from leaves grown under elevated CO2 had reduced nitrogen concentrations and greater C/N ratios. Invertebrates were provided individually with either (i two litter discs, one of each CO2 treatment ('choice', or (ii one litter disc of each CO2 treatment alone ('no-choice'. Consumption was recorded. Only Odontocerum albicorne showed a feeding preference in the choice test, consuming more ambient- than elevated-CO2 birch litter. Species' responses to alder were highly idiosyncratic in the no-choice test: Gammarus pulex and O. albicorne consumed more elevated-CO2 than ambient-CO2 litter, indicating compensatory feeding, while Oniscus asellus consumed more of the ambient-CO2 litter. No species responded to CO2 treatment when fed birch litter. Overall, these results show how elevated atmospheric CO2 can alter litter chemistry, affecting invertebrate feeding behaviour in species-specific ways. The data highlight the need for greater species-level information when predicting changes to detrital processing-a key ecosystem function-under atmospheric change.

  14. The impact of anti-HY responses on outcome in current and subsequent pregnancies of patients with recurrent pregnancy losses

    Christiansen, Ole Bjarne; Steffensen, Rudi Nora; Nielsen, Henriette Svarre

    2010-01-01

    Women pregnant with a male fetus often generate cellular and humoral immune responses against male-specific minor histocompatibility (HY) antigens-however, the importance of these responses for pregnancy outcome is unclear. Epidemiologic studies have shown that the birth of a boy compared...... with a girl prior to a series of miscarriages significantly reduces the chance of a subsequent live birth and pregnancies with boys have an increased risk of placental abruption. This paper aims to review the current knowledge about the impact of anti-HY immunity on pregnancy outcome in terms of miscarriage...... and placental abruption. Our knowledge primarily comes from studies of the impact on pregnancy outcome of HLA class II alleles known to restrict CD4 T cell mediated anti-HY responses among 358 secondary recurrent miscarriage (SRM) patients and 203 of their children born prior to the miscarriages...

  15. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  16. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  17. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  18. The Impact of Induction Chemotherapy and the Associated Tumor Response on Subsequent Radiation-Related Changes in Lung Function and Tumor Response

    Mao Jingfang; Kocak, Zafer; Zhou Sumin; Garst, Jennifer; Evans, Elizabeth S.; Zhang Junan; Larrier, Nicole A.; Hollis, Donna R.; Folz, Rodney J.; Marks, Lawrence B.

    2007-01-01

    Purpose: To assess the impact of induction chemotherapy, and associated tumor shrinkage, on the subsequent radiation-related changes in pulmonary function and tumor response. Methods and Materials: As part of a prospective institutional review board-approved study, 91 evaluable patients treated definitively with thoracic radiation therapy (RT) for unresectable lung cancer were analyzed. The rates of RT-associated pulmonary toxicity and tumor response were compared in the patients with and without pre-RT chemotherapy. In the patients receiving induction chemotherapy, the rates of RT-associated pulmonary toxicity and tumor response were compared in the patients with and without a response (modified Response Evaluation Criteria in Solid Tumor criteria) to the pre-RT chemotherapy. Comparisons of the rates of improvements in pulmonary function tests (PFTs) post-RT, dyspnea requiring steroids, and percent declines in PFTs post-RT were compared in patient subgroups using Fisher's exact test, analysis of variance, and linear or logistic regression. Results: The use of pre-RT chemotherapy appears to increase the rate of radiation-induced pneumonitis (p = 0.009-0.07), but has no consistent impact on changes in PFTs. The degree of induction chemotherapy-associated tumor shrinkage is not associated with the rate of subsequent RT-associated pulmonary toxicity. The degree of tumor response to chemotherapy is not related to the degree of tumor response to RT. Conclusions: Additional study is needed to better clarify the impact of chemotherapy on radiation-associated disfunction

  19. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  1. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination.

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G

    2017-07-18

    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  2. Biodegradation of free cyanide and subsequent utilisation of biodegradation by-products by Bacillus consortia: optimisation using response surface methodology.

    Mekuto, Lukhanyo; Ntwampe, Seteno Karabo Obed; Jackson, Vanessa Angela

    2015-07-01

    A mesophilic alkali-tolerant bacterial consortium belonging to the Bacillus genus was evaluated for its ability to biodegrade high free cyanide (CN(-)) concentration (up to 500 mg CN(-)/L), subsequent to the oxidation of the formed ammonium and nitrates in a continuous bioreactor system solely supplemented with whey waste. Furthermore, an optimisation study for successful cyanide biodegradation by this consortium was evaluated in batch bioreactors (BBs) using response surface methodology (RSM). The input variables, that is, pH, temperature and whey-waste concentration, were optimised using a numerical optimisation technique where the optimum conditions were found to be as follows: pH 9.88, temperature 33.60 °C and whey-waste concentration of 14.27 g/L, under which 206.53 mg CN(-)/L in 96 h can be biodegraded by the microbial species from an initial cyanide concentration of 500 mg CN(-)/L. Furthermore, using the optimised data, cyanide biodegradation in a continuous mode was evaluated in a dual-stage packed-bed bioreactor (PBB) connected in series to a pneumatic bioreactor system (PBS) used for simultaneous nitrification, including aerobic denitrification. The whey-supported Bacillus sp. culture was not inhibited by the free cyanide concentration of up to 500 mg CN(-)/L, with an overall degradation efficiency of ≥ 99 % with subsequent nitrification and aerobic denitrification of the formed ammonium and nitrates over a period of 80 days. This is the first study to report free cyanide biodegradation at concentrations of up to 500 mg CN(-)/L in a continuous system using whey waste as a microbial feedstock. The results showed that the process has the potential for the bioremediation of cyanide-containing wastewaters.

  3. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  4. Heart type fatty acid binding protein response and subsequent development of atherosclerosis in insulin resistant polycystic ovary syndrome patients.

    Cakir, Evrim; Ozbek, Mustafa; Sahin, Mustafa; Cakal, Erman; Gungunes, Askin; Ginis, Zeynep; Demirci, Taner; Delibasi, Tuncay

    2012-12-18

    Women with polycystic ovary syndrome (PCOS) have higher risk for cardiovascular disease (CVD). Heart type fatty acid binding protein (HFABP) has been found to be predictive for myocardial ischemia.Wet ested whether HFABP is the predictor for CVD in PCOS patients, who have an increased risk of cardiovascular disease. This was a prospective, cross sectional controlled study conducted in a training and research hospital.The study population consisted of 46 reproductive-age PCOS women and 28 control subjects. We evaluated anthropometric and metabolic parameters, carotid intima media thickness and HFABP levels in both PCOS patients and control group. Mean fasting insulin, homeostasis model assessment insulin resistance index (HOMA-IR), triglyceride, total cholesterol, low density lipoprotein cholesterol, free testosterone, total testosterone, carotid intima media thickness (CIMT) levels were significantly higher in PCOS patients. Although HFABP levels were higher in PCOS patients, the difference did not reach statistically significant in early age groups. After adjustment for age and body mass index, HFABP level was positive correlated with hsCRP, free testosterone levels, CIMT and HOMA-IR. Heart type free fatty acid binding protein appeared to have an important role in metabolic response and subsequent development of atherosclerosis in insulin resistant, hyperandrogenemic PCOS patients.

  5. Heart type fatty acid binding protein response and subsequent development of atherosclerosis in insulin resistant polycystic ovary syndrome patients

    Cakir Evrim

    2012-12-01

    Full Text Available Abstract Background Women with polycystic ovary syndrome (PCOS have higher risk for cardiovascular disease (CVD. Heart type fatty acid binding protein (HFABP has been found to be predictive for myocardial ischemia.Wet ested whether HFABP is the predictor for CVD in PCOS patients, who have an increased risk of cardiovascular disease. Methods This was a prospective, cross sectional controlled study conducted in a training and research hospital.The study population consisted of 46 reproductive-age PCOS women and 28 control subjects. We evaluated anthropometric and metabolic parameters, carotid intima media thickness and HFABP levels in both PCOS patients and control group. Results Mean fasting insulin, homeostasis model assessment insulin resistance index (HOMA-IR, triglyceride, total cholesterol, low density lipoprotein cholesterol, free testosterone, total testosterone, carotid intima media thickness (CIMT levels were significantly higher in PCOS patients. Although HFABP levels were higher in PCOS patients, the difference did not reach statistically significant in early age groups. After adjustment for age and body mass index, HFABP level was positive correlated with hsCRP, free testosterone levels, CIMT and HOMA-IR. Conclusions Heart type free fatty acid binding protein appeared to have an important role in metabolic response and subsequent development of atherosclerosis in insulin resistant, hyperandrogenemic PCOS patients.

  6. IgA attenuates anaphylaxis and subsequent immune responses in mice: possible application of IgA to vaccines.

    Yamaki, Kouya; Nakashima, Takayuki; Miyatake, Kenji; Ishibashi, Yuki; Ito, Ayaka; Kuranishi, Ayu; Taguchi, Akihito; Morioka, Ayumi; Yamamoto, Midori; Yoshino, Shin

    2014-01-01

    Administration of the influenza vaccination to patients with an egg allergy is major health concern. Contaminating egg antigens occasionally induce severe anaphylactic shock in these patients following administration of the vaccination; therefore, the development of a safer vaccination is needed. In the present study, we investigated whether a mixture of four newly and previously generated anti-ovalbumin (OVA) IgA monoclonal antibodies (mAbs) could inhibit both anaphylactic shock upon a subcutaneous OVA challenge and subsequent further sensitization against OVA in passively anti-OVA IgE-sensitized mice and actively sensitized mice with an injection of OVA. The prevention of anaphylaxis by anti-OVA IgA mAbs was suggested to be mediated through the inhibition of OVA binding to allergenic antibodies such as anti-OVA IgE on mast cells and deceleration of the rate of OVA penetration from the injected site into the systemic circulation. Anti-OVA IgA mAbs inhibited further sensitization against OVA in mice actively sensitized with OVA, but did not affect sensitization against the unrelated antigen, phosphorylcholine-keyhole limpet hemocyanin co-injected with OVA. Our findings indicate that adding the anti-egg antigen IgA to the influenza vaccine should reduce not only the risk of inducing anaphylactic shock, but also undesired further sensitization against egg antigens following the vaccination without affecting the intended beneficial effect of the vaccine, namely the upregulation of immune responses to influenza viruses.

  7. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  8. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  9. Corn defense responses to nitrogen availability and subsequent performance and feeding preferences of beet armyworm (Lepidoptera: Noctuidae).

    Ren, Li-Li; Hardy, Giles; Liu, Zhu-Dong; Wei, Wei; Dai, Hua-Guo

    2013-06-01

    Many studies have reported the effect of nitrogen (N) fertilization on plant constitutive defense responses; however, little is known about their effects on plant induced defense patterns and its consequence for insect herbivores. In our experiments, the effects of N availability on growth, nutritional quality (N content, protein/carbohydrate [P:C] ratio, modified gross energy [MGE]), and constitutive phenolics of corn, Zea mays L. were quantified. Moreover, the indirect effects of N fertilization on the beet armyworm, Spodoptera exigua Hübner through larval performance and feeding preference were examined. N fertilization increased plant growth, and depressed defense traits by increasing N content and the P:C ratio, as well as decreasing the constitutive concentration of phenolics. Subsequently, beet armyworm showed higher performance and preferentially fed on high-N corn because of its low defense traits. After beet armyworm feeding, high-N corn significantly deterred larval feeding, and had negative effects on the performance of beet armyworm through decreasing P:C ratio and increasing induced phenolics. On the contrary, there were no significant changes in P:C ratio and phenolics in low-N corn after feeding damage. Larval performance and preference were also not affected by induced compounds in low-N corn, which suggested that the expression of induced defense was dependent on N availability. The result indicates that N availability can exert a variety of bottom-up effect on plant defense patterns to influence insect population dynamics, and thereby may represent a source of variation in plant-insect interactions.

  10. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  11. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  12. Whole-brain radiotherapy with or without efaproxiral for the treatment of brain metastases: Determinants of response and its prognostic value for subsequent survival

    Stea, Baldassarre; Suh, John H.; Boyd, Adam P. M.S.; Cagnoni, Pablo J.; Shaw, Edward

    2006-01-01

    Purpose: To determine the prognostic factors for radiographic response and its prognostic value for subsequent survival in patients undergoing whole-brain radiotherapy (WBRT) for brain metastases. Methods and Materials: Five hundred fifteen eligible patients were randomized in a phase III trial evaluating WBRT and supplemental oxygen with or without efaproxiral, an allosteric modifier of hemoglobin that reduces hemoglobin oxygen-binding affinity and enhances tumor oxygenation, potentially increasing tumor radiosensitivity. Brain images were obtained at baseline and at scheduled follow-up visits after WBRT. Landmark analysis was used to assess the ability of response at selected time points to predict subsequent survival. Logistic regression was used to assess determinants of response at 3 months. Results: Treatment arm, Karnofsky Performance Status, presence or absence of liver metastases, and primary site were all determinants of response at the 3-month follow-up visit, with patients in the efaproxiral arm experiencing a 67% greater odds of response at this visit (p = 0.02). Response at 3 and 6 months was a significant prognostic factor for longer subsequent survival. Conclusions: The 3-month scan is a valuable prognostic factor for subsequent survival in patients with brain metastases treated with WBRT. Patients in the efaproxiral arm had a higher response rate at 3 and 6 months than those in the control arm

  13. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  14. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  15. Ascaris suum infection negatively affects the response to a Mycoplasma hyopneumoniae vaccination and subsequent challenge infection in pigs

    Steenhard, Nina R.; Jungersen, Gregers; Kokotovic, Branko

    2009-01-01

    Since their first introduction more than a century ago, vaccines have become one of the most cost-effective tools to prevent and manage infectious diseases in human and animal populations. It is vital to understand the possible mechanisms that may impair optimal vaccine efficacy. The hypothesis...... posed in this study was that a concurrent Ascaris suum infection of pigs vaccinated with a Mycoplasma hyopneumoniae (Mh)vaccine would modulate the protectiveimmuneresponse to a subsequent challenge infection. Four groups of pigs were either (1) untreated (group C), (2) vaccinated againstMh 3 weeks after...... the start of the study (group V), (3) given a trickle infection with A. suum throughout the study (group A), or (4) given a trickle infection with A. suum and vaccinated against Mh (group AV). All pigs were subsequently inoculated with live Mh bacteria 4 weeks after the Mh vaccination and necropsied after...

  16. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  17. Vitamin A supplementation at birth might prime the response to subsequent vitamin A supplements in girls. Three year follow-up of a randomized trial

    Fisker, Ane Bærent; Aaby, Peter; Rodrigues, Amabelia

    2011-01-01

    OBJECTIVES: Within a randomised trial of neonatal vitamin A supplementation (VAS) in Guinea-Bissau, neonatal VAS did not affect overall infant mortality. We conducted a post-hoc analysis to test the hypothesis that neonatal VAS primes the response to subsequent vitamin A. METHODS: All trial...

  18. A non-linear association between self-reported negative emotional response to stress and subsequent allostatic load

    Dich, Nadya; Doan, Stacey N; Kivimäki, Mika

    2014-01-01

    dysregulation. Allostatic load also increased with age, but the association between negative emotional response and allostatic load remained stable over time. These results provide evidence for a more nuanced understanding of the role of negative emotions in long-term physical health....... response to major life events and allostatic load, a multisystem indicator of physiological dysregulation. Study sample was 6764 British civil service workers from the Whitehall II cohort. Negative emotional response was assessed by self-report at baseline. Allostatic load was calculated using...... cardiovascular, metabolic and immune function biomarkers at three clinical follow-up examinations. A non-linear association between negative emotional response and allostatic load was observed: being at either extreme end of the distribution of negative emotional response increased the risk of physiological...

  19. Can short-term administration of dexamethasone abrogate radiation-induced acute cytokine gene response in lung and modify subsequent molecular responses?

    Hong, J.-H.; Chiang, C.-S.; Tsao, C.-Y.; Lin, P.-Y.; Wu, C.-J.; McBride, William H.

    2001-01-01

    Purpose: To investigate the effects of short-term administration of dexamethasone (DEX) on radiation-induced responses in the mouse lung, focusing on expression of pro-inflammatory cytokine and related genes. Methods and Materials: At indicated times after thoracic irradiation and/or drug treatment, mRNA expression levels of cytokines (mTNF-α, mIL-1α, mIL-1β, mIL-2, mIL-3, mIL-4, mIL-5, mIL-6, mIFN-γ) and related genes in the lungs of C3H/HeN mice were measured by RNase protection assay. Results: Radiation-induced pro-inflammatory cytokine mRNA expression levels in lung peak at 6 h after thoracic irradiation. DEX (5 mg/kg) suppresses both basal cytokine mRNA levels and this early response when given immediately after irradiation. However, by 24 h, in mice treated with DEX alone or DEX plus radiation, there was a strong rebound effect that lasted up to 3 days. Modification of the early radiation-induced response by DEX did not change the second wave of cytokine gene expression in the lung that occurs at 1 to 2 weeks, suggesting that early cytokine gene induction might not determine subsequent molecular events. A single dose of DEX attenuated, but did not completely suppress, increases in cytokine mRNA levels induced by lipopolysaccharide (2.5 mg/kg) treatment, but, unlike with radiation, no significant rebound effect was seen. Five days of dexamethasone treatment in the pneumonitic phase also inhibited pro-inflammatory cytokine gene expression and, again, there was a rebound effect after withdrawal of the drug. Conclusions: Our findings suggest that short-term use of dexamethasone can temporarily suppress radiation-induced pro-inflammatory cytokine gene expression, but there may be a rebound after drug withdrawal and the drug does little to change the essence and course of the pneumonitic process

  20. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  1. Adoptive transfer of natural antibodies to non-immunized chickens affects subsequent antigen-specific humoral and cellular immune responses

    Lammers, A.; Klomp, M.E.V.; Nieuwland, M.G.B.; Savelkoul, H.F.J.; Parmentier, H.K.

    2004-01-01

    To determine a regulatory function of natural antibodies in the immune response of chickens, pooled plasma obtained from non-immunized (naive) 15 months old hens was subjected to keyhole limpet hemocyanin (KLH) antigen-affinity chromatography. Purified KLH-binding antibodies were adoptively

  2. Initial cognitive response to cholinesterase inhibitors and subsequent long-term course in patients with mild Alzheimer's disease

    Droogsma, Erika; van Asselt, Dieneke; Diekhuis, Marjolein; Veeger, Nic; van der Hooft, Cornelis; De Deyn, Peter Paul

    Background: Some guidelines recommend to discontinue treatment with cholinesterase inhibitors (ChEIs) in patients with Alzheimer's disease (AD) without an initial response to ChEI treatment. Evidence supporting this recommendation, however, is limited. This study aimed to investigate the relation

  3. Spontaneous Transient Lateral Thoracic Lung Herniation Resulting in Systemic Inflammatory Response Syndrome (SIRS and Subsequent Contralateral Lung Injury

    Antony Kaliyadan

    2011-01-01

    Full Text Available Lung herniation is a relatively rare clinical entity that is most commonly either congenital or acquired traumatically. We describe a case of spontaneous lung herniation secondary to acute cough in an obese male smoker complicated by contralateral acute lung injury and systemic inflammatory response syndrome (SIRS. Mechanisms of lung herniation, classification, diagnosis, and management will be discussed.

  4. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  5. Mycobacterium vaccae induces a strong Th1 response that subsequently declines in C57BL/6 mice.

    Zhang, Lijiao; Jiang, Yanlong; Cui, Ziyin; Yang, Wentao; Yue, Limin; Ma, Yingcong; Shi, Shaohua; Wang, Chunfang; Wang, Chunfeng; Qian, Aidong

    2016-12-30

    Mycobacterium (M.) vaccae is a fast-growing species of saprophytic bacteria that is widely distributed. To understand the host immune responses induced by M. vaccae isolated from bovine submaxillary lymph nodes, C57BL/6 mice were infected with reference strain M. bovis Bacillus Calmette-Guérin (BCG) and isolated M. vaccae using intraperitoneal injections. Comparison of the bacterial replication and organ pathology between M. vaccae and M. bovis BCG revealed that M. vaccae was more malignant than M. bovis in mice. We also demonstrated that serum from the M. vaccae -infected mice contained a higher expression level of gamma-interferon (IFN-γ), tumor necrosis factor alpha, monocyte chemoattractant protein-1, interleukin (IL)-4, IL-12, IL-10 and transforming growth factor beta than did the other groups, especially after week 4. Furthermore, when the numbers of CD3⁺CD4⁺IFN-γ⁺ and CD3⁺CD4⁺IL4⁺cells in the infected mice were observed by flow cytometry, we found that a powerful T helper 1 (Th1) response was induced by M. vaccae infection, which was associated with the emergence of CD3⁺CD4⁺IFN-γ⁺cells. However, the Th1 response declined over time, which was associated with appearance of the CD4⁺CD25⁺FoxP3⁺ and CD4⁺CD25⁺CD152⁺Treg cell reaction. In addition, a strong Th2 response was found. Finally, we found that M. vaccae infection increased the production of type I IFNs, which was associated with a reduced Th1 response.

  6. Reduced neonatal regulatory T cell response to microbial stimuli associates with subsequent eczema in high-risk infants.

    Ismail, Intan H; Boyle, Robert J; Mah, Li-Jeen; Licciardi, Paul V; Tang, Mimi L K

    2014-11-01

    Regulatory T cells (Treg) play an essential role in early immune programming and shaping the immune response towards a pro-allergic or tolerant state. We evaluated cord blood Treg and cytokine responses to microbial and non-microbial stimuli in infants at high risk of allergic disease and their associations with development of allergic disease in the first year. Cord blood mononuclear cells from 72 neonates were cultured with toll-like receptors (TLR2) ligands: lipoteichoic acid (LTA) and heat-killed Lactobacillus rhamnosus GG (HKL); TLR4 ligand: lipopolysaccharide (LPS); ovalbumin (OVA); anti-CD3; or media for 48 h. Treg numbers and Treg cytokines were assessed in relation to allergic disease outcomes during the first year of life (eczema and atopic sensitization). Infants with eczema (n = 24) had reduced percentages of FoxP3(hi)CD25(hi) Treg in LTA (p = 0.01, adj p = 0.005) and HKL (p = 0.04, adj p = 0.02) stimulated cultures as well as reduced IL-10 (p = 0.01) production following HKL stimulation compared to those without eczema (n = 48). No differences in Treg or cytokine responses to LPS, OVA or anti-CD3 were seen. Infants who developed sensitization had lower percentages of Treg following TLR2 stimulation (but not other stimuli) compared to non-sensitized infants. High-risk children who develop allergic disease in the first year of life have deficient Treg responses to microbial stimuli but not allergen from the time of birth, which may contribute to failure of immune tolerance development in infancy. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Microwave dissolution of plant tissue and the subsequent determination of trace lanthanide and actinide elements by inductively coupled plasma-mass spectrometry

    Alvarado, J.S.; Neal, T.J.; Smith, L.L.; Erickson, M.D.

    1997-01-01

    Recently there has been much concern with the ability of plants to uptake heavy metals from their surroundings. With the development of instrumental techniques with low detection limits such as inductively coupled plasma-mass spectrometry (ICP-MS), attention is shifting toward achieving faster and more elegant ways of oxidizing the organic material inherent in environmental samples. Closed-vessel microwave dissolution was compared with conventional methods for the determination of concentrations of cerium, samarium, europium, terbium, uranium and thorium in a series of samples from the National Institute of Standards and Technology and from fields in Idaho. The ICP-MS technique exhibited detection limits in parts-per-trillion and linear calibration plots over three orders of magnitude for the elements under study. The results obtained by using nitric acid and hydrogen peroxide in a microwave digestion system for the analysis of reference materials showed close agreement with the accepted values. These values were compared with results obtained from dry- and wet-ashing procedures. The findings from an experiment comparing radiometric techniques for the determination of actinide elements to ICP-MS are reported

  8. Key Role of the Scavenger Receptor MARCO in Mediating Adenovirus Infection and Subsequent Innate Responses of Macrophages.

    Maler, Mareike D; Nielsen, Peter J; Stichling, Nicole; Cohen, Idan; Ruzsics, Zsolt; Wood, Connor; Engelhard, Peggy; Suomalainen, Maarit; Gyory, Ildiko; Huber, Michael; Müller-Quernheim, Joachim; Schamel, Wolfgang W A; Gordon, Siamon; Jakob, Thilo; Martin, Stefan F; Jahnen-Dechent, Willi; Greber, Urs F; Freudenberg, Marina A; Fejer, György

    2017-08-01

    The scavenger receptor MARCO is expressed in several subsets of naive tissue-resident macrophages and has been shown to participate in the recognition of various bacterial pathogens. However, the role of MARCO in antiviral defense is largely unexplored. Here, we investigated whether MARCO might be involved in the innate sensing of infection with adenovirus and recombinant adenoviral vectors by macrophages, which elicit vigorous immune responses in vivo Using cells derived from mice, we show that adenovirus infection is significantly more efficient in MARCO-positive alveolar macrophages (AMs) and in AM-like primary macrophage lines (Max Planck Institute cells) than in MARCO-negative bone marrow-derived macrophages. Using antibodies blocking ligand binding to MARCO, as well as gene-deficient and MARCO-transfected cells, we show that MARCO mediates the rapid adenovirus transduction of macrophages. By enhancing adenovirus infection, MARCO contributes to efficient innate virus recognition through the cytoplasmic DNA sensor cGAS. This leads to strong proinflammatory responses, including the production of interleukin-6 (IL-6), alpha/beta interferon, and mature IL-1α. These findings contribute to the understanding of viral pathogenesis in macrophages and may open new possibilities for the development of tools to influence the outcome of infection with adenovirus or adenovirus vectors. IMPORTANCE Macrophages play crucial roles in inflammation and defense against infection. Several macrophage subtypes have been identified with differing abilities to respond to infection with both natural adenoviruses and recombinant adenoviral vectors. Adenoviruses are important respiratory pathogens that elicit vigorous innate responses in vitro and in vivo The cell surface receptors mediating macrophage type-specific adenovirus sensing are largely unknown. The scavenger receptor MARCO is expressed on some subsets of naive tissue-resident macrophages, including lung alveolar macrophages

  9. Culture medium type affects endocytosis of multi-walled carbon nanotubes in BEAS-2B cells and subsequent biological response.

    Haniu, Hisao; Saito, Naoto; Matsuda, Yoshikazu; Tsukahara, Tamotsu; Maruyama, Kayo; Usui, Yuki; Aoki, Kaoru; Takanashi, Seiji; Kobayashi, Shinsuke; Nomura, Hiroki; Okamoto, Masanori; Shimizu, Masayuki; Kato, Hiroyuki

    2013-09-01

    We examined the cytotoxicity of multi-walled carbon nanotubes (MWCNTs) and the resulting cytokine secretion in BEAS-2B cells or normal human bronchial epithelial cells (HBEpCs) in two types of culture media (Ham's F12 containing 10% FBS [Ham's F12] and serum-free growth medium [SFGM]). Cellular uptake of MWCNT was observed by fluorescent microscopy and analyzed using flow cytometry. Moreover, we evaluated whether MWCNT uptake was suppressed by 2 types of endocytosis inhibitors. We found that BEAS-2B cells cultured in Ham's F12 and HBEpCs cultured in SFGM showed similar biological responses, but BEAS-2B cells cultured in SFGM did not internalize MWCNTs, and the 50% inhibitory concentration value, i.e., the cytotoxicity, was increased by more than 10-fold. MWCNT uptake was suppressed by a clathrin-mediated endocytosis inhibitor and a caveolae-mediated endocytosis inhibitor in BEAS-2B cells cultured in Ham's F12 and HBEpCs cultured in SFGM. In conclusion, we suggest that BEAS-2B cells cultured in a medium containing serum should be used for the safety evaluation of nanomaterials as a model of normal human bronchial epithelial cells. However, the culture medium composition may affect the proteins that are expressed on the cytoplasmic membrane, which may influence the biological response to MWCNTs. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Molecular and Photosynthetic Responses to Prolonged Darkness and Subsequent Acclimation to Re-Illumination in the Diatom Phaeodactylum tricornutum

    Nymark, Marianne; Valle, Kristi Collier; Hancke, Kasper

    2013-01-01

    and immediately utilize the available energy in photosynthesis and growth. We have investigated both the response to prolonged darkness and the re-acclimation to moderate intensity white irradiance (E = 100 µmol m−2 s−1) in the diatom Phaeodactylum tricornutum, using an integrated approach involving global......-introduction of the cells to the initial light conditions revealed 5) distinct expression profiles for nuclear genes involved in photosynthesis and those involved in photoprotection, 6) rapid rise in photosynthetic parameters (α and rETRmax) within 0.5 h of re-exposure to light despite a very modest de novo synthesis......Photosynthetic diatoms that live suspended throughout the water column will constantly be swept up and down by vertical mixing. When returned to the photic zone after experiencing longer periods in darkness, mechanisms exist that enable the diatoms both to survive sudden light exposure...

  11. Arsenic trioxide mediates HAPI microglia inflammatory response and subsequent neuron apoptosis through p38/JNK MAPK/STAT3 pathway

    Mao, Jiamin [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Yang, Jianbing [Department of Pediatrics, Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001 (China); Zhang, Yan [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Li, Ting [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Wang, Cheng [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Xu, Lingfei; Hu, Qiaoyun; Wang, Xiaoke; Jiang, Shengyang [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Chen, Gang, E-mail: chengang@ntu.edu.cn [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China)

    2016-07-15

    Arsenic is a widely distributed toxic metalloid all over the world. Inorganic arsenic species are supposed to affect astrocytic functions and to cause neuron apoptosis in CNS. Microglias are the key cell type involved in innate immune responses in CNS, and microglia activation has been linked to inflammation and neurotoxicity. In this study, using ELISA, we showed that Arsenic trioxide up-regulated the expression and secretion of IL-1β in a dose-dependent manner and a time-dependent manner in cultured HAPI microglia cells. The secretion of IL-1β caused the apoptosis of SH-SY5Y. These pro-inflammatory responses were inhibited by the STAT3 blocker, AG490 and P38/JNK MAPK blockers SB202190, SP600125. Further, Arsenic trioxide exposure could induce phosphorylation and activation of STAT3, and the translocation of STAT3 from the cytosol to the nucleus in this HAPI microglia cell line. Thus, the STAT3 signaling pathway can be activated after Arsenic trioxide treatment. However, P38/JNK MAPK blockers SB202190, SP600125 also obviously attenuated STAT3 activation and transnuclear transport induced by Arsenic trioxide. In concert with these results, we highlighted that the secretion of IL-1β and STAT3 activation induced by Arsenic trioxide can be mediated by elevation of P38/JNK MAPK in HAPI microglia cells and then induced the toxicity of neurons. - Highlights: • Arsenic trioxide exposure induced expression of IL-β in HAPI microglia. • Arsenic trioxide exposure induced activation of MAPK pathways in HAPI microglia. • Arsenic trioxide exposure induced activation of STAT3 pathways in HAPI microglia. • The expression of IL-β though P38/JNK MAPK/STAT3 pathways in HAPI microglia.

  12. Arsenic trioxide mediates HAPI microglia inflammatory response and subsequent neuron apoptosis through p38/JNK MAPK/STAT3 pathway

    Mao, Jiamin; Yang, Jianbing; Zhang, Yan; Li, Ting; Wang, Cheng; Xu, Lingfei; Hu, Qiaoyun; Wang, Xiaoke; Jiang, Shengyang; Nie, Xiaoke; Chen, Gang

    2016-01-01

    Arsenic is a widely distributed toxic metalloid all over the world. Inorganic arsenic species are supposed to affect astrocytic functions and to cause neuron apoptosis in CNS. Microglias are the key cell type involved in innate immune responses in CNS, and microglia activation has been linked to inflammation and neurotoxicity. In this study, using ELISA, we showed that Arsenic trioxide up-regulated the expression and secretion of IL-1β in a dose-dependent manner and a time-dependent manner in cultured HAPI microglia cells. The secretion of IL-1β caused the apoptosis of SH-SY5Y. These pro-inflammatory responses were inhibited by the STAT3 blocker, AG490 and P38/JNK MAPK blockers SB202190, SP600125. Further, Arsenic trioxide exposure could induce phosphorylation and activation of STAT3, and the translocation of STAT3 from the cytosol to the nucleus in this HAPI microglia cell line. Thus, the STAT3 signaling pathway can be activated after Arsenic trioxide treatment. However, P38/JNK MAPK blockers SB202190, SP600125 also obviously attenuated STAT3 activation and transnuclear transport induced by Arsenic trioxide. In concert with these results, we highlighted that the secretion of IL-1β and STAT3 activation induced by Arsenic trioxide can be mediated by elevation of P38/JNK MAPK in HAPI microglia cells and then induced the toxicity of neurons. - Highlights: • Arsenic trioxide exposure induced expression of IL-β in HAPI microglia. • Arsenic trioxide exposure induced activation of MAPK pathways in HAPI microglia. • Arsenic trioxide exposure induced activation of STAT3 pathways in HAPI microglia. • The expression of IL-β though P38/JNK MAPK/STAT3 pathways in HAPI microglia.

  13. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia.

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

    2014-01-01

    First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.

  14. Immune sensitization to methylene diphenyl diisocyanate (MDI resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses

    Redlich Carrie A

    2011-03-01

    Full Text Available Abstract Background Methylene diphenyl diisocyanate (MDI, a reactive chemical used for commercial polyurethane production, is a well-recognized cause of occupational asthma. The major focus of disease prevention efforts to date has been respiratory tract exposure; however, skin exposure may also be an important route for inducing immune sensitization, which may promote subsequent airway inflammatory responses. We developed a murine model to investigate pathogenic mechanisms by which MDI skin exposure might promote subsequent immune responses, including respiratory tract inflammation. Methods Mice exposed via the skin to varying doses (0.1-10% w/v of MDI diluted in acetone/olive oil were subsequently evaluated for MDI immune sensitization. Serum levels of MDI-specific IgG and IgE were measured by enzyme-linked immunosorbant assay (ELISA, while respiratory tract inflammation, induced by intranasal delivery of MDI-mouse albumin conjugates, was evaluated based on bronchoalveolar lavage (BAL. Autologous serum IgG from "skin only" exposed mice was used to detect and guide the purification/identification of skin proteins antigenically modified by MDI exposure in vivo. Results Skin exposure to MDI resulted in specific antibody production and promoted subsequent respiratory tract inflammation in animals challenged intranasally with MDI-mouse albumin conjugates. The degree of (secondary respiratory tract inflammation and eosinophilia depended upon the (primary skin exposure dose, and was maximal in mice exposed to 1% MDI, but paradoxically limited in mice receiving 10-fold higher doses (e.g. 10% MDI. The major antigenically-modified protein at the local MDI skin exposure site was identified as albumin, and demonstrated biophysical changes consistent with MDI conjugation. Conclusions MDI skin exposure can induce MDI-specific immune sensitivity and promote subsequent respiratory tract inflammatory responses and thus, may play an important role in MDI asthma

  15. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  16. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

    2014-01-01

    Introduction First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance – Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥2 TAMs; or M184V+≥1 TAM. Virological suppression was defined as viral load (VL) Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥2 TAMs; and 32 with M184V+≥1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤200 cells/µL at genotyping (OR=4.43, 95% CI [1.59–12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39–16.36], p<0.001). Among 87/105 patients with available VL at 12 months after switch to second-line ART, virological suppression was achieved in 85%. The median genotypic susceptibility score (GSS) for the second-line regimen was 2.00. Patients with ART adherence ≥95% were more likely to be virologically suppressed (OR=9.33, 95% CI (2.43–35.81), p=0.001). Measures of patient resistance to second-line ART, including the GSS, were not significantly associated with virological outcome. Conclusions Multi-NRTI RAMs at first-line failure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving

  18. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  19. Farm to abattoir conditions, animal factors and their subsequent effects on cattle behavioural responses and beef quality — A review

    Yonela Zifikile Njisane

    2017-06-01

    Full Text Available The current review seeks to highlight the concerns that have been raised on pre-slaughter stress, contributing factors and its consequent effects on cattle behavioural responses and the quality of beef; inter-linking the activities involved from birth to slaughter. Such information is crucial in light of the consumer concerns on overall animal welfare, quality of meat and food security. Slaughter animals are exposed to different conditions during production and transportation to abattoirs on a daily basis. However; the majority of studies that have been done previously singled out different environments in the meat production chain, while conclusions have been made that the welfare of slaughter animals and the quality of meat harvested from them is dependent on the whole chain. Behaviour is a critical component used to evaluate the animals’ wellbeing and it has been reported to have an effect on product quality. Apart from the influence of on-farm, transportation and abattoir conditions, the genetic background of the animal also affects how it perceives and responds to certain encounters. Stress activates the animals’ hypothalamic-pituitary-adrenal activity, triggering release of various stress hormones such as catecholamines and cortisol, thus glycogen depletion prior slaughter, elevated ultimate pH and poor muscle-meat conversion. Pre-slaughter stress sometimes results to cattle attaining bruises, resulting to the affected parts of the carcass being trimmed and condemned for human consumption, downgrading of the carcass and thus profit losses.

  20. An accessory to the 'Trinity': SR-As are essential pathogen sensors of extracellular dsRNA, mediating entry and leading to subsequent type I IFN responses.

    Stephanie J DeWitte-Orr

    2010-03-01

    Full Text Available Extracellular RNA is becoming increasingly recognized as a signaling molecule. Virally derived double stranded (dsRNA released into the extracellular space during virus induced cell lysis acts as a powerful inducer of classical type I interferon (IFN responses; however, the receptor that mediates this response has not been identified. Class A scavenger receptors (SR-As are likely candidates due to their cell surface expression and ability to bind nucleic acids. In this study, we investigated a possible role for SR-As in mediating type I IFN responses induced by extracellular dsRNA in fibroblasts, a predominant producer of IFNbeta. Fibroblasts were found to express functional SR-As, even SR-A species thought to be macrophage specific. SR-A specific competitive ligands significantly blocked extracellular dsRNA binding, entry and subsequent interferon stimulated gene (ISG induction. Candidate SR-As were systematically investigated using RNAi and the most dramatic inhibition in responses was observed when all candidate SR-As were knocked down in unison. Partial inhibition of dsRNA induced antiviral responses was observed in vivo in SR-AI/II(-/- mice compared with WT controls. The role of SR-As in mediating extracellular dsRNA entry and subsequent induced antiviral responses was observed in both murine and human fibroblasts. SR-As appear to function as 'carriers', facilitating dsRNA entry and delivery to the established dsRNA sensing receptors, specifically TLR3, RIGI and MDA-5. Identifying SR-As as gatekeepers of the cell, mediating innate antiviral responses, represents a novel function for this receptor family and provides insight into how cells recognize danger signals associated with lytic virus infections. Furthermore, the implications of a cell surface receptor capable of recognizing extracellular RNA may exceed beyond viral immunity to mediating other important innate immune functions.

  1. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  2. Stimulation Induced Electrographic Seizures in Deep Brain Stimulation of the Anterior Nucleus of the Thalamus Do Not Preclude a Subsequent Favorable Treatment Response.

    Nora, Tommi; Heinonen, Hanna; Tenhunen, Mirja; Rainesalo, Sirpa; Järvenpää, Soila; Lehtimäki, Kai; Peltola, Jukka

    2018-01-01

    Deep brain stimulation (DBS) of the anterior nucleus of the thalamus (ANT) is a method of neuromodulation used for refractory focal epilepsy. We report a patient suffering from drug-resistant epilepsy who developed novel visual symptoms and atypical seizures with the onset of ANT-DBS therapy. Rechallenge under video electroencephalography recording confirmed that lowering the stimulation voltage alleviated these symptoms. Subsequent stimulation with the initial voltage value did not cause the recurrence of either the visual symptoms or the new seizure type, and appeared to alleviate the patient's seizures in long-term follow-up. We therefore hypothesize that the occurrence of stimulation induced seizures at the onset of DBS therapy should not be considered as a failure in the DBS therapy, and the possibility of a subsequent favorable response to the treatment still exists.

  3. Stimulation Induced Electrographic Seizures in Deep Brain Stimulation of the Anterior Nucleus of the Thalamus Do Not Preclude a Subsequent Favorable Treatment Response

    Tommi Nora

    2018-02-01

    Full Text Available Deep brain stimulation (DBS of the anterior nucleus of the thalamus (ANT is a method of neuromodulation used for refractory focal epilepsy. We report a patient suffering from drug-resistant epilepsy who developed novel visual symptoms and atypical seizures with the onset of ANT-DBS therapy. Rechallenge under video electroencephalography recording confirmed that lowering the stimulation voltage alleviated these symptoms. Subsequent stimulation with the initial voltage value did not cause the recurrence of either the visual symptoms or the new seizure type, and appeared to alleviate the patient’s seizures in long-term follow-up. We therefore hypothesize that the occurrence of stimulation induced seizures at the onset of DBS therapy should not be considered as a failure in the DBS therapy, and the possibility of a subsequent favorable response to the treatment still exists.

  4. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (pSalmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (pSalmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Influence of prior natural aging on the subsequent artificial aging response of aluminium alloy A356 with respective globular and dendritic microstructures

    Moller, H

    2011-01-01

    Full Text Available on the subsequent artificial aging response of SSM-HPDC A356 [9, 10]. An artificial aging treatment at 180◦C for 4 h can, however, negate the effects of any prior natural aging [10]. A recent review paper [15] on the heat treatment of Al- Si-Cu-Mg alloys (which..., 8]. The assumption is that these heat treatments are not necessarily the optimum treatments, as the difference in solidification history and microstructure of SSM processed components should be considered [7–11]. However, a recent paper...

  6. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  7. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  8. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  9. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  10. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  11. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  12. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  13. Herpes simplex virus specific T cell response in a cohort with primary genital infection correlates inversely with frequency of subsequent recurrences.

    Franzen-Röhl, Elisabeth; Schepis, Danika; Atterfelt, Fredrik; Franck, Kristina; Wikström, Arne; Liljeqvist, Jan-Åke; Bergström, Tomas; Aurelius, Elisabeth; Kärre, Klas; Berg, Louise; Gaines, Hans

    2017-05-01

    During the last decades, a changing epidemiological pattern of genital herpes simplex virus (HSV) infection has emerged. Primary infection is now caused as often by HSV-1 as by HSV-2. Once established, HSV can be reactivated leading to recurrent mucocutaneous lesions as well as meningitis. Why some otherwise immune-competent individuals experience severe and frequent recurrences is not known, and the immunological mechanism underlying recurrent symptomatic HSV infection is not fully understood. In this study, we investigate and characterise the immune response of patients with first episode of HSV genital infection and its relation to the frequency of symptomatic recurrences. In this cohort study, clinical and immunological data were collected from 29 patients who were followed 1 year after presenting with a first episode of genital or meningeal HSV infection. They were classified by PCR and serology as those with primary HSV-1, primary HSV-2 and non-primary HSV-2 infection. HSV-specific interleukin(Il)-4 and Il-10 responses at first visit were higher in primary infected HSV-2 infected patients experiencing lower numbers of recurrences during subsequent year. The median number of recurrences following primary HSV-2 genital infection may partly be predicted by the strength of an early HSV-specific IL-4 and IL-10 response. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Efficacy of DHMEQ, a NF-κB inhibitor, in islet transplantation: II. Induction DHMEQ treatment ameliorates subsequent alloimmune responses and permits long-term islet allograft acceptance.

    Watanabe, Masaaki; Yamashita, Kenichiro; Kamachi, Hirofumi; Kuraya, Daisuke; Koshizuka, Yasuyuki; Shibasaki, Susumu; Asahi, Yoh; Ono, Hitoshi; Emoto, Shin; Ogura, Masaomi; Yoshida, Tadashi; Ozaki, Michitaka; Umezawa, Kazuo; Matsushita, Michiaki; Todo, Satoru

    2013-09-15

    Long-term graft deterioration remains a major obstacle in the success of pancreatic islet transplantation (PITx). Antigen-independent inflammatory and innate immune responses strengthen subsequent antigen-dependent immunity; further, activation of nuclear factor (NF)-κB plays a key role during these responses. In this study, we tested our hypothesis that, by the inhibition of NF-κB activation, the suppression of these early responses after PITx could facilitate graft acceptance. Full major histocompatibility complex (MHC)-mismatched BALB/c (H-2) mice islets were transplanted into streptozotocin-induced diabetic C57BL/6 (B6: H-2) mice. The NF-κB inhibitor dehydroxymethylepoxyquinomicin (DHMEQ) was administered for either 3 or 14 days after PITx. To some PITx recipients, tacrolimus was also administered. Islet allograft survival, alloimmune responses, and in vitro effects of DHMEQ on dendritic cells (DCs) were assessed. With a vehicle treatment, 600 islet allografts were promptly rejected after PITx. In contrast, 3-day treatment with DHMEQ, followed by 2-week treatment with tacrolimus, allowed permanent acceptance of islet allografts. The endogenous danger-signaling molecule high mobility group complex 1 (HMGB1) was elevated in sera shortly after PITx, whereas DHMEQ administration abolished this elevation. DHMEQ suppressed HMGB1-driven cellular activation and proinflammatory cytokine secretion in mouse bone marrow-derived DCs and significantly reduced the capacity of DCs to prime allogeneic T-cell proliferation in vitro. Finally, the DHMEQ plus tacrolimus regimen reverted the diabetic state with only 300 islet allografts. Inhibition of NF-κB activation by DHMEQ shortly after PITx suppresses HMGB1, which activates DCs and strengthens the magnitude of alloimmune responses; this permits long-term islet allograft acceptance, even in case of fewer islet allografts.

  15. Total and Envelope Protein-Specific Antibody-Secreting Cell Response in Pediatric Dengue Is Highly Modulated by Age and Subsequent Infections.

    Jessica F Toro

    Full Text Available The response of antibody-secreting cells (ASC induced by dengue has only recently started to be characterized. We propose that young age and previous infections could be simple factors that affect this response. Here, we evaluated the primary and secondary responses of circulating ASC in infants (6-12 months old and children (1-14 years old infected with dengue showing different degrees of clinical severity. The ASC response was delayed and of lower magnitude in infants, compared with older children. In primary infection (PI, the total and envelope (E protein-specific IgM ASC were dominant in infants but not in children, and a negative correlation was found between age and the number of IgM ASC (rho = -0.59, P = 0.03. However, infants with plasma dengue-specific IgG detectable in the acute phase developed an intense ASC response largely dominated by IgG and comparable to that of children with secondary infection (SI. IgM and IgG produced by ASC circulating in PI or SI were highly cross-reactive among the four serotypes. Dengue infection caused the disturbance of B cell subsets, particularly a decrease in the relative frequency of naïve B cells. Higher frequencies of total and E protein-specific IgM ASC in the infants and IgG in the children were associated with clinically severe forms of infection. Therefore, the ASC response induced by dengue is highly influenced by the age at which infection occurs and previous immune status, and its magnitude is a relevant element in the clinical outcome. These results are important in the search for correlates of protection and for determining the ideal age for vaccinating against dengue.

  16. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  17. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  18. Impact of the initial classic section during a simulated cross-country skiing skiathlon on the cardiopulmonary responses during the subsequent period of skate skiing.

    Mourot, Laurent; Fabre, Nicolas; Andersson, Erik; Willis, Sarah J; Hébert-Losier, Kim; Holmberg, Hans-Christer

    2014-08-01

    The aim of this study was to assess potential changes in the performance and cardiorespiratory responses of elite cross-country skiers following transition from the classic (CL) to the skating (SK) technique during a simulated skiathlon. Eight elite male skiers performed two 6 km (2 × 3 km) roller-skiing time trials on a treadmill at racing speed: one starting with the classic and switching to the skating technique (CL1-SK2) and another employing the skating technique throughout (SK1-SK2), with continuous monitoring of gas exchanges, heart rates, and kinematics (video). The overall performance times in the CL1-SK2 (21:12 ± 1:24) and SK1-SK2 (20:48 ± 2:00) trials were similar, and during the second section of each performance times and overall cardiopulmonary responses were also comparable. However, in comparison with SK1-SK2, the CL1-SK2 trial involved significantly higher increases in minute ventilation (V̇E, 89.8 ± 26.8 vs. 106.8 ± 17.6 L·min(-1)) and oxygen uptake (V̇O2; 3.1 ± 0.8 vs 3.5 ± 0.5 L·min(-1)) 2 min after the transition as well as longer time constants for V̇E, V̇O2, and heart rate during the first 3 min after the transition. This higher cardiopulmonary exertion was associated with ∼3% faster cycle rates. In conclusion, overall performance during the 2 time trials did not differ. The similar performance times during the second sections were achieved with comparable mean cardiopulmonary responses. However, the observation that during the initial 3-min post-transition following classic skiing cardiopulmonary responses and cycle rates were slightly higher supports the conclusion that an initial section of classic skiing exerts an impact on performance during a subsequent section of skate skiing.

  19. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  20. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  1. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  2. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  3. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  4. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  5. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  6. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  7. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  8. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  9. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  10. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  11. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  13. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  14. Nucleus accumbens response to food cues predicts subsequent snack consumption in women and increased body mass index in those with reduced self-control.

    Lawrence, Natalia S; Hinton, Elanor C; Parkinson, John A; Lawrence, Andrew D

    2012-10-15

    Individuals have difficulty controlling their food consumption, which is due in part to the ubiquity of tempting food cues in the environment. Individual differences in the propensity to attribute incentive (motivational) salience to and act on these cues may explain why some individuals eat more than others. Using fMRI in healthy women, we found that food cue related activity in the nucleus accumbens, a key brain region for food motivation and reward, was related to subsequent snack food consumption. However, both nucleus accumbens activation and snack food consumption were unrelated to self-reported hunger, or explicit wanting and liking for the snack. In contrast, food cue reactivity in the ventromedial prefrontal cortex was associated with subjective hunger/appetite, but not with consumption. Whilst the food cue reactivity in the nucleus accumbens that predicted snack consumption was not directly related to body mass index (BMI), it was associated with increased BMI in individuals reporting low self-control. Our findings reveal a neural substrate underpinning automatic environmental influences on consumption in humans and demonstrate how self-control interacts with this response to predict BMI. Our data provide support for theoretical models that advocate a 'dual hit' of increased incentive salience attribution to food cues and poor self-control in determining vulnerability to overeating and overweight. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  16. Assessing the capacity of growth, survival, and acid adaptive response of Listeria monocytogenes during storage of various cheeses and subsequent simulated gastric digestion.

    Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N

    2017-04-04

    Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition

  17. Repeated Vaccination of Cows with HIV Env gp140 during Subsequent Pregnancies Elicits and Sustains an Enduring Strong Env-Binding and Neutralising Antibody Response.

    Behnaz Heydarchi

    Full Text Available An important feature of a potential vaccine against HIV is the production of broadly neutralising antibodies (BrNAbs capable of potentially blocking infectivity of a diverse array of HIV strains. BrNAbs naturally arise in some HIV infected individuals after several years of infection and their serum IgG can neutralise various HIV strains across different subtypes. We previously showed that vaccination of cows with HIV gp140 AD8 trimers resulted in a high titre of serum IgG against HIV envelope (Env that had strong BrNAb activity. These polyclonal BrNAbs concentrated into the colostrum during the late stage of pregnancy and can be harvested in vast quantities immediately after calving. In this study, we investigated the effect of prolonged HIV gp140 vaccination on bovine colostrum IgG HIV Env-binding and BrNAb activity over subsequent pregnancies. Repeated immunisation led to a maintained high titre of HIV Env specific IgG in the colostrum batches, but this did not increase through repeated cycles. Colostrum IgG from all batches also strongly competed with sCD4 binding to gp140 Env trimer and with human-derived monoclonal VRC01 and b12 BrNAbs that bind the CD4 binding site (CD4bs. Furthermore, competition neutralisation assays using RSC3 Env gp120 protein core and a derivative CD4bs mutant, RSC3 Δ371I/P363N, showed that CD4bs neutralising antibodies contribute to the neutralising activity of all batches of purified bovine colostrum IgG. This result indicates that the high IgG titre/avidity of anti-CD4bs antibodies with BrNAb activity was achieved during the first year of vaccination and was sustained throughout the years of repeated vaccinations in the cow tested. Although IgG of subsequent colostrum batches may have a higher avidity towards the CD4bs, the overall breadth in neutralisation was not enhanced. This implies that the boosting vaccinations over 4 years elicited a polyclonal antibody response that maintained the proportion of both

  18. Assessment of ecosystem response to a temporary water level drawdown and subsequent refilling at Topock Marsh, Arizona—July 2011–October 2014

    Daniels, Joan S.; Haegele, Jeanette C.

    2017-01-20

    with higher concentrations of these components downstream (measured at TP-8). The upstream sampling locations in 2013–14 had decreased turbidity, therefore more SAV biomass accumulated, especially in shallow areas with water depths of ≤1.0 meter (≤3.3 feet). However, the furthest downstream station had higher turbidity caused by both the suspension of autochthonous sediment and high phytoplankton density and biovolume. This higher turbidity resulted in minimal SAV growth, especially in the deeper water (>1.0 meter [>3.3 feet]). Emergent vegetation not only survived the low water conditions of 2011, but expanded its areal coverage and subsequently thrived in the higher water elevations. Overall, no immediate critically negative consequences were detected for aquatic fauna or flora that could be attributd unequivocally to the effect of low water levels. Concentrations of nutrient and trace elements in all water samples were below wildlife toxicity thresholds as established by Arizona Department of Environmental Quality. Three nonnative species were discovered shortly after the Fire Break Canal went into operation. Of the three, gizzard shad (Dorosoma cepedianum) and Eurasian watermilfoil (Myriophyllum spicatum) increased substantially in numbers from 2011–14, but quagga mussels (Dreissena bugensis) did not increase. Future monitoring will determine the long-term impact of the new flow regime

  19. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  20. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  1. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  2. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  3. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  4. The Accumulative Effect of Concentric‐Biased and Eccentric‐ Biased Exercise on Cardiorespiratory and Metabolic Responses to Subsequent Low‐Intensity Exercise: A Preliminary Study

    Gavin James Peter

    2015-12-01

    Full Text Available The study investigated the accumulative effect of concentric-biased and eccentric-biased exercise on cardiorespiratory, metabolic and neuromuscular responses to low-intensity exercise performed hours later. Fourteen young men cycled at low-intensity (~60 rpm at 50% maximal oxygen uptake for 10 min before, and 12 h after: concentric-biased, single-leg cycling exercise (CON (performed ~19:30 h and eccentric-biased, double-leg knee extension exercise (ECC (~06:30 h the following morning. Respiratory measures were sampled breath-by-breath, with oxidation values derived from stoichiometry equations. Knee extensor neuromuscular function was assessed before and after CON and ECC. Cardiorespiratory responses during low-intensity cycling were unchanged by accumulative CON and ECC. The RER was lower during low-intensity exercise 12 h after CON and ECC (0.88 ± 0.08, when compared to baseline (0.92 ± 0.09; p = 0.02. Fat oxidation increased from baseline (0.24 ± 0.2 g·min1 to 12 h after CON and ECC (0.39 ± 0.2 g·min1; p = 0.01. Carbohydrate oxidation decreased from baseline (1.59 ± 0.4 g·min-1 to 12 h after CON and ECC (1.36 ± 0.4 g·min1; p = 0.03. These were accompanied by knee extensor force loss (right leg: -11.6%, p < 0.001; left leg: -10.6%, p = 0.02 and muscle soreness (right leg: 2.5 ± 0.9, p < 0.0001; left leg: 2.3 ± 1.2, p < 0.01. Subsequent concentric-biased and eccentric-biased exercise led to increased fat oxidation and decreased carbohydrate oxidation, without impairing cardiorespiration, during low-intensity cycling. An accumulation of fatiguing and damaging exercise increases fat utilisation during low intensity exercise performed as little as 12 h later.

  5. A non-lethal traumatic/hemorrhagic insult strongly modulates the compartment-specific PAI-1 response in the subsequent polymicrobial sepsis.

    Pierre Raeven

    Full Text Available INTRODUCTION: Plasminogen activator inhibitor 1 (PAI-1 is a key factor in trauma- and sepsis-induced coagulopathy. We examined how trauma-hemorrhage (TH modulates PAI-1 responses in subsequent cecal ligation and puncture (CLP-induced sepsis, and the association of PAI-1 with septic outcomes. METHODS: Mice underwent TH and CLP 48 h later in three separate experiments. In experiment 1, mice were sacrificed pre- and post-CLP to characterize the trajectory of PAI-1 in plasma (protein and tissues (mRNA. Post-CLP dynamics in TH-CLP (this study and CLP-Only mice (prior study were then compared for modulatory effects of TH. In experiment 2, to relate PAI-1 changes to outcome, mice underwent TH-CLP and were sampled daily and followed for 14 days to compare non-survivors (DEAD and survivors (SUR. In experiment 3, plasma and tissue PAI-1 expression were compared between mice predicted to die (P-DIE and to live (P-LIVE. RESULTS: In experiment 1, an early post-TH rise of circulating PAI-1 was contrasted by a delayed (post-TH decrease of PAI-1 mRNA in organs. In the post-CLP phase, profiles of circulating PAI-1 were similar between TH-CLP and CLP-Only mice. Conversely, PAI-1 mRNA declined in the liver and heart of TH-CLP mice versus CLP-Only. In experiment 2, there were no DEAD/SUR differences in circulating PAI-1 prior to CLP. Post-CLP, circulating PAI-1 in DEAD was 2-4-fold higher than in SUR. PAI-1 increase heralded septic deaths up to 48 h prior but DEAD/SUR thrombomodulin (endothelial injury marker levels were identical. In experiment 3, levels of circulating PAI-1 and its hepatic gene expression were higher in P-DIE versus P-LIVE mice and those increases closely correlated with liver dysfunction. CONCLUSIONS: Trauma modulated septic PAI-1 responses in a compartment-specific fashion. Only post-CLP increases in circulating PAI-1 predicted septic outcomes. In posttraumatic sepsis, pre-lethal release of PAI-1 was mostly of hepatic origin and was independent

  6. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  7. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  8. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  10. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  11. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  12. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  13. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  14. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  15. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  16. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  17. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  18. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  19. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  20. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  1. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  2. Matching Subsequences in Trees

    Bille, Philip; Gørtz, Inge Li

    2009-01-01

    Given two rooted, labeled trees P and T the tree path subsequence problem is to determine which paths in P are subsequences of which paths in T. Here a path begins at the root and ends at a leaf. In this paper we propose this problem as a useful query primitive for XML data, and provide new...

  3. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  4. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  5. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  6. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  7. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  9. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  10. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  11. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  12. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  13. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  14. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  15. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  16. Early life status epilepticus and stress have distinct and sex-specific effects on learning, subsequent seizure outcomes, including anticonvulsant response to phenobarbital.

    Akman, Ozlem; Moshé, Solomon L; Galanopoulou, Aristea S

    2015-02-01

    Neonatal status epilepticus (SE) is often associated with adverse cognitive and epilepsy outcomes. We investigate the effects of three episodes of kainic acid-induced SE (3KA-SE) and maternal separation in immature rats on subsequent learning, seizure susceptibility, and consequences, and the anticonvulsant effects of phenobarbital, according to sex, type, and age at early life (EL) event. 3KA-SE or maternal separation was induced on postnatal days (PN) 4-6 or 14-16. Rats were tested on Barnes maze (PN16-19), or lithium-pilocarpine SE (PN19) or flurothyl seizures (PN32). The anticonvulsant effects of phenobarbital (20 or 40 mg/kg/rat, intraperitoneally) pretreatment were tested on flurothyl seizures. FluoroJadeB staining assessed hippocampal injury. 3KA-SE or separation on PN4-6 caused more transient learning delays in males and did not alter lithium-pilocarpine SE latencies, but aggravated its outcomes in females. Anticonvulsant effects of phenobarbital were preserved and potentiated in specific groups depending on sex, type, and age at EL event. Early life 3KA-SE and maternal separation cause more but transient cognitive deficits in males but aggravate the consequences of subsequent lithium-pilocarpine SE in females. In contrast, on flurothyl seizures, EL events showed either beneficial or no effect, depending on gender, type, and age at EL events. © 2014 John Wiley & Sons Ltd.

  17. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  18. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  19. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  20. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  1. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  2. A non-linear association between self-reported negative emotional response to stress and subsequent allostatic load: prospective results from the Whitehall II cohort study.

    Dich, Nadya; Doan, Stacey N; Kivimäki, Mika; Kumari, Meena; Rod, Naja Hulvej

    2014-11-01

    Previous research suggests that high levels of negative emotions may affect health. However, it is likely that the absence of an emotional response following stressful events may also be problematic. Accordingly, we investigated whether a non-linear association exists between negative emotional response to major life events and allostatic load, a multisystem indicator of physiological dysregulation. Study sample was 6764 British civil service workers from the Whitehall II cohort. Negative emotional response was assessed by self-report at baseline. Allostatic load was calculated using cardiovascular, metabolic and immune function biomarkers at three clinical follow-up examinations. A non-linear association between negative emotional response and allostatic load was observed: being at either extreme end of the distribution of negative emotional response increased the risk of physiological dysregulation. Allostatic load also increased with age, but the association between negative emotional response and allostatic load remained stable over time. These results provide evidence for a more nuanced understanding of the role of negative emotions in long-term physical health. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  4. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  5. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  6. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  7. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  9. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  10. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  11. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  12. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  13. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  14. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  15. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  16. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  17. Effect of elevated pCO2 on metabolic responses of porcelain crab (Petrolisthes cinctipes) Larvae exposed to subsequent salinity stress.

    Miller, Seth H; Zarate, Sonia; Smith, Edmund H; Gaylord, Brian; Hosfelt, Jessica D; Hill, Tessa M

    2014-01-01

    Future climate change is predicted to alter the physical characteristics of oceans and estuaries, including pH, temperature, oxygen, and salinity. Investigating how species react to the influence of such multiple stressors is crucial for assessing how future environmental change will alter marine ecosystems. The timing of multiple stressors can also be important, since in some cases stressors arise simultaneously, while in others they occur in rapid succession. In this study, we investigated the effects of elevated pCO2 on oxygen consumption by larvae of the intertidal porcelain crab Petrolisthes cinctipes when exposed to subsequent salinity stress. Such an exposure mimics how larvae under future acidified conditions will likely experience sudden runoff events such as those that occur seasonally along portions of the west coast of the U.S. and in other temperate systems, or how larvae encounter hypersaline waters when crossing density gradients via directed swimming. We raised larvae in the laboratory under ambient and predicted future pCO2 levels (385 and 1000 µatm) for 10 days, and then moved them to seawater at ambient pCO2 but with decreased, ambient, or elevated salinity, to monitor their respiration. While larvae raised under elevated pCO2 or exposed to stressful salinity conditions alone did not exhibit higher respiration rates than larvae held in ambient conditions, larvae exposed to elevated pCO2 followed by stressful salinity conditions consumed more oxygen. These results show that even when multiple stressors act sequentially rather than simultaneously, they can retain their capacity to detrimentally affect organisms.

  18. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  19. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  20. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  1. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  2. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  3. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  4. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  5. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  6. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  7. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  8. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  9. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  10. Reproductive survival of explanted human tumor cells after exposure to nitrogen mustard or x irradiation; differences in response with subsequent subculture in vitro

    Wells, J.; Berry, R.J.; Laing, A.H.

    1977-01-01

    Curves for the survival of reproductive capacity of explanted human tumor cells, following exposure to the alkylating agent nitrogen mustard (mustine hydrochloride) or 250-kVp x rays, were obtained as soon as a satisfactory plating efficiency, i.e., greater than or approximately equal to 10 percent, was obtained from the tumor cells in vitro (usually within 2-10 weeks of explanation). It was found that all six tumor explants tested became more sensitive to the action of nitrogen mustard on serial subculture, whereas the response of four explants which were X-irradiated was invariant with further subculturing. Furthermore, all but one explant yielded survival curves which were extremely similar, with D/sub q/ values circa 440-610 rad. One line, from a seminoma, however, had a D/sub q/ of 150 rad. These radiosensitive seminoma cells were, however, the most resistant to the action of nitrogen mustard. The increase in sensitivity to nitrogen mustard with serial subculture in vitro was not associated with any change in the proliferative rate of the cells, although it may be associated with an increase in the efficiency of transport

  11. The value of {sup 18}F-FDG PET before and after induction chemotherapy for the early prediction of a poor pathologic response to subsequent preoperative chemoradiotherapy in oesophageal adenocarcinoma

    Rossum, Peter S.N. van [The University of Texas MD Anderson Cancer Center, Department of Radiation Oncology, Houston, TX (United States); University Medical Center Utrecht, Department of Radiation Oncology, Utrecht (Netherlands); Fried, David V.; Zhang, Lifei; Court, Laurence E. [The University of Texas MD Anderson Cancer Center, Department of Radiation Physics, Houston, TX (United States); Hofstetter, Wayne L. [The University of Texas MD Anderson Cancer Center, Department of Thoracic and Cardiovascular Surgery, Houston, TX (United States); Ho, Linus [The University of Texas MD Anderson Cancer Center, Department of Gastrointestinal Medical Oncology, Houston, TX (United States); Meijer, Gert J. [University Medical Center Utrecht, Department of Radiation Oncology, Utrecht (Netherlands); Carter, Brett W. [The University of Texas MD Anderson Cancer Center, Department of Diagnostic Radiology, Houston, TX (United States); Lin, Steven H. [The University of Texas MD Anderson Cancer Center, Department of Radiation Oncology, Houston, TX (United States)

    2017-01-15

    The purpose of our study was to determine the value of {sup 18}F-FDG PET before and after induction chemotherapy in patients with oesophageal adenocarcinoma for the early prediction of a poor pathologic response to subsequent preoperative chemoradiotherapy (CRT). In 70 consecutive patients receiving a three-step treatment strategy of induction chemotherapy and preoperative chemoradiotherapy for oesophageal adenocarcinoma, {sup 18}F-FDG PET scans were performed before and after induction chemotherapy (before preoperative CRT). SUV{sub max}, SUV{sub mean}, metabolic tumour volume (MTV), and total lesion glycolysis (TLG) were determined at these two time points. The predictive potential of (the change in) these parameters for a poor pathologic response, progression-free survival (PFS) and overall survival (OS) was assessed. A poor pathologic response after induction chemotherapy and preoperative CRT was found in 27 patients (39 %). Patients with a poor pathologic response experienced less of a reduction in TLG after induction chemotherapy (p < 0.01). The change in TLG was predictive for a poor pathologic response at a threshold of -26 % (sensitivity 67 %, specificity 84 %, accuracy 77 %, PPV 72 %, NPV 80 %), yielding an area-under-the-curve of 0.74 in ROC analysis. Also, patients with a decrease in TLG lower than 26 % had a significantly worse PFS (p = 0.02), but not OS (p = 0.18). {sup 18}F-FDG PET appears useful to predict a poor pathologic response as well as PFS early after induction chemotherapy in patients with oesophageal adenocarcinoma undergoing a three-step treatment strategy. As such, the early {sup 18}F-FDG PET response after induction chemotherapy could aid in individualizing treatment by modification or withdrawal of subsequent preoperative CRT in poor responders. (orig.)

  12. The value of 18F-FDG PET before and after induction chemotherapy for the early prediction of a poor pathologic response to subsequent preoperative chemoradiotherapy in oesophageal adenocarcinoma

    Rossum, Peter S.N. van; Fried, David V.; Zhang, Lifei; Court, Laurence E.; Hofstetter, Wayne L.; Ho, Linus; Meijer, Gert J.; Carter, Brett W.; Lin, Steven H.

    2017-01-01

    The purpose of our study was to determine the value of 18 F-FDG PET before and after induction chemotherapy in patients with oesophageal adenocarcinoma for the early prediction of a poor pathologic response to subsequent preoperative chemoradiotherapy (CRT). In 70 consecutive patients receiving a three-step treatment strategy of induction chemotherapy and preoperative chemoradiotherapy for oesophageal adenocarcinoma, 18 F-FDG PET scans were performed before and after induction chemotherapy (before preoperative CRT). SUV max , SUV mean , metabolic tumour volume (MTV), and total lesion glycolysis (TLG) were determined at these two time points. The predictive potential of (the change in) these parameters for a poor pathologic response, progression-free survival (PFS) and overall survival (OS) was assessed. A poor pathologic response after induction chemotherapy and preoperative CRT was found in 27 patients (39 %). Patients with a poor pathologic response experienced less of a reduction in TLG after induction chemotherapy (p < 0.01). The change in TLG was predictive for a poor pathologic response at a threshold of -26 % (sensitivity 67 %, specificity 84 %, accuracy 77 %, PPV 72 %, NPV 80 %), yielding an area-under-the-curve of 0.74 in ROC analysis. Also, patients with a decrease in TLG lower than 26 % had a significantly worse PFS (p = 0.02), but not OS (p = 0.18). 18 F-FDG PET appears useful to predict a poor pathologic response as well as PFS early after induction chemotherapy in patients with oesophageal adenocarcinoma undergoing a three-step treatment strategy. As such, the early 18 F-FDG PET response after induction chemotherapy could aid in individualizing treatment by modification or withdrawal of subsequent preoperative CRT in poor responders. (orig.)

  13. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  14. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  15. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  16. Curcumin modulates the inflammatory response and inhibits subsequent fibrosis in a mouse model of viral-induced acute respiratory distress syndrome.

    Avasarala, Sreedevi; Zhang, Fangfang; Liu, Guangliang; Wang, Ruixue; London, Steven D; London, Lucille

    2013-01-01

    Acute Respiratory Distress Syndrome (ARDS) is a clinical syndrome characterized by diffuse alveolar damage usually secondary to an intense host inflammatory response of the lung to a pulmonary or extrapulmonary infectious or non-infectious insult often leading to the development of intra-alveolar and interstitial fibrosis. Curcumin, the principal curcumoid of the popular Indian spice turmeric, has been demonstrated as an anti-oxidant and anti-inflammatory agent in a broad spectrum of diseases. Using our well-established model of reovirus 1/L-induced acute viral pneumonia, which displays many of the characteristics of the human ALI/ARDS, we evaluated the anti-inflammatory and anti-fibrotic effects of curcumin. Female CBA/J mice were treated with curcumin (50 mg/kg) 5 days prior to intranasal inoculation with 10(7)pfu reovirus 1/L and daily, thereafter. Mice were evaluated for key features associated with ALI/ARDS. Administration of curcumin significantly modulated inflammation and fibrosis, as revealed by histological and biochemical analysis. The expression of IL-6, IL-10, IFNγ, and MCP-1, key chemokines/cytokines implicated in the development of ALI/ARDS, from both the inflammatory infiltrate and whole lung tissue were modulated by curcumin potentially through a reduction in the phosphorylated form of NFκB p65. While the expression of TGFß1 was not modulated by curcumin, TGFß Receptor II, which is required for TGFß signaling, was significantly reduced. In addition, curcumin also significantly inhibited the expression of α-smooth muscle actin and Tenascin-C, key markers of myofibroblast activation. This data strongly supports a role for curcumin in modulating the pathogenesis of viral-induced ALI/ARDS in a pre-clinical model potentially manifested through the alteration of inflammation and myofibroblast differentiation.

  17. Language experience changes subsequent learning

    Onnis, Luca; Thiessen, Erik

    2013-01-01

    What are the effects of experience on subsequent learning? We explored the effects of language-specific word order knowledge on the acquisition of sequential conditional information. Korean and English adults were engaged in a sequence learning task involving three different sets of stimuli: auditory linguistic (nonsense syllables), visual non-linguistic (nonsense shapes), and auditory non-linguistic (pure tones). The forward and backward probabilities between adjacent elements generated two equally probable and orthogonal perceptual parses of the elements, such that any significant preference at test must be due to either general cognitive biases, or prior language-induced biases. We found that language modulated parsing preferences with the linguistic stimuli only. Intriguingly, these preferences are congruent with the dominant word order patterns of each language, as corroborated by corpus analyses, and are driven by probabilistic preferences. Furthermore, although the Korean individuals had received extensive formal explicit training in English and lived in an English-speaking environment, they exhibited statistical learning biases congruent with their native language. Our findings suggest that mechanisms of statistical sequential learning are implicated in language across the lifespan, and experience with language may affect cognitive processes and later learning. PMID:23200510

  18. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  19. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  20. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  1. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  2. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  3. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  4. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  5. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  6. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  7. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  8. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  9. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  10. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  11. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  12. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  15. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  16. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  17. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  18. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  19. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  20. Study of the quenching and subsequent return to room temperature of uranium-chromium, uranium-iron, and uranium-molybdenum alloys containing only small amounts of the alloying element

    Delaplace, J.

    1960-09-01

    By means of an apparatus which makes possible thermal pre-treatments in vacuo, quenching carried out in a high purity argon atmosphere, and simultaneous recording of time temperature cooling and thermal contraction curves, the author has examined the transformations which occur in uranium-chromium, uranium-iron and uranium-molybdenum alloys during their quenching and subsequent return to room temperature. For uranium-chromium and uranium-iron alloys, the temperature at which the γ → β transformation starts varies very little with the rate of cooling. For uranium-molybdenum alloys containing 2,8 atom per cent of Mo, this temperature is lowered by 120 deg. C for a cooling rate of 500 deg. C/mn. The temperature at which the β → α transformation starts is lowered by 170 deg. C for a cooling rate of 500 deg. C/mn in the case of uranium-chromium alloy containing 0,37 atom per cent of Cr. The temperature is little affected in the case of uranium-iron alloys. The addition of chromium or iron makes it possible to conserve the form β at ordinary temperatures after quenching from the β and γ regions. The β phase is particularly unstable and changes into needles of the α form even at room temperatures according to an autocatalytic transformation law similar to the austenitic-martensitic transformation law in the case of iron. The β phase obtained by quenching from the β phase region is more stable than that obtained by quenching from the γ region. Chromium is a more effective stabiliser of the β phase than is iron. Unfortunately it causes serious surface cracking. The β → α transformation in uranium-chromium alloys has been followed at room temperature by means of micro-cinematography. The author has not observed the direct γ → α transformation in uranium-molybdenum alloys containing 2,8 per cent of molybdenum even for cooling rates of up to 2000 deg. C/s. He has however observed the formation of several martensitic structures. (author) [fr

  1. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  2. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  3. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  5. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  7. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  8. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  9. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  10. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  11. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  12. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  13. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  14. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  15. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  16. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  17. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  18. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  19. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  20. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  1. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  2. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  3. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  4. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  5. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  6. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  7. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  8. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  9. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  10. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  12. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  13. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  14. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  15. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  16. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  17. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  18. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  19. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  20. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  1. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  2. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  3. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  4. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  5. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  6. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  7. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  8. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  9. Sustained Antibody Responses 6 Years Following 1, 2, or 3 Doses of Quadrivalent Human Papillomavirus (HPV) Vaccine in Adolescent Fijian Girls, and Subsequent Responses to a Single Dose of Bivalent HPV Vaccine: A Prospective Cohort Study.

    Toh, Zheng Quan; Russell, Fiona M; Reyburn, Rita; Fong, James; Tuivaga, Evelyn; Ratu, Tupou; Nguyen, Cattram D; Devi, Rachel; Kama, Mike; Matanitobua, Silivia; Tabrizi, Sepehr N; Garland, Suzanne M; Sinha, Rohit; Frazer, Ian; Tikoduadua, Lisi; Kado, Joseph; Rafai, Eric; Mulholland, Edward K; Licciardi, Paul V

    2017-04-01

    The duration of antibody response following reduced human papillomavirus (HPV) vaccine doses has not been determined. We compared the antibody responses in girls previously vaccinated with zero, 1, 2, or 3 doses of quadrivalent HPV vaccine (4vHPV; Gardasil, Merck) 6 years previously. A prospective cohort study was undertaken in 200 Fijian girls 15-19 years of age. Approximately equal numbers of girls from 2 main ethnic groups (Fijians of Indian descent [FID] and Indigenous Fijians [iTaukei]) in Fiji were recruited for each dosage groups. Blood was drawn before and 28 days following a single dose of bivalent HPV vaccine (2vHPV; Cervarix, GlaxoSmithKline). We measured neutralizing antibodies (NAb) against HPV-6, -11, -16, and -18 using the pseudovirion-based neutralization assay. After 6 years (before a dose of 2vHPV was given), the geometric mean NAb titers for all 4 HPV types were not statistically different between 2-dose (2D) and 3-dose (3D) recipients: HPV-6 (3D: 2216 [95% confidence interval {CI},1695-2896]; 2D: 1476 [95% CI, 1019-2137]; P = .07), HPV-11 (3D: 4431 [95% CI, 3396-5783]; 2D: 2951 [95% CI, 1984-4390]; P = .09), HPV-16 (3D: 3373 [95% CI, 2511-4530]; 2D: 3275 [95% CI, 2452-4373]; P = .89); HPV-18 (3D: 628 [95% CI: 445-888]; 2D: 606 [95% CI, 462-862]; P = .89), and were higher in FID than iTaukei girls. Although 1-dose recipients had significantly lower NAb titers than 2-/3-dose recipients, their NAb titers were 5- to 30-fold higher than unvaccinated girls. Post-2vHPV NAb titers against HPV-16 and -18 were not statistically different between girls who received 1, 2, or 3 doses of 4vHPV previously. Two doses of 4vHPV provide similar NAb titers as 3 doses for 6 years, although the clinical significance is unknown. A single dose of 4vHPV elicits antibodies that persisted for at least 6 years, and induced immune memory, suggesting possible protection against HPV vaccine types after a single dose of 4vHPV. © The Author 2016. Published by Oxford University

  10. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  11. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  12. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  13. Subsequence Automata with Default Transitions

    Bille, Philip; Gørtz, Inge Li; Skjoldjensen, Frederik Rye

    2016-01-01

    of states and transitions) of the subsequence automaton is O(nσ) and that this bound is asymptotically optimal. In this paper, we consider subsequence automata with default transitions, that is, special transitions to be taken only if none of the regular transitions match the current character, and which do...... not consume the current character. We show that with default transitions, much smaller subsequence automata are possible, and provide a full trade-off between the size of the automaton and the delay, i.e., the maximum number of consecutive default transitions followed before consuming a character......(nσ) and delay O(1), thus matching the bound for the standard subsequence automaton construction. The key component of our result is a novel hierarchical automata construction of independent interest....

  14. Subsequence automata with default transitions

    Bille, Philip; Gørtz, Inge Li; Skjoldjensen, Frederik Rye

    2017-01-01

    of states and transitions) of the subsequence automaton is O(nσ) and that this bound is asymptotically optimal. In this paper, we consider subsequence automata with default transitions, that is, special transitions to be taken only if none of the regular transitions match the current character, and which do...... not consume the current character. We show that with default transitions, much smaller subsequence automata are possible, and provide a full trade-off between the size of the automaton and the delay, i.e., the maximum number of consecutive default transitions followed before consuming a character......(1), thus matching the bound for the standard subsequence automaton construction. Finally, we generalize the result to multiple strings. The key component of our result is a novel hierarchical automata construction of independent interest....

  15. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  16. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  17. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  18. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  19. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  20. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  1. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  2. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  4. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  5. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  6. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  7. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  8. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  9. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  10. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  12. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  13. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  14. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  15. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  17. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  18. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  19. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  1. Study of the quenching and subsequent return to room temperature of uranium-chromium, uranium-iron, and uranium-molybdenum alloys containing only small amounts of the alloying element; Etude de la trempe et du revenu a la temperature ordinaire d'alliages uranium-chrome, uranium-fer et uranium-molybdene, a faible teneur en element d'alliage

    Delaplace, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1960-09-15

    By means of an apparatus which makes possible thermal pre-treatments in vacuo, quenching carried out in a high purity argon atmosphere, and simultaneous recording of time temperature cooling and thermal contraction curves, the author has examined the transformations which occur in uranium-chromium, uranium-iron and uranium-molybdenum alloys during their quenching and subsequent return to room temperature. For uranium-chromium and uranium-iron alloys, the temperature at which the {gamma} {yields} {beta} transformation starts varies very little with the rate of cooling. For uranium-molybdenum alloys containing 2,8 atom per cent of Mo, this temperature is lowered by 120 deg. C for a cooling rate of 500 deg. C/mn. The temperature at which the {beta} {yields} {alpha} transformation starts is lowered by 170 deg. C for a cooling rate of 500 deg. C/mn in the case of uranium-chromium alloy containing 0,37 atom per cent of Cr. The temperature is little affected in the case of uranium-iron alloys. The addition of chromium or iron makes it possible to conserve the form {beta} at ordinary temperatures after quenching from the {beta} and {gamma} regions. The {beta} phase is particularly unstable and changes into needles of the {alpha} form even at room temperatures according to an autocatalytic transformation law similar to the austenitic-martensitic transformation law in the case of iron. The {beta} phase obtained by quenching from the {beta} phase region is more stable than that obtained by quenching from the {gamma} region. Chromium is a more effective stabiliser of the {beta} phase than is iron. Unfortunately it causes serious surface cracking. The {beta} {yields} {alpha} transformation in uranium-chromium alloys has been followed at room temperature by means of micro-cinematography. The author has not observed the direct {gamma} {yields} {alpha} transformation in uranium-molybdenum alloys containing 2,8 per cent of molybdenum even for cooling rates of up to 2000 deg. C

  2. Study of the quenching and subsequent return to room temperature of uranium-chromium, uranium-iron, and uranium-molybdenum alloys containing only small amounts of the alloying element; Etude de la trempe et du revenu a la temperature ordinaire d'alliages uranium-chrome, uranium-fer et uranium-molybdene, a faible teneur en element d'alliage

    Delaplace, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1960-09-15

    By means of an apparatus which makes possible thermal pre-treatments in vacuo, quenching carried out in a high purity argon atmosphere, and simultaneous recording of time temperature cooling and thermal contraction curves, the author has examined the transformations which occur in uranium-chromium, uranium-iron and uranium-molybdenum alloys during their quenching and subsequent return to room temperature. For uranium-chromium and uranium-iron alloys, the temperature at which the {gamma} {yields} {beta} transformation starts varies very little with the rate of cooling. For uranium-molybdenum alloys containing 2,8 atom per cent of Mo, this temperature is lowered by 120 deg. C for a cooling rate of 500 deg. C/mn. The temperature at which the {beta} {yields} {alpha} transformation starts is lowered by 170 deg. C for a cooling rate of 500 deg. C/mn in the case of uranium-chromium alloy containing 0,37 atom per cent of Cr. The temperature is little affected in the case of uranium-iron alloys. The addition of chromium or iron makes it possible to conserve the form {beta} at ordinary temperatures after quenching from the {beta} and {gamma} regions. The {beta} phase is particularly unstable and changes into needles of the {alpha} form even at room temperatures according to an autocatalytic transformation law similar to the austenitic-martensitic transformation law in the case of iron. The {beta} phase obtained by quenching from the {beta} phase region is more stable than that obtained by quenching from the {gamma} region. Chromium is a more effective stabiliser of the {beta} phase than is iron. Unfortunately it causes serious surface cracking. The {beta} {yields} {alpha} transformation in uranium-chromium alloys has been followed at room temperature by means of micro-cinematography. The author has not observed the direct {gamma} {yields} {alpha} transformation in uranium-molybdenum alloys containing 2,8 per cent of molybdenum even for cooling rates of up to 2000 deg. C

  3. Roles of p300 and cyclic adenosine monophosphate response element binding protein in high glucose-induced hypoxia-inducible factor 1α inactivation under hypoxic conditions.

    Ding, Lingtao; Yang, Minlie; Zhao, Tianlan; Lv, Guozhong

    2017-05-01

    Given the high prevalence of diabetes and burn injuries worldwide, it is essential to dissect the underlying mechanism of delayed burn wound healing in diabetes patients, especially the high glucose-induced hypoxia-inducible factor 1 (HIF-1)-mediated transcription defects. Human umbilical vein endothelial cells were cultured with low or high concentrations of glucose. HIF-1α-induced vascular endothelial growth factor (VEGF) transcription was measured by luciferase assay. Immunofluorescence staining was carried out to visualize cyclic adenosine monophosphate response element binding protein (CREB) localization. Immunoprecipitation was carried out to characterize the association between HIF-1α/p300/CREB. To test whether p300, CREB or p300+CREB co-overexpression was sufficient to rescue the HIF-1-mediated transcription defect after high glucose exposure, p300, CREB or p300+CREB co-overexpression were engineered, and VEGF expression was quantified. Finally, in vitro angiogenesis assay was carried out to test whether the high glucose-induced angiogenesis defect is rescuable by p300 and CREB co-overexpression. Chronic high glucose treatment resulted in impaired HIF-1-induced VEGF transcription and CREB exclusion from the nucleus. P300 or CREB overexpression alone cannot rescue high glucose-induced HIF-1α transcription defects. In contrast, co-overexpression of p300 and CREB dramatically ameliorated high glucose-induced impairment of HIF-1-mediated VEGF transcription, as well as in vitro angiogenesis. Finally, we showed that co-overexpression of p300 and CREB rectifies the dissociation of HIF-1α-p300-CREB protein complex in chronic high glucose-treated cells. Both p300 and CREB are required for the function integrity of HIF-1α transcription machinery and subsequent angiogenesis, suggesting future studies to improve burn wound healing might be directed to optimization of the interaction between p300, CREB and HIF-1α. © 2016 The Authors. Journal of Diabetes

  4. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  5. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  6. Reactions to abortion and subsequent mental health.

    Fergusson, David M; Horwood, L John; Boden, Joseph M

    2009-11-01

    There has been continued interest in the extent to which women have positive and negative reactions to abortion. To document emotional reactions to abortion, and to examine the links between reactions to abortion and subsequent mental health outcomes. Data were gathered on the pregnancy and mental health history of a birth cohort of over 500 women studied to the age of 30. Abortion was associated with high rates of both positive and negative emotional reactions; however, nearly 90% of respondents believed that the abortion was the right decision. Analyses showed that the number of negative responses to the abortion was associated with increased levels of subsequent mental health disorders (Pabortion and reporting negative reactions had rates of mental health disorders that were approximately 1.4-1.8 times higher than those not having an abortion. Abortion was associated with both positive and negative emotional reactions. The extent of negative emotional reactions appeared to modify the links between abortion and subsequent mental health problems.

  7. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  8. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  9. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  10. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  11. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  12. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  13. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  14. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  15. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  16. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  17. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  18. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  19. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  20. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  1. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  2. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  3. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  4. Negative Correlation between Circulating CD4+FOXP3+CD127− Regulatory T Cells and Subsequent Antibody Responses to Infant Measles Vaccine but Not Diphtheria–Tetanus–Pertussis Vaccine Implies a Regulatory Role

    Jorjoh Ndure

    2017-08-01

    Full Text Available Regulatory T cells (Tregs play a key homeostatic role by suppressing immune responses. They have been targeted in mouse and human cancer studies to improve vaccine immunogenicity and tumor clearance. A number of commercially available drugs and experimental vaccine adjuvants have been shown to target Tregs. Infants have high numbers of Tregs and often have poor responses to vaccination, yet the role Tregs play in controlling vaccine immunogenicity has not been explored in this age group. Herein, we explore the role of CD4+FOXP3+CD127− Tregs in controlling immunity in infant males and females to vaccination with diphtheria–tetanus–whole cell pertussis (DTP and/or measles vaccine (MV. We find correlative evidence that circulating Tregs at the time of vaccination suppress antibody responses to MV but not DTP; and Tregs 4 weeks after DTP vaccination may suppress vaccine-specific cellular immunity. This opens the exciting possibility that Tregs may provide a future target for improved vaccine responses in early life, including reducing the number of doses of vaccine required. Such an approach would need to be safe and the benefits outweigh the risks, thus further research in this area is required.

  5. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  6. Radiographic element

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  7. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  8. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  9. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  10. Standard elements; Elements standards

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  11. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  12. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  13. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  14. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  15. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  16. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  17. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  18. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  19. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  20. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  1. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  2. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  3. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  4. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  5. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  6. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  7. A simple approach for the sonochemical loading of Au, Ag and Pd nanoparticle on functionalized MWCNT and subsequent dispersion studies for removal of organic dyes: Artificial neural network and response surface methodology studies.

    Moghaddari, Mitra; Yousefi, Fakhri; Ghaedi, Mehrorang; Dashtian, Kheibar

    2018-04-01

    In this study, the artificial neural network (ANN) and response surface methodology (RSM) based on central composite design (CCD) were applied for modeling and optimization of the simultaneous ultrasound-assisted removal of quinoline yellow (QY) and eosin B (EB). The MWCNT-NH 2 and its composites were prepared by sonochemistry method and characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD) and energy dispersive spectroscopy (EDS) analysis's. Initial dyes concentrations, adsorbent mass, sonication time and pH contribution on QY and EB removal percentage were investigated by CCD and replication of experiments at conditions suggested by model has results which statistically are close to experimented data. The ultrasound irradiation is associated with raising mass transfer of process so that small amount of the adsorbent (0.025 g) is able to remove high percentage (88.00% and 91.00%) of QY and EB, respectively in short time (6.0 min) at pH = 6. Analysis of experimental data by conventional models is good indication of Langmuir efficiency for fitting and explanation of experimented data. The ANN based on the Levenberg-Marquardt algorithm (LMA) combined of linear transfer function at output layer and tangent sigmoid transfer function at hidden layer with 20 hidden neurons supply best operation conditions for good prediction of adsorption data. Accurate and efficient artificial neural network was obtained by changing the number of neurons in the hidden layer, while data was divided into training, test and validation sets which contained 70, 15 and 15% of data points respectively. The Average absolute deviation (AAD)% of a collection of 128 data points for MWCNT-NH 2 and composites is 0.58%.for EB and 0.55 for YQ. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  9. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  10. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  11. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  12. Galvanic element. Galvanisches Element

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  13. Tetanus-diphtheria-pertussis vaccine may suppress the immune response to subsequent immunization with pneumococcal CRM197-conjugate vaccine (coadministered with quadrivalent meningococcal TT-conjugate vaccine): a randomized, controlled trial⋆.

    Tashani, Mohamed; Heron, Leon; Wong, Melanie; Rashid, Harunor; Booy, Robert

    2017-07-01

    : Due to their antigenic similarities, there is a potential for immunological interaction between tetanus/diphtheria-containing vaccines and carrier proteins presented on conjugate vaccines. The interaction could, unpredictably, result in either enhancement or suppression of the immune response to conjugate vaccines if they are injected soon after or concurrently with diphtheria or tetanus toxoid. We examined this interaction among adult Australian travellers before attending the Hajj pilgrimage of 2015. We randomly assigned each participant to one of three vaccination schedules. Group A received tetanus, diphtheria and acellular pertussis vaccine (Tdap) 3-4 weeks before receiving CRM197-conjugated 13-valent pneumococcal vaccine (PCV13) coadministered with TT-conjugated quadrivalent meningococcal vaccine (MCV4). Group B received all three vaccines concurrently. Group C received PCV13 and MCV4 3-4 weeks before Tdap. Blood samples collected at baseline, at each vaccination visit and 3-4 weeks after vaccination were tested for the pneumococcal opsonophagocytic assay (OPA). A total of 166 participants aged 18-64 (median 42) years were recruited, 159 completed the study. Compared with the other groups, Group A had significantly ( P  vaccination in seven serotypes of PCV13 (1, 3, 4, 5, 14, 18C and 9V). Additionally, Group A had lower frequency of serorises (≥ 4-fold rise in OPA titres) in serotype5 (79%, p = 0.01) and 18C (73.5%, p = 0.06); whereas Groups B and C had significantly lower frequencies of serorises in Serotype 4 (82%) and 6A (73.5%), respectively. No statistically significant difference was detected across the three groups in frequencies achieving OPA titre ≥ 1:8 post-vaccination. Tdap vaccination 3-4 weeks before administration of PCV13 and MCV4 significantly reduced the GMTs to seven of the 13 pneumococcal serotypes in adults. If multiple vaccination is required before travel, deferring tetanus/diphtheria until after administering the

  14. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  15. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  16. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  17. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  18. 75 FR 81593 - Proposed Subsequent Arrangement

    2010-12-28

    ... content of U.S.-origin nuclear material contained in irradiated fuel elements at the hot laboratory of the... of irradiated fuel elements for the period ending December 31, 2015. In accordance with section 131a...

  19. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  20. CEO age and gender: Subsequent market performance

    Marcelo Eduardo

    2016-12-01

    Full Text Available The issue of CEO age and gender vs. concurrent performance is extensively examined, but the association with subsequent performance has limited treatment in the financial literature, and with conflicting findings. In the current study, we examine the association between CEO age and gender, and subsequent company market performance using a more recent set of observations and the standard four-factor model to estimate future cumulative abnormal shareholder returns. We find that subsequent abnormal shareholder returns are marginally significantly higher for female CEOs than for their male counterparts, but no material pattern is observed between CEO age and subsequent abnormal shareholder return performance.

  1. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  3. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  5. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  6. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  7. Complement activation by cholesterol crystals triggers a subsequent cytokine response

    Niyonzima, Nathalie; Halvorsen, Bente; Sporsheim, Bjørnar

    2017-01-01

    beneficial effects on atherosclerosis and a large clinical trial with an IL-1β inhibitor is currently in progress (the CANTOS study). However, upstream inhibition of CC-induced inflammation by using a complement inhibitor may be more efficient in treating atherosclerosis since this will block initiation...

  8. Economic impact of land finance and subsequent risk response

    Lü Wei; Xu Hongwei

    2014-01-01

    In China,land finance is actually an endogenous factor in economic growth.As a kind of nontraditional,informal government revenue in China's economic transition process,land finance is unstable,non-standard and unsustainable,and it simultaneously makes the current land-finance dependent growth mode difficult to maintain.The paper firstly analyzes the impact of the land finance on China's economic growth and economic structure change followed by discussing the possible risks in post-"land finance" period.It then put forward some suggestions to deal with the problem.The analysis shows that land finance exacerbates the economic fluctuation,bringing in the increase of government public expenditure and economic growth in the short term.Nonetheless,in the long term there is no significant effect,and it could gradually lead to a more unreasonable economic structure.In the post-"land finance" period,if we do not take precautions in advance,it will restrain the sustainable development of China's economy and society.

  9. Subsequent pregnancy outcome after previous foetal death

    Nijkamp, J. W.; Korteweg, F. J.; Holm, J. P.; Timmer, A.; Erwich, J. J. H. M.; van Pampus, M. G.

    Objective: A history of foetal death is a risk factor for complications and foetal death in subsequent pregnancies as most previous risk factors remain present and an underlying cause of death may recur. The purpose of this study was to evaluate subsequent pregnancy outcome after foetal death and to

  10. Wildland fire limits subsequent fire occurrence

    Sean A. Parks; Carol Miller; Lisa M. Holsinger; Scott Baggett; Benjamin J. Bird

    2016-01-01

    Several aspects of wildland fire are moderated by site- and landscape-level vegetation changes caused by previous fire, thereby creating a dynamic where one fire exerts a regulatory control on subsequent fire. For example, wildland fire has been shown to regulate the size and severity of subsequent fire. However, wildland fire has the potential to influence...

  11. A Review of Subsequence Time Series Clustering

    Seyedjamal Zolhavarieh

    2014-01-01

    Full Text Available Clustering of subsequence time series remains an open issue in time series clustering. Subsequence time series clustering is used in different fields, such as e-commerce, outlier detection, speech recognition, biological systems, DNA recognition, and text mining. One of the useful fields in the domain of subsequence time series clustering is pattern recognition. To improve this field, a sequence of time series data is used. This paper reviews some definitions and backgrounds related to subsequence time series clustering. The categorization of the literature reviews is divided into three groups: preproof, interproof, and postproof period. Moreover, various state-of-the-art approaches in performing subsequence time series clustering are discussed under each of the following categories. The strengths and weaknesses of the employed methods are evaluated as potential issues for future studies.

  12. A review of subsequence time series clustering.

    Zolhavarieh, Seyedjamal; Aghabozorgi, Saeed; Teh, Ying Wah

    2014-01-01

    Clustering of subsequence time series remains an open issue in time series clustering. Subsequence time series clustering is used in different fields, such as e-commerce, outlier detection, speech recognition, biological systems, DNA recognition, and text mining. One of the useful fields in the domain of subsequence time series clustering is pattern recognition. To improve this field, a sequence of time series data is used. This paper reviews some definitions and backgrounds related to subsequence time series clustering. The categorization of the literature reviews is divided into three groups: preproof, interproof, and postproof period. Moreover, various state-of-the-art approaches in performing subsequence time series clustering are discussed under each of the following categories. The strengths and weaknesses of the employed methods are evaluated as potential issues for future studies.

  13. A Review of Subsequence Time Series Clustering

    Teh, Ying Wah

    2014-01-01

    Clustering of subsequence time series remains an open issue in time series clustering. Subsequence time series clustering is used in different fields, such as e-commerce, outlier detection, speech recognition, biological systems, DNA recognition, and text mining. One of the useful fields in the domain of subsequence time series clustering is pattern recognition. To improve this field, a sequence of time series data is used. This paper reviews some definitions and backgrounds related to subsequence time series clustering. The categorization of the literature reviews is divided into three groups: preproof, interproof, and postproof period. Moreover, various state-of-the-art approaches in performing subsequence time series clustering are discussed under each of the following categories. The strengths and weaknesses of the employed methods are evaluated as potential issues for future studies. PMID:25140332

  14. The effect of prior deformation on subsequent microplasticity and damage evolution in an austenitic stainless steel at elevated temperature

    Li, Dong-Feng; Davies, Catrin M.; Zhang, Shu-Yan; Dickinson, Calum; O’Dowd, Noel P.

    2013-01-01

    The micromechanical deformation of an austenitic stainless steel under uniaxial tension at elevated temperature (550 °C) following room-temperature compression has been examined in this work. The study combines micromechanical finite-element modelling and in situ neutron diffraction measurements. Overall, good agreement has been achieved between the measured and simulated stress vs. lattice strain response, when prestrain is accounted for. The results indicate that the introduction of prestrain can significantly influence subsequent microscale deformation and damage development associated with microplasticity and that an appropriate representation of strain history can improve the predictive accuracy at the microscale for a polycrystalline material

  15. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  16. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  17. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  18. Tritium sorption by cement and subsequent release

    Ono, F.; Tanaka, S.; Yamawaki, M.

    1994-01-01

    In a fusion reactor or tritium handling facilities, contamination of concrete by tritium and subsequent release from it to the reactor or experimental rooms is a matter of problem for safety control of tritium and management of operational environment. In order to evaluate these tritium behavior, interaction of tritiated water with concrete or cement should be clarified. In the present study, HTO sorption and subsequent release from cement were studied by combining various experimental methods. From the basic studies on tritium-cement interactions, it has become possible to evaluate tritium uptake by cement or concrete and subsequent tritium release behavior as well as tritium removing methods from them

  19. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  20. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  2. Rapid Development, Build-Out Ratio and Subsequent Neighborhood Turnover

    George O. Rogers

    2018-04-01

    Full Text Available Neighborhood development is primarily comprised of structural elements that include design elements, nearby amenities and ecological attributes. This paper assumes that the process of development itself also influences the character of the neighborhood—specifically, that the rate of development and build-out ratio influences neighborhood turnover. While the structural components clearly set a framework for development, the process of development expresses the character of the neighborhood in subtle messages conveyed through the market. Neighborhoods in the rapidly growing university town of College Station, Texas are analyzed in terms of neighborhood design, nearby amenities and landscape ecology components. Residential property records are used to characterize each neighborhood in terms of the rate of development and current build-out ratio. The multivariate analysis indicates that the development rate increases subsequent neighborhood turnover rates while the build-out ratio decreases it.

  3. Associations between mental disorders and subsequent onset of hypertension

    Stein, Dan J.; Aguilar-Gaxiola, Sergio; Alonso, Jordi; Bruffaerts, Ronny; de Jonge, Peter; Liu, Zharoui; Caldas-de-Almeida, Jose Miguel; O’Neill, Siobhan; Viana, Maria Carmen; Al-Hamzawi, Ali Obaid; Angermeyer, Mattias C.; Benjet, Corina; de Graaf, Ron; Ferry, Finola; Kovess-Masfety, Viviane; Levinson, Daphna; de Girolamo, Giovanni; Florescu, Silvia; Hu, Chiyi; Kawakami, Norito; Haro, Josep Maria; Piazza, Marina; Wojtyniak, Bogdan J; Xavier, Miguel; Lim, Carmen C.W.; Kessler, Ronald C.; Scott, Kate

    2013-01-01

    Background Previous work has suggested significant associations between various psychological symptoms (e.g. depression, anxiety, anger, alcohol abuse) and hypertension. However, the presence and extent of associations between common mental disorders and subsequent adult onset of hypertension remains unclear. Further, there is little data available on how such associations vary by gender or over life course. Methods Data from the World Mental Health Surveys (comprising 19 countries, and 52,095 adults) were used. Survival analyses estimated associations between first onset of common mental disorders and subsequent onset of hypertension, with and without psychiatric comorbidity adjustment. Variations in the strength of associations by gender and by life course stage of onset of both the mental disorder and hypertension were investigated. Results After psychiatric comorbidity adjustment, depression, panic disorder, social phobia, specific phobia, binge eating disorder, bulimia nervosa, alcohol abuse, and drug abuse were significantly associated with subsequent diagnosis of hypertension (with ORs ranging from 1.1 to 1.6). Number of lifetime mental disorders was associated with subsequent hypertension in a dose-response fashion. For social phobia and alcohol abuse, associations with hypertension were stronger for males than females. For panic disorder, the association with hypertension was particularly apparent in earlier onset hypertension. Conclusions Depression, anxiety, impulsive eating disorders, and substance use disorders disorders were significantly associated with the subsequent diagnosis of hypertension. These data underscore the importance of early detection of mental disorders, and of physical health monitoring in people with these conditions.. PMID:24342112

  4. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  5. Transplutonium elements

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  6. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  7. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  8. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  9. Effects of tire inclination (turning traffic and dynamic loading on the pavement stress–strain responses using 3-D finite element modeling

    Xiaodi Hu

    2017-07-01

    Full Text Available In this study, ABAQUS finite element (FE modeling in three-dimensional (3-D loading mode was utilized to analytically investigate and quantify the effects of tire inclination and dynamic loading on the stress–strain responses of a pavement structure under varying loading and environmental conditions. The input variables for modeling consisted of actual laboratory and field data obtained from an in-service highway US 59 and included the in-situ pavement structure, material properties (i.e., modulus and shear strength, traffic, and climatic (i.e., temperature data. Computational modeling and sensitivity analyses were conducted through variation of the following two input variables with a focus on the top surfacing hot-mix asphalt (HMA layer: a tire inclination angle to simulate turning traffic, and, b dynamic loading to simulate accelerating, steady rolling, and decelerating (braking traffic. The generated maximum shear stress and vertical strain responses were then analyzed and correlated to the HMA material strength and the actual measured/observed field rutting performance data. The corresponding results indicated that inclined tires (simulating turning traffic and decelerating (braking vehicles induced the most severe shear stresses and vertical strains on the pavement structure in terms of magnitude (i.e., increased; exceeding the HMA material strength in some cases. Thus, for pavement design and structural analysis purposes, the following critical highway areas that may be subjected to extreme stresses and strains due to turning and stopping (braking traffic, particularly in high temperature environments, should be given more attention with respect to material strength characterization to mitigate potential shear/rutting failures: intersections, junctions; urban stop–go sections, and curves. Keywords: 3-D FE stress–strain modeling, Rutting, Shear deformation, Shear stress, Vertical strains

  10. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  11. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  12. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  13. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  14. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  16. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  17. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  18. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  19. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  20. Investigation on the Cyclic Response of Superelastic Shape Memory Alloy (SMA Slit Damper Devices Simulated by Quasi-Static Finite Element (FE Analyses

    Jong Wan Hu

    2014-02-01

    Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.

  1. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  2. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  3. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  4. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  5. Embolisation of intracranial meningiomas without subsequent surgery

    Bendszus, M.; Solymosi, L.; Martin-Schrader, I.; Schlake, H.P.

    2003-01-01

    In an open, prospective study, we embolised intracranial meningiomas in seven patients, without subsequent surgery. Follow-up over a mean of 20 months included serial neurological examination, MRI and MR spectroscopy. Clinically, embolisation had no adverse effects. Symptomatic patients showed clinical improvement. On MRI marked tumour shrinkage occurred after embolisation in six patients, and was most pronounced during the first 6 months. In a young boy the tumour was unchanged despite complete angiographic devascularisation. Embolisation without subsequent surgery may cause substantial tumour shrinkage and thus be used in selected in patients. However, thorough follow-up is mandatory to ascertain the effects of embolisation. (orig.)

  6. Toxic Elements

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  7. Hypokalaemia and subsequent hyperkalaemia in hospitalized patients

    M.J. Crop (Meindert); E.J. Hoorn (Ewout); J. Lindemans (Jan); R. Zietse (Bob)

    2007-01-01

    textabstractBackground. The objective was to study the epidemiology of hypokalaemia [serum potassium concentration (SK) <3.5 mmol/l] in a general hospital population, specifically focusing on how often and why patients develop subsequent hyperkalaemia (SK<5.0 mmol/l). Methods. In a 3-month

  8. Subsequent childbirth after a previous traumatic birth.

    Beck, Cheryl Tatano; Watson, Sue

    2010-01-01

    Nine percent of new mothers in the United States who participated in the Listening to Mothers II Postpartum Survey screened positive for meeting the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition criteria for posttraumatic stress disorder after childbirth. Women who have had a traumatic birth experience report fewer subsequent children and a longer length of time before their second baby. Childbirth-related posttraumatic stress disorder impacts couples' physical relationship, communication, conflict, emotions, and bonding with their children. The purpose of this study was to describe the meaning of women's experiences of a subsequent childbirth after a previous traumatic birth. Phenomenology was the research design used. An international sample of 35 women participated in this Internet study. Women were asked, "Please describe in as much detail as you can remember your subsequent pregnancy, labor, and delivery following your previous traumatic birth." Colaizzi's phenomenological data analysis approach was used to analyze the stories of the 35 women. Data analysis yielded four themes: (a) riding the turbulent wave of panic during pregnancy; (b) strategizing: attempts to reclaim their body and complete the journey to motherhood; (c) bringing reverence to the birthing process and empowering women; and (d) still elusive: the longed-for healing birth experience. Subsequent childbirth after a previous birth trauma has the potential to either heal or retraumatize women. During pregnancy, women need permission and encouragement to grieve their prior traumatic births to help remove the burden of their invisible pain.

  9. Subsequent Reproductive Performance in Survivors of Complicated ...

    Objective To study the subsequent reproductive performance of women who had undergone complicated abortions. Materials and Methods Attempts were made to trace 299 survivors of complicated abortions from an earlier study. Their contact telephone numbers and addresses had been recorded at the time of initial ...

  10. 75 FR 346 - Proposed Subsequent Arrangement

    2010-01-05

    ... Uses of Nuclear Energy. This subsequent arrangement concerns the retransfer of 28,409 kg of U.S.-origin... Fuels in Kanakawa-ken, Japan. The material, which is currently located at Cameco, Port Hope, Ontario, will be transferred to Global Nuclear Fuel, Kanakawa-ken, Japan to be fabricated into fuel pellets and...

  11. 78 FR 72072 - Proposed Subsequent Arrangement

    2013-12-02

    ... g of U.S.-origin atomized low-enriched uranium-7wt. % molybdenum powder, containing 365.638 g in the..., which is located at and was prepared by KAERI, will be used for the irradiation test of full-size fuel... subsequent arrangement concerning the retransfer of nuclear material of United States origin will not be...

  12. 78 FR 40131 - Proposed Subsequent Arrangement

    2013-07-03

    ... INFORMATION: This subsequent arrangement concerns the retransfer of 302,188 kg of U.S.-origin natural uranium..., Saskatchewan, Canada, to Springfields Fuels Ltd. in Lancashire, United Kingdom. The material, which is... arrangement concerning the retransfer of nuclear material of United States origin will not be inimical to the...

  13. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  14. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  15. Fuel element

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  16. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  17. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  18. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, including glucose, on pancreatic development. We previously showed that glucose and its metabolism through the hexosamine biosynthesis pathway (HBP) promote pancreatic endocrine cell differentiation. Here, we analysed the role of the transcription factor carbohydrate-responsive element-binding protein (ChREBP) in this process. This transcription factor is activated by glucose, and has been recently described as a target of the HBP. We used an in vitro bioassay in which pancreatic endocrine and exocrine cells develop from rat embryonic pancreas in a way that mimics in vivo pancreatic development. Using this model, gain-of-function and loss-of-function experiments were undertaken. ChREBP was produced in the endocrine lineage during pancreatic development, its abundance increasing with differentiation. When rat embryonic pancreases were cultured in the presence of glucose or xylitol, the production of ChREBP targets was induced. Concomitantly, beta cell differentiation was enhanced. On the other hand, when embryonic pancreases were cultured with inhibitors decreasing ChREBP activity or an adenovirus producing a dominant-negative ChREBP, beta cell differentiation was reduced, indicating that ChREBP activity was necessary for proper beta cell differentiation. Interestingly, adenovirus producing a dominant-negative ChREBP also reduced the positive effect of N-acetylglucosamine, a substrate of the HBP acting on beta cell differentiation. Our work supports the idea that glucose, through the transcription factor ChREBP, controls beta cell differentiation from pancreatic progenitors.

  19. Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

    Matthew S Lalonde

    2011-05-01

    Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

  20. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  1. Numerical Simulation on Seismic Response of the Filled Joint under High Amplitude Stress Waves Using Finite-Discrete Element Method (FDEM

    Xiaolin Huang

    2016-12-01

    Full Text Available This paper numerically investigates the seismic response of the filled joint under high amplitude stress waves using the combined finite-discrete element method (FDEM. A thin layer of independent polygonal particles are used to simulate the joint fillings. Each particle is meshed using the Delaunay triangulation scheme and can be crushed when the load exceeds its strength. The propagation of the 1D longitude wave through a single filled joint is studied, considering the influences of the joint thickness and the characteristics of the incident wave, such as the amplitude and frequency. The results show that the filled particles under high amplitude stress waves mainly experience three deformation stages: (i initial compaction stage; (ii crushing stage; and (iii crushing and compaction stage. In the initial compaction stage and crushing and compaction stage, compaction dominates the mechanical behavior of the joint, and the particle area distribution curve varies little. In these stages, the transmission coefficient increases with the increase of the amplitude, i.e., peak particle velocity (PPV, of the incident wave. On the other hand, in the crushing stage, particle crushing plays the dominant role. The particle size distribution curve changes abruptly with the PPV due to the fragments created by the crushing process. This process consumes part of wave energy and reduces the stiffness of the filled joint. The transmission coefficient decreases with increasing PPV in this stage because of the increased amount of energy consumed by crushing. Moreover, with the increase of the frequency of the incident wave, the transmission coefficient decreases and fewer particles can be crushed. Under the same incident wave, the transmission coefficient decreases when the filled thickness increases and the filled particles become more difficult to be crushed.

  2. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  3. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  4. Utilization of a hybrid finite-element based registration method to quantify heterogeneous tumor response for adaptive treatment for lung cancer patients

    Sharifi, Hoda; Zhang, Hong; Bagher-Ebadian, Hassan; Lu, Wei; Ajlouni, Munther I.; Jin, Jian-Yue; (Spring Kong, Feng-Ming; Chetty, Indrin J.; Zhong, Hualiang

    2018-03-01

    Tumor response to radiation treatment (RT) can be evaluated from changes in metabolic activity between two positron emission tomography (PET) images. Activity changes at individual voxels in pre-treatment PET images (PET1), however, cannot be derived until their associated PET-CT (CT1) images are appropriately registered to during-treatment PET-CT (CT2) images. This study aimed to investigate the feasibility of using deformable image registration (DIR) techniques to quantify radiation-induced metabolic changes on PET images. Five patients with non-small-cell lung cancer (NSCLC) treated with adaptive radiotherapy were considered. PET-CTs were acquired two weeks before RT and 18 fractions after the start of RT. DIR was performed from CT1 to CT2 using B-Spline and diffeomorphic Demons algorithms. The resultant displacements in the tumor region were then corrected using a hybrid finite element method (FEM). Bitmap masks generated from gross tumor volumes (GTVs) in PET1 were deformed using the four different displacement vector fields (DVFs). The conservation of total lesion glycolysis (TLG) in GTVs was used as a criterion to evaluate the quality of these registrations. The deformed masks were united to form a large mask which was then partitioned into multiple layers from center to border. The averages of SUV changes over all the layers were 1.0  ±  1.3, 1.0  ±  1.2, 0.8  ±  1.3, 1.1  ±  1.5 for the B-Spline, B-Spline  +  FEM, Demons and Demons  +  FEM algorithms, respectively. TLG changes before and after mapping using B-Spline, Demons, hybrid-B-Spline, and hybrid-Demons registrations were 20.2%, 28.3%, 8.7%, and 2.2% on average, respectively. Compared to image intensity-based DIR algorithms, the hybrid FEM modeling technique is better in preserving TLG and could be useful for evaluation of tumor response for patients with regressing tumors.

  5. Plant HDAC inhibitor chrysin arrest cell growth and induce p21WAF1 by altering chromatin of STAT response element in A375 cells

    Pal-Bhadra, Manika; Bhadra, Utpal; Ramaiah, M Janaki; Reddy, T Lakshminarayan; Krishnan, Anita; Pushpavalli, SNCVL; Babu, K Suresh; Tiwari, Ashok K; Rao, J Madhusudana; Yadav, Jhillu S

    2012-01-01

    Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21 WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21 WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK

  6. Association of Periodontitis and Subsequent Depression

    Hsu, Chih-Chao; Hsu, Yi-Chao; Chen, Hsuan-Ju; Lin, Che-Chen; Chang, Kuang-Hsi; Lee, Chang-Yin; Chong, Lee-Won; Kao, Chia-Hung

    2015-01-01

    Abstract Periodontitis is a systemic and chronic inflammatory disease associated with multiple physical conditions. Distress and depression are other problems affecting the progression of periodontitis. However, the causal relationship between depression and periodontitis has not been adequately investigated. This aim of this study was to determine the association between periodontitis and the subsequent development of depression. We identified 12,708 patients with newly diagnosed periodontitis from 2000 to 2005 and 50,832 frequency-matched individuals without periodontitis. Both groups were followed until diagnosed with depression, withdrawal from the National Health Insurance program, or the end of 2011. The association between periodontitis and depressio was analyzed using Cox proportional hazard regression models. The incidence density rate of depression was higher in the periodontitis group than in the nonperiodontitis group, with an adjusted hazard ratio of 1.73 (95% confidence interval 1.58–1.89) when adjusting for sex, age, and comorbidity. Cox models revealed that periodontitis was an independent risk factor for depression in patients, except for comorbidities of diabetes mellitus (DM), alcohol abuse, and cancer. Periodontitis may increase the risk of subsequent depression and was suggested an independent risk factor regardless of sex, age, and most comorbidities. However, DM, alcohol abuse, and cancer may prevent the development of subsequent depression because of DM treatment, the paradoxical effect of alcohol, and emotional distress to cancer, respectively. Prospective studies on the relationship between periodontitis and depression are warranted. PMID:26705230

  7. Induced abortion and subsequent pregnancy duration

    Zhou, Wei Jin; Sørensen, Henrik Toft; Olsen, Jørn

    1999-01-01

    OBJECTIVE: To examine whether induced abortion influences subsequent pregnancy duration. METHODS: Women who had their first pregnancies during 1980, 1981, and 1982 were identified in three Danish national registries. A total of 15,727 women whose pregnancies were terminated by first-trimester ind......OBJECTIVE: To examine whether induced abortion influences subsequent pregnancy duration. METHODS: Women who had their first pregnancies during 1980, 1981, and 1982 were identified in three Danish national registries. A total of 15,727 women whose pregnancies were terminated by first......-trimester induced abortions were compared with 46,026 whose pregnancies were not terminated by induced abortions. All subsequent pregnancies until 1994 were identified by register linkage. RESULTS: Preterm and post-term singleton live births were more frequent in women with one, two, or more previous induced...... abortions. After adjusting for potential confounders and stratifying by gravidity, the odds ratios of preterm singleton live births in women with one, two, or more previous induced abortions were 1.89 (95% confidence interval [CI] 1.70, 2.11), 2.66 (95% CI 2.09, 3.37), and 2.03 (95% CI 1.29, 3...

  8. Response

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  9. PELTIER ELEMENTS

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  10. Transposable elements in cancer.

    Burns, Kathleen H

    2017-07-01

    Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

  11. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  12. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  13. A case report of spontaneous mutation (C33>U) in the iron-responsive element of L-ferritin causing hyperferritinemia-cataract syndrome.

    Cao, Wei

    2010-01-15

    The hereditary hyperferritinemia cataract syndrome (HHCS) is an autosomal dominant disorder characterized by juvenile-onset cataracts and elevated serum ferritin levels. It is caused by mutation in the iron response element (IRE) within the 5\\'UTR of L-ferritin gene. The mutation results in a loss of post-transcriptional negative feedback exerted by the interaction between iron regulatory proteins 1, 2 (IRP1 and IRP2) and IRE, which leads to uncontrolled expression of L-ferritin. In this paper, we describe the molecular pathogenesis of non-hereditary hyperferritinemia cataract syndrome (non-H-HCS) in a patient with typical HHCS ocular lens morphology and high ferritin levels without obvious family history. Initial sequencing of the full-length L-ferritin cloned from genomic DNA demonstrated a mutation (C33>T) in the IRE of the affected patient but not in her unaffected family members. The mutation (C\\/T heterozygote) was also detected in cDNA derived from her blood mononuclear cells. Structure-prediction-modeling indicates that this mutation would significantly alter the secondary structure of the IRE, resulting in a loss of the interaction between IRP and IRE. By using IRP1\\/IRP2-human IgG1 Fc fusion proteins, we established a novel in vitro report system (modified ELISA) to verify impaired IRE\\/IRP binding. Both the C33>U and A40G mutations (the first identified mutation for HHCS) showed a dramatically decreased binding to IRP1\\/IRP2 protein, compared to the normal IRE RNA. Surprisingly, a decrease in L-ferritin mRNA levels was observed in the affected patient compared to controls suggesting a mechanism of transcriptional negative feedback by high intracellular L-ferritin protein levels not described heretofore. Taken together, spontaneous mutation in the IRE of L-ferritin may cause non-H-HCS by the same mechanism as HHCS. In addition, under abnormal circumstances, the protein level of L-ferritin may be principally controlled by post

  14. Tritium sorption by cement and subsequent release

    Ono, F.; Yamawaki, M.

    1995-01-01

    In a fusion reactor or tritium-handling facilities, contamination of concrete by tritium and subsequent release from it to the reator or experimental room is a matter of problem for safe control of tritium and management of operational environment. In order to evaluate this tritium behavior, interaction of tritiated water with concrete or cement should be clarified. In the present study, HTO sorption and subsequent release from cement were experimentally studied.(1)Sorption experiments were conducted using columns packed with cement particles of different sizes. From the analysis of the breakthrough curve, tritium diffusivity in macropores and microparticles were evaluated.(2)From the short-term tritium release experiments, effective desorption rate constants were evaluated and the effects of temperature and moisture were studied.(3)In the long-term tritium release experiments to 6000h, the tritium release mechanism was found to be composed of three kinds of water: initially from capillary water, and in the second stage from gel water and from the water in the cement crystal.(4)Tritium release behavior by heat treatment to 800 C was studied. A high temperature above 600 C was required for the tritium trapped in the crystal water to be released. (orig.)

  15. Workplace bullying and subsequent health problems.

    Nielsen, Morten Birkeland; Magerøy, Nils; Gjerstad, Johannes; Einarsen, Ståle

    2014-07-01

    Cross-sectional studies demonstrate that exposure to bullying in the workplace is positively correlated with self-reported health problems. However, these studies do not provide a basis to draw conclusions on the extent to which bullying leads to increased health problems or whether health problems increase the risk of being bullied. To provide better indications of a causal relationship, knowledge from prospective studies on the association between bullying in the workplace and health outcomes is therefore summarised. We conducted a systematic literature review of original articles from central literature databases on longitudinal associations between bullying in the workplace and health. Average associations between bullying and health outcomes are calculated using meta-analysis. A consistent finding across the studies is that exposure to bullying is significantly positively related to mental health problems (OR =1.68; 95% KI 1.35-2.09) and somatic symptoms (OR = 1.77; 95% KI 1.41-2.22) over time. Mental health problems are also associated with subsequent exposure to bullying (OR = 1.74; 95% KI 1.44-2.12). Bullying is positively related to mental health problems and somatic symptoms. The association between mental health problems and subsequent bullying indicates a self-reinforcing process between mental health and bullying. The methodological quality of the studies that were conducted is relatively sound. However, based on the existing knowledge base there are no grounds for conclusions regarding an unambiguous causal relationship between bullying and health.

  16. Fuel element

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  17. Transactinide elements

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)

  18. Separation and Recycling for Rare Earth Elements by Homogeneous Liquid-Liquid Extraction (HoLLE Using a pH-Responsive Fluorine-Based Surfactant

    Shotaro Saito

    2015-08-01

    Full Text Available A selective separation and recycling system for metal ions was developed by homogeneous liquid-liquid extraction (HoLLE using a fluorosurfactant. Sixty-two different elemental ions (e.g., Ag, Al, As, Au, B, Ba, Be, Bi, Ca, Cd, Ce, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Gd, Ge, Hf, Hg, Ho, In, Ir, La, Lu, Mg, Mn, Mo, Nb, Nd, Ni, Os, P, Pb, Pd, Pr, Pt, Re, Rh, Ru, Sb, Sc, Se, Si, Sm, Sn, Sr, Ta, Tb, Te, Ti, Tl, Tm, V, W, Y, Yb, Zn, and Zr were examined. By changing pH from a neutral or alkaline solution (pH ≥ 6.5 to that of an acidic solution (pH < 4.0, gallium, zirconium, palladium, silver, platinum, and rare earth elements were extracted at >90% efficiency into a sedimented Zonyl FSA® (CF3(CF2n(CH22S(CH22COOH, n = 6–8 liquid phase. Moreover, all rare earth elements were obtained with superior extraction and stripping percentages. In the recycling of rare earth elements, the sedimented phase was maintained using a filter along with a mixed solution of THF and 1 M sodium hydroxide aqueous solution. The Zonyl FSA® was filtrated and the rare earth elements were recovered on the filter as a hydroxide. Furthermore, the filtrated Zonyl FSA was reusable by conditioning the subject pH.

  19. Activity recognition from minimal distinguishing subsequence mining

    Iqbal, Mohammad; Pao, Hsing-Kuo

    2017-08-01

    Human activity recognition is one of the most important research topics in the era of Internet of Things. To separate different activities given sensory data, we utilize a Minimal Distinguishing Subsequence (MDS) mining approach to efficiently find distinguishing patterns among different activities. We first transform the sensory data into a series of sensor triggering events and operate the MDS mining procedure afterwards. The gap constraints are also considered in the MDS mining. Given the multi-class nature of most activity recognition tasks, we modify the MDS mining approach from a binary case to a multi-class one to fit the need for multiple activity recognition. We also study how to select the best parameter set including the minimal and the maximal support thresholds in finding the MDSs for effective activity recognition. Overall, the prediction accuracy is 86.59% on the van Kasteren dataset which consists of four different activities for recognition.

  20. A Finnic holy word and its subsequent history

    Mauno Koski

    1990-01-01

    Full Text Available This article concentrates on a specific ancient holy word in Finnish and its subsequent development, hiisi. In the Finnish language region hiisi appears as an element in place names in over 230 villages established by the end of the thirteenth century, and at least a majority of these must have existed since prehistoric times. In Finland as well as in Estonia it is possible to demonstrate an earlier sacral function in places which contain hiisi as a component of their name, partly with the help of archeological discoveries, and partly with the help of oral folk tradition. It is particularly among the earliest settlement areas of Southwest Finland, Satakunta and Häme that hiisi features in the names of sacrificial sites or trees, in other words in the same areas where it features in the names of burial grounds. Names in which the hiisi element precedes a word meaning a lake, pond, or other water formation, occur particularly in the eastern Finnish dialect regions, as well as in the regions of Karelian, Olonets, Lydian, and Vepsian. In addition to its factual meaning of cult place, the Finnish word hiisi has come to denote a supernatural entity both in terms of its reference to a place and in terms of its reference to a being.

  1. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I

    Seiki, Motoharu; Inoue, Junichiro; Hidaka, Makoto; Yoshida, Mitsuaki

    1988-01-01

    The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40 tax and p27 rex and a cytoplasmic protein, p21 X-III . p40 tax activates transcription from the long terminal repeat (LTR), whereas p27 rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, the authors identify two cis-acting sequence elements needed for regulation by p27 rex : a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27 rex ; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests and unusual regulatory mechanism of RNA processing in the nucleus

  2. Boundary Element Analysis of the Steady-state Response of an Elastic Half-Space to a Moving Force on its Surface

    Andersen, Lars; Nielsen, Søren R. K.

    2003-01-01

    The paper deals with the boundary element method formulation of the steady-state wave propagation through elastic media due to a source moving with constant velocity. The Greens' function for the three-dimensional full-space is formulated in a local frame of reference following the source...... is approximated, but the error which is introduced in this way is insignificant. Numerical examples are given for a moving rectangular load on an elastic half-space. The result from a boundary element code based on the derived Green's function are compared with a semi-analytic solution....

  3. Influence of easily ionised elements on the delayed responses of the emission intensities of an analyte in a power modulated U-shaped argon stabilised DC arc plasma with an aerosol supply

    MIROSLAV KUZMANOVIC

    2005-09-01

    Full Text Available The current of a U-shaped argon stabilised DC arc was square modulated with a 40 Hz repetition frequency between 6 and 3 A. The delayed line intensity responses to the modulation of the arc current were investigated using calcium as a representative analyte. The intensities of both the atomic and ionic lines were monitored at different distances from the arc axis in the presence of various concentrations of the easily ionised element. Temporal evolutions were monitored on a millisecond time scale. It was found that the responses of the line intesity to the arc current change strongly depended on the observed radial position, especially in the vicinity of the arc axis. The obtained results showed a significant influence of even small amounts of the easily ionised element on the excitation and transport of the analyte and indicated a way of possibly improving the analytical capabilities of the excitation source.

  4. New elements

    Flerov, G.

    1976-01-01

    The history is briefly described of the investigation of superheavy elements at the Joint Institute for Nuclear Research at Dubna. The significance of the investigation is assessed from the point of view of the nuclear structure study and major problems encountered in experimental efforts are indicated. Current experimental methods aiming at the discovery or the production of superheavy nuclei with Z approximately 114 are listed. (I.W.)

  5. Predicting Subsequent Task Performance From Goal Motivation and Goal Failure

    Laura Catherine Healy

    2015-07-01

    Full Text Available Recent research has demonstrated that the cognitive processes associated with goal pursuit can continue to interfere with unrelated tasks when a goal is unfulfilled. Drawing from the self-regulation and goal-striving literatures, the present study explored the impact of goal failure on subsequent cognitive and physical task performance. Furthermore, we examined if the autonomous or controlled motivation underpinning goal striving moderates the responses to goal failure. Athletes (75 male, 59 female, Mage = 19.90 years, SDage = 3.50 completed a cycling trial with the goal of covering a given distance in 8 minutes. Prior to the trial, their motivation was primed using a video. During the trial they were provided with manipulated performance feedback, thus creating conditions of goal success or failure. No differences emerged in the responses to goal failure between the primed motivation or performance feedback conditions. We make recommendations for future research into how individuals can deal with failure in goal striving.

  6. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  7. Emotionally negative pictures increase attention to a subsequent auditory stimulus.

    Tartar, Jaime L; de Almeida, Kristen; McIntosh, Roger C; Rosselli, Monica; Nash, Allan J

    2012-01-01

    Emotionally negative stimuli serve as a mechanism of biological preparedness to enhance attention. We hypothesized that emotionally negative stimuli would also serve as motivational priming to increase attention resources for subsequent stimuli. To that end, we tested 11 participants in a dual sensory modality task, wherein emotionally negative pictures were contrasted with emotionally neutral pictures and each picture was followed 600 ms later by a tone in an auditory oddball paradigm. Each trial began with a picture displayed for 200 ms; half of the trials began with an emotionally negative picture and half of the trials began with an emotionally neutral picture; 600 ms following picture presentation, the participants heard either an oddball tone or a standard tone. At the end of each trial (picture followed by tone), the participants categorized, with a button press, the picture and tone combination. As expected, and consistent with previous studies, we found an enhanced visual late positive potential (latency range=300-700 ms) to the negative picture stimuli. We further found that compared to neutral pictures, negative pictures resulted in early attention and orienting effects to subsequent tones (measured through an enhanced N1 and N2) and sustained attention effects only to the subsequent oddball tones (measured through late processing negativity, latency range=400-700 ms). Number pad responses to both the picture and tone category showed the shortest response latencies and greatest percentage of correct picture-tone categorization on the negative picture followed by oddball tone trials. Consistent with previous work on natural selective attention, our results support the idea that emotional stimuli can alter attention resource allocation. This finding has broad implications for human attention and performance as it specifically shows the conditions in which an emotionally negative stimulus can result in extended stimulus evaluation. Copyright © 2011

  8. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  9. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  10. Varying response of the concentration and content of soybean seed mineral elements, carbohydrates, organic acids, amino acids, protein, and oil to phosphorus starvation and CO2 enrichment

    A detailed investigation of the concentration (g-1 seed weight) and content (g plant-1) of seed mineral elements and metabolic profile under phosphorus (P) starvation at ambient (aCO2) and elevated carbon dioxide (eCO2) in soybean is limited. Soybean plants were grown in a controlled environment at ...

  11. Neither Reb1p nor poly(dA*T) elements are responsible for the highly specific chromatin organization at the ILV1 promoter

    Moreira, José Manuel Alfonso; Hörz, Wolfram; Holmberg, Steen

    2001-01-01

    Analysis of the chromatin structure at the yeast ILV1 locus revealed highly positioned nucleosomes covering the entire locus except for a hypersensitive site in the promoter region. All previously identified cis-acting elements required for GCN4-independent ILV1 basal level transcription, includi...

  12. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake.

    Shirokova, L S; Pokrovsky, O S; Moreva, O Yu; Chupakov, A V; Zabelina, S A; Klimov, S I; Shorina, N V; Vorobieva, T Ya

    2013-10-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa-0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30°C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70-80% to only 20-30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90-98% in most summers and winters to approximately 60-70% in August 2010. During this hot summer, measurable and significant (>30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved (organic matter by heterotrophic aerobic bacterioplankton and 3) photo-degradation of DOM and photo-chemical liberation of organic-bound TE. While the first process may have caused significant decreases in the total dissolved concentration of micronutrients (a factor of 2 to 5 for Cr, Mn, Fe, Ni, Cu, Zn and Cd and a factor of >100 for Co), the second and third factors could have brought

  13. Postidentification Feedback Affects Subsequent Eyewitness Identification Performance

    Palmer, Matthew A.; Brewer, Neil; Weber, Nathan

    2010-01-01

    Eyewitnesses sometimes view more than one lineup during an investigation. We investigated the effects of postidentification feedback following one lineup on responses to a second lineup. Witnesses (N = 621) viewed a mock crime and, later, attempted to identify the culprit from an initial (target-absent) lineup and a second (target-present or…

  14. Decisions reduce sensitivity to subsequent information.

    Bronfman, Zohar Z; Brezis, Noam; Moran, Rani; Tsetsos, Konstantinos; Donner, Tobias; Usher, Marius

    2015-07-07

    Behavioural studies over half a century indicate that making categorical choices alters beliefs about the state of the world. People seem biased to confirm previous choices, and to suppress contradicting information. These choice-dependent biases imply a fundamental bound of human rationality. However, it remains unclear whether these effects extend to lower level decisions, and only little is known about the computational mechanisms underlying them. Building on the framework of sequential-sampling models of decision-making, we developed novel psychophysical protocols that enable us to dissect quantitatively how choices affect the way decision-makers accumulate additional noisy evidence. We find robust choice-induced biases in the accumulation of abstract numerical (experiment 1) and low-level perceptual (experiment 2) evidence. These biases deteriorate estimations of the mean value of the numerical sequence (experiment 1) and reduce the likelihood to revise decisions (experiment 2). Computational modelling reveals that choices trigger a reduction of sensitivity to subsequent evidence via multiplicative gain modulation, rather than shifting the decision variable towards the chosen alternative in an additive fashion. Our results thus show that categorical choices alter the evidence accumulation mechanism itself, rather than just its outcome, rendering the decision-maker less sensitive to new information. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  15. Communicating hydrocephalus subsequent to purulent meningitis

    Suzuki, Hiroshi; Ogawa, Kimio; Hibio, Shuichi; Goto, Kazuhiko; Shiihara, Hiroaki

    1984-01-01

    Based on CT findings one year after shunting, ventricular dialtion was classified into five degrees for examining prognosis of communicating hydrocephalus subsequent to purulent meningitis. Factors causing and aggravating hydrocephalus were also examined. Patients with hydrocephalus tended to have spasms frequently as the first symptom within one month after birth when there were few characteristic findings. Spasm and disturbance of consciousness occurred frequently during the first week of the occurrence of disease. Large numbers of cells in the spinal fluid and high volume of spinal cord protein were persistent in patients aged one month or less. Chloride transport decreased in patients aged two months or more. The occurrence of syndrome of the pyramidal tract, eye symptoms, movement of head to the left and right, and involuntary movement suggested serious conditions of the disease. Disturbance of movement could be relieved by giving adequate antibiotics as soon as meningitis was discovered within one month after birth and by giving chloramphenicol when symptoms suggesting the development of serious conditions occurred. However, mental retardation and epilepsy could not be prevented. (Namekawa, K.)

  16. Compressed Subsequence Matching and Packed Tree Coloring

    Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li

    2017-01-01

    We present a new algorithm for subsequence matching in grammar compressed strings. Given a grammar of size n compressing a string of size N and a pattern string of size m over an alphabet of size \\(\\sigma \\), our algorithm uses \\(O(n+\\frac{n\\sigma }{w})\\) space and \\(O(n+\\frac{n\\sigma }{w}+m\\log N\\log...... w\\cdot occ)\\) or \\(O(n+\\frac{n\\sigma }{w}\\log w+m\\log N\\cdot occ)\\) time. Here w is the word size and occ is the number of minimal occurrences of the pattern. Our algorithm uses less space than previous algorithms and is also faster for \\(occ=o(\\frac{n}{\\log N})\\) occurrences. The algorithm uses...... a new data structure that allows us to efficiently find the next occurrence of a given character after a given position in a compressed string. This data structure in turn is based on a new data structure for the tree color problem, where the node colors are packed in bit strings....

  17. Probabilistic finite elements

    Belytschko, Ted; Wing, Kam Liu

    1987-01-01

    In the Probabilistic Finite Element Method (PFEM), finite element methods have been efficiently combined with second-order perturbation techniques to provide an effective method for informing the designer of the range of response which is likely in a given problem. The designer must provide as input the statistical character of the input variables, such as yield strength, load magnitude, and Young's modulus, by specifying their mean values and their variances. The output then consists of the mean response and the variance in the response. Thus the designer is given a much broader picture of the predicted performance than with simply a single response curve. These methods are applicable to a wide class of problems, provided that the scale of randomness is not too large and the probabilistic density functions possess decaying tails. By incorporating the computational techniques we have developed in the past 3 years for efficiency, the probabilistic finite element methods are capable of handling large systems with many sources of uncertainties. Sample results for an elastic-plastic ten-bar structure and an elastic-plastic plane continuum with a circular hole subject to cyclic loadings with the yield stress on the random field are given.

  18. JAC2D: A two-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    Biffle, J.H.; Blanford, M.L.

    1994-05-01

    JAC2D is a two-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equations. The method is implemented in a two-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. A four-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic/plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  19. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake

    Shirokova, L.S.; Pokrovsky, O.S.; Moreva, O.Yu.; Chupakov, A.V.; Zabelina, S.A.; Klimov, S.I.; Shorina, N.V.; Vorobieva, T.Ya.

    2013-01-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa–0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30 °C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70–80% to only 20–30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90–98% in most summers and winters to approximately 60–70% in August 2010. During this hot summer, measurable and significant (> 30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved ( 100 for Co), the second and third factors could have brought about the decrease of allochthonous DOC concentration as well as the concentration and proportion of organic and organo-mineral colloidal forms of non-essential low-soluble trace elements present in the form of organic colloids (Al, Y, Ti, Zr, Hf, Th, Pb, all REEs). It can be hypothesized that climate warming in

  20. JAC3D -- A three-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    Biffle, J.H.

    1993-02-01

    JAC3D is a three-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equation. The method is implemented in a three-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. An eight-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic-plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  1. Superheavy elements

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  2. Cough during infancy and subsequent childhood asthma.

    Oren, E; Rothers, J; Stern, D A; Morgan, W J; Halonen, M; Wright, A L

    2015-09-01

    Wheezing in infancy has been associated with subsequent asthma, but whether cough similarly influences asthma risk has been little studied. We sought to determine whether prolonged cough and cough without cold in the first year of life are associated with childhood asthma. Participants in the Infant Immune Study, a non-selected birth cohort, were surveyed 7 times in the first 9 months of life regarding the presence of wheeze and cough. Cough for more than 28 days was defined as prolonged. Parents were asked at 1 year if the child ever coughed without a cold. Asthma was defined as parental report of physician diagnosis of asthma, with symptoms or medication use between 2 and 9 years. Logistic regression was used to assess adjusted odds for asthma associated with cough characteristics. A total of 24% (97) of children experienced prolonged cough and 23% (95) cough without cold in the first 9 months, respectively. Prolonged cough was associated with increased risk of asthma relative to brief cough (OR 3.57, CI: 1.88, 6.76), with the risk being particularly high among children of asthmatic mothers. Cough without cold (OR 3.13, 95% CI: 1.76, 5.57) was also independently associated with risk of childhood asthma. Both relations persisted after adjustment for wheeze and total IgE at age 1. Prolonged cough in infancy and cough without cold are associated with childhood asthma, independent of infant wheeze. These findings suggest that characteristics of cough in infancy are early markers of asthma susceptibility, particularly among children with maternal asthma. © 2015 John Wiley & Sons Ltd.

  3. The evolution of the elements

    Williams, P.M.

    1978-01-01

    It is believed that only the lightest elements, hydrogen and helium, were created during the 'Big Bang' origin of the Universe and that all heavier elements were synthesized by nuclear reactions in stars, the interstellar medium and possibly in 'little bangs' in the nuclei of galaxies. The composition of the interstellar medium has evolved through enrichment by processed material shed by evolving stars and the composition of the Solar System reflects that of the interstellar medium at the time of its formation. Differentiation processes during the evolution of the Solar System and individual planets account for the different compositions of the Sun and the planets. The measurement of the abundance distribution of the elements has become a very powerful tool in the elucidation of the evolution of the Solar System, stars and the Galaxy. This review attempts to trace the formation of the elements in stars and their subsequent evolution. (author)

  4. Downhole Elemental Analysis with LIBS

    Moreschini, Paolo; Zacny, Kris; Rickman, Doug

    2011-01-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized laser-induced breakdown spectrometer (LIBS) analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a

  5. Fuel element

    Hirose, Yasuo.

    1982-01-01

    Purpose: To increase the plenum space in a fuel element used for a liquid metal cooled reactor. Constitution: A fuel pellet is secured at one end with an end plug and at the other with a coil spring in a tubular container. A mechanism for fixing the coil spring composed of a tubular unit is mounted by friction with the inner surface of the tubular container. Accordingly, the recoiling force of the coil spring can be retained by fixing mechanism with a small volume, and since a large amount of plenum space can be obtained, the internal pressure rise in the cladding tube can be suppressed even if large quantities of fission products are discharged. (Kamimura, M.)

  6. Low-temperature-induced expression of rice ureidoglycolate amidohydrolase is mediated by a C-repeat/dehydration-responsive element that specifically interacts with rice C-repeat-binding factor 3

    Juan eLi

    2015-11-01

    Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.

  7. Transported biofilms and their influence on subsequent macrofouling colonization.

    Sweat, L Holly; Swain, Geoffrey W; Hunsucker, Kelli Z; Johnson, Kevin B

    2017-05-01

    Biofilm organisms such as diatoms are potential regulators of global macrofouling dispersal because they ubiquitously colonize submerged surfaces, resist antifouling efforts and frequently alter larval recruitment. Although ships continually deliver biofilms to foreign ports, it is unclear how transport shapes biofilm microbial structure and subsequent macrofouling colonization. This study demonstrates that different ship hull coatings and transport methods change diatom assemblage composition in transported coastal marine biofilms. Assemblages carried on the hull experienced significant cell losses and changes in composition through hydrodynamic stress, whereas those that underwent sheltered transport, even through freshwater, were largely unaltered. Coatings and their associated biofilms shaped distinct macrofouling communities and affected recruitment for one third of all species, while biofilms from different transport treatments had little effect on macrofouling colonization. These results demonstrate that transport conditions can shape diatom assemblages in biofilms carried by ships, but the properties of the underlying coatings are mainly responsible for subsequent macrofouling. The methods by which organisms colonize and are transferred by ships have implications for their distribution, establishment and invasion success.

  8. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  9. Disease related tissue damage and subsequent changes in fillet structure

    of the fish and subsequent a reduction in price. Despite this, the impact of infectious diseases on the meat quality and the mechanisms behind are poorly investigated. Wound repair is a dynamic, interactive response to tissue injury that involves a complex interaction and cross talk of various cell types......, extracellular matrix molecules, soluble mediators and cytokines. In order to describe the molecular mechanisms and processes of wound repair, a panel of genes covering immunological factors and tissue regeneration were used to measure changes at the mRNA level following mechanical tissue damage in rainbow trout...... (Oncorhynchus mykiss). Needle disrupted muscle tissue was sampled at different time points and subject to real-time RT-PCR for measuring the expression of the genes IL-1β, IL-8, IL-10, TGF-β, Myostatin-1ab, MMP-2, CTGF, Collagen-1α, VEGF, iNOS, Arg-2 and FGF. The results showed an initial phase with up...

  10. Empathy toward strangers triggers oxytocin release and subsequent generosity.

    Barraza, Jorge A; Zak, Paul J

    2009-06-01

    Empathy is related to a variety of prosocial behaviors, but the brain mechanisms producing the experience of empathy have not been fully characterized. This study investigated whether the experience of empathy raises oxytocin levels and affects subsequent generosity toward strangers. Short video clips of an emotional scene and an unemotional scene were used as stimuli. Participants rated the emotions they experienced and then played a $40 ultimatum game to gauge their generosity. We found that empathy was associated with a 47% increase in oxytocin from baseline. We also found the empathy-oxytocin response was stronger in women than in men. Higher levels of empathy were also associated with more generous monetary offers toward strangers in the ultimatum game. Our findings provide the first evidence that oxytocin is a physiologic signature for empathy and that empathy mediates generosity.

  11. Influence of three-dimensional reconstruction method for building a model of the cervical spine on its biomechanical responses: A finite element analysis study

    Iman Zafarparandeh

    2016-03-01

    Full Text Available In some finite element analysis studies of models of sections of the spine, the three-dimensional solid model is built by assuming symmetry about the mid-sagittal plane of the section, whereas in other studies, the model is built from the exact geometry of the section. The influence of the method used to build the solid model on model parameters, in the case of the cervical spine, has not been reported in the literature. This issue is the subject of this study, with the section being C2–C7, the applied loadings being extension, flexion, left lateral bending, and right axial rotation (each of magnitude 1 Nm, and the model parameters determined being rotation, intradiskal pressure, and facet load at each of the segments. When all the parameter results were considered, it was found that, by and large, the influence of solid model construction method used (exact geometry vs assumption of symmetry about the mid-sagittal plane of the section was marginal. As construction of a symmetric finite element model requires less time and effort, construction of an asymmetric model may be justified in special cases only.

  12. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic Conditions at Different pH and Alkalinity

    Tyler S. Anderson

    2017-07-01

    Full Text Available Biomass and tissue elemental differences were quantified for lettuce grown in deep-water conventional hydroponic conditions at two pH and alkalinity conditions. Nutrient solutions were created using inorganic salts and either reverse osmosis (RO water or municipal water with high alkalinity. Three treatments were evaluated: (a nutrient solution created with reverse osmosis (RO water and maintained at pH 5.8 (H5; (b same as H5 but maintained at pH 7.0 (H7; and (c nutrient solution created using municipal water and maintained at pH 7.0, referred to as HA7. Averaged across three trials, the HA7 and H7 treatments produced 26% less shoot fresh weight (FW than the H5 treatment with an 18% reduction in dry weight (DW. The H5 treatment had the least biomass in root FW and DW. In tissue elemental analyses, both the pH 7.0 treatments showed lower concentrations than H5 in Cu, N, Mo, and Sr, and increased concentrations in Ba, Mg, Na, and Zn. There were no differences in Al, C, Ca, Fe, K, Mn, Ni, P, S, and Si concentrations among treatments (p = 0.05. The results from this experiment can be used to isolate the effects of pH and alkalinity in aquaponic conditions where pH and alkalinity will mimic HA7 conditions.

  13. Potential of Ranunculus acris L. for biomonitoring trace element contamination of riverbank soils: photosystem II activity and phenotypic responses for two soil series.

    Marchand, Lilian; Lamy, Pierre; Bert, Valerie; Quintela-Sabaris, Celestino; Mench, Michel

    2016-02-01

    Foliar ionome, photosystem II activity, and leaf growth parameters of Ranunculus acris L., a potential biomonitor of trace element (TE) contamination and phytoavailability, were assessed using two riverbank soil series. R. acris was cultivated on two potted soil series obtained by mixing a TE (Cd, Cu, Pb, and Zn)-contaminated technosol with either an uncontaminated sandy riverbank soil (A) or a silty clay one slightly contaminated by TE (B). Trace elements concentrations in the soil-pore water and the leaves, leaf dry weight (DW) yield, total leaf area (TLA), specific leaf area (SLA), and photosystem II activity were measured for both soil series after a 50-day growth period. As soil contamination increased, changes in soluble TE concentrations depended on soil texture. Increase in total soil TE did not affect the leaf DW yield, the TLA, the SLA, and the photosystem II activity of R. acris over the 50-day exposure. The foliar ionome did not reflect the total and soluble TE concentrations in both soil series. Foliar ionome of R. acris was only effective to biomonitor total and soluble soil Na concentrations in both soil series and total and soluble soil Mo concentrations in the soil series B.

  14. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  15. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  16. Transboundary geophysical mapping of geological elements and salinity distribution critical for the assessment of future sea water intrusion in response to sea level rise

    F. Jørgensen

    2012-07-01

    Full Text Available Geophysical techniques are increasingly being used as tools for characterising the subsurface, and they are generally required to develop subsurface models that properly delineate the distribution of aquifers and aquitards, salt/freshwater interfaces, and geological structures that affect groundwater flow. In a study area covering 730 km2 across the border between Germany and Denmark, a combination of an airborne electromagnetic survey (performed with the SkyTEM system, a high-resolution seismic survey and borehole logging has been used in an integrated mapping of important geological, physical and chemical features of the subsurface. The spacing between flight lines is 200–250 m which gives a total of about 3200 line km. About 38 km of seismic lines have been collected. Faults bordering a graben structure, buried tunnel valleys, glaciotectonic thrust complexes, marine clay units, and sand aquifers are all examples of geological structures mapped by the geophysical data that control groundwater flow and to some extent hydrochemistry. Additionally, the data provide an excellent picture of the salinity distribution in the area and thus provide important information on the salt/freshwater boundary and the chemical status of groundwater. Although the westernmost part of the study area along the North Sea coast is saturated with saline water and the TEM data therefore are strongly influenced by the increased electrical conductivity there, buried valleys and other geological elements are still revealed. The mapped salinity distribution indicates preferential flow paths through and along specific geological structures within the area. The effects of a future sea level rise on the groundwater system and groundwater chemistry are discussed with special emphasis on the importance of knowing the existence, distribution and geometry of the mapped geological elements, and their control on the groundwater salinity distribution is assessed.

  17. Predicting the flexure response of wood-plastic composites from uni-axial and shear data using a finite-element model

    Scott E. Hamel; John C. Hermanson; Steven M. Cramer

    2014-01-01

    Wood-plastic composites (WPCs), commonly used in residential decks and railings, exhibit mechanical behavior that is bimodal, anisotropic, and nonlinear viscoelastic. They exhibit different stress-strain responses to tension and compression, both of which are nonlinear. Their mechanical properties vary with respect to extrusion direction, their deformation under...

  18. Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components

    Franco-Mariscal, Antonio Joaquín

    2015-01-01

    This paper presents a project about the chemical elements made by 15-year-old Spanish high school students of Chemistry. It focuses on context-based teaching combined with the advantages of creating a large mural which subsequently is exposed in the school. The project consisted of researching the chemical elements in the different materials that…

  19. Nuclear fuel element

    Iwano, Yoshihiko.

    1993-01-01

    Microfine cracks having a depth of less than 10% of a pipe thickness are disposed radially from a central axis each at an interval of less than 100 micron over the entire inner circumferential surface of a zirconium alloy fuel cladding tube. For manufacturing such a nuclear fuel element, the inside of the cladding tube is at first filled with an electrolyte solution of potassium chloride. Then, electrolysis is conducted using the cladding tube as an anode and the electrolyte solution as a cathode, and the inner surface of the cladding tube with a zirconium dioxide layer having a predetermined thickness. Subsequently, the cladding tube is laid on a smooth steel plate and lightly compressed by other smooth steel plate to form microfine cracks in the zirconium dioxide layer on the inner surface of the cladding tube. Such a compressing operation is continuously applied to the cladding tube while rotating the cladding tube. This can inhibit progress of cracks on the inner surface of the cladding tube, thereby enabling to prevent failure of the cladding tube even if a pellet/cladding tube mechanical interaction is applied. Accordingly, reliability of the nuclear fuel elements is improved. (I.N.)

  20. 29 CFR 18.407 - Subsequent remedial measures.

    2010-07-01

    ... OFFICE OF ADMINISTRATIVE LAW JUDGES Rules of Evidence Relevancy and Its Limits § 18.407 Subsequent... event less likely to occur, evidence of the subsequent measures is not admissible to prove negligence or...

  1. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  2. The effect of unsuccessful retrieval on children's subsequent learning.

    Carneiro, Paula; Lapa, Ana; Finn, Bridgid

    2018-02-01

    It is well known that successful retrieval enhances subsequent adults' learning by promoting long-term retention. Recent research has also found benefits from unsuccessful retrieval, but the evidence is not as clear-cut when the participants are children. In this study, we employed a methodology based on guessing-the weak associate paradigm-to test whether children can learn from generated errors or whether errors are harmful for learning. We tested second- and third-grade children in Experiment 1 and tested preschool and kindergarten children in Experiment 2. With slight differences in the method, in both experiments children heard the experimenter saying one word (cue) and were asked to guess an associate word (guess condition) or to listen to the correspondent target-associated word (study condition), followed by corrective feedback in both conditions. At the end of the guessing phase, the children undertook a cued-recall task in which they were presented with each cue and were asked to say the corrected target. Together, the results showed that older children-those in kindergarten and early elementary school-benefited from unsuccessful retrieval. Older children showed more correct responses and fewer errors in the guess condition. In contrast, preschoolers produced similar levels of correct and error responses in the two conditions. In conclusion, generating errors seems to be beneficial for future learning of children older than 5years. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Comparison of lime and fly ash as amendments to acidic coal mine refusej growth responses and trace-element uptake of two grasses

    Jasrow, J. D.; Zimmerman, C. A.; Dvorak, A. J.; Hinchman, R. R.

    1979-10-01

    Two commonly used revegetation species, Kentucky 31 tall fescue (Festuca arundinacea Schreb.) and Lincoln smooth brome (Bromus inermis Leyss.) were grown for 60 days in pots containing coarse coal mine refuse (referred to as gob, pH = 3.5) that was amended with lime or alkaline fly ash. Both species were also grown in pots containing a silt-loam surface soil as a control. Morphological growth parameters were measured over time; dry weights and shoot:root ratios were determined at harvest. Concentrations of Al, As, Cd, Co, Cr, Cu, Fe, Hg, Mn, Ni, Pb, Se, V, and Zn in the plant shoots were determined by atomic absorption spectrophotometry. Plant growth of both species was not as good on either lime- or fly ash-amended gob as it was on surface soil. Although plant height and length of the longest lead were not significantly different (p > 0.10) at the end of the experiment for plants grown on the two amended-gob substrates, parameters giving an indication of plant vigor (i.e., number of leaves and stems, width of the longest lead, and biomass) were significantly greater (p < 0.01) for plants grown on lime-amended gob than for those grown on fly ash-amended gob. Significant (p < 0.05) differences in the tissue concentrations of Cd, Co, Fe, Hg, Mn, Pb, V, and Zn were found among the plants grown on the three substrates. Except for Hg and Pb, these elements were higher in plants grown on at least one of the amended-gob substrates than in plants grown on surface soil. Significant substrate differences were not observed for Al, As, Cr, Cu, Ni, and Se. The tissue concentrations of some elements - notably Al, Cu, Fe, Mn, V, and Zn - were high enough in plants from one or more of the substrates to either approach or exceed concentrations that have been reported to be associated with toxic effects in some plant species.

  4. Changes in nutrient stoichiometry, elemental homeostasis and growth rate of aquatic litter-associated fungi in response to inorganic nutrient supply.

    Gulis, Vladislav; Kuehn, Kevin A; Schoettle, Louie N; Leach, Desiree; Benstead, Jonathan P; Rosemond, Amy D

    2017-12-01

    Aquatic fungi mediate important energy and nutrient transfers in freshwater ecosystems, a role potentially altered by widespread eutrophication. We studied the effects of dissolved nitrogen (N) and phosphorus (P) concentrations and ratios on fungal stoichiometry, elemental homeostasis, nutrient uptake and growth rate in two experiments that used (1) liquid media and a relatively recalcitrant carbon (C) source and (2) fungi grown on leaf litter in microcosms. Two monospecific fungal cultures and a multi-species assemblage were assessed in each experiment. Combining a radioactive tracer to estimate fungal production (C accrual) with N and P uptake measurements provided an ecologically relevant estimate of mean fungal C:N:P of 107:9:1 in litter-associated fungi, similar to the 92:9:1 obtained from liquid cultures. Aquatic fungi were found to be relatively homeostatic with respect to their C:N ratio (~11:1), but non-homeostatic with respect to C:P and N:P. Dissolved N greatly affected fungal growth rate and production, with little effect on C:nutrient stoichiometry. Conversely, dissolved P did not affect fungal growth and production but controlled biomass C:P and N:P, probably via luxury P uptake and storage. The ability of fungi to immobilize and store excess P may alter nutrient flow through aquatic food webs and affect ecosystem functioning.

  5. System response of a DOE Defense Program package in a transportation accident environment

    Chen, T.F.; Hovingh, J.; Kimura, C.Y.

    1992-01-01

    The system response in a transportation accident environment is an element to be considered in an overall Transportation System Risk Assessment (TSRA) framework. The system response analysis uses the accident conditions and the subsequent accident progression analysis to develop the accident source term, which in turn, is used in the consequence analysis. This paper proposes a methodology for the preparation of the system response aspect of the TSRA

  6. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J

    2016-03-01

    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  7. Melatonin Secretion during a Short Nap Fosters Subsequent Feedback Learning

    Christian D. Wiesner

    2018-01-01

    Full Text Available Sleep helps to protect and renew hippocampus-dependent declarative learning. Less is known about forms of learning that mainly engage the dopaminergic reward system. Animal studies showed that exogenous melatonin modulates the responses of the dopaminergic reward system and acts as a neuroprotectant promoting memory. In humans, melatonin is mainly secreted in darkness during evening hours supporting sleep. In this study, we investigate the effects of a short period of daytime sleep (nap