WorldWideScience

Sample records for response elements levels

  1. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  2. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  3. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    International Nuclear Information System (INIS)

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  4. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  5. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  6. Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

    Science.gov (United States)

    Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

    2008-05-02

    Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

  7. Trace elements levels in centenarian 'dodgers'.

    Science.gov (United States)

    Alis, Rafael; Santos-Lozano, Alejandro; Sanchis-Gomar, Fabian; Pareja-Galeano, Helios; Fiuza-Luces, Carmen; Garatachea, Nuria; Lucia, Alejandro; Emanuele, Enzo

    2016-05-01

    Trace element bioavailability can play a role in several metabolic and physiological pathways known to be altered during the aging process. We aimed to explore the association of trace elements with increased lifespan by analyzing the circulating levels of seven trace elements (Cr, Cu, Fe, Mn, Mo, Se and Zn) in a cohort of healthy centenarians or 'dodgers' (≥100 years, free of major age-related diseases) in comparison with sex-matched younger elderly controls. Centenarians showed significant lower Cu (783.7 (76.7, 1608.9) vs 962.5 (676.3, 2064.4)μg/mL, Pdodgers', and, therefore, at least partly, be involved in the healthy aging phenotype shown by these subjects. These results should be confirmed in larger cohorts of other geographic/ethnic origin and the potential cause-effect association tested in mechanistic experimental settings. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  9. Transboundary geophysical mapping of geological elements and salinity distribution critical for the assessment of future sea water intrusion in response to sea level rise

    Directory of Open Access Journals (Sweden)

    F. Jørgensen

    2012-07-01

    Full Text Available Geophysical techniques are increasingly being used as tools for characterising the subsurface, and they are generally required to develop subsurface models that properly delineate the distribution of aquifers and aquitards, salt/freshwater interfaces, and geological structures that affect groundwater flow. In a study area covering 730 km2 across the border between Germany and Denmark, a combination of an airborne electromagnetic survey (performed with the SkyTEM system, a high-resolution seismic survey and borehole logging has been used in an integrated mapping of important geological, physical and chemical features of the subsurface. The spacing between flight lines is 200–250 m which gives a total of about 3200 line km. About 38 km of seismic lines have been collected. Faults bordering a graben structure, buried tunnel valleys, glaciotectonic thrust complexes, marine clay units, and sand aquifers are all examples of geological structures mapped by the geophysical data that control groundwater flow and to some extent hydrochemistry. Additionally, the data provide an excellent picture of the salinity distribution in the area and thus provide important information on the salt/freshwater boundary and the chemical status of groundwater. Although the westernmost part of the study area along the North Sea coast is saturated with saline water and the TEM data therefore are strongly influenced by the increased electrical conductivity there, buried valleys and other geological elements are still revealed. The mapped salinity distribution indicates preferential flow paths through and along specific geological structures within the area. The effects of a future sea level rise on the groundwater system and groundwater chemistry are discussed with special emphasis on the importance of knowing the existence, distribution and geometry of the mapped geological elements, and their control on the groundwater salinity distribution is assessed.

  10. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  11. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Science.gov (United States)

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  12. Characterization of transuranic elements at environmental levels

    International Nuclear Information System (INIS)

    Edgington, D.N.

    1981-01-01

    This paper summarizes current understanding of transuranic speciation in natural waters. Several predictive models describing the behaviour of these elements in both marine and fresh-water systems illustrate the importance of this information. (author)

  13. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  14. Transboundary geophysical mapping of geological elements and salinity distribution critical for the assessment of future sea water intrusion in response to sea level rise

    DEFF Research Database (Denmark)

    Joergensen, F.; Scheer, W.; Thomsen, S.

    2012-01-01

    Geophysical techniques are increasingly being used as tools for characterising the subsurface, and they are generally required to develop subsurface models that properly delineate the distribution of aquifers and aquitards, salt/freshwater interfaces, and geological structures that affect......, and sand aquifers are all examples of geological structures mapped by the geophysical data that control groundwater flow and to some extent hydrochemistry. Additionally, the data provide an excellent picture of the salinity distribution in the area and thus provide important information on the salt...... revealed. The mapped salinity distribution indicates preferential flow paths through and along specific geological structures within the area. The effects of a future sea level rise on the groundwater system and groundwater chemistry are discussed with special emphasis on the importance of knowing...

  15. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  16. Trace elements levels in centenarian ‘dodgers’

    OpenAIRE

    Alis, Rafael; Santos-Lozano, Alejandro; Sanchís-Gomar, Fabián; Pareja Galeano, Helios; Fiuza Luces, María del Carmen; Garatachea, Nuria; Lucía Mulas, Alejandro; Emanuele, Enzo

    2016-01-01

    Trace element bioavailability can play a role in several metabolic and physiological pathways known to be altered during the aging process. We aimed to explore the association of trace elements with increased lifespan by analyzing the circulating levels of seven trace elements (Cr, Cu, Fe, Mn, Mo, Se and Zn) in a cohort of healthy centenarians or ‘dodgers’ (≥100 years, free of major age-related diseases) in comparison with sex-matched younger elderly controls. Centenarians showed significant ...

  17. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  18. Redox balance and blood elemental levels in atherosclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Napoleao, P. [Centro de Biologia Ambiental and Departamento de Biologia Animal, Faculdade de Ciencias de Lisboa, C2, Campo Grande, 1749-016 Lisbon (Portugal) and Laboratorio de Feixes de Ioes, Instituto Tecnologico e Nuclear, E.N. no 10, 2685-953 Sacavem (Portugal)]. E-mail: pnapoleao@itn.pt; Lopes, P.A. [Centro de Biologia Ambiental and Departamento de Biologia Animal, Faculdade de Ciencias de Lisboa, C2, Campo Grande, 1749-016 Lisbon (Portugal); Santos, M. [Centro de Quimica e Bioquimica and Departamento de Quimica e Bioquimica, Faculdade de Ciencias de Lisboa, 1749-016 Lisbon (Portugal); Steghens, J.-P. [Federation de Biochimie, Hopital Edouard Herriot, 3 Place d' Arsonval, 69437 03 Lyon (France); Viegas-Crespo, A.M. [Centro de Biologia Ambiental and Departamento de Biologia Animal, Faculdade de Ciencias de Lisboa, C2, Campo Grande, 1749-016 Lisbon (Portugal); Pinheiro, T. [Laboratorio de Feixes de Ioes, Instituto Tecnologico e Nuclear, E.N. no 10, 2685-953 Sacavem (Portugal); Centro de Fisica Nuclear, Universidade de Lisboa, Av. Prof. Egas Moniz, 1700 Lisbon (Portugal)

    2006-08-15

    Oxidation of lipids and proteins represents a causative event for atherogenesis, which can be opposed by antioxidant activity. Elements, such as, Fe, Cu, Zn and Se can be involved in both mechanisms. Thus, evaluation of blood elemental levels, easily detected by PIXE, and of redox parameters may be useful in assessing the risk of atherosclerosis. A group of stable patients suffering from atherosclerosis, was matched with a cohort of normo-tensive and -lipidemic volunteers. Although no major discrepancies were observed for trace elemental levels in blood, increased concentrations of K and Ca were found in atherosclerotic group. Patients presented enhance levels of antioxidant ({alpha}-tocopherol) and decreased of protein oxidation (protein carbonyls), while for the lipid oxidation marker (malondialdehyde) no variation was observed. This study contributes to a better understanding of atherosclerosis development and its relationship with blood elemental levels, and set basis for further clinical trials with pathological groups in acute phase.

  19. Trace and ultratrace level elemental and speciation analysis

    International Nuclear Information System (INIS)

    Arunachalam, J.

    2012-01-01

    Accurate determination of elements present at parts per million and billion levels in various matrices is a growing requirement in different fields. In environmental sciences various trace elements need to be analyzed so as establish the dispersal models of pollutants or the adequacy of effluent treatment prior to discharge into water bodies. The issues of bioaccumulation and magnification are important in aquatic systems. In nutrition and biochemistry one has to establish the bio-availability of essential and toxic elemental species as toxic elements prevent assimilation of essential elements. Fission and fusion technologies use a variety of structural materials requiring many trace elements to be present at levels strictly below the specified levels. Ultra-pure bulk semiconductor materials are required for fabrication devices. In metallurgy and materials sciences too, various trace elements are known to influence the properties. In the emerging fields like nanotechnology, it is necessary to understand the passage and accumulation of nano-particles inside the cells, through trace analysis. Many analytical techniques exist which can provide the concentration information in the bulk materials with good accuracy. They include ICP-AES, FAAS, and ICP-MS, which are solution based techniques. Direct solid state analytical techniques are Glow Discharge Mass Spectrometry (GDMS) and XRF. Accelerator based ion-beam analysis techniques can provide information on concentration and depth profiles of different elements in layered structures. Hyphenated techniques such as HPLC/lC-ICPMS, are helpful in identifying various chemical oxidation states in which a given element might be present in a matrix, which is termed as speciation analysis. This presentation will include the existing analytical competencies and the laboratory requirements for trace and ultra trace element elemental and speciation analyses and their applications. (author)

  20. Glutathione level after long-term occupational elemental mercury exposure

    International Nuclear Information System (INIS)

    Kobal, Alfred Bogomir; Prezelj, Marija; Horvat, Milena; Krsnik, Mladen; Gibicar, Darija; Osredkar, Josko

    2008-01-01

    Many in vitro and in vivo studies have elucidated the interaction of inorganic mercury (Hg) and glutathione. However, human studies are limited. In this study, we investigated the potential effects of remote long-term intermittent occupational elemental Hg vapour (Hg o ) exposure on erythrocyte glutathione levels and some antioxidative enzyme activities in ex-mercury miners in the period after exposure. The study included 49 ex-mercury miners divided into subgroups of 28 still active, Hg o -not-exposed miners and 21 elderly retired miners, and 41 controls, age-matched to the miners subgroup. The control workers were taken from 'mercury-free works'. Reduced glutathione (GSH) and oxidized disulphide glutathione (GSSG) concentrations in haemolysed erythrocytes were determined by capillary electrophoresis, while total glutathione (total GSH) and the GSH/GSSG ratio were calculated from the determined values. Catalase (CAT), glutathione peroxidase (GPx), and glutathione reductase (GR) activities in erythrocytes were measured using commercially available reagent kits, while urine Hg (U-Hg) concentrations were determined by cold vapour atomic absorption (CVAAS). No correlation of present U-Hg levels, GSH, GSSG, and antioxidative enzymes with remote occupational biological exposure indices were found. The mean CAT activity in miners and retired miners was significantly higher (p o could be an inductive and additive response to maintain the balance between GSH and antioxidative enzymes in interaction with the Hg body burden accumulated during remote occupational exposure, which does not represent a severely increased oxidative stress

  1. Comparison of trace element contamination levels (Cu, Zn, Fe, Cd ...

    African Journals Online (AJOL)

    Comparison of trace element contamination levels (Cu, Zn, Fe, Cd and Pb) in the soft tissues of the gastropods Tympanotonus fuscatus fuscatus and Tf radula collected in the Ebrié Lagoon (Côte d'Ivoire): Evidence of the risks linked to linked to lead and.

  2. Levels of trace elements in MWSS drinking water

    International Nuclear Information System (INIS)

    Andal, T.T.

    1998-01-01

    As a water supplier for the metropolis, vigilance over the water quality has not been taken for granted at the Metropolitan Waterworks and Sewerage System (MWSS). By the early 1980's, a control laboratory equipped with modern facilities had been set up to supplement the already existing control laboratory at Filter Plant II handling physical, chemical, bacteriological, biological and mineral analyses and examinations, efficiently. The new central laboratory is intended to monitor trace elements, organic constituents and other elements with health related impact so as to assure the consumers of a safe drinking water supply at all times. This presentation reviews the levels of trace element pollution in MWSS tap water, then and now, in justification of the rehabilitation projects along the distribution network, in the treatment plants and other pertinent innovations corresponding to budgeted capital outlays as invested by the system. (author)

  3. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  4. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  5. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  6. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  7. Levels of macroelements and toxic elements in herbal teas

    Directory of Open Access Journals (Sweden)

    Mihaljev Željko A.

    2015-01-01

    Full Text Available A total of 14 diverse herbal teas were examined, including: yarrow, basil, St.John’s wort, peppermint, horsetail, nettle, thyme, corn silk, hibiscus, marshmallow, chamomile, rosehip, heather and wild mint. The samples were prepared using the method of microwave digestion, and measurements were performed by the use of inductively coupled plasma mass spectrometry (Cd, Hg, Pb, As, Sb; atomic absorption spectrometry (Mg; emission flame photometry (Ca, K, Na and spectrophotometry (P. Intervals of variation (mg/kg for macroelements were: Ca (2738-35399; P (1545-6264; Mg (1647-7816; Na (293-10629 and K (9683-33985, and for toxic elements: Cd (0.014-0.645; Hg (<0.001- 0.017; Pb (0.064-1.340; As (0.030-0.544 and Sb (0.004-0.068. In the three samples (yarrow and two St.John’s wort samples measured cadmium concentration was higher than the maximum level for dried herbs, recommended by WHO. Ward's hierarchical clustering method was performed with the aim of grouping herbal teas by the amount of toxic elements. [Projekat Ministarstva nauke Republike Srbije, br. TR31071

  8. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  9. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  10. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  11. Regulatable elements in the high-level waste management program

    International Nuclear Information System (INIS)

    Oakley, D.

    1979-01-01

    Regulatable elements of a deep geological nuclear waste isolation system are those characteristics of a candidate system which need to be specified to achieve control of its performance. This report identifies the regulatable elements with respect to waste form, repository design, site suitability, and the modeling and decision analysis processes. Regulatable elements in each section are listed and described briefly as they affect the short-term and long-term performance of a deep geological repository

  12. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  13. Comparison of trace element contamination levels (Cu, Zn, Fe, Cd ...

    African Journals Online (AJOL)

    SERVER

    2008-03-18

    Mar 18, 2008 ... Chemical analysis of the trace elements in the soft tissues. The trace elements of interest (Cu, Zn, Fe, Pb, Cd) were then determined in the digested solutions, using Thermoelemental type. M6 brand of an atomic absorption Spectrometer equipped with a flame operated atomisation system and a deuterium ...

  14. Levels of Major and Minor Elements in Some Commercial Fruit ...

    African Journals Online (AJOL)

    Purpose: To evaluate the macro- and micro-nutrient elements of some commercially available fruit juices in Serbia. Methods: Inductively coupled plasma optical emission spectrometry (ICP-OES) technique was employed for determination of the major and minor elements in samples of two different types of fruit juices - clear ...

  15. Adaptive response after low level irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Pelevina, I I; Afanasjev, G G; JaGotlib, V; Tereschenko, D G; Tronov, V A; Serebrjany, A M [Russian Academy of Sciences, Moscow (Russian Federation). Institute of Chemical Physics

    1996-02-01

    The experiments conducted on cultured HeLa (tissue culture) cells revealed that there is a limit of dose above which adaptive response was not observed and a limit of dose below which this response was not induced. The exposure of cells in the territories with elevated radiation background leads to genome instability which results in enhanced radiosensitivity. Investigations on the blood lymphocytes of people living in contaminated regions revealed that adaptive response was more significant in children whereas in adults there was slight increase. Acute irradiation serves as a tool revealing the changes that took place in DNA during chronic low level irradiations after Chernobyl disaster. (author).

  16. Multi-level damage identification with response reconstruction

    Science.gov (United States)

    Zhang, Chao-Dong; Xu, You-Lin

    2017-10-01

    Damage identification through finite element (FE) model updating usually forms an inverse problem. Solving the inverse identification problem for complex civil structures is very challenging since the dimension of potential damage parameters in a complex civil structure is often very large. Aside from enormous computation efforts needed in iterative updating, the ill-condition and non-global identifiability features of the inverse problem probably hinder the realization of model updating based damage identification for large civil structures. Following a divide-and-conquer strategy, a multi-level damage identification method is proposed in this paper. The entire structure is decomposed into several manageable substructures and each substructure is further condensed as a macro element using the component mode synthesis (CMS) technique. The damage identification is performed at two levels: the first is at macro element level to locate the potentially damaged region and the second is over the suspicious substructures to further locate as well as quantify the damage severity. In each level's identification, the damage searching space over which model updating is performed is notably narrowed down, not only reducing the computation amount but also increasing the damage identifiability. Besides, the Kalman filter-based response reconstruction is performed at the second level to reconstruct the response of the suspicious substructure for exact damage quantification. Numerical studies and laboratory tests are both conducted on a simply supported overhanging steel beam for conceptual verification. The results demonstrate that the proposed multi-level damage identification via response reconstruction does improve the identification accuracy of damage localization and quantization considerably.

  17. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  19. Levels of essential and non-essential elements in commercially ...

    African Journals Online (AJOL)

    The focus of this study was to assess the quality of commercially packaged moringa tea brands available in the retail markets in Nigerian cities on the basis of the essential and nonessential elemental content in their tissues. Four different brands of moringa tea comprising two locally processed teas and two imported teas ...

  20. DETERMINATION OF MULTI ELEMENT LEVELS IN LEAVES AND ...

    African Journals Online (AJOL)

    Preferred Customer

    ICP-OES (Spectro Analytical Instruments, Kleve, Germany) was used for the determination of elements. ... Samples. In this study, 18 different herbal tea samples (leaves and flowers) that are traditionally used for medical ... analysis of CRM were all within the 95% reliability limit. The results ..... reasons for serious health risks.

  1. Levels of Major and Minor Elements in Some Commercial Fruit ...

    African Journals Online (AJOL)

    1Faculty of Medicine, Department of Pharmacy, 2Faculty of Sciences and Mathematics, ... Purpose: To evaluate the macro- and micro-nutrient elements of some commercially available fruit juices in ... national regulations. ... the consumption of natural products, such as fruit ... analytical techniques, each with its advantages.

  2. Do points, levels and leaderboards harm intrinsic motivation? An empirical analysis of common gamification elements

    DEFF Research Database (Denmark)

    Mekler, Elisa D.; Brühlmann, Florian; Opwis, Klaus

    2013-01-01

    It is heavily debated within the gamification community whether specific game elements may actually undermine users' intrinsic motivation. This online experiment examined the effects of three commonly employed game design elements - points, leaderboard, levels - on users' performance, intrinsic...

  3. Reward or its denial during the neonatal period affects adult spatial memory and hippocampal phosphorylated cAMP response element-binding protein levels of both the neonatal and adult rat.

    Science.gov (United States)

    Diamantopoulou, A; Stamatakis, A; Panagiotaropoulos, T; Stylianopoulou, F

    2011-05-05

    Early life experiences, particularly mother-infant interactions, have been shown to influence adult coping and learning abilities via gene-environment interactions. We have developed a paradigm, in which mother contact is used as either a positive or a negative reinforcer in a T-maze, during postnatal days 10-13. In both neonates receiving (RER) or denied (DER) the expected reward, exposure to the memory test in the absence of the mother resulted in a remarkable increase in the number of pCREB immunopositive cells, when compared to their corresponding levels 2 h after the completion of the training process, but also to the levels of naïve animals. In the CA3 area, the pattern of pCREB immunoreactivity, when evaluated 2 h after the completion of the training on postnatal day 13 seemed to distinguish between the two different neonatal experiences in the T-maze, with the DER pups showing higher levels of pCREB immunopositive cells than the RER. Exposure to the Morris Water Maze (MWM) during adulthood revealed a memory advantage of the DER animals compared to the RER and the animals not exposed to the neonatal experience. Relevantly, in the DER animals an increased number of pCREB immunopositive cells was observed in the CA3 area even 24 h after the end of MWM training. When also measured after exposure to the probe trial, the number of pCREB immunopositive cells was again higher in the DER compared to the RER animals. In conclusion, we show that a learning experience involving discrepancy during the particularly plastic neonatal period is able to induce long-term effects, which result in enhanced adult hippocampal dependent spatial memory. Furthermore, our data document a role of plasticity molecules like pCREB in mediating hippocampal dependent learning and detection of novelty not only in adulthood, but also more importantly in the neonatal period of the rat. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  4. Levels of major and trace elements, including rare earth elements, and ²³⁸U in Croatian tap waters.

    Science.gov (United States)

    Fiket, Željka; Rožmarić, Martina; Krmpotić, Matea; Benedik, Ljudmila

    2015-05-01

    Concentrations of 46 elements, including major, trace, and rare earth elements, and (238)U in Croatian tap waters were investigated. Selected sampling locations include tap waters from various hydrogeological regions, i.e., different types of aquifers, providing insight into the range of concentrations of studied elements and (238)U activity concentrations in Croatian tap waters. Obtained concentrations were compared with the Croatian maximum contaminant levels for trace elements in water intended for human consumption, as well as WHO and EPA drinking water standards. Concentrations in all analyzed tap waters were found in accordance with Croatian regulations, except tap water from Šibenik in which manganese in concentration above maximum permissible concentration (MPC) was measured. Furthermore, in tap water from Osijek, levels of arsenic exceeded the WHO guidelines and EPA regulations. In general, investigated tap waters were found to vary considerably in concentrations of studied elements, including (238)U activity concentrations. Causes of variability were further explored using statistical methods. Composition of studied tap waters was found to be predominately influenced by hydrogeological characteristics of the aquifer, at regional and local level, the existing redox conditions, and the household plumbing system. Rare earth element data, including abundances and fractionation patterns, complemented the characterization and facilitated the interpretation of factors affecting the composition of the analyzed tap waters.

  5. Serum Levels of Selected Vitamins and Trace Elements in Nigerian ...

    African Journals Online (AJOL)

    olayemitoyin

    In addition to direct effects of alcohol on immune responses ... U/L. Cigarette smokers or those with high parasite densities ... Independent Student's t-test was used to compare the .... carotene, vitamins C and E, zinc and selenium are.

  6. Comparative study of trace element levels in some local vegetable ...

    African Journals Online (AJOL)

    The level of heavy metals in two varieties of vegetables harvested during the dry and wet seasons from seven different locations in Ilorin, Nigeria, were determined. The correlation between the level of metals in the vegetables and the irrigation water was also studied. Vegetables harvested during the dry season were found ...

  7. Serum levels of selected vitamins and trace elements in Nigerian ...

    African Journals Online (AJOL)

    Folic acid, vitamins and Zinc play essential role in DNA methylation but alcohol consumption is known to affect the levels of these micronutrients leading to risk of developing various illnesses and certain cancers. This study determined the levels of DNA methylation dependent-micronutrients (folate, vitamin B12, vitamin B6, ...

  8. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  9. Isolation of transplutonium elements from high-level radioactive wastes using diphenyl(dibutylcarbamoylmethyl)phosphine oxide

    International Nuclear Information System (INIS)

    Chmutova, M.K.; Litvina, M.N.; Pribylova, G.A.; Ivanova, L.A.; Myasoedov, B.F.; Smirnov, I.V.; Shadrin, A.Yu.

    1999-01-01

    Consequent stages of development of principal technological scheme of extraction separation of transplutonium elements from high-level radioactive wastes of spent fuel reprocessing are presented. Approach to reagent selection from the series of carbamoylmethylphosphine oxides is based. Distribution of transplutonium elements and accompanying elements between model solution of high-level radioactive wastes and solution of reagent in organic solvent is investigated. Methods of separation of transplutonium elements, reextraction of transplutonium elements together with rare earth elements are developed. Principal technological scheme of transplutonium elements separation from nonevaporated raffinates of spent fuel of WWER type reactors and method of separation of transplutonium and rare earth elements in weakly acid reextract with the use of liquid chromatography with free immobile phase are proposed [ru

  10. Escitalopram plasma levels and antidepressant response.

    Science.gov (United States)

    Florio, Vincenzo; Porcelli, Stefano; Saria, Alois; Serretti, Alessandro; Conca, Andreas

    2017-09-01

    Major Depression Disorder (MDD) has a highly variable treatment response due to the large inter-individual variation in the pharmacokinetics and pharmacodynamics of drug treatments. In detail the correlation between plasma level and efficacy has been much debated. Among first-line drugs for MDD, one of the most used is escitalopram. In the present study we investigated the association between serum concentration of escitalopram (SCE) and antidepressant response (AR). 70 MDD patients treated with escitalopram monotherapy were recruited and followed for three months. Hamilton Depression Rating Scale - 21 (HAMD-21) was administrated at baseline, month 1, and month 3 to assess AR. SCE was measured at steady state. Linear regression analysis and nonlinear least-squares regression were used to estimate association between SCE and AR. We found an association between SCE and AR both at month 1 (pescitalopram the association between SCE and AR likely follows a nearly-asymptotic function, with poor AR at sub-therapeutic SCE and stable AR response at therapeutic SCE. Thus, when a patient reaches the therapeutic SCE range, further increase of escitalopram dosage seems to be useless, although further studies are needed to confirm our findings. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

  11. Levels of trace elements in medicinal plants with anti-diabetic potential

    International Nuclear Information System (INIS)

    Ray, D.K.; Jena, S.

    2014-01-01

    Medicinal plants with anti-diabetic potential have been characterized by Particle-Induced X-ray Emission (PIXE) technique. Trace elements such as Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Rb, Sr and Pb are found to be present in these studied medicinal plant samples. The concentrations of elements like K and Ca are quantified in percentage level whereas other elements are found to be in parts per million levels. Elemental analysis of ten different medicinal plant samples commonly used for management and cure of diabetes, shows variation in concentrations. These elements either directly or indirectly may play some role to control diabetes. (author)

  12. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  13. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  14. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  15. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  16. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  17. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  18. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  19. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  20. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  1. Sulfate-driven elemental sparing is regulated at the transcriptional and posttranscriptional levels in a filamentous cyanobacterium.

    Science.gov (United States)

    Gutu, Andrian; Alvey, Richard M; Bashour, Sami; Zingg, Daniel; Kehoe, David M

    2011-03-01

    Sulfur is an essential nutrient that can exist at growth-limiting concentrations in freshwater environments. The freshwater cyanobacterium Fremyella diplosiphon (also known as Tolypothrix sp. PCC 7601) is capable of remodeling the composition of its light-harvesting antennae, or phycobilisomes, in response to changes in the sulfur levels in its environment. Depletion of sulfur causes these cells to cease the accumulation of two forms of a major phycobilisome protein called phycocyanin and initiate the production of a third form of phycocyanin, which possesses a minimal number of sulfur-containing amino acids. Since phycobilisomes make up approximately 50% of the total protein in these cells, this elemental sparing response has the potential to significantly influence the fitness of this species under low-sulfur conditions. This response is specific for sulfate and occurs over the physiological range of sulfate concentrations likely to be encountered by this organism in its natural environment. F. diplosiphon has two separate sulfur deprivation responses, with low sulfate levels activating the phycobilisome remodeling response and low sulfur levels activating the chlorosis or bleaching response. The phycobilisome remodeling response results from changes in RNA abundance that are regulated at both the transcriptional and posttranscriptional levels. The potential of this response, and the more general bleaching response of cyanobacteria, to provide sulfur-containing amino acids during periods of sulfur deprivation is examined.

  2. Sulfate-Driven Elemental Sparing Is Regulated at the Transcriptional and Posttranscriptional Levels in a Filamentous Cyanobacterium▿ †

    Science.gov (United States)

    Gutu, Andrian; Alvey, Richard M.; Bashour, Sami; Zingg, Daniel; Kehoe, David M.

    2011-01-01

    Sulfur is an essential nutrient that can exist at growth-limiting concentrations in freshwater environments. The freshwater cyanobacterium Fremyella diplosiphon (also known as Tolypothrix sp. PCC 7601) is capable of remodeling the composition of its light-harvesting antennae, or phycobilisomes, in response to changes in the sulfur levels in its environment. Depletion of sulfur causes these cells to cease the accumulation of two forms of a major phycobilisome protein called phycocyanin and initiate the production of a third form of phycocyanin, which possesses a minimal number of sulfur-containing amino acids. Since phycobilisomes make up approximately 50% of the total protein in these cells, this elemental sparing response has the potential to significantly influence the fitness of this species under low-sulfur conditions. This response is specific for sulfate and occurs over the physiological range of sulfate concentrations likely to be encountered by this organism in its natural environment. F. diplosiphon has two separate sulfur deprivation responses, with low sulfate levels activating the phycobilisome remodeling response and low sulfur levels activating the chlorosis or bleaching response. The phycobilisome remodeling response results from changes in RNA abundance that are regulated at both the transcriptional and posttranscriptional levels. The potential of this response, and the more general bleaching response of cyanobacteria, to provide sulfur-containing amino acids during periods of sulfur deprivation is examined. PMID:21239582

  3. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  4. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  6. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  7. A Global Overview of Exposure Levels and Biological Effects of Trace Elements in Penguins.

    Science.gov (United States)

    Espejo, Winfred; Celis, José E; GonzÃlez-Acuña, Daniel; Banegas, Andiranel; Barra, Ricardo; Chiang, Gustavo

    2018-01-01

    Trace elements are chemical contaminants that can be present almost anywhere on the planet. The study of trace elements in biotic matrices is a topic of great relevance for the implications that it can have on wildlife and human health. Penguins are very useful, since they live exclusively in the Southern Hemisphere and represent about 90% of the biomass of birds of the Southern Ocean. The levels of trace elements (dry weight) in different biotic matrices of penguins were reviewed here. Maps of trace element records in penguins were included. Data on exposure and effects of trace elements in penguins were collected from the literature. The most reported trace elements in penguins are aluminum, arsenic, cadmium, lead, mercury, copper, zinc, and manganese. Trace elements have been measured in 11 of the 18 species of penguins. The most studied biotic matrices are feathers and excreta. Most of the studies have been performed in Antarctica and subantarctic Islands. Little is known about the interaction among metals, which could provide better knowledge about certain mechanisms of detoxification in penguins. Future studies of trace elements in penguins must incorporate other metals such as vanadium, cobalt, nickel, and chromium. Data of metals in the species such as Eudyptes pachyrhynchus, Eudyptes moseleyi, Eudyptes sclateri, Eudyptes robustus, Eudyptes schlegeli, Spheniscus demersus, Spheniscus mendiculus, and Megadyptes antipodes are urged. It is important to correlate levels of metals in different biotic matrices with the effects on different species and in different geographic locations.

  8. Item response theory at subject- and group-level

    NARCIS (Netherlands)

    Tobi, Hilde

    1990-01-01

    This paper reviews the literature about item response models for the subject level and aggregated level (group level). Group-level item response models (IRMs) are used in the United States in large-scale assessment programs such as the National Assessment of Educational Progress and the California

  9. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  10. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  11. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  12. Training elements at different levels in the strategies for control of schistosomiasis

    DEFF Research Database (Denmark)

    Ørnbjerg, Niels; Simonsen, P. E.; Furu, Peter

    1989-01-01

    Recently acquired comprehensive knowledge concerning the epidemiology of schistosomiasis has provided the background for the establishment of schistosomiasis control strategies. However, the planning, implementation, and maintenance of such control programmes requires sufficient numbers of well t...... trained personnel at the local, district and central levels. Training of health personnel as well as motivation of the community are fundamental and essential elements in any schistosomiasis control programme. The training elements and approaches are discussed....

  13. Levels of Essential Elements in Different Medicinal Plants Determined by Using Inductively Coupled Plasma Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Eid I. Brima

    2018-01-01

    Full Text Available The objective of this study was to investigate the content of essential elements in medicinal plants in the Kingdom of Saudi Arabia (KSA. Five different medical plants (mahareeb (Cymbopogon schoenanthus, sheeh (Artemisia vulgaris, harjal (Cynanchum argel delile, nabipoot (Equisetum arvense, and cafmariam (Vitex agnus-castus were collected from Madina city in the KSA. Five elements Fe, Mn, Zn, Cu, and Se were determined by using inductively coupled plasma mass spectrometry (ICP-MS. Fe levels were the highest and Se levels were the lowest in all plants. The range levels of all elements in all plants were as follows: Fe 193.4–1757.9, Mn 23.6–143.7, Zn 15.4–32.7, Se 0.13–0.92, and Cu 11.3–21.8 µg/g. Intakes of essential elements from the medical plants in infusion were calculated: Fe 4.6–13.4, Mn 6.7–123.2, Zn 7.0–42.7, Se 0.14–1.5, and Cu 1.5–5.0 µg/dose. The calculated intakes of essential elements for all plants did not exceed the daily intake set by the World Health Organization (WHO and European Food Safety Authority (EFSA. These medicinal plants may be useful sources of essential elements, which are vital for health.

  14. The Determination Of Trace Element Levels In Diet By Neutron Activation Analysis

    International Nuclear Information System (INIS)

    Kukuh, Ratnawati; Djojosubroto, Harjoto

    2002-01-01

    Trace element levels in foodstuff are normally low. Although the levels are low, certain trace elements which are called essential trace elements have an important role in metabolism process. Deficiency or intoxication of essential trace elements may lead to abnormal health. In this study the levels of Zn, Fe, AI, Mn, and Co in diet samples were determined by neutron activation analysis, and then the daily intakes of these elements were estimated. The samples were prepared by duplicate diet method, representing those that were consumed by population from West, Central and East Java. Following the collection the respective samples were blended, then were freeze dried at-54 o c. The elemental quantification were performed by neutron activation analysis. The traceability of the determination was ensured using standard reference material NIST-SRM-1548a. The results show that the daily intake for Zn were 2.8-22.8 mg/day (reference value were 5- 40 mg/day), Fe were 3.1-26.5 mg/day (reference value were 6-40 mg/day), AI were 4,2-32.9 mg/day (reference value were 2-45 mg/day), Mn were 1.0-5,6 mg/day (reference value were 0.4-10,0 mg/day), and Co were 0,005-0,074 mg/day (reference value were 0.005 -1.8 mg/day

  15. Thermoelectric properties control due to doping level and sintering conditions for FGM thermoelectric element

    CERN Document Server

    Kajikawa, T; Shiraishi, K; Ohmori, M; Hirai, T

    1999-01-01

    Thermoelectric performance is determined with three factors, namely, Seebeck coefficient, electrical resistivity and thermal conductivity. For metal and single crystalline semiconductor, those factors have close interrelation each $9 other. However, as the sintered thermoelectric element has various levels of superstructure from macro scale and micro scale in terms of the thermoelectric mechanism, the relationship among them is more complex than that for the $9 melt- grown element, so it is suggested that the control of the temperature dependence of thermoelectric properties is possible to enhance the thermoelectric performance for wide temperature range due to FGM approach. The research $9 objective is to investigate the characteristics of the thermoelectric properties for various doping levels and hot-pressed conditions to make the thermoelectric elements for which the temperature dependence of the performance is $9 controlled due to FGM approach varying the doping levels and sintering conditions. By usage ...

  16. Impact of element-level static condensation on iterative solver performance

    KAUST Repository

    Pardo, D.

    2015-10-02

    This paper provides theoretical estimates that quantify and clarify the savings associated to the use of element-level static condensation as a first step of an iterative solver. These estimates are verified numerically. The numerical evidence shows that static condensation at the element level is beneficial for higher-order methods. For lower-order methods or when the number of iterations required for convergence is low, the setup cost of the elimination as well as its implementation may offset the benefits obtained during the iteration process. However, as the iteration count (e.g., above 50) or the polynomial order (e.g., above cubics) grows, the benefits of element-level static condensation are significant.

  17. Methodological approaches to the assessment level of social responsibility

    OpenAIRE

    Vorona, E.

    2010-01-01

    A study of current approaches to assessing the level of social responsibility. Proposed methodological approach to evaluating the performance of the social responsibility of railway transport. Conceptual Basis of social reporting in rail transport.

  18. Climate change adapatation response at local government level

    CSIR Research Space (South Africa)

    Mambo, Julia

    2018-03-01

    Full Text Available The climate change response policy gives the mandate to all municipalities and other levels of government to develop and implement climate chnage adaptation response. The availability of appropriate information is essential for this process...

  19. Trace element levels in whole blood of riparian villagers of the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Lisboa Rodrigues, Jairo; Lemos Batista, Bruno [Laboratorio de Toxicologia e Essencialidade de Metais, Depto. de Analises Clinicas, Toxicologicas e Bromatologicas, Faculdade de Ciencias Farmaceuticas de Ribeirao Preto-USP, Avenida do Cafe s/n, Monte Alegre, 14040-903, Ribeirao Preto-SP (Brazil); Fillion, Myriam [Centre interdisciplinaire de recherche sur la biologie, la sante, la societe et l' environnement (CINBIOSE), Universite du Quebec a Montreal (Canada); Passos, Carlos J.S. [Faculdade UnB Planaltina (FUP), Universidade de Brasilia, Planaltina (DF) (Brazil); Mergler, Donna [Centre interdisciplinaire de recherche sur la biologie, la sante, la societe et l' environnement (CINBIOSE), Universite du Quebec a Montreal (Canada); Barbosa, Fernando, E-mail: fbarbosa@fcfrp.usp.br [Laboratorio de Toxicologia e Essencialidade de Metais, Depto. de Analises Clinicas, Toxicologicas e Bromatologicas, Faculdade de Ciencias Farmaceuticas de Ribeirao Preto-USP, Avenida do Cafe s/n, Monte Alegre, 14040-903, Ribeirao Preto-SP (Brazil)

    2009-06-15

    Monitoring the nutritional status of essential elements is of critical importance in human health. However, trace element concentrations in biological fluids are affected by environmental and physiological parameters, and therefore considerable variations can occur between specific population subgroups. Brazil is a large country with much food diversity. Moreover, dietary habits differ from north to south. As an example, the traditional populations of the Brazilian Amazon basin are heavily dependent on fish, fruits, vegetables and manioc for their daily sustenance. However, very few studies have examined to what extent these diets reflect adequate nutritional status for essential elements. Then, in the present study we have evaluated the levels of some trace elements (Cu, Co, Zn Sr, and Rb) in the whole blood of a riparian Brazilian Amazonian population and estimated the influence of age and gender on levels and inter-element interactions in the same population. For this, 253 subjects, aged 15 to 87, from 13 communities situated on the banks of the Tapajos, one of the major tributaries of the Amazon, were randomly selected. The values found for cobalt, copper and strontium in whole blood are in the same range as in other populations. On the other hand, the levels of rubidium and zinc may be considered higher. Moreover, gender was shown to influence Zn and Cu levels while age influenced the concentrations of Sr and Rb in men and Cu in women. Given the scarcity of studies examining nutritional status in traditional communities of the Amazon, our study is the first to provide relevant insight into trace element values in this region and inter-element interactions. This paper is also of particular importance for future studies looking at the possible protective effects of traditional Amazon riparian diets against mercury intake from fish consumption.

  20. Trace element levels in whole blood of riparian villagers of the Brazilian Amazon

    International Nuclear Information System (INIS)

    Lisboa Rodrigues, Jairo; Lemos Batista, Bruno; Fillion, Myriam; Passos, Carlos J.S.; Mergler, Donna; Barbosa, Fernando

    2009-01-01

    Monitoring the nutritional status of essential elements is of critical importance in human health. However, trace element concentrations in biological fluids are affected by environmental and physiological parameters, and therefore considerable variations can occur between specific population subgroups. Brazil is a large country with much food diversity. Moreover, dietary habits differ from north to south. As an example, the traditional populations of the Brazilian Amazon basin are heavily dependent on fish, fruits, vegetables and manioc for their daily sustenance. However, very few studies have examined to what extent these diets reflect adequate nutritional status for essential elements. Then, in the present study we have evaluated the levels of some trace elements (Cu, Co, Zn Sr, and Rb) in the whole blood of a riparian Brazilian Amazonian population and estimated the influence of age and gender on levels and inter-element interactions in the same population. For this, 253 subjects, aged 15 to 87, from 13 communities situated on the banks of the Tapajos, one of the major tributaries of the Amazon, were randomly selected. The values found for cobalt, copper and strontium in whole blood are in the same range as in other populations. On the other hand, the levels of rubidium and zinc may be considered higher. Moreover, gender was shown to influence Zn and Cu levels while age influenced the concentrations of Sr and Rb in men and Cu in women. Given the scarcity of studies examining nutritional status in traditional communities of the Amazon, our study is the first to provide relevant insight into trace element values in this region and inter-element interactions. This paper is also of particular importance for future studies looking at the possible protective effects of traditional Amazon riparian diets against mercury intake from fish consumption.

  1. Removal of actinide elements from high level radioactive waste by trialkylphosphine oxide (TRPO)

    International Nuclear Information System (INIS)

    Song Chongli; Yang Dazhu; He Longhai; Xu Jingming; Zhu Yongjun

    1992-03-01

    The modified TRPO process for removing actinide elements from synthetic solution, which was taken from reprocessing of power reactor nuclear fuel, was verified by cascade experiment. Neptunium valence was adjusted in the process for improving neptunium removing efficiency. At 1 mol/L concentration of HNO 3 of feed solution and after a few stages of extraction with 30% t=TRPO kerosene, over 99.9% of Am, Pu, Np and U could be removed from HAW (high level radioactive waste) solution. The stripping of actinides loaded in TRPO are accomplished by high concentration nitric acid, oxalic acid and sodium carbonate instead of amino carboxylic complexing agents used in previous process. The actinides stripped were divided into three groups, which are Am + RE, Np + Pu, and U, and the cross contamination between them is small. Behaviours of F.P. elements are divided into three types which are not extracted, little extracted and extracted elements. The extracted elements are rare earth and Pd, Zr and Mo which are co-extracted with actinides. The separation factor between actinides and other two types of F.P.elements will increase if more scrubbing sections are added in the process. The relative concentration profile of actinide elements and Tc in various stages as well as the distribution of actinides and F.P. elements in the process stream solutions are also presented

  2. Disposal of flow-level radioactive waste in Belgium: A safety analysis for inorganic chemotoxic elements

    International Nuclear Information System (INIS)

    Mallants, D.; Volckaert, G.; Marivoet, J.; Neerdael, B.

    2000-01-01

    Low-level radioactive waste often contains large quantities of inorganic chemical substances. Due attention should therefore be given to the safety implications of both the radiological and chemical substances in the waste. Our study develops the safety assessment methodology for surface disposal with emphasis on the potential effects of inorganic nonradiological elements on human health. Contamination of groundwater was considered as the major exposure pathway. The applied methodology first screens all elements on the basis of five criteria. Conservative screening calculations were used to screen out the elements that do not pose danger to humans, and to select those that could have a negative impact and thus require further analysis. The latter was done by first calculating the elemental mass fluxes out of the repository and into the aquifer followed by the calculation of groundwater concentrations. The results showed that on the basis of the screening calculations, 75% of all elements could be classified as non-hazardous. The detailed calculations showed that the majority of the remaining elements had groundwater concentrations below the drinking water or groundwater standards. The results further showed that for a few elements the maximum groundwater concentration was above the standard, but below the background concentrations. (author)

  3. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  4. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  5. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  6. Quantifying human response capabilities towards tsunami threats at community level

    Science.gov (United States)

    Post, J.; Mück, M.; Zosseder, K.; Wegscheider, S.; Taubenböck, H.; Strunz, G.; Muhari, A.; Anwar, H. Z.; Birkmann, J.; Gebert, N.

    2009-04-01

    Decision makers at the community level need detailed information on tsunami risks in their area. Knowledge on potential hazard impact, exposed elements such as people, critical facilities and lifelines, people's coping capacity and recovery potential are crucial to plan precautionary measures for adaptation and to mitigate potential impacts of tsunamis on society and the environment. A crucial point within a people-centred tsunami risk assessment is to quantify the human response capabilities towards tsunami threats. Based on this quantification and spatial representation in maps tsunami affected and safe areas, difficult-to-evacuate areas, evacuation target points and evacuation routes can be assigned and used as an important contribution to e.g. community level evacuation planning. Major component in the quantification of human response capabilities towards tsunami impacts is the factor time. The human response capabilities depend on the estimated time of arrival (ETA) of a tsunami, the time until technical or natural warning signs (ToNW) can be received, the reaction time (RT) of the population (human understanding of a tsunami warning and the decision to take appropriate action), the evacuation time (ET, time people need to reach a safe area) and the actual available response time (RsT = ETA - ToNW - RT). If RsT is larger than ET, people in the respective areas are able to reach a safe area and rescue themselves. Critical areas possess RsT values equal or even smaller ET and hence people whin these areas will be directly affected by a tsunami. Quantifying the factor time is challenging and an attempt to this is presented here. The ETA can be derived by analyzing pre-computed tsunami scenarios for a respective area. For ToNW we assume that the early warning center is able to fulfil the Indonesian presidential decree to issue a warning within 5 minutes. RT is difficult as here human intrinsic factors as educational level, believe, tsunami knowledge and experience

  7. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  9. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  10. Comparison of serum trace element levels in patients with or without pre-eclampsia

    Directory of Open Access Journals (Sweden)

    Leila Farzin

    2012-01-01

    Full Text Available Objective: In developing countries, nutritional deficiency of essential trace elements is a common health problem, particularly among pregnant women because of increased requirements of various nutrients. Accordingly, this study was initiated to compare trace elements status in women with or without pre-eclampsia. Materials and Methods: In this study, serum trace elements including zinc (Zn, selenium (Se, copper (Cu, calcium (Ca and magnesium (Mg were determined by using atomic absorption spectrometry (AAS in 60 patients and 60 healthy subjects. Results: There was no significant difference in the values of Cu between two groups (P > 0.05. A significant difference in Zn, Se, Ca and Mg levels were observed between patients with pre-eclampsia and control group (P 0.05. Conclusion: Our findings indicate that the levels of Zn, Se, Ca and Mg are significantly altered in pregnant women with pre-eclampsia. This research shows that these deficiencies can not due to hemodilution.

  11. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  12. Impact of element-level static condensation on iterative solver performance

    KAUST Repository

    Pardo, D.; Á lvarez-Aramberri, J.; Paszynski, M.; Dalcin, Lisandro; Calo, Victor M.

    2015-01-01

    that static condensation at the element level is beneficial for higher-order methods. For lower-order methods or when the number of iterations required for convergence is low, the setup cost of the elimination as well as its implementation may offset

  13. The Effects of Social Capital Elements on Job Satisfaction and Motivation Levels of Teachers

    Science.gov (United States)

    Boydak Özan, Mukadder; Yavuz Özdemir, Tuncay; Yaras, Zübeyde

    2017-01-01

    The purpose of this study is to examine the effects of social capital elements' on job satisfaction and motivation levels of teachers. The mixed method was used in the study. The quantitative data were analyzed through Correlation and Multiple Regression analyses. An interview form developed by the researchers was used for analyzing the…

  14. Matching of singly- and doubly-unresolved limits of tree-level QCD squared matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Somogyi, Gabor [University of Debrecen and Institute of Nuclear Research of the Hungarian Academy of Sciences, H-4001 Debrecen, PO Box 51 (Hungary); Trocsanyi, Zoltan [University of Debrecen and Institute of Nuclear Research of the Hungarian Academy of Sciences, H-4001 Debrecen, PO Box 51 (Hungary); Duca, Vittorio Del [Istituto Nazionale di Fisica Nucleare, Sez. di Torino, via P. Giuria, 1 - 10125 Torino (Italy)

    2005-06-01

    We describe how to disentangle the singly- and doubly-unresolved (soft and/or collinear) limits of tree-level QCD squared matrix elements. Using the factorization formulae presented in this paper, we outline a viable general subtraction scheme for computing next-to-next-to-leading order corrections for electron-positron annihilation into jets.

  15. Quantum Biology at the Cellular Level - elements of the research program

    OpenAIRE

    Bordonaro, Michael; Ogryzko, Vasily

    2013-01-01

    Quantum Biology is emerging as a new field at the intersection between fundamental physics and biology, promising novel insights into the nature and origin of biological order. We discuss several elements of QBCL (Quantum Biology at Cellular Level), a research program designed to extend the reach of quantum concepts to higher than molecular levels of biological organization. Key words. decoherence, macroscopic superpositions, basis-dependence, formal superposition, non-classical correlations,...

  16. Adjacent level effects of bi level disc replacement, bi level fusion and disc replacement plus fusion in cervical spine--a finite element based study.

    Science.gov (United States)

    Faizan, Ahmad; Goel, Vijay K; Biyani, Ashok; Garfin, Steven R; Bono, Christopher M

    2012-03-01

    Studies delineating the adjacent level effect of single level disc replacement systems have been reported in literature. The aim of this study was to compare the adjacent level biomechanics of bi-level disc replacement, bi-level fusion and a construct having adjoining level disc replacement and fusion system. In total, biomechanics of four models- intact, bi level disc replacement, bi level fusion and fusion plus disc replacement at adjoining levels- was studied to gain insight into the effects of various instrumentation systems on cranial and caudal adjacent levels using finite element analysis (73.6N+varying moment). The bi-level fusion models are more than twice as stiff as compared to the intact model during flexion-extension, lateral bending and axial rotation. Bi-level disc replacement model required moments lower than intact model (1.5Nm). Fusion plus disc replacement model required moment 10-25% more than intact model, except in extension. Adjacent level motions, facet loads and endplate stresses increased substantially in the bi-level fusion model. On the other hand, adjacent level motions, facet loads and endplate stresses were similar to intact for the bi-level disc replacement model. For the fusion plus disc replacement model, adjacent level motions, facet loads and endplate stresses were closer to intact model rather than the bi-level fusion model, except in extension. Based on our finite element analysis, fusion plus disc replacement procedure has less severe biomechanical effects on adjacent levels when compared to bi-level fusion procedure. Bi-level disc replacement procedure did not have any adverse mechanical effects on adjacent levels. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Evaluation of some essential element levels in thalassemia major patients in Mosul district, Iraq.

    Science.gov (United States)

    Al-Samarrai, Abdulmunaim H; Adaay, Mohaisen H; Al-Tikriti, Khudhair A; Al-Anzy, Muayed M

    2008-01-01

    To evaluate the levels of some essential elements in thalassemic patients in Mosul, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital based study. Essential elements levels were estimated. The mean, standard deviation, correlation coefficient, and z-test were used. P-values copper, and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate, and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism.

  18. Evaluation of some essential elements levels in thalassemia patients in Mosul, Iraq

    International Nuclear Information System (INIS)

    Al-Samarrai, Abdulmunaim H.; Al-Tikriti, Khudhair A.; Al-Anzy, Muayed M.; Adaay, Mohaisen H.

    2008-01-01

    Objective was to evaluate the levels of some essential elements in thalassemic patients in Mousel, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital study. Essential elements levels were estimated. The mean, standard deviation, correction coefficient and z-test were used. P-values < 0.05 were considered statistically significant. Low serum Zinc, Magnesium, high serum copper and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism. (author)

  19. Matrix elements of Yale potential and level properties of light nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, N; Prakash, O [Delhi Univ. (India). Dept. of Physics and Astrophysics

    1976-07-01

    Shell model calculations using bare and renormalized matrix elements of the Yale potential are reported for the normal-parity states of A = 6-9 nuclei. Renormalization of the two-body matrix elements using second-order perturbation theory is not found to improve the agreements with the experimental data. Inclusion of the energy shifts of ground state rotational bands in /sup 8/Be and /sup 9/Be are, however, found to improve the agreements with the excitation energies of nuclear levels. The need for carrying out more calculations of these nuclei with realistic forces is pointed out.

  20. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  1. Fundamental study on the extraction of transuranium elements from high-level liquid waste

    International Nuclear Information System (INIS)

    Kubota, Masumitsu; Morita, Yasuji; Tochiyama, Osamu; Inoue, Yasushi.

    1988-01-01

    A great many extractants have been studied for the separation of transuranium elements. The present study deals with the survey and classification of the extractants appearing in literature, bearing in mind the relationship between the molecular structure of extractants and their extractability for the transuranium elements from the standpoint of their selective separation from high-level liquid waste (HLW) generated from fuel reprocessing. The extractants surveyed were classified into six groups; unidentate neutral organophosphorus compounds, bidentate neutral organophosphorus compounds, acidic organophosphorus compounds, amines and ammonium salts, N,N-disubstituted amides and the other compounds. These extractants are not always applicable to the separation of transuranium elements from HLW because of their limitations in extractability and radiation durability. Only a limited number of extractants belonging to the bidentate neutral organophosphorus compounds and the acidic organophosphorus compounds are considered to be suitable for the present purpose. (author)

  2. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  3. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  4. Atomic energy levels of the iron-period elements: potassium through nickel

    International Nuclear Information System (INIS)

    Sugar, J.; Corliss, C.

    1985-01-01

    Experimentally derived energy levels of the elements from potassium to nickel in all stages of ionization are critically compiled. The data for each level include its position in /cm (relative to the ground state), configuration, term designation, J-value, and, where available, the g-value and two leading percentages of the eigenvector composition in the most appropriate coupling scheme. For the He I and H I isoelectronic sequences, calculated level positions are given because they are considered more accurate than the measurements presently available. Ionization energies for each ion are derived either from Rydberg series, extrapolation, or calculation. Complete references are given for the compiled data

  5. A local level set method based on a finite element method for unstructured meshes

    International Nuclear Information System (INIS)

    Ngo, Long Cu; Choi, Hyoung Gwon

    2016-01-01

    A local level set method for unstructured meshes has been implemented by using a finite element method. A least-square weighted residual method was employed for implicit discretization to solve the level set advection equation. By contrast, a direct re-initialization method, which is directly applicable to the local level set method for unstructured meshes, was adopted to re-correct the level set function to become a signed distance function after advection. The proposed algorithm was constructed such that the advection and direct reinitialization steps were conducted only for nodes inside the narrow band around the interface. Therefore, in the advection step, the Gauss–Seidel method was used to update the level set function using a node-by-node solution method. Some benchmark problems were solved by using the present local level set method. Numerical results have shown that the proposed algorithm is accurate and efficient in terms of computational time

  6. A local level set method based on a finite element method for unstructured meshes

    Energy Technology Data Exchange (ETDEWEB)

    Ngo, Long Cu; Choi, Hyoung Gwon [School of Mechanical Engineering, Seoul National University of Science and Technology, Seoul (Korea, Republic of)

    2016-12-15

    A local level set method for unstructured meshes has been implemented by using a finite element method. A least-square weighted residual method was employed for implicit discretization to solve the level set advection equation. By contrast, a direct re-initialization method, which is directly applicable to the local level set method for unstructured meshes, was adopted to re-correct the level set function to become a signed distance function after advection. The proposed algorithm was constructed such that the advection and direct reinitialization steps were conducted only for nodes inside the narrow band around the interface. Therefore, in the advection step, the Gauss–Seidel method was used to update the level set function using a node-by-node solution method. Some benchmark problems were solved by using the present local level set method. Numerical results have shown that the proposed algorithm is accurate and efficient in terms of computational time.

  7. Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

    Science.gov (United States)

    Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

    2013-02-01

    Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

  8. Levels of aqueous humor trace elements in patients with open-angle glaucoma.

    Science.gov (United States)

    Hohberger, Bettina; Chaudhri, M Anwar; Michalke, Bernhard; Lucio, Marianna; Nowomiejska, Katarzyna; Schlötzer-Schrehardt, Ursula; Grieb, Pawel; Rejdak, Robert; Jünemann, Anselm G M

    2018-01-01

    Trace elements might play a role in the complex multifactorial pathogenesis of open-angle glaucoma. The aim of this study was to analyze concentrations of trace elements in aqueous humor samples of patients with primary open-angle glaucoma (POAG) and pseudoexfoliation glaucoma (PEXG). Thirty-three aqueous humor samples were obtained from patients undergoing cataract surgery: 12 patients with POAG (age 65.3±10.50, female 8, male 4), 10 patients with PEXG (age 65.9±11.27, female 6, male 4) and 11 patients without glaucoma (age 69.5±13.70, female 7, male 4) serving as controls. Aqueous humor levels of cadmium, iron, manganese, cobalt, copper and zinc were measured by Flow-Injection-Inductively-Coupled-Plasma-Mass-Spectrometry (FI-ICP-MS). From the statistical evaluation, we observed that patients with POAG had significantly higher aqueous humor levels of zinc (p=0.006) compared to controls. Increased aqueous humor levels of zinc were also observed in patients with PEXG in relation to control (p=0.0006). For iron we observed a significantly reduction in PEXG compared to control (p=0.002) and a significant difference between POAG and PEXG (p=0.0091). No significant differences were observed in aqueous humor levels of manganese, cobalt, copper, cadmium between glaucoma and control patients. No differences were seen for iron (POAG vs. controls). Analysis of trace element ratios was added. Significant differences in aqueous humor levels of zinc and iron between glaucoma and control patients support the hypothesis that these trace elements are involved in the pathogenesis of open-angle glaucoma. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Selenite modulates the level of phenolics and nutrient element to alleviate the toxicity of arsenite in rice (Oryza sativa L.).

    Science.gov (United States)

    Chauhan, Reshu; Awasthi, Surabhi; Tripathi, Preeti; Mishra, Seema; Dwivedi, Sanjay; Niranjan, Abhishek; Mallick, Shekhar; Tripathi, Pratibha; Pande, Veena; Tripathi, Rudra Deo

    2017-04-01

    Arsenic (As) contamination of paddy rice is a serious threat all over the world particularly in South East Asia. Selenium (Se) plays important role in protection of plants against various abiotic stresses including heavy metals. Moreover, arsenite (AsIII) and selenite (SeIV) can be biologically antagonistic due to similar electronic configuration and sharing the common transporter for their uptake in plant. In the present study, the response of oxidative stress, phenolic compounds and nutrient elements was analyzed to investigate Se mediated As tolerance in rice seedlings during AsIII and SeIV exposure in hydroponics. Selenite (25µM) significantly decreased As accumulation in plant than As (25µM) alone treated plants. Level of oxidative stress related parameters viz., reactive oxygen species (ROS), lipid peroxidation, electrical conductivity, nitric oxide and pro-oxidant enzyme (NADPH oxidase), were in the order of As>As+Se>control>Se. Selenium ameliorated As phytotoxicity by increased level of phenolic compounds particularly gallic acid, protocatechuic acid, ferulic acid and rutin and thiol metabolism related enzymes viz., serine acetyl transferase (SAT) and cysteine synthase (CS). Selenium supplementation enhanced the uptake of nutrient elements viz., Fe, Mn, Co, Cu, Zn, Mo, and improved plant growth. The results concluded that Se addition in As contaminated environment might be an important strategy to reduce As uptake and associated phytotoxicity in rice plant by modulation of phenolic compounds and increased uptake of nutrient elements. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Links between geodiversity and cultural elements on three scale levels, a neglected part of geoconservation

    Science.gov (United States)

    van den Ancker, Hanneke; Jungerius, Pieter Dirk

    2015-04-01

    The best-known landscape map of The Netherlands is a simplified version of the first geological map of The Netherlands and was made between 1856 and 1867 by Winand Staring. It still is the basis of our vegetation districts. The main landscape units of this map are the sand landscape, the peat landscape, the river landscape, the marine landscape, the coastal dunes and the hills. On this scale level there is general awareness of the relationships between the geo aspects (geomorphology, geology, geohydrology and soil science) of the landscape and historical land use, e.g. in field patterns and other cultural elements (archaeology and historical geography). From three of these units, examples of interactions between geo-aspects and cultural elements are given for two different scale levels: first on a more regional scale level, then on site level. Especially the last level requires field study. The relationships between the geo and cultural aspects appear to be most intact and are most variable at the site level. Earth scientists as yet hardly involve themselves in geoconservation studies re these relationships, for which reason the geo-aspects of the cultural elements, especially those at the site level, often are not noticed and disappear during land development projects or gardening efforts. It also is a missed opportunity as these sites offer a chance to raise interest of a broader public for geomorphology and soils, which are in general more difficult to communicate. The development and management of cultural landscapes and sites, by Dutch law is the domain of land owners and landscape architects, who in the course of a project consult other experts. Our plea for future planning projects is to work with a team of experts including archaeologists, historical geographers, flora and fauna experts, geologists, geomorphologists and soil specialists. Although the costs of preparing a plan will be slightly higher, our experience is that it will improve the quality of

  11. Effects of industrial processing on essential elements and regulated and emerging contaminant levels in seafood

    DEFF Research Database (Denmark)

    Rasmussen, Rie Romme; Bøge Søndergaard, Annette; Bøknæs, Niels

    2017-01-01

    Mitigation of contaminants in industrial processing was studied for prawns (cooked and peeled), Greenland halibut (cold smoked) and Atlantic salmon (cold smoked and trimmed). Raw prawns had significantly higher cadmium, chromium, iron, selenium and zinc content in autumn than in spring, while...... summer levels typically were intermediate. Peeling raw prawns increased mercury concentration but reduced the concentration of all other elements including inorganic arsenic, total arsenic, chromium, zinc, selenium but especially cadmium, copper and iron (p

  12. Computing the dynamics of biomembranes by combining conservative level set and adaptive finite element methods

    OpenAIRE

    Laadhari , Aymen; Saramito , Pierre; Misbah , Chaouqi

    2014-01-01

    International audience; The numerical simulation of the deformation of vesicle membranes under simple shear external fluid flow is considered in this paper. A new saddle-point approach is proposed for the imposition of the fluid incompressibility and the membrane inextensibility constraints, through Lagrange multipliers defined in the fluid and on the membrane respectively. Using a level set formulation, the problem is approximated by mixed finite elements combined with an automatic adaptive ...

  13. Separation of transuranium elements from high-level waste by extraction with diisodecyl phosphoric acid

    International Nuclear Information System (INIS)

    Morita, Y.; Kubota, M.; Tani, S.

    1991-01-01

    Separation of transuranic elements (TRU) by extraction with diisodecyl phosphoric acid (DIDPA) has been studied to develop a partitioning process for high-level waste (HLW). In the present study, experiments of counter-current continuous extraction and back-extraction using a miniature mixer-settler were carried out to find the optimum process condition for the separation of Np initially in the pentavalent state and to examine the extraction behaviors of fission and corrosion products. (J.P.N.)

  14. Determination of elemental levels in radiopharmaceuticals by instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Capote Rodriguez, Gil; Guevara, Sergio Ribeiro; Arribere, Maria; Hernandez Rivero, Tulio

    2001-01-01

    .3 % relative to a 7.6 x 7.6 cm NaI(Tl) crystal at 1.33 MeV and a 25 cm source to detector distance. Data collection was performed using a P C equipped with a 4096 multichannel analyzer. Gamma-ray spectra were evaluated for peak position and intensity by the GAMANAL analyzing routine. Elemental composition was determined by INAA, using the absolute parametric method. The thermal, epithermal and fast fluxes were obtained in each irradiation run using Co, Au and Ni monitors and the nuclear data needed to calculate the elemental concentrations in the samples were taken from the literature. The accuracy and precision of the analytical results were evaluated by analyzing three Certified Reference Materials: IAEA Lake Sediment SL-1, IAEA-393 (algae) and NIST Buffalo River Sediment BRS. The procedure used for the analysis allowed to obtain the concentration levels of forty-two elements. With the use of INAA, important information on the concentration levels of several toxic elements (Hg, Cd, As, Se, Sb, U and Th) was obtained. In addition, thirty-five other trace elements (Na, Mg, Al, Cl, K, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Br, Rb, Sr, Zr, Mo, Ag, I, Cs, Ba, La, Ce, Nd, Sm, Eu, Tb, Dy, Yb, Lu, Hf and Ta) were determined in the active components of three radiopharmaceuticals. The technique used for the irradiation arrangement allowed to increase the sensitivity, precision and accuracy of the INAA. The results of the elemental levels of trace elements in three radiopharmaceuticals were used in their registration. The feasibility of applying INAA in order to obtain quick information on the concentration levels of several important minor and trace elements in radiopharmaceutical samples was demonstrated. (author)

  15. Radical Surgery of Only the Anterior Elements of the Spine at the Posterior Element Fusion Level due to Metastatic Thyroid Cancer

    Directory of Open Access Journals (Sweden)

    Ryuto Tsuchiya

    2017-01-01

    Full Text Available Spinal metastasis of differentiated thyroid cancer can have a favorable prognosis if radical surgery is performed. We encountered a case of spinal metastasis involving three anterior vertebral bodies at the posterior element fusion level and successfully achieved adequate stability by radical surgery involving only the anterior elements. A 67-year-old woman who had numbness and muscle weakness in the lower limbs caused by metastatic spinal tumor at the posterior element fusion level of L1–L3 vertebrae was treated with radical surgery of only the anterior element to gain stability. Similar situations may occur in cases involving other malignant tumor metastases or spinal primary tumors. If such a case occurs, this method could be useful in preventing metastasis to the posterior element.

  16. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  17. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  18. Interactions between the Isolated-Interactive Elements Effect and Levels of Learner Expertise: Experimental Evidence from an Accountancy Class

    Science.gov (United States)

    Blayney, Paul; Kalyuga, Slava; Sweller, John

    2010-01-01

    This study investigated interactions between the isolated-interactive elements effect and levels of learner expertise with first year undergraduate university accounting students. The isolated-interactive elements effect occurs when learning is facilitated by initially presenting elements of information sequentially in an isolated form rather than…

  19. Baseline Response Levels Are a Nuisance in Infant Contingency Learning

    Science.gov (United States)

    Millar, W. S.; Weir, Catherine

    2015-01-01

    The impact of differences in level of baseline responding on contingency learning in the first year was examined by considering the response acquisition of infants classified into baseline response quartiles. Whereas the three lower baseline groups showed the predicted increment in responding to a contingency, the highest baseline responders did…

  20. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  1. Blood lead level and its relationship to essential elements in preschool children from Nanning, China.

    Science.gov (United States)

    Chen, Jingwen; Li, Muyan; Lv, Qun; Chen, Guoli; Li, Yong; Li, Shaojun; Mo, Yuhuan; Ou, Shiyan; Yuan, Zongxiang; Huang, Mingli; Jiang, Yueming

    2015-04-01

    Our study aimed to assess the distribution of blood lead level and its relationship to essential elements in preschool children in an urban area of China. A total of 6741 children aged 0- to 6-year-old were recruited. Levels of lead, zinc, copper, iron, calcium, and magnesium in whole blood samples were determined using atomic absorption spectrometry. The mean blood lead level (BLL) and the prevalence of BLL≥10μg/dl (5.26±4.08μg/dl and 6.84%, respectively) increased with age gradually, and there was a gender-difference for blood lead, copper, zinc and iron levels. Compared with the group of children who had BLLslead with zinc, iron and magnesium, and a negative correlation of lead with calcium were found in the group of children with BLLintoxication prevalence in preschool children. Metabolic disorder of essential elements was found even with a low level of lead exposure. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  3. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  5. Levels of particulate air pollution, its elemental composition, determinants and health effects in metro systems

    Science.gov (United States)

    Nieuwenhuijsen, M. J.; Gómez-Perales, J. E.; Colvile, R. N.

    The aim of this study was to review and summarise the levels of particulate air pollution, its elemental composition, its determinants, and its potential health effects in metro systems. A number of studies have been conducted to assess the levels of particulate matter and its chemical composition in metro systems. The monitoring equipment used varied and may have led to different reporting and makes it more difficult to compare results between metro systems. Some of the highest average levels of particulate matter were measured in the London metro system. Whereas some studies have reported higher levels of particulate matter in the metro system (e.g. London, Helsinki, Stockholm) compared to other modes of transport (London) and street canyons (Stockholm and Helsinki), other studies reported lower levels in the metro system (e.g. Hong Kong, Guangzhou, and Mexico City). The differences may be due to different material of the wheel, ventilation levels and breaking systems but there is no good evidence to what extent the differences may be explained by this, except perhaps for some elements (e.g. Fe, Mn). The dust in the metro system was shown to be more toxic than ambient airborne particulates, and its toxicity was compared with welding dust. The higher toxicity may be due to the higher iron content. Although the current levels of particulate matter and toxic matter are unlikely to lead to any significant excess health effects in commuters, they should be reduced where possible. It will be difficult to introduce measures to reduce the levels in older metro systems, e.g. by introducing air conditioning in London, but certainly they should be part of any new designs of metro systems.

  6. Response of rabbits to varying levels of cassava and Leucaena ...

    African Journals Online (AJOL)

    Response of rabbits to varying levels of cassava and Leucaena leucocephala leaf meal diets. ... Bulletin of Animal Health and Production in Africa ... An experiment was carried out to determine the performance, haematology, carcass characteristics and sensory evaluation of meat from rabbits (n = 30) fed varying levels of ...

  7. Reduction of Cortisol Levels and Participants' Responses Following Art Making

    Science.gov (United States)

    Kaimal, Girija; Ray, Kendra; Muniz, Juan

    2016-01-01

    This quasi-experimental study investigated the impact of visual art making on the cortisol levels of 39 healthy adults. Participants provided saliva samples to assess cortisol levels before and after 45 minutes of art making. Participants also provided written responses about the experience at the end of the session. Results indicate that art…

  8. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  9. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  10. Can biomass responses to warming at plant to ecosystem levels be predicted by leaf-level responses?

    Science.gov (United States)

    Xia, J.; Shao, J.; Zhou, X.; Yan, W.; Lu, M.

    2015-12-01

    Global warming has the profound impacts on terrestrial C processes from leaf to ecosystem scales, potentially feeding back to climate dynamics. Although numerous studies had investigated the effects of warming on C processes from leaf to plant and ecosystem levels, how leaf-level responses to warming scale up to biomass responses at plant, population, and community levels are largely unknown. In this study, we compiled a dataset from 468 papers at 300 experimental sites and synthesized the warming effects on leaf-level parameters, and plant, population and ecosystem biomass. Our results showed that responses of plant biomass to warming mainly resulted from the changed leaf area rather than the altered photosynthetic capacity. The response of ecosystem biomass to warming was weaker than those of leaf area and plant biomass. However, the scaling functions from responses of leaf area to plant biomass to warming were different in diverse forest types, but functions were similar in non-forested biomes. In addition, it is challenging to scale the biomass responses from plant up to ecosystem. These results indicated that leaf area might be the appropriate index for plant biomass response to warming, and the interspecific competition might hamper the scaling of the warming effects on plant and ecosystem levels, suggesting that the acclimation capacity of plant community should be incorporated into land surface models to improve the prediction of climate-C cycle feedback.

  11. The Effect of Helicobacter pylori Eradication on the Levels of Essential Trace Elements

    Directory of Open Access Journals (Sweden)

    Meng-Chieh Wu

    2014-01-01

    Full Text Available Objective. This study was designed to compare the effect of Helicobacter pylori (H. pylori infection treatment on serum zinc, copper, and selenium levels. Patients and Methods. We measured the serum zinc, copper, and selenium levels in H. pylori-positive and H. pylori-negative patients. We also evaluated the serum levels of these trace elements after H. pylori eradication. These serum copper, zinc, and selenium levels were determined by inductively coupled plasma mass spectrometry. Results. Sixty-three H. pylori-positive patients and thirty H. pylori-negative patients were studied. Serum copper, zinc, and selenium levels had no significant difference between H. pylori-positive and H. pylori-negative groups. There were 49 patients with successful H. pylori eradication. The serum selenium levels were lower after successful H. pylori eradication, but not significantly (P=0.06. There were 14 patients with failed H. pylori eradication. In this failed group, the serum selenium level after H. pylori eradication therapy was significantly lower than that before H. pylori eradication therapy (P<0.05. The serum zinc and copper levels had no significant difference between before and after H. pylori eradication therapies. Conclusion. H pylori eradication regimen appears to influence the serum selenium concentration (IRB number: KMUH-IRB-20120327.

  12. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  13. Comprehensive Wavelengths, Energy Levels, and Hyperfine Structure Parameters of Singly-Ionized Iron-Group Elements

    Science.gov (United States)

    Nave, Gillian

    We propose to measure wavelengths, energy levels, and hyperfine structure parameters of Ni II, Mn II, Sc II and other singly-ionized iron-group elements, covering the wavelength range 80 nm to 5500 nm. We shall use archival data from spectrometers at NIST and Kitt Peak National Observatory for spectra above 140 nm. Additional experimental observations will be taken if needed using Fourier transform spectrometers at NIST. Spectra will be taken using our normal incidence grating spectrograph to provide better sensitivity than the FT spectra and to extend the wavelength range down to 80 nm. We aim to produce a comprehensive description of the spectra of all singly-ionized iron- group elements. The wavelength uncertainty of the strong lines will be better than 1 part in 10^7. For most singly-ionized iron-group elements available laboratory data have uncertainties an order of magnitude larger than astronomical observations over wide spectra ranges. Some of these laboratory measurements date back to the 1960's. Since then, Fourier transform spectroscopy has made significant progress in improving the accuracy and quantity of data in the UV-vis-IR region, but high quality Fourier transform spectra are still needed for Mn II, Ni II and Sc II. Fourier transform spectroscopy has low sensitivity in the VUV region and is limited to wavelengths above 140 nm. Spectra measured with high-resolution grating spectrographs are needed in this region in order to obtain laboratory data of comparable quality to the STIS and COS spectrographs on the Hubble Space Telescope. Currently, such data exist only for Fe II and Cr II. Lines of Sc II, V II, and Mn II show hyperfine structure, but hyperfine structure parameters have been measured for relatively few lines of these elements. Significant errors can occur if hyperfine structure is neglected when abundances are determined from stellar spectra. Measurements of hyperfine structure parameters will be made using Fourier transform spectroscopy

  14. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  15. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  17. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  18. Relationship between the level of essential metal elements in human hair and coronary heart disease

    International Nuclear Information System (INIS)

    Bor-Tsung Hsieh; Kai-Yuan Cheng; Ying-Chen Chang

    2011-01-01

    Studies on epidemics have demonstrated the relationship between coronary heart disease (CHD) and mineral substances, such as selenium, calcium, magnesium, sodium, potassium, copper, zinc, iron, manganese, and vanadium, in human bodies. In this study, instrumental neutron activation analysis (INAA) and flame atomic absorption spectrophotometry (FAAS) were applied to evaluate the levels of selenium, calcium, magnesium, sodium, potassium, copper, zinc, and iron in healthy individuals and CHD patients. Hair samples were collected from 42 healthy participants and 28 diagnosed CHD patients. Calcium, magnesium, copper, and zinc levels in healthy individuals are significantly higher than the levels found in the patients (p < 0.01). Calcium/selenium ratio is also significantly higher in healthy individuals (p < 0.05). Based on the possible synergies and/or antagonisms of elements and their absorption and metabolism, magnesium/calcium, zinc/copper, and sodium/potassium ratios showed positive relevance (p < 0.01). (author)

  19. Level set methods for detonation shock dynamics using high-order finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Dobrev, V. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Grogan, F. C. [Univ. of California, San Diego, CA (United States); Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kolev, T. V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rieben, R [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tomov, V. Z. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-05-26

    Level set methods are a popular approach to modeling evolving interfaces. We present a level set ad- vection solver in two and three dimensions using the discontinuous Galerkin method with high-order nite elements. During evolution, the level set function is reinitialized to a signed distance function to maintain ac- curacy. Our approach leads to stable front propagation and convergence on high-order, curved, unstructured meshes. The ability of the solver to implicitly track moving fronts lends itself to a number of applications; in particular, we highlight applications to high-explosive (HE) burn and detonation shock dynamics (DSD). We provide results for two- and three-dimensional benchmark problems as well as applications to DSD.

  20. Errors and conflict at the task level and the response level.

    Science.gov (United States)

    Desmet, Charlotte; Fias, Wim; Hartstra, Egbert; Brass, Marcel

    2011-01-26

    In the last decade, research on error and conflict processing has become one of the most influential research areas in the domain of cognitive control. There is now converging evidence that a specific part of the posterior frontomedian cortex (pFMC), the rostral cingulate zone (RCZ), is crucially involved in the processing of errors and conflict. However, error-related research has focused primarily on a specific error type, namely, response errors. The aim of the present study was to investigate whether errors on the task level rely on the same neural and functional mechanisms. Here we report a dissociation of both error types in the pFMC: whereas response errors activate the RCZ, task errors activate the dorsal frontomedian cortex. Although this last region shows an overlap in activation for task and response errors on the group level, a closer inspection of the single-subject data is more in accordance with a functional anatomical dissociation. When investigating brain areas related to conflict on the task and response levels, a clear dissociation was perceived between areas associated with response conflict and with task conflict. Overall, our data support a dissociation between response and task levels of processing in the pFMC. In addition, we provide additional evidence for a dissociation between conflict and errors both at the response level and at the task level.

  1. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  2. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  3. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  4. Effect of kombucha on some trace element levels in different organs of electromagnetic field exposed rats

    Directory of Open Access Journals (Sweden)

    Ola A. Gharib

    2014-01-01

    Full Text Available Mobile phones have increased exponentially all over the world. The present study was performed to evaluate the effect of kombucha (KT on some trace element levels of brain, spleen and intestine in male albino rats exposed to a 950 MHz electromagnetic field (EMF. Four experimental groups labelled as controls, EMF group, KT group and KT + EMF group were formed with six randomly chosen animals in each group. After EMF exposure for eight weeks and the animals were sacrificed by decapitation. Brain, spleen and intestine samples were collected for trace element analysis. The group of animals subjected to electromagnetic waves caused significant increases in iron copper levels and copper/zinc ratio accompanied with a decrease of zinc level in all studied organs. Combined treatment of kombucha with EMF resulted in a successful attenuation of these adverse effects of EMF. From present findings we can state that kombucha as a supplement has an ameliorative signs against the effects of electromagnetic radiation.

  5. Addictive drugs and their duration affecting on trace elements levels in men

    International Nuclear Information System (INIS)

    Nadeem, A.; Iqbal, K.; Shafiq, T.; Rehman, S.

    2008-01-01

    During the drug addiction the blood biochemistry particularly level of trace elements in blood is widely affected. Eighty male addicts of various age groups along with seventeen normal subjects were studied. The plasma Zinc and manganese concentration was high in addict person as compared to normal subjects. Where as a significant decrease in iron concentration was observed in addicts. The plasma copper concentration was also low in addicts as compared to normal subjects. In conclusion drug addiction leads to many biochemical changes that may have detritus effects on health status of addicts. (author)

  6. Segregation of the elements of the platinum group in a simulated high-level waste glass

    International Nuclear Information System (INIS)

    Mitamura, H.; Banba, T.; Kamizono, H.; Kiriyama, Y.; Kumata, M.; Murakami, T.; Tashiro, S.

    1983-01-01

    Segregation of the elements of the platinum group occurred during vitrification of the borosilicate glass containing 20 wt% simulated high-level waste oxides. The segregated materials were composed of two crystalline phases: one was the solid solution of ruthenium and rhodium dioxides and the other was that of palladium and rhodium metals also with tellurium. The segregated materials were not distributed homogeneously throughout the glass: (i) on the surface of the glass, there occurred palladium, rhodium and tellurium alloy alone; and (ii) at the inner part of the glass, the agglomerates of the two phases were concentrated in one part and dispersed in the other

  7. Determination of response level for imported meat and poultry

    Energy Technology Data Exchange (ETDEWEB)

    Houston, Donald L; Engel, Ronald E

    1986-07-01

    The response level of 75,000 picocuries per kilogram (pci/kg) for imported meat and poultry was determined in accordance with the Food and Drug Administration's (FDA's) Accidental Radioactive Contamination of Human Food and Animal Feeds, Recommendations for State and Local Agencies which was published in the Federal Register of October 22, 1982, and in consultation with FDA. The response level takes into account the total intake of activity from a radionuclide and the average daily consumption of food in the United States. This response level value is based, in part, upon the expectation that the major contributors of radiation to imported meat and poultry will be cesium-134 (half-life 2.1 years) and cesium-137 (half-life 30 years)

  8. Determination of response level for imported meat and poultry

    International Nuclear Information System (INIS)

    Houston, Donald L.; Engel, Ronald E.

    1986-01-01

    The response level of 75,000 picocuries per kilogram (pci/kg) for imported meat and poultry was determined in accordance with the Food and Drug Administration's (FDA's) Accidental Radioactive Contamination of Human Food and Animal Feeds, Recommendations for State and Local Agencies which was published in the Federal Register of October 22, 1982, and in consultation with FDA. The response level takes into account the total intake of activity from a radionuclide and the average daily consumption of food in the United States. This response level value is based, in part, upon the expectation that the major contributors of radiation to imported meat and poultry will be cesium-134 (half-life 2.1 years) and cesium-137 (half-life 30 years)

  9. Trace elements in home-produced eggs in Belgium: Levels and spatiotemporal distribution

    International Nuclear Information System (INIS)

    Waegeneers, Nadia; Hoenig, Michel; Goeyens, Leo; De Temmerman, Ludwig

    2009-01-01

    The purpose of this study was to evaluate the levels of arsenic, cadmium, lead, copper and zinc in home-produced eggs, soils and kitchen waste samples of private chicken owners in Belgium, and to determine spatiotemporal differences in trace element contents in eggs. Eggs were sampled in all provinces of Belgium in autumn 2006 and spring 2007. A total number of 59 private chicken owners participated in the study. Trace elements were determined by inductively coupled plasma-mass spectrometry except for mercury, which was determined by atomic absorption of mercury vapour. The mean fresh weight concentrations in eggs in autumn and spring respectively were < 8.0 and < 8.0 μg/kg for arsenic, 0.5 and < 0.5 μg/kg for cadmium, 116 and 74 μg/kg for lead, 0.43 and 0.52 mg/kg for copper, 20.3 and 19.2 mg/kg for zinc, and 3.15 and 4.44 μg/kg for mercury. Analysis of variance determined significant differences in some trace element concentrations in eggs among seasons and regions in Belgium. Average concentrations of arsenic, cadmium and mercury corresponded well with values measured in other countries, while copper and zinc concentrations were within the same order of magnitude as in other countries. Average lead concentrations were high compared to concentrations in eggs from other countries and correlated well with lead concentrations in soil, indicating that the soil is an important source. Other sources of trace elements in eggs might be home-grown vegetables and forage (grass and herbs), and indirectly, air pollution.

  10. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  11. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  12. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  13. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  14. Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

    Science.gov (United States)

    Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

    2017-09-19

    A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  16. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  17. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  18. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  19. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  20. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  1. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Linear response at the 4-component relativistic level

    DEFF Research Database (Denmark)

    Saue, T.; Jensen, Hans Jørgen Aagaard

    2003-01-01

    The theory, implementation, and application of linear response at the 4-component relativistic closed-shell Hartree-Fock level based on the concept of quasienergy and time averaging are reported. As such, an efficient AO-driven algorithm is obtained by assigning specific Hermiticity and time...

  3. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  4. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  5. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  7. Cardiac response and anxiety levels in psychopathic murderers.

    Science.gov (United States)

    Serafim, Antonio de Pádua; Barros, Daniel Martins de; Valim, André; Gorenstein, Clarice

    2009-09-01

    To compare the emotional response and level of anxiety of psychopathic murderers, non-psychopathic murderers, and nonpsychopathic non-criminals. 110 male individuals aged over 18 years were divided into three groups: psychopathic murderers (n = 38); non-psychopathic murderers (n = 37) serving sentences for murder convictions in Maximum Security Prisons in the State of Sao Paulo; and non-criminal, non-psychopathic individuals (n = 35) according to the Psychopathy Checklist-Revised. The emotional response of subjects was assessed by heart rate variation and anxiety level (State-Trait Anxiety Inventory) after viewing standardized pictures depicting pleasant, unpleasant and neutral content from the International Affective Picture System. Psychopathic murderers presented lower anxiety levels and smaller heart rate variations when exposed to pleasant and unpleasant stimuli than nonpsychopathic murderers or non-psychopathic non-criminals. The results also demonstrated that the higher the score for factor 1 on the Psychopathy Checklist-Revised, the lower the heart rate variation and anxiety level. The results suggest that psychopathic murderers do not present variation in emotional response to different visual stimuli. Although the non-psychopathic murderers had committed the same type of crime as the psychopathic murderers, the former tended to respond with a higher level of anxiety and heart rate variation.

  8. Levels of platinum group elements and rare-earth elements in wild mushroom species growing in Poland.

    Science.gov (United States)

    Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika

    2016-01-01

    Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.

  9. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  10. Effects of chemical elements in the trophic levels of natural salt marshes.

    Science.gov (United States)

    Kamiński, Piotr; Barczak, Tadeusz; Bennewicz, Janina; Jerzak, Leszek; Bogdzińska, Maria; Aleksandrowicz, Oleg; Koim-Puchowska, Beata; Szady-Grad, Małgorzata; Klawe, Jacek J; Woźniak, Alina

    2016-06-01

    The relationships between the bioaccumulation of Na, K, Ca, Mg, Fe, Zn, Cu, Mn, Co, Cd, and Pb, acidity (pH), salinity (Ec), and organic matter content within trophic levels (water-soil-plants-invertebrates) were studied in saline environments in Poland. Environments included sodium manufactures, wastes utilization areas, dumping grounds, and agriculture cultivation, where disturbed Ca, Mg, and Fe exist and the impact of Cd and Pb is high. We found Zn, Cu, Mn, Co, and Cd accumulation in the leaves of plants and in invertebrates. Our aim was to determine the selectivity exhibited by soil for nutrients and heavy metals and to estimate whether it is important in elucidating how these metals are available for plant/animal uptake in addition to their mobility and stability within soils. We examined four ecological plant groups: trees, shrubs, minor green plants, and water macrophytes. Among invertebrates, we sampled breastplates Malacostraca, small arachnids Arachnida, diplopods Diplopoda, small insects Insecta, and snails Gastropoda. A higher level of chemical elements was found in saline polluted areas (sodium manufactures and anthropogenic sites). Soil acidity and salinity determined the bioaccumulation of free radicals in the trophic levels measured. A pH decrease caused Zn and Cd to increase in sodium manufactures and an increase in Ca, Zn, Cu, Cd, and Pb in the anthropogenic sites. pH increase also caused Na, Mg, and Fe to increase in sodium manufactures and an increase in Na, Fe, Mn, and Co in the anthropogenic sites. There was a significant correlation between these chemical elements and Ec in soils. We found significant relationships between pH and Ec, which were positive in saline areas of sodium manufactures and negative in the anthropogenic and control sites. These dependencies testify that the measurement of the selectivity of cations and their fluctuation in soils provide essential information on the affinity and binding strength in these environments. The

  11. Blood lead: Its effect on trace element levels and iron structure in hemoglobin

    International Nuclear Information System (INIS)

    Jin, C.; Li, Y.; Li, Y.L.; Zou, Y.; Zhang, G.L.; Normura, M.; Zhu, G.Y.

    2008-01-01

    Lead is a ubiquitous environmental pollutant that induce a broad range of physiological and biochemical dysfunctions. The purpose of this study was to investigate its effects on trace elements and the iron structure in hemoglobin. Blood samples were collected from rats that had been exposed to lead. The concentration of trace elements in whole blood and blood plasma was determined by ICP-MS and the results indicate that lead exists mainly in the red blood cells and only about 1-3% in the blood plasma. Following lead exposure, the concentrations of zinc and iron in blood decrease, as does the hemoglobin level. This indicates that the heme biosynthetic pathway is inhibited by lead toxicity and that lead poisoning-associated anemia occurs. The selenium concentration also decreases after lead exposure, which may lead to an increased rate of free radical production. The effect of lead in the blood on iron structure in hemoglobin was determined by EXAFS. After lead exposure, the Fe-O bond length increases by about 0.07 A and the Fe-Np bond length slightly increases, but the Fe-N ε bond length remains unchanged. This indicates that the blood content of Hb increases, but that the content of HbO 2 decreases

  12. Transient response of level instruments in a research reactor

    International Nuclear Information System (INIS)

    Cheng, Lap Y.

    1989-01-01

    A numerical model has been developed to simulate the dynamics of water level instruments in a research nuclear reactor. A bubble device, with helium gas as the working fluid, is used to monitor liquid level by sensing the static head pressure due to the height of liquid in the reactor vessel. A finite-difference model is constructed to study the transient response of the water level instruments to pressure perturbations. The field equations which describe the hydraulics of the helium gas in the bubbler device are arranged in the form of a tridiagonal matrix and the field variables are solved at each time step by the Thomas algorithm. Simulation results indicate that the dynamic response of the helium gas depends mainly on the volume and the inertia of the gas in the level instrument tubings. The anomalies in the simulated level indication are attributed to the inherent lag in the level instrument due to the hydraulics of the system. 1 ref., 5 figs

  13. Behavioral response of manatees to variations in environmental sound levels

    Science.gov (United States)

    Miksis-Olds, Jennifer L.; Wagner, Tyler

    2011-01-01

    Florida manatees (Trichechus manatus latirostris) inhabit coastal regions because they feed on the aquatic vegetation that grows in shallow waters, which are the same areas where human activities are greatest. Noise produced from anthropogenic and natural sources has the potential to affect these animals by eliciting responses ranging from mild behavioral changes to extreme aversion. Sound levels were calculated from recordings made throughout behavioral observation periods. An information theoretic approach was used to investigate the relationship between behavior patterns and sound level. Results indicated that elevated sound levels affect manatee activity and are a function of behavioral state. The proportion of time manatees spent feeding and milling changed in response to sound level. When ambient sound levels were highest, more time was spent in the directed, goal-oriented behavior of feeding, whereas less time was spent engaged in undirected behavior such as milling. This work illustrates how shifts in activity of individual manatees may be useful parameters for identifying impacts of noise on manatees and might inform population level effects.

  14. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  15. Effects of the interleukin-6 (IL-6) polymorphism on toxic metal and trace element levels in placental tissues

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Tekin, Deniz; Aliyev, Vugar; Yalcin, Serap; Kurtay, Guelay; Soeylemezoglu, Tuelin

    2011-01-01

    The placenta is a crucial organ of fetal origin that functions in providing nutrients to the fetus from the mother. During pregnancy, the need for essential micronutrients, such as Fe and Zn, increases due to the requirements of the growing fetus. Maternal Fe deficiency induces an increase in Cu levels and can also affect cytokine levels in the placenta. On the other hand, Cu deficiency, although not as common, can also have destructive effects on the fetus. Interleukin-6 (IL-6) is a pleiotropic cytokine with a wide range of biological activities, including such as immune responses, acute-phase reactions, and inflammation. The placenta produces a significant amount of IL-6 during pregnancy. The effects of the IL-6 -174 G/C single nucleotide polymorphism (SNP) on IL-6 gene transcription and on plasma cytokine levels were assessed in the present study. We investigated the association between the IL-6 -174 G/C polymorphism and trace element/toxic metal levels in placental tissues. For the purposes of this study, 95 healthy volunteers were evaluated. Presence of the IL-6 polymorphism was determined using the standard polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique, and metal levels were analyzed by atomic absorption spectrometry (AAS). Based on our data, there were no significant associations between the IL-6 -174 G/C polymorphism and Pb, Cd, Fe, or Zn levels in the placental tissues (p > 0.05), but a statistically significant association was detected between the polymorphism and Cu levels (p = 0.016). We determined that the mean Cu levels in the placental tissues from individuals with GG, GC and CC genotypes were 5.62 ± 1.98, 6.22 ± 3.22 and 8.00 ± 1.32 ppm, respectively, whereas the overall mean Cu level from the placental tissues was 5.98 ± 2.51 ppm. - Highlights: → We studied between the association of IL-6 polymorphism and metal levels in the placenta tissues. → It was the first report evaluating the association

  16. Street-level classification of illicit heroin using inorganic elements coupled with pattern monitoring

    Directory of Open Access Journals (Sweden)

    Kar-Weng Chan

    2016-09-01

    Full Text Available A total of 96 illicit heroin samples seized in 2013–2014 were analyzed by inductively coupled plasma-mass spectrometry (ICP-MS to determine 16 inorganic elements at parts-per-billion (ppb level. Of eleven submissions, two or three samples with similar appearance were taken from the same seizure to form related samples. These samples were used to monitor the clustering outcome suggested by principal component analysis (PCA. They provided hints regarding the acceptance of within-seizure variability in-situ. The previously established data pretreatment method (N+4R did not function well with the present data probably due to the higher concentrations reported for the current samples. With the aid of the above-cited related samples for pattern monitoring, a better outcome was achieved when the pretreatment method was modified to employ solely standardization (S to optimize the necessary variability for sample classification.

  17. Comparative analysis of elements and models of implementation in local-level spatial plans in Serbia

    Directory of Open Access Journals (Sweden)

    Stefanović Nebojša

    2017-01-01

    Full Text Available Implementation of local-level spatial plans is of paramount importance to the development of the local community. This paper aims to demonstrate the importance of and offer further directions for research into the implementation of spatial plans by presenting the results of a study on models of implementation. The paper describes the basic theoretical postulates of a model for implementing spatial plans. A comparative analysis of the application of elements and models of implementation of plans in practice was conducted based on the spatial plans for the local municipalities of Arilje, Lazarevac and Sremska Mitrovica. The analysis includes four models of implementation: the strategy and policy of spatial development; spatial protection; the implementation of planning solutions of a technical nature; and the implementation of rules of use, arrangement and construction of spaces. The main results of the analysis are presented and used to give recommendations for improving the elements and models of implementation. Final deliberations show that models of implementation are generally used in practice and combined in spatial plans. Based on the analysis of how models of implementation are applied in practice, a general conclusion concerning the complex character of the local level of planning is presented and elaborated. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR 36035: Spatial, Environmental, Energy and Social Aspects of Developing Settlements and Climate Change - Mutual Impacts and Grant no. III 47014: The Role and Implementation of the National Spatial Plan and Regional Development Documents in Renewal of Strategic Research, Thinking and Governance in Serbia

  18. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  19. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  20. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  1. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  2. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  3. Responses to Human Bioeffluents at Levels Recommended by Ventilation Standards

    DEFF Research Database (Denmark)

    Zhang, Xiaojing; Wargocki, Pawel; Lian, Zhiwei

    2017-01-01

    The purpose of this study was to examine whether exposure to human bioeffluents, at the levels recommended by the current ventilation standards, would cause any effects on humans. Ten subjects were exposed in a low-emission stainless-steel climate chamber for 4.25 hours. The outdoor air supply rate...... was set to 33 or 4 l/s per person, creating two levels of bioeffluents with carbon dioxide (CO2) at 500 or 1600 ppm. Subjective ratings were collected, cognitive performance was examined and physiological responses were monitored. The results show that exposures to human bioeffluents at ventilation rate...

  4. Investigation of Elemental Mass Spectrometry in Pharmacology for Peptide Quantitation at Femtomolar Levels.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Cordeau

    Full Text Available In the search of new robust and environmental-friendly analytical methods able to answer quantitative issues in pharmacology, we explore liquid chromatography (LC associated with elemental mass spectrometry (ICP-MS to monitor peptides in such complex biological matrices. The novelty is to use mass spectrometry to replace radiolabelling and radioactivity measurements, which represent up-to now the gold standard to measure organic compound concentrations in life science. As a proof of concept, we choose the vasopressin (AVP/V1A receptor system for model pharmacological assays. The capacity of ICP-MS to provide highly sensitive quantitation of metallic and hetero elements, whatever the sample medium, prompted us to investigate this technique in combination with appropriate labelling of the peptide of interest. Selenium, that is scarcely present in biological media, was selected as a good compromise between ICP-MS response, covalent tagging ability using conventional sulfur chemistry and peptide detection specificity. Applying selenium monitoring by elemental mass spectrometry in pharmacology is challenging due to the very high salt content and organic material complexity of the samples that produces polyatomic aggregates and thus potentially mass interferences with selenium detection. Hyphenation with a chromatographic separation was found compulsory. Noteworthy, we aimed to develop a straightforward quantitative protocol that can be performed in any laboratory equipped with a standard macrobore LC-ICP-MS system, in order to avoid time-consuming sample treatment or special implementation of instrumental set-up, while allowing efficient suppression of all mass interferences to reach the targeted sensitivity. Significantly, a quantification limit of 57 ng Se L-1 (72 femtomoles of injected Se was achieved, the samples issued from the pharmacological assays being directly introduced into the LC-ICP-MS system. The established method was successfully

  5. The determination of low level trace elements in coals by laser ablation-inductively coupled plasma-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Booth, C.A.; Spears, D.A.; Krause, P.; Cox, A.G. [University of Sheffield, Sheffield (United Kingdom). Dept. of Earth Sciences

    1999-11-01

    The rapid determination of elements present in low level concentrations in bituminous coals is possible using laser abalation-inductively coupled plasma-mass spectrometry (l.a.-i.c.p.-m.s.). A wide range of trace elements can routinely be determined using this technique but it is for environmentally sensitive elements, such as As, Cd, Mo, Sb, Se and Hg, that it is of most use due to the low levels of detection. Calibration of the i.c.p.-m.s. was achieved using a series of uncertified coals and the method evaluated using the South African certified coals, Sarm 18, 19 and 20. A critical evaluation of the data obtained shows that for many of the elements studied the results obtained are both accurate and precise, even at very low concentrations, with the limits of detection for all of the elements being in the {mu}g/kg (parts per billion) range. 6 refs., 3 figs., 9 tabs.

  6. Cardiac response and anxiety levels in psychopathic murderers

    OpenAIRE

    Serafim,Antonio de Pádua; Barros,Daniel Martins de; Valim,André; Gorenstein,Clarice

    2009-01-01

    OBJECTIVE: To compare the emotional response and level of anxiety of psychopathic murderers, non-psychopathic murderers, and nonpsychopathic non-criminals. METHOD: 110 male individuals aged over 18 years were divided into three groups: psychopathic murderers (n = 38); non-psychopathic murderers (n = 37) serving sentences for murder convictions in Maximum Security Prisons in the State of Sao Paulo; and non-criminal, non-psychopathic individuals (n = 35) according to the Psychopathy Checklist-R...

  7. Response of sunflower to various levels of nitrogen and phosphorus

    International Nuclear Information System (INIS)

    Arif, M.; Karar, K.M.

    2003-01-01

    To study the response of sunflower to various levels of nitrogen and phosphorous, an experiment was conducted in pots at NWFP Agricultural University Peshawar, during 1997. Four nitrogen levels 0, 80, 120, 160 kg/ha and three phosphorous levels 0,60,90 kg/ha were included in the experiment. Increase in nitrogen levels significantly increased head diameter, grain yield per head and thousand-grain weight. Maximum head diameter (25.71), grain yield per head (114.84g) and thousand-grain weight (75.67g) was recorded at nitrogen level of 160 kg/ha. Increased in phosphorus level increased plant height and thousand grains weight. Tallest plants (198.92cm) were observed at 6Okg P/ha while heavy grains (70.67g) were recorded at P level of 9Okg P/sub 2/O/sub 5/ha. It is concluded that l60kg N/ha and 9Okg P/ha is proper dose of N and P for sunflower hybrid. (author)

  8. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  9. Effects of industrial processing on essential elements and regulated and emerging contaminant levels in seafood.

    Science.gov (United States)

    Rasmussen, Rie Romme; Søndergaard, Annette Bøge; Bøknæs, Niels; Cederberg, Tommy Licht; Sloth, Jens Jørgen; Granby, Kit

    2017-06-01

    Mitigation of contaminants in industrial processing was studied for prawns (cooked and peeled), Greenland halibut (cold smoked) and Atlantic salmon (cold smoked and trimmed). Raw prawns had significantly higher cadmium, chromium, iron, selenium and zinc content in autumn than in spring, while summer levels typically were intermediate. Peeling raw prawns increased mercury concentration but reduced the concentration of all other elements including inorganic arsenic, total arsenic, chromium, zinc, selenium but especially cadmium, copper and iron (p processing was observed. Non-toxic organic arsenic in raw Greenland halibut (N = 10) and salmon (N = 4) did not transform to carcinogenic inorganic arsenic during industrial cold smoking. Hence inorganic arsenic was low (Processing salmon did not significantly change any levels (calculated both per wet weight, dry weight or lipid content). Cold smoking decreased total arsenic (17%) and increased PCB congeners (10-22%) in Greenland halibut (wet weight). However PFOS, PCB and PBDE congeners were not different in processed Greenland halibut when corrected for water loss or lipid content. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Quantum biology at the cellular level--elements of the research program.

    Science.gov (United States)

    Bordonaro, Michael; Ogryzko, Vasily

    2013-04-01

    Quantum biology is emerging as a new field at the intersection between fundamental physics and biology, promising novel insights into the nature and origin of biological order. We discuss several elements of QBCL (quantum biology at cellular level) - a research program designed to extend the reach of quantum concepts to higher than molecular levels of biological organization. We propose a new general way to address the issue of environmentally induced decoherence and macroscopic superpositions in biological systems, emphasizing the 'basis-dependent' nature of these concepts. We introduce the notion of 'formal superposition' and distinguish it from that of Schroedinger's cat (i.e., a superposition of macroscopically distinct states). Whereas the latter notion presents a genuine foundational problem, the former one contradicts neither common sense nor observation, and may be used to describe cellular 'decision-making' and adaptation. We stress that the interpretation of the notion of 'formal superposition' should involve non-classical correlations between molecular events in a cell. Further, we describe how better understanding of the physics of Life can shed new light on the mechanism driving evolutionary adaptation (viz., 'Basis-Dependent Selection', BDS). Experimental tests of BDS and the potential role of synthetic biology in closing the 'evolvability mechanism' loophole are also discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Predicting protein folding pathways at the mesoscopic level based on native interactions between secondary structure elements

    Directory of Open Access Journals (Sweden)

    Sze Sing-Hoi

    2008-07-01

    Full Text Available Abstract Background Since experimental determination of protein folding pathways remains difficult, computational techniques are often used to simulate protein folding. Most current techniques to predict protein folding pathways are computationally intensive and are suitable only for small proteins. Results By assuming that the native structure of a protein is known and representing each intermediate conformation as a collection of fully folded structures in which each of them contains a set of interacting secondary structure elements, we show that it is possible to significantly reduce the conformation space while still being able to predict the most energetically favorable folding pathway of large proteins with hundreds of residues at the mesoscopic level, including the pig muscle phosphoglycerate kinase with 416 residues. The model is detailed enough to distinguish between different folding pathways of structurally very similar proteins, including the streptococcal protein G and the peptostreptococcal protein L. The model is also able to recognize the differences between the folding pathways of protein G and its two structurally similar variants NuG1 and NuG2, which are even harder to distinguish. We show that this strategy can produce accurate predictions on many other proteins with experimentally determined intermediate folding states. Conclusion Our technique is efficient enough to predict folding pathways for both large and small proteins at the mesoscopic level. Such a strategy is often the only feasible choice for large proteins. A software program implementing this strategy (SSFold is available at http://faculty.cs.tamu.edu/shsze/ssfold.

  12. The Effect of Smoking on the Serum Level of Some Trace Elements in Pregnant Women

    International Nuclear Information System (INIS)

    El-Ghetany, SH.M.; Ahmad, M.H.; Marei, E.S.; Ashrey, H. A.

    2005-01-01

    Maternal smoking during pregnancy is a cause of many adverse outcomes, not only during fetal life, but may also extend to childhood and even early adulthood. This study was designed to evaluate the effect of tobacco smoking on some trace elements on pregnant mothers who smoke and their newborns. The study was carried out on 150 pregnant women and their newborns; fifty smokers (group I), fifty passive smoker subjects (group II) and 50 non-smokers served as controls (group III). Their neonates were also categorized into three groups accordingly. Maternal urine cotinine was determined by radioimmunoassay as an indicator for the degree of influence of smoking, it confirmed a significant elevation among groups I and II. The serum levels of zinc (Zn), selenium (Se), copper (Cu), cadmium (Cd), manganese (Mn) and magnesium (Mg) were measured in the serum of pregnant mothers and the cord serum of their newborns by atomic absorption spectrophotometer. This study demonstrated significant lower concentrations of serum Zn and Se in group I and II and their newborns when compared to the control group and control newborns. Significant increases in serum Cd and Cu were observed in-group I and II and their neonates versus the controls. As regards Mn and Mg no significant difference was established between the three studied groups. Our results suggested that tobacco smoking had definite effect on some trace elements that absolutely had drawbacks on both pregnant mothers and their babies. Tobacco smoke contains many toxic, mutagenic and teratogenic substances. Several epidemiological studies illustrated that cigarette smoking among females during the reproductive period have a direct insult on the nutritional and health status of their babies (Jauniaux et al, 1999). Cigarette smoking

  13. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  14. The influence of pulse duration on the stress levels in ablation of ceramics: A finite element study

    International Nuclear Information System (INIS)

    Verde, A. Vila; Ramos, Marta M.D.

    2006-01-01

    We present a finite element model to investigate the dynamic thermal and mechanical response of ceramic materials to pulsed infrared radiation. The model was applied to the specific problem of determining the influence of the pulse duration on the stress levels reached in human dental enamel irradiated by a CO 2 laser at 10.6 μm with pulse durations between 0.1 and 100 μs and sub-ablative fluence. Our results indicate that short pulses with durations much larger than the characteristic acoustic relaxation time of the material can still cause high stress transients at the irradiated site, and indicate that pulse durations of the order of 10 μs may be more adequate both for enamel surface modification and for ablation than pulse durations up to 1 μs. The model presented here can easily be modified to investigate the dynamic response of ceramic materials to mid-infrared radiation and help determine optimal pulse durations for specific procedures

  15. State-level emergency preparedness and response capabilities.

    Science.gov (United States)

    Watkins, Sharon M; Perrotta, Dennis M; Stanbury, Martha; Heumann, Michael; Anderson, Henry; Simms, Erin; Huang, Monica

    2011-03-01

    Prior assessments of public health readiness had identified gaps in radiation preparedness. In recent years, preparedness planning has involved an "all-hazards" approach. Current assessment of the national status related to radiation public health emergency preparedness capabilities at the state and local health department levels was needed. A survey of state health departments related to radiation readiness was undertaken in 2010 by the Council of State and Territorial Epidemiologists (CSTE). States with nuclear power plants were instructed to consider their responses exclusive of capabilities and resources related to the plants given that the emergency response plans for nuclear power plants are specific and unique. Thirty-eight (76%) state health departments responded to the survey, including 26 of the 31 states with nuclear power plants. Specific strengths noted at the state level included that the majority of states had a written radiation response plan and most plans include a detailed section for communications issues during a radiation emergency. In addition, more than half of the states indicated that their relationship with federal partners is sufficient to provide resources for radiation emergencies, indicating the importance states placed on federal resources and expertise. Specific weaknesses are discussed and include that most states had completed little to no planning for public health surveillance to assess potential human health impacts of a radiation event; less than half had written plans to address exposure assessment, environmental sampling, human specimen collection and analysis, and human health assessment. Few reported having sufficient resources to do public health surveillance, radiation exposure assessment, laboratory functions and other capabilities. Levels of planning, resources and partnerships varied among states, those with nuclear power plants were better prepared. Gaps were evident in all states; however and additional training and

  16. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  17. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  18. Exercise responses in patients with chronically high creatine kinase levels.

    Science.gov (United States)

    Cooper, Christopher B; Dolezal, Brett A; Neufeld, Eric V; Shieh, Perry; Jenner, John R; Riley, Marshall

    2017-08-01

    Elevated serum creatine kinase (CK) is often taken to reflect muscle disease, but many individuals have elevated CK without a specific diagnosis. How elevated CK reflects muscle metabolism during exercise is not known. Participants (46 men, 48 women) underwent incremental exercise testing to assess aerobic performance, cardiovascular response, and ventilatory response. Serum lactate, ammonia, and CK were measured at rest, 4 minutes into exercise, and 2 minutes into recovery. High-CK and control subjects demonstrated similar aerobic capacities and cardiovascular responses to incremental exercise. Those with CK ≥ 300 U/L exhibited significantly higher lactate and ammonia levels after maximal exercise, together with increased ventilatory responses, whereas those with CK ≥200 U/L but ≤ 300 U/L did not. We recommend measurement of lactate and ammonia profiles during a maximal incremental exercise protocol to help identify patients who warrant muscle biopsy to rule out myopathy. Muscle Nerve 56: 264-270, 2017. © 2016 Wiley Periodicals, Inc.

  19. On analyzing free-response data on location level

    Science.gov (United States)

    Bandos, Andriy I.; Obuchowski, Nancy A.

    2017-03-01

    Free-response ROC (FROC) data are typically collected when primary question of interest is focused on the proportions of the correct detection-localization of known targets and frequencies of false positive responses, which can be multiple per subject (image). These studies are particularly relevant for CAD and related applications. The fundamental tool of the location-level FROC analysis is the FROC curve. Although there are many methods of FROC analysis, as we describe in this work, some of the standard and popular approaches, while important, are not suitable for analyzing specifically the location-level FROC performance as summarized by the FROC curve. Analysis of the FROC curve, on the other hand, might not be straightforward. Recently we developed an approach for the location-level analysis of the FROC data using the well-known tools for clustered ROC analysis. In the current work, based on previously developed concepts, and using specific examples, we demonstrate the key reasons why specifically location-level FROC performance cannot be fully addressed by the common approaches as well as illustrate the proposed solution. Specifically, we consider the two most salient FROC approaches, namely JAFROC and the area under the exponentially transformed FROC curve (AFE) and show that clearly superior FROC curves can have lower values for these indices. We describe the specific features that make these approaches inconsistent with FROC curves. This work illustrates some caveats for using the common approaches for location-level FROC analysis and provides guidelines for the appropriate assessment or comparison of FROC systems.

  20. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  1. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  2. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  3. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  4. Study of the influencing factors of the blood levels of toxic elements in Africans from 16 countries

    International Nuclear Information System (INIS)

    Henríquez-Hernández, Luis Alberto; Luzardo, Octavio P.; Boada, Luis D.; Carranza, Cristina; Pérez Arellano, José Luis; González-Antuña, Ana; Almeida-González, Maira; Barry-Rodríguez, Carlos; Zumbado, Manuel; Camacho, María

    2017-01-01

    Africa's economy is growing faster than any other continent and it has been estimated that the middle class in Africa now exceeds 350 million people. This has meant a parallel increase in the importation of consumer goods and in the implementation of communication and information technologies (ICT), but also in the generation of large quantities of e-waste. However, inadequate infrastructure development remains a major constraint to the continent's economic growth and these highly toxic residues are not always adequately managed. Few studies have been conducted to date assessing the possible association between socioeconomic development factors, including e-waste generation, and blood levels of inorganic elements in African population. To disclose the role of geographical, anthropogenic, and socioeconomic development determinants on the blood levels of Ag, Al, As, Be, Cd, Co, Cr, Hg, Ni, Pb, Sb, and V —all of them frequently found in e-waste—, an immigrant population-based study was made including a total of 245 subjects from 16 countries recently arrived to the Canary Islands (Spain). Women presented higher levels of blood elements than men, and Northern Africans (Moroccans) were the most contaminated. People from low-income countries exhibited significantly lower blood levels of inorganic elements than those from middle-income countries. We found a significant association between the use of motor vehicles and the implementation of information and communication technologies (ICT) and the level of contamination. Immigrants from the countries with a high volume of imports of second-hand electronic equipment, telephone and internet use had higher levels of inorganic elements. In general terms, the higher level of economic development the higher the blood levels of inorganic pollutants, suggesting that the economic development of Africa, in parallel to e-waste generation and the existence of informal recycling sites, have directly affected the level of

  5. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  6. Fitness Level Modulates Intraocular Pressure Responses to Strength Exercises.

    Science.gov (United States)

    Vera, Jesús; Jiménez, Raimundo; Redondo, Beatríz; Cárdenas, David; García-Ramos, Amador

    2018-06-01

    Purpose/Aim: The execution of strength exercises has demonstrated to increase the intraocular pressure (IOP) levels, and it may have a negative impact on the ocular health. We aimed to explore the influence of fitness level on the acute IOP response to strength exercises performed under different loading conditions, as well as to test whether the IOP responses differ between the bench press and jump squat when performed against the same relative loads. Forty military personnel males were divided in two subgroups (20 high-fit and 20 low-fit) based on their relative to body mass one-repetition maximum (1-RM). Participants performed an incremental loading test in the bench press and jump squat exercises, and IOP was assessed before and after each repetition by rebound tonometry. IOP increased immediately after executing both exercises (p e., high-fit and low-fit) and in both exercises (R 2 range: 0.81-1.00). Higher fitness level attenuated the IOP rise produced by both exercises (p < 0.01 in both cases). The bench press induced higher IOP increments than the jump squat for both groups at relative loads of ~50%1-RM and ~60%1-RM (p < 0.01 in all cases). These data indicate that IOP increases as a consequence of performing strength exercises, being the increment accentuated with the increase of the load and in the bench press compared to the jump squat exercise. Of special importance would be that the IOP responses were significantly reduced in high-fit individuals. These findings should be addressed in glaucoma patients.

  7. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  8. Attention-level transitory response: a novel hybrid BCI approach

    Science.gov (United States)

    Diez, Pablo F.; Garcés Correa, Agustina; Orosco, Lorena; Laciar, Eric; Mut, Vicente

    2015-10-01

    Objective. People with disabilities may control devices such as a computer or a wheelchair by means of a brain-computer interface (BCI). BCI based on steady-state visual evoked potentials (SSVEP) requires visual stimulation of the user. However, this SSVEP-based BCI suffers from the ‘Midas touch effect’, i.e., the BCI can detect an SSVEP even when the user is not gazing at the stimulus. Then, these incorrect detections deteriorate the performance of the system, especially in asynchronous BCI because ongoing EEG is classified. In this paper, a novel transitory response of the attention-level of the user is reported. It was used to develop a hybrid BCI (hBCI). Approach. Three methods are proposed to detect the attention-level of the user. They are based on the alpha rhythm and theta/beta rate. The proposed hBCI scheme is presented along with these methods. Hence, the hBCI sends a command only when the user is at a high-level of attention, or in other words, when the user is really focused on the task being performed. The hBCI was tested over two different EEG datasets. Main results. The performance of the hybrid approach is superior to the standard one. Improvements of 20% in accuracy and 10 bits min-1 are reported. Moreover, the attention-level is extracted from the same EEG channels used in SSVEP detection and this way, no extra hardware is needed. Significance. A transitory response of EEG signal is used to develop the attention-SSVEP hBCI which is capable of reducing the Midas touch effect.

  9. Second level semi-degenerate fields in W{sub 3} Toda theory: matrix element and differential equation

    Energy Technology Data Exchange (ETDEWEB)

    Belavin, Vladimir [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physical Institute,Leninsky Avenue 53, 119991 Moscow (Russian Federation); Department of Quantum Physics, Institute for Information Transmission Problems,Bolshoy Karetny per. 19, 127994 Moscow (Russian Federation); Moscow Institute of Physics and Technology,Dolgoprudnyi, 141700 Moscow region (Russian Federation); Cao, Xiangyu [LPTMS, CNRS (UMR 8626), Université Paris-Saclay,15 rue Georges Clémenceau, 91405 Orsay (France); Estienne, Benoit [LPTHE, CNRS and Université Pierre et Marie Curie, Sorbonne Universités,4 Place Jussieu, 75252 Paris Cedex 05 (France); Santachiara, Raoul [LPTMS, CNRS (UMR 8626), Université Paris-Saclay,15 rue Georges Clémenceau, 91405 Orsay (France)

    2017-03-02

    In a recent study we considered W{sub 3} Toda 4-point functions that involve matrix elements of a primary field with the highest-weight in the adjoint representation of sl{sub 3}. We generalize this result by considering a semi-degenerate primary field, which has one null vector at level two. We obtain a sixth-order Fuchsian differential equation for the conformal blocks. We discuss the presence of multiplicities, the matrix elements and the fusion rules.

  10. Examining the best-fit paradigm for FEM at element level

    Indian Academy of Sciences (India)

    Interestingly, an esoteric branch of pure mathematics called “functional analysis”, more general and profound than variational calculus and originally developed by mathematicians, can be employed to explain clearly how the finite element machinery works. In a very abstract way, finite element results can be portrayed as ...

  11. Zero-field magnetic response functions in Landau levels

    Science.gov (United States)

    Gao, Yang; Niu, Qian

    2017-07-01

    We present a fresh perspective on the Landau level quantization rule; that is, by successively including zero-field magnetic response functions at zero temperature, such as zero-field magnetization and susceptibility, the Onsager’s rule can be corrected order by order. Such a perspective is further reinterpreted as a quantization of the semiclassical electron density in solids. Our theory not only reproduces Onsager’s rule at zeroth order and the Berry phase and magnetic moment correction at first order but also explains the nature of higher-order corrections in a universal way. In applications, those higher-order corrections are expected to curve the linear relation between the level index and the inverse of the magnetic field, as already observed in experiments. Our theory then provides a way to extract the correct value of Berry phase as well as the magnetic susceptibility at zero temperature from Landau level fan diagrams in experiments. Moreover, it can be used theoretically to calculate Landau levels up to second-order accuracy for realistic models.

  12. Levels of trace elements in different varieties of wheat determined by Atomic Absorption Spectroscopy

    International Nuclear Information System (INIS)

    Mohamed, A.E.; Taha, G.M.

    2003-01-01

    Trace elements Ag, Au, Ca, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, Pb, Sr and Zn were determined in six wheat samples purchased from the open market in different localities (Egypt, Saudi Arabia, Yemen, Oman, Dubai and Australia). The dried powdered samples were decomposed in HNO3-HClO4 acids mixtures and elements were determined using recording atomic absorption spectrophotometer. The results were within the safety baseline of all the assayed elements. Certified biological standards, Brown's Kale (BK), Orchard Leaves (OL) and tomato leaves (TOML) were used to assure the accuracy of results. However, Co, Pb and Sr were absent from samples except the Egyptian samples. The obtained databases were statistically treated. Several significant and strong positive correlation coefficients (r=0.506-1.00) between the groups of elements were observed. On the other hand, strong negative correlations (r=0.492-0.873) between another group of elements were also shown. (author)

  13. Response of Wheat Genotypes to Different Levels of Nitrogen

    Directory of Open Access Journals (Sweden)

    Shukra Raj Shrestha

    2016-12-01

    Full Text Available A field experiment was conducted using six genotypes of wheat (Triticum aestivum L. for response to different levels of nitrogen (N use. The experiment was laid out in split plot design with four levels (0, 50, 100 and 150 kg N ha-1 as main plots and six wheat genotypes (BL 3623, BL 3629, BL 3872, NL 1008, NL 1055 and Vijay, a check variety as sub-plots. Grain yield and other yield components increased linearly in response to N concentrations in both seasons. Only two parameters: days to heading (DOH and days to maturity (DTM varied significantly (p ≤ 0.05 among wheat genotypes in both the years. None of the parameters showed interaction effects in both seasons. Vijay showed highest grain yield of 3.12 t ha-1 in 2013 with the application of 100 kg N ha-1, and 3.23 t ha-1 in 2014 with 150 kg N ha-1. Spike length, productive tillers m-2, number of spikes m-2 and test weight were greater with higher N rates. The straw yield of wheat fertilized with 150 kg N ha-1 was the highest in Vijay (4.35 t ha-1 and BL 3872 (4.33 t ha-1, respectively. Vijay with 100 kg N ha-1 produced the highest number of productive tillers m-2 (276.33 in 2013 and 296.00 with the application of 150 kg N ha-1 in 2014.

  14. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  15. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  16. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  17. Determination of trace element levels in leaves of Nerium oleander using X-Ray Fluorescence

    International Nuclear Information System (INIS)

    Santos, Ramon S.; Sanches, Francis A.C.R.A.; Neves, Arthur O.P.; Oliveira, Luis F.; Oliveira, Davi F.; Anjos, Marcelino J.

    2013-01-01

    The environmental pollution by human activity has been one of the most concerns in the last years, principally due to rapid urban growth in the cities and the industrialization process. The air pollution can be increased due to several different kinds of emissions: urban traffic, industrial activities, burning fuel, civil industry of construction/demolition, fires and natural phenomena. Many of these emissions move from long distances due to convections currents and finally tend to deposit mainly in the plants leaves and in the soil. Thus, the plants leaves works as a natural sampler by the emissions deposit in these ones. In this study Nerium oleander leaves were used to measure the environmental pollutions levels in different sampling urban regions in the city of Rio de Janeiro/RJ: Andarai, Benfica, Bonsucesso, Caju, Engenho de Dentro, Engenho Novo, Estacio, Grajau, Inhauma, Lins, Maracana, Maria da Graca, Meier, Praca da Bandeira, Riachuelo, Rio Comprido, Sao Cristovao, Tijuca, Vila Isabel and city Center. The control samples were collected in Campo Grande near of Parque Nacional da Pedra Branca/RJ (National Park of Pedra Branca/RJ). The leaves were collected from adult plants and after the collection the samples were cleaned and placed in the greenhouse for drying, then were mashed and pressed into tablets forms. The analyses were performed using the energy dispersion X-ray fluorescence (EDXRF), developed on the own laboratory and based in a SiPIN detector and a mini X ray tube. It was possible to detect 16 elements in the analyzed samples: K, Ca, Cr, Mn, Fe, Cu, Zn, Br, Rb, Sr, Ba and Pb. The results shows that, in the studied areas, the analysis of the Nerium oleander plant shows a low-cost option and with a substantial efficiency as an environmental pollution biomonitor. (author)

  18. Determination of trace element levels in leaves of Nerium oleander using X-Ray Fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Ramon S.; Sanches, Francis A.C.R.A.; Neves, Arthur O.P.; Oliveira, Luis F.; Oliveira, Davi F.; Anjos, Marcelino J. [Universidade do Estado do Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil). Inst. de Fisica Armando Dias Tavares. Dept. de Fisica Aplicada e Termodinamica

    2013-07-01

    The environmental pollution by human activity has been one of the most concerns in the last years, principally due to rapid urban growth in the cities and the industrialization process. The air pollution can be increased due to several different kinds of emissions: urban traffic, industrial activities, burning fuel, civil industry of construction/demolition, fires and natural phenomena. Many of these emissions move from long distances due to convections currents and finally tend to deposit mainly in the plants leaves and in the soil. Thus, the plants leaves works as a natural sampler by the emissions deposit in these ones. In this study Nerium oleander leaves were used to measure the environmental pollutions levels in different sampling urban regions in the city of Rio de Janeiro/RJ: Andarai, Benfica, Bonsucesso, Caju, Engenho de Dentro, Engenho Novo, Estacio, Grajau, Inhauma, Lins, Maracana, Maria da Graca, Meier, Praca da Bandeira, Riachuelo, Rio Comprido, Sao Cristovao, Tijuca, Vila Isabel and city Center. The control samples were collected in Campo Grande near of Parque Nacional da Pedra Branca/RJ (National Park of Pedra Branca/RJ). The leaves were collected from adult plants and after the collection the samples were cleaned and placed in the greenhouse for drying, then were mashed and pressed into tablets forms. The analyses were performed using the energy dispersion X-ray fluorescence (EDXRF), developed on the own laboratory and based in a SiPIN detector and a mini X ray tube. It was possible to detect 16 elements in the analyzed samples: K, Ca, Cr, Mn, Fe, Cu, Zn, Br, Rb, Sr, Ba and Pb. The results shows that, in the studied areas, the analysis of the Nerium oleander plant shows a low-cost option and with a substantial efficiency as an environmental pollution biomonitor. (author)

  19. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  20. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  1. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  2. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  3. Investigation of waste form materials suitable for immobilizing actinide elements in high-level waste

    International Nuclear Information System (INIS)

    Hayakawa, Issei; Kamizono, Hiroshi

    1992-07-01

    The microstructure of waste form materials suitable for immobilizing actinide elements can be classified into the following two categories. (1) Actinide elements are immobilized in an crystallized matrix after the formation of solid solution or compounds. (2) Actinide elements are immobilized in a durable material by encapsulation. Based on crystal chemistry, durability data, phase diagrams, compositions of natural minerals, eleven oxide compounds and one non-oxide compound are pointed out to be new candidates included in category (1). The other survey on material compositions, manufacturing conditions and feasibility shows that SiC, glassy carbon, ZrO 2 , Ti-O-Si-C ceramics are preferable matrix materials included in category (2). Polymers and fine powders are suitable as starting materials for the encapsulation of actinide elements because of their excellent sinterability. (author) 50 refs

  4. Examining the best-fit paradigm for FEM at element level

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    mathematical physics that are not always amenable to analytical methods. ... Invoking the virtual work principle, one can use an approximate ...... Reddy J N 2003 An introduction to the finite element method (New Delhi: Tata McGraw-Hill).

  5. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  7. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  8. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  9. Bean leaf growth response to moderate ozone levels

    Energy Technology Data Exchange (ETDEWEB)

    Evans, L S

    1973-01-01

    The middle leaflet from the first trifoliate leaf of pinto bean plants (Phaseolus vulgaris) was subjected to various ozone levels for both 12 and 24 h to show moderate oxidant injury. Rates of leaf expansion were used as criteria to measure the effects of ozone at three leaflet positions. Growth analysis included Y-intercepts indicating growth after day 1, growth after day 3, and regression line slopes between days 1 and 7 after the beginning of the experiments. Slopes of growth rate regression lines differentiated untreated leaflets from leaflets exposed to a 0.60 ppm-h (0.05 ppm for 12 h) dose. Growth rates of plants exposed to 1.20 ppm-h (either 0.05 ppm for 24 h, or 0.10 ppm for 12 h) were distinguishable from untreated plants within three days. Basal leaf portions showed the most differential ozone response compared with lateral and tip positions.

  10. Dose response curves for effects of low-level radiation

    International Nuclear Information System (INIS)

    Myers, D.K.

    1980-01-01

    The linear dose-response model used by international committees to assess the genetic and carcinogenic hazards of low-level radiation appears to be the most reasonable interpretation of the available scientific data that are relevant to this topic. There are, of course, reasons to believe that this model may overestimate radiation hazards in certain instances, a fact acknowledged in recent reports of these committees. The linear model is now also being utilized to estimate the potential carcinogenic hazards of other agents such as asbestos and polycyclic aromatic hydrocarbons. This model implies that there is no safe dose for any of these agents and that potential health hazards will increase in direct proportion to total accumulated dose. The practical implication is the recommendation that all exposures should be kept 'as low as reasonably achievable, economic and social factors being taken into account'. (auth)

  11. Trophic level responses differ as climate warms in Ireland

    Science.gov (United States)

    Donnelly, Alison; Yu, Rong; Liu, Lingling

    2015-08-01

    Effective ecosystem functioning relies on successful species interaction. However, this delicate balance may be disrupted if species do not respond to environmental change at a similar rate. Here we examine trends in the timing of spring phenophases of groups of species occupying three trophic levels as a potential indicator of ecosystem response to climate warming in Ireland. The data sets were of varying length (1976-2009) and from varying locations: (1) timing of leaf unfolding and May Shoot of a range of broadleaf and conifer tree species, (2) first appearance dates of a range of moth species, and (3) first arrival dates of a range of spring migrant birds. All three groups revealed a statistically significant ( Pphenology that was driven by rising spring temperature ( P<0.05; 0.45 °C /decade). However, the rate of advance was greater for moths (1.8 days/year), followed by birds (0.37 days/year) and trees (0.29 days/year). In addition, the length of time between (1) moth emergence and leaf unfolding and (2) moth emergence and bird arrival decreased significantly ( P<0.05 and P<0.001, respectively), indicating a decrease in the timing between food supply and demand. These differing trophic level response rates demonstrate the potential for a mismatch in the timing of interdependent phenophases as temperatures rise. Even though these data were not specifically collected to examine climate warming impacts, we conclude that such data may be used as an early warning indicator and as a means to monitor the potential for future ecosystem disruption to occur as climate warms.

  12. Estimating Derived Response Levels at the Savannah River Site for Use with Emergency Response Models

    International Nuclear Information System (INIS)

    Simpkins, A.A.

    2002-01-01

    Emergency response computer models at the Savannah River Site (SRS) are coupled with real-time meteorological data to estimate dose to individuals downwind of accidental radioactive releases. Currently, these models estimate doses for inhalation and shine pathways, but do not consider dose due to ingestion of contaminated food products. The Food and Drug Administration (FDA) has developed derived intervention levels (DIL) which refer to the radionuclide-specific concentration in food present throughout the relevant period of time, with no intervention, that could lead to an individual receiving a radiation dose equal to the protective action guide. In the event of an emergency, concentrations in various food types are compared with these levels to make interdictions decisions. Prior to monitoring results being available, concentrations in the environmental media (i.e. soil), called derived response levels (DRLs), can be estimated from the DILs and directly compared with computer output to provide preliminary guidance as to whether intervention is necessary. Site-specific derived response levels (DRLs) are developed for ingestion pathways pertinent to SRS: milk, meat, fish, grain, produce, and beverage. This provides decision-makers with an additional tool for use immediately following an accident prior to the acquisition of food monitoring data

  13. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  14. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  15. Technical responsibilities in low-level waste disposal

    International Nuclear Information System (INIS)

    Murray, R.L.; Walker, C.K.

    1989-01-01

    North Carolina will be the host state for a low-level radioactive waste (LLRW) disposal facility serving the Southeast Compact for 20 yr beginning in 1993. Primary responsibility for the project rests with the North Carolina Low-Level Radioactive Waste Management Authority, a citizen board. The North Carolina project embodies a unique combination of factors that places the authority in a position to exercise technical leadership in the LLRW disposal field. First, the Southeast Compact is the largest in the United States in terms of area, population, and waste generation. second, it is in a humid rather than an arid region. Third, the citizens of the state are intensely interested in preserving life style, environment, and attractiveness of the region to tourists and are especially sensitive to the presence of waste facilities of any kind. Finally, disposal rules set by the Radiation Protection Commission and enforced by the Radiation Protection Section are stricter than the U.S. Nuclear Regulatory Commission's 10CFR61. These four factors support the authority's belief that development of the facility cannot be based solely on engineering and economics, but that social factors, including perceptions of human risk, concerns for the environment, and opinions about the desirability of hosting a facility, should be integral to the project. This philosophy guides the project's many technical aspects, including site selection, site characterization, technology selection and facility design, performance assessment modeling, and waste reduction policies. Each aspect presents its own unique problems

  16. Modes of occurrence of potentially hazardous elements in coal: levels of confidence

    Science.gov (United States)

    Finkelman, R.B.

    1994-01-01

    The modes of occurrence of the potentially hazardous elements in coal will be of significance in any attempt to reduce their mobilization due to coal combustion. Antimony and selenium may be present in solid solution in pyrite, as minute accessory sulfides dispersed throughout the organic matrix, or in organic association. Because of these modes of occurrence it is anticipated that less than 50% of these elements will be routinely removed by conventional coal cleaning procedures. Arsenic and mercury occur primarily in late-stage coarse-grained pyrite therefore physical coal cleaning procedures should be successful in removing substantial proportions of these elements. Cadmium occurs in sphalerite and lead in galena. Both of these minerals exhibit a wide range of particle sizes and textural relations. Depending on the particle size and textural relations, physical coal cleaning may remove as little as 25% of these elements or as much as 75%. Manganese in bituminous coal occurs in carbonates, especially siderite. Physical coal cleaning should remove a substantial proportion of this element. More information is needed to elucidate the modes of occurrence of beryllium, chromium, cobalt, and nickel. ?? 1994.

  17. A finite element/level set model of polyurethane foam expansion and polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Rekha R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Long, Kevin Nicholas [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Roberts, Christine Cardinal [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Celina, Mathias C. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brunini, Victor [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Soehnel, Melissa Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Noble, David R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Tinsley, James [Honeywell Federal Manufacturing & Technologies, Kansas City, MO (United States); Mondy, Lisa [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-12-01

    Polyurethane foams are used widely for encapsulation and structural purposes because they are inexpensive, straightforward to process, amenable to a wide range of density variations (1 lb/ft3 - 50 lb/ft3), and able to fill complex molds quickly and effectively. Computational model of the filling and curing process are needed to reduce defects such as voids, out-of-specification density, density gradients, foam decomposition from high temperatures due to exotherms, and incomplete filling. This paper details the development of a computational fluid dynamics model of a moderate density PMDI structural foam, PMDI-10. PMDI is an isocyanate-based polyurethane foam, which is chemically blown with water. The polyol reacts with isocyanate to produces the polymer. PMDI- 10 is catalyzed giving it a short pot life: it foams and polymerizes to a solid within 5 minutes during normal processing. To achieve a higher density, the foam is over-packed to twice or more of its free rise density of 10 lb/ft3. The goal for modeling is to represent the expansion, filling of molds, and the polymerization of the foam. This will be used to reduce defects, optimize the mold design, troubleshoot the processed, and predict the final foam properties. A homogenized continuum model foaming and curing was developed based on reaction kinetics, documented in a recent paper; it uses a simplified mathematical formalism that decouples these two reactions. The chemo-rheology of PMDI is measured experimentally and fit to a generalized- Newtonian viscosity model that is dependent on the extent of cure, gas fraction, and temperature. The conservation equations, including the equations of motion, an energy balance, and three rate equations are solved via a stabilized finite element method. The equations are combined with a level set method to determine the location of the foam-gas interface as it evolves to fill the mold. Understanding the thermal history and loads on the foam due to exothermicity and oven

  18. Effect of spatial resolution of soil data on predictions of eggshell trace element levels in the Rook Corvus frugilegus.

    Science.gov (United States)

    Orłowski, Grzegorz; Siebielec, Grzegorz; Kasprzykowski, Zbigniew; Dobicki, Wojciech; Pokorny, Przemysław; Wuczyński, Andrzej; Polechoński, Ryszard; Mazgajski, Tomasz D

    2016-12-01

    Although a considerable research effort has gone into studying the dietary pathways of metals to the bodies of laying female birds and their eggs in recent years, no detailed investigations have yet been carried out relating the properties of the biogeochemical environment at large spatial scales to eggshell trace element levels in typical soil-invertebrate feeding birds under natural conditions. We used data from a large-scale nationwide monitoring survey of soil quality in Poland (3724 sampling points from the 43 792 available) to predict levels of five trace elements (copper [Cu], cadmium [Cd], nickel [Ni], zinc [Zn] and lead [Pb]) in Rook Corvus frugilegus eggshells from 42 breeding colonies. Our major aim was to test whether differences exist in the explanatory power of soil data (acidity, content of elements and organic matter, and particle size) used as a correlate of concentrations of eggshell trace elements among four different distances (5, 10, 15 and 20 km) around rookeries. Over all four distances around the rookeries only the concentrations of Cu and Cd in eggshells were positively correlated with those in soil, while eggshell Pb was correlated with the soil Pb level at the two longest distances (15 and 20 km) around the rookeries. The physical properties of soil (primarily the increase in pH) adversely affected eggshell Cd and Pb concentrations. The patterns and factors governing metal bioaccumulation in soil invertebrates and eggshells appear to be coincident, which strongly suggests a general similarity in the biochemical pathways of elements at different levels of the food web. The increasing acidification of arable soil as a result of excessive fertilisation and over-nitrification can enhance the bioavailability of toxic elements to laying females and their eggs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. A Model for determination of screening levels for radioactive elements in soil

    International Nuclear Information System (INIS)

    Peres, Ana C.; Hiromoto, Goro

    2008-01-01

    Full text: At the present, decision about clean-up of Brazilian sites contaminated with radioactive isotopes is addressed on a case-by-case basis, since there is no general guidance or recommendation to support actions in early phases of the problem identification. For chemicals, CETESB - the governmental organization responsible for preventing and controlling environmental pollution in Sao Paulo State - established quality reference values for prevention and intervention, as the first step to implement a remediation policy based on human health risk assessment. The aim of this study is to develop a methodology for the establishment of target values for radioactive soil contamination, as far as possible consistent and compatible with the approach adopted by CETESB for sites contaminated with chemicals. The following steps have been addressed in this study: conceptual scenario and model development; codification of the equations in an electronic spreadsheet; selection of proper input values; derivation of the intervention levels for selected radionuclides using Monte Carlo methods. The mathematical model developed was mainly based on the equations used by the U.S. Environmental Protection Agency and by the National Council on Radiation Protection and Measurements for soil screening purposes. Results are presented for selected natural and man-made radioactive isotopes. (author)

  20. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  1. Relative element levels in the paired samples of scalp hair and fingernails of patients from New Delhi

    Energy Technology Data Exchange (ETDEWEB)

    Sukumar, A. [School of Environmental Sciences, Jawaharlal Nehru University, New Delhi-110 067 (India)]. E-mail: sukumarindia@rediffmail.com; Subramanian, R. [School of Environmental Sciences, Jawaharlal Nehru University, New Delhi-110 067 (India)

    2007-01-01

    Specific elements are bioconcentrated in human hair and nails, which have unique advantages of application in population monitoring studies thereby, recognized as biological tools for disease diagnosis and prevention. However, investigations are meager for relative element profile in hair and nails of same subjects. In this study, hair and nails were analyzed to find effects of age, sex, smoking habit, diet, urban and rural exposure gradients, occupation, and health on element levels. Scalp hair and fingernails were sampled along with a questionnaire from urban and rural subjects of New Delhi; patients of hypertension, coronary heart disease, and diabetes were identified clinically. Cadmium, chromium, copper, nickel, lead and zinc concentrations were determined by AAS in both the samples; CRM (human hair powder) analysis showed acceptable precision and accuracy in element measurement. In comparison to controls, Cr-H and Zn-H levels were lower respectively in female hypertensive and total hypertensive subjects, whereas, Zn-N and Cu-N were lower respectively in total CHD and diabetic subjects, and hypertensive and CHD urban subjects. Cd concentrations were higher in both the samples of tobacco smoking rural subjects than that of non-smokers. Farmers had lower Pb-H than rural businessmen did. Cr, Cu, Ni, and Zn concentrations were different due to rural and urban gradient but not to the influence of age, sex, and diet. Pb value was alone correlated between the paired samples. Thus, higher Cd levels in the smokers and lower Cr, Cu and Zn levels in the patients were observed.

  2. Relative element levels in the paired samples of scalp hair and fingernails of patients from New Delhi

    International Nuclear Information System (INIS)

    Sukumar, A.; Subramanian, R.

    2007-01-01

    Specific elements are bioconcentrated in human hair and nails, which have unique advantages of application in population monitoring studies thereby, recognized as biological tools for disease diagnosis and prevention. However, investigations are meager for relative element profile in hair and nails of same subjects. In this study, hair and nails were analyzed to find effects of age, sex, smoking habit, diet, urban and rural exposure gradients, occupation, and health on element levels. Scalp hair and fingernails were sampled along with a questionnaire from urban and rural subjects of New Delhi; patients of hypertension, coronary heart disease, and diabetes were identified clinically. Cadmium, chromium, copper, nickel, lead and zinc concentrations were determined by AAS in both the samples; CRM (human hair powder) analysis showed acceptable precision and accuracy in element measurement. In comparison to controls, Cr-H and Zn-H levels were lower respectively in female hypertensive and total hypertensive subjects, whereas, Zn-N and Cu-N were lower respectively in total CHD and diabetic subjects, and hypertensive and CHD urban subjects. Cd concentrations were higher in both the samples of tobacco smoking rural subjects than that of non-smokers. Farmers had lower Pb-H than rural businessmen did. Cr, Cu, Ni, and Zn concentrations were different due to rural and urban gradient but not to the influence of age, sex, and diet. Pb value was alone correlated between the paired samples. Thus, higher Cd levels in the smokers and lower Cr, Cu and Zn levels in the patients were observed

  3. In situ quantitative determination of transuranic elements in areas of high-level gamma radiation

    International Nuclear Information System (INIS)

    Brodzinski, R.L.; Wogman, N.A.

    1978-01-01

    A technique is described for passive neutron monitoring of transuranic elements. The method provides quantitative determinations of transuranic element concentrations in a variety of field situations where no other measurement method is possible. The technique can measure concentrations of transuranic oxides as low as 8 nCi/cmsup 3 and is capable of operating in gamma radiation fields up to megarads per hour. Information on chemical and isotopic composition can also be obtained from the data. Several successful applications of the technique are discussed. 1 ref

  4. In situ quantitative determination of transuranic elements in areas of high-level gamma radiation

    International Nuclear Information System (INIS)

    Brodzinski, R.L.; Wogman, N.A.

    1978-01-01

    A technique is described for passive neutron monitoring of transuranic elements. The method provides quantitative determinations of transuranic element concentrations in a variety of field situations where no other measurement method is possible. The technique can measure concentrations of transuranic oxides as low as 8 nCi/cm 3 and is capable of operating in gamma radiation fields up to megarads per hour. Information on chemical and isotopic composition can also be obtained from the data. Several successful applications of the technique are discussed

  5. Levels of toxic elements in soils of abandoned waste dump site ...

    African Journals Online (AJOL)

    Of all the five toxic elements studied, the highest mean concentration (mg/kg) of 133.74±10.60 was recorded for Pb followed by Cr (22.27±3.03), Ni (8.14±0.33) and As (5.97±0.32) in the soils while the least mean concentration of 1.64±0.11 was recorded for Cd. The toxic elements were examined for dependency upon some ...

  6. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  7. What Level Design Elements Determine Flow? : How Light and Objects Guide the Player in Overwatch and Doom

    OpenAIRE

    Eliasson, David

    2017-01-01

    This thesis presents a comparative study between Overwatch (2016) and Doom (2016) to determine how these fast-paced games facilitate flow in their gameplay. The second chapter looks at formal definitions of flow and level design to establish a vocabulary for following chapters. Through formal analysis the level designs of both games are then examined to establish what elements in them guide players and keep the flow in gameplay. The thesis also examines how the initial gameplay design princip...

  8. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  9. Structural evaluation of the John A. Roebling Suspension Bridge : element level analysis.

    Science.gov (United States)

    2008-07-01

    The primary objective of the structural evaluation of the John A. Roebling Bridge is to determine the maximum allowable gross vehicle weight (GVW) that can be carried by the bridge deck structural elements such as the open steel grid deck, channels, ...

  10. Combining Content and Elements of Communication into an Upper-Level Biochemistry Course

    Science.gov (United States)

    Whittington, Carli P.; Pellock, Samuel J.; Cunningham, Rebecca L.; Cox, James R.

    2014-01-01

    This report describes how a science communication module was incorporated into an advanced biochemistry course. Elements of communication were taught synergistically with biochemistry content in this course in an effort to expose students to a variety of effective oral communication strategies. Students were trained to use these established…

  11. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  12. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  13. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  14. A model for determination of screening level for radioactive elements in soil

    International Nuclear Information System (INIS)

    Peres, Ana Claudia

    2007-01-01

    At the present, decision about clean-up of Brazilian sites contaminated with radioactive isotopes is addressed on a case-by-case basis, since there is no general guidance or recommendation to support actions in early phases of the problem identification. For chemicals, CETESB - the governmental organization responsible for preventing and controlling environmental pollution in Sao Paulo State - established background values, prevention and intervention, as the first step to implement a remediation actions based on human health risk assessment. The aim of this study was to develop a methodology for the establishment of target values for radioactive soil contamination, as far as possible consistent and compatible with the approach adopted by CETESB for sites contaminated with chemicals. The following steps have been addressed in this study: conceptual scenario and model development; codification of the equations in an electronic spreadsheet; selection of proper range and statistical distribution of the input values; derivation of the intervention levels for selected radionuclides using Monte Carlo methods. The mathematical model developed was mainly based on the equations used by the U.S. Environmental Protection Agency (EPA) and by the National Council on Radiation Protection and Measurements (NCRP) for soil screening purposes. Intervention and prevention values are presented for adult and 10 years old child, for each 3 exposure scenarios: agricultural, residential and industrial; the following radionuclides were considered: 3 H, 14 C, 32 P, 35 S, 45 Ca, 51 Cr, 90 Sr, 125 I, 131 I, 134 Cs, 137 Cs, 210 Pb, 226 Ra, 228 Ra, 232 Th, 238 U, 239 Pu and 241 Am. Quality reference values were determined for 40 K, 137 Cs, 210 Pb, 226 Ra, 228 Ra, 228 Th, Th-nat e U-nat. Results obtained in this study showed a good agreement with those reported by NCRP, considering that the equations and the input data used in both models are not the same ones.(author)

  15. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  16. Trace elements in Antarctic fish species and the influence of foraging habitats and dietary habits on mercury levels

    Energy Technology Data Exchange (ETDEWEB)

    Goutte, Aurélie, E-mail: aurelie.goutte@ephe.sorbonne.fr [École Pratique des Hautes Études (EPHE), SPL, UPMC Univ Paris 06, UMR 7619 METIS, F-75005, 4 place Jussieu, Paris (France); Cherel, Yves [Centre d' Etudes Biologiques de Chizé, UMR 7372, CNRS-Université de La Rochelle, 79360 Villiers-en-Bois (France); Churlaud, Carine [Littoral Environnement et Sociétés (LIENSs), UMR 7266, CNRS-Université de la Rochelle, 2 rue Olympe de Gouges, 17000 La Rochelle (France); Ponthus, Jean-Pierre [École Pratique des Hautes Études (EPHE), SPL, UPMC Univ Paris 06, UMR 7619 METIS, F-75005, 4 place Jussieu, Paris (France); Massé, Guillaume [Unité Mixte Internationale Takuvik, Pavillon Alexandre-Vachon, Université Laval, QC, Québec (Canada); Bustamante, Paco [Littoral Environnement et Sociétés (LIENSs), UMR 7266, CNRS-Université de la Rochelle, 2 rue Olympe de Gouges, 17000 La Rochelle (France)

    2015-12-15

    This study aims at describing and interpreting concentration profiles of trace elements in seven Antarctic fish species (N = 132 specimens) off Adélie Land. Ichthyofauna plays a key role in the Antarctic ecosystem, as they occupy various ecological niches, including cryopelagic (ice-associated), pelagic, and benthic habitats. Firstly, trace element levels in the studied specimens were similar to those previously observed in fish from the Southern Ocean. Apart from manganese and zinc, concentrations of arsenic, cadmium, copper, iron, mercury (Hg), nickel, selenium and silver differed among fish species. Muscle δ{sup 13}C and δ{sup 15}N values were determined to investigate whether the fish foraging habitats and dietary habits could explain Hg levels. Species and foraging habitat (δ{sup 13}C) were strong predictors for variations of Hg concentrations in muscle tissues. The highest Hg contamination was found in shallow benthic fish compared to cryopelagic and pelagic fish. This pattern was likely due to the methylation of Hg in the coastal sediment and the photodemethylation by ultraviolet radiation in surface waters. - Highlights: • Trace elements and stable isotopes were analyzed in seven Antarctic fish species. • Levels of trace elements in liver and in muscle differed among species. • Hg load was higher in benthic fish than in cryopelagic and pelagic fish. • These findings could be due to the high methylation rate of Hg in the sediment.

  17. Trace elements in Antarctic fish species and the influence of foraging habitats and dietary habits on mercury levels

    International Nuclear Information System (INIS)

    Goutte, Aurélie; Cherel, Yves; Churlaud, Carine; Ponthus, Jean-Pierre; Massé, Guillaume; Bustamante, Paco

    2015-01-01

    This study aims at describing and interpreting concentration profiles of trace elements in seven Antarctic fish species (N = 132 specimens) off Adélie Land. Ichthyofauna plays a key role in the Antarctic ecosystem, as they occupy various ecological niches, including cryopelagic (ice-associated), pelagic, and benthic habitats. Firstly, trace element levels in the studied specimens were similar to those previously observed in fish from the Southern Ocean. Apart from manganese and zinc, concentrations of arsenic, cadmium, copper, iron, mercury (Hg), nickel, selenium and silver differed among fish species. Muscle δ"1"3C and δ"1"5N values were determined to investigate whether the fish foraging habitats and dietary habits could explain Hg levels. Species and foraging habitat (δ"1"3C) were strong predictors for variations of Hg concentrations in muscle tissues. The highest Hg contamination was found in shallow benthic fish compared to cryopelagic and pelagic fish. This pattern was likely due to the methylation of Hg in the coastal sediment and the photodemethylation by ultraviolet radiation in surface waters. - Highlights: • Trace elements and stable isotopes were analyzed in seven Antarctic fish species. • Levels of trace elements in liver and in muscle differed among species. • Hg load was higher in benthic fish than in cryopelagic and pelagic fish. • These findings could be due to the high methylation rate of Hg in the sediment.

  18. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  19. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  20. Determination of the levels of trace elements in ten years old children from Antofagasta city, Chile by neutron activation analysis

    International Nuclear Information System (INIS)

    Gras, N.; Munoz, A.L.; Jamett J, A.; Pena C, L.; Santander M, M.

    1988-01-01

    The levels of trace elements in scalp hair of ten years old children of Antofagasta city were determined. For this study, the city was divided in convenient areas. Comparisons between levels of concentrations considering residential areas, sex, values obtained for children of Santiago, and the ranges given in the literature were established. Fifty samples of hair were analyzed by instrumental neutron activation analisis. The elements selected were: As, Br, Co, Cr, Cu, Fe, Hg, K, Na. Sb, and Zn. The effectiveness of wash procedure before irradiation was studied. Ten samples were taken with sufficient amount of hair and each was divided into two, only one of them was washed and both were analyzed. The levels of concentrations were compared. (author)

  1. Leader Style and Anxiety Level: Their Relation to Autonomic Response.

    Science.gov (United States)

    Seemann, Daniel C.

    1982-01-01

    Studied effects of leader style and a group of people classified as either high-anxious or low-anxious. Measured participants' (N=71) responses to the leader styles using Galvanic Skin Response. Results indicated similar responses of participants to both autocratic and democratic leadership styles. (RC)

  2. Volume concentration of 41 elements in ground level of atmosphere in Bratislava

    International Nuclear Information System (INIS)

    Florek, M.; Meresova, J.; Holy, K.; Sykora, I.; Frontasyeva, M. V.; Pavlov, S. S.

    2006-01-01

    The concentrations of 41 chemical elements (heavy metals, rare earths, and actinides) were determined in atmospheric aerosol using nuclear and related analytical techniques. The sampling location was in Bratislava (Slovak Republic). The main goal of this study is the quantification of the atmospheric pollution and its trend. The elemental content in filters was measured using instrumental neutron activation analysis at IBR-2 reactor in JINR Dubna and by atomic absorption spectrometry in Bratislava. The obtained results confirmed the decreasing trend of pollution by most of the heavy metals in Bratislava atmosphere, and they are compared with the contents of pollutants in atmosphere of other cities. We determined also the composition of clear filter materials. (authors)

  3. Finite-element analysis of NiTi wire deflection during orthodontic levelling treatment

    International Nuclear Information System (INIS)

    Razali, M F; Mahmud, A S; Abdullah, J; Mokhtar, N

    2016-01-01

    Finite-element analysis is an important product development tool in medical devices industry for design and failure analysis of devices. This tool helps device designers to quickly explore various design options, optimizing specific designs and providing a deeper insight how a device is actually performing. In this study, three-dimensional finite-element models of superelastic nickel-titanium arch wire engaged in a three brackets system were developed. The aim was to measure the effect of binding friction developed on wire-bracket interaction towards the remaining recovery force available for tooth movement. Uniaxial and three brackets bending test were modelled and validated against experimental works. The prediction made by the three brackets bending models shows good agreement with the experimental results. (paper)

  4. Finite-element analysis of NiTi wire deflection during orthodontic levelling treatment

    Science.gov (United States)

    Razali, M. F.; Mahmud, A. S.; Mokhtar, N.; Abdullah, J.

    2016-02-01

    Finite-element analysis is an important product development tool in medical devices industry for design and failure analysis of devices. This tool helps device designers to quickly explore various design options, optimizing specific designs and providing a deeper insight how a device is actually performing. In this study, three-dimensional finite-element models of superelastic nickel-titanium arch wire engaged in a three brackets system were developed. The aim was to measure the effect of binding friction developed on wire-bracket interaction towards the remaining recovery force available for tooth movement. Uniaxial and three brackets bending test were modelled and validated against experimental works. The prediction made by the three brackets bending models shows good agreement with the experimental results.

  5. Levels of some trace elements in serum of esophageal cancer patients

    International Nuclear Information System (INIS)

    Saeed, D. M. A.

    2011-01-01

    The aim of this study is to measure the concentrations of six trace elements (Zn, Se, Fe, Co, Rb, Hg) in the serum of patients with esophageal cancer who were newly diagnosed before undergoing any type of treatment. Biopsy was taken from diseased esophagus and examined histologically. A total of 43 samples of patients and 36 samples from healthy control group was collected, which were then dried by freeze drying. Then analyzed by neutron activation analysis technology, using research reactor in Syria (the miniature neutron source, MNSR) with neutron flux of 1x10''1''2 n.cm ''-''2 s''-''1 was performed. Certified reference sample from the International Agency were obtained for quality control analysis to ensure the reliability of the device. All six elements were statistically analyzed, the study proved statistical significant difference concentration of following five elements, Zn, Se, Fe, Co, Rb in the serum of patients compared to the serum samples of healthy people. The concentration of Zn and Se in patients serum were less compared to serum of healthy individuals, and the concentrations of Fe, Co, Rb in serum of patients were higher than its that the serum of healthy individuals. While the concentrations of Hg was found to be higher in serum of healthy individuals compared to patients serum, but without statistical significant. The concentration presented by means with standard deviation. The findings were compared to results obtained from literature. All five elements compatible with literature. Hg has not been investigated in such studies before. Selenium and zinc supplementation are need by cancer patient in order to enhance and increase the chances for natural immunological of cancer.(Author)

  6. Levels of some trace elements in serum of esophageal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Saeed, D M. A. [Sudan Academy of Sciences, Atomic Energy Council, Khartoum (Sudan)

    2011-01-15

    The aim of this study is to measure the concentrations of six trace elements (Zn, Se, Fe, Co, Rb, Hg) in the serum of patients with esophageal cancer who were newly diagnosed before undergoing any type of treatment. Biopsy was taken from diseased esophagus and examined histologically. A total of 43 samples of patients and 36 samples from healthy control group was collected, which were then dried by freeze drying. Then analyzed by neutron activation analysis technology, using research reactor in Syria (the miniature neutron source, MNSR) with neutron flux of 1x10''1''2 n.cm ''-''2 s''-''1 was performed. Certified reference sample from the International Agency were obtained for quality control analysis to ensure the reliability of the device. All six elements were statistically analyzed, the study proved statistical significant difference concentration of following five elements, Zn, Se, Fe, Co, Rb in the serum of patients compared to the serum samples of healthy people. The concentration of Zn and Se in patients serum were less compared to serum of healthy individuals, and the concentrations of Fe, Co, Rb in serum of patients were higher than its that the serum of healthy individuals. While the concentrations of Hg was found to be higher in serum of healthy individuals compared to patients serum, but without statistical significant. The concentration presented by means with standard deviation. The findings were compared to results obtained from literature. All five elements compatible with literature. Hg has not been investigated in such studies before. Selenium and zinc supplementation are need by cancer patient in order to enhance and increase the chances for natural immunological of cancer.(Author)

  7. Planing of land use of structural elements of ecological network at local level

    OpenAIRE

    Tretiak V.; Hun'ko L.

    2016-01-01

    and Management projecting of structural elements of land use of the ecological network on the territory of the village council begins with ecological and landscape micro zoning of the territory of village council, held during the preparatory work for the drafting of land and are finished by the formation of environmentally homogeneous regions, to which the system components of ecological network are tied, as well as environmental measures in the form of local environmental restrictions (encum...

  8. Trace-elements, methylmercury and metallothionein levels in Magellanic penguin (Spheniscus magellanicus) found stranded on the Southern Brazilian coast.

    Science.gov (United States)

    Kehrig, Helena A; Hauser-Davis, Rachel A; Seixas, Tércia G; Fillmann, Gilberto

    2015-07-15

    Magellanic penguins have been reported as good biomonitors for several types of pollutants, including trace-elements. In this context, selenium (Se), total mercury, methylmercury, inorganic mercury (Hg(inorg)), cadmium (Cd) and lead (Pb), as well as metallothionein (MT) levels, were evaluated in the feathers, liver and kidney of juvenile Magellanic penguins found stranded along the coast of Southern Brazil. The highest concentrations of all trace-elements and methylmercury were found in internal organs. Concentrations of Cd and Se in feathers were extremely low in comparison with their concentrations in soft tissues. The results showed that both Se and MT are involved in the detoxification of trace-elements (Cd, Pb and Hg(inorg)) since statistically significant relationships were found in liver. Conversely, hepatic Se was shown to be the only detoxifying agent for methylmercury. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. KEY ELEMENTS OF CHARACTERIZING SAVANNAH RIVER SITE HIGH LEVEL WASTE SLUDGE INSOLUBLES THROUGH SAMPLING AND ANALYSIS

    International Nuclear Information System (INIS)

    Reboul, S; Barbara Hamm, B

    2007-01-01

    Characterization of HLW is a prerequisite for effective planning of HLW disposition and site closure performance assessment activities. Adequate characterization typically requires application of a combination of data sources, including process knowledge, theoretical relationships, and real-waste analytical data. Consistently obtaining high quality real-waste analytical data is a challenge, particularly for HLW sludge insolubles, due to the inherent complexities associated with matrix heterogeneities, sampling access limitations, radiological constraints, analyte loss mechanisms, and analyte measurement interferences. Understanding how each of these complexities affects the analytical results is the first step to developing a sampling and analysis program that provides characterization data that are both meaningful and adequate. A summary of the key elements impacting SRS HLW sludge analytical data uncertainties is presented in this paper, along with guidelines for managing each of the impacts. The particular elements addressed include: (a) sample representativeness; (b) solid/liquid phase quantification effectiveness; (c) solids dissolution effectiveness; (d) analyte cross contamination, loss, and tracking; (e) dilution requirements; (f) interference removal; (g) analyte measurement technique; and (h) analytical detection limit constraints. A primary goal of understanding these elements is to provide a basis for quantifying total propagated data uncertainty

  10. k0-INAA measurement of levels of toxic elements in oil sludge and their leachability

    International Nuclear Information System (INIS)

    Syazwani Mohd Fadzil; Kok Siong Khoo; Sukiman Sarmani; Majid, A.A.; Ainon Hamzah

    2011-01-01

    Development of the petroleum industry has resulted in increasing production of oil sludge, the disposal of which risks introducing hazardous elements into the environment. In the frames of these studies the presence of the toxic metals arsenic, chromium and zinc in oil sludge and the leachability of those toxins. Samples were obtained from a refinery plant in Sg Udang, Melaka and from the Miri Crude Oil Terminal, Sarawak, both in Malaysia. k 0 -Instrumental Neutron Activation Analysis was used to measure mass fractions of elements. The samples were packed and irradiated in a TRIGA Mark II reactor. Mass fraction of arsenic in the oil sludge samples were found to be higher than the EPA pollutant mass fraction limit; mass fractions of chromium and zinc were below of this limit. Samples were also tested for leachability, which was found to be contributed to by controlled diffusion. Slow leachability of arsenic was found to be higher than the EPA limit in these oil sludge samples, influenced by such factors as redox condition. It was found however, that the most leachable of these elements in all samples from both sites was zinc, followed by arsenic and chromium, indicating that zinc may present a more serious threat of environmental contamination than the other two. (author)

  11. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  12. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  13. DETERMINATION of the TRACE ELEMENT LEVELS in HAIR of SMOKERS and NON-SMOKERS by ICP-MS

    Directory of Open Access Journals (Sweden)

    Elif Varhan Oral

    2016-09-01

    Full Text Available For at least 50 years, determination of the trace element levels in human hair has been used to assess environmental and vocational exposure to toxic elements . As compared to other biological matrices (e.g. blood, urine, human hair is stable and therefore useful as a matrice. In this study, analyses of toxic and essential trace elements, such as Cd, Pb, Cu and Fe, were done in hair samples which we collected from male smokers (10 people and non-smokers (10 people who live in Diyarbakır, Turkey and concentrations in hair samples were compared. Hair samples were washed by a standard procedure proposed by the International Atomic Energy Agency. Then the samples were dried for 16 h at 110°C in an oven. Solubilization procedure was carried out by nitric acid hydrogen peroxide mixture (3:1 in closed vessels in a microwave oven. Trace element analyses were carried out by using inductively coupled plasma-mass spectrometry (ICP-MS  technique. In our study, while concentrations of Cd, Pb, and Fe elements were found to be considerably higher in smokers than non-smokers, similar results were observed in Cu concentrations. The precision and accuracy of the method was evaluated by applying spike method to samples. Analytical recovery results were found between 91.2% and 104.6%.

  14. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  15. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  16. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  17. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  18. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  19. Levels, spatial variation and compartmentalization of trace elements in brown algae Cystoseira from marine protected areas of Crimea (Black Sea)

    International Nuclear Information System (INIS)

    Kravtsova, Alexandra V.; Milchakova, Nataliya A.; Frontasyeva, Marina V.

    2015-01-01

    Highlights: • 19 trace elements were determined in Cystoseira spp. from marine protected areas. • Levels of 10 elements were lower than reported data for Black Sea Cystoseira spp. • Concentrations of most trace elements were higher in “branches” than in “stems”. • Spatial variations of V, Co, Ni and Zn can be related to anthropogenic activities. • Al, Sc, Fe, Rb, Cs, Th, U varied depending on geological composition of the coast. - Abstract: Levels of Al, Sc, V, Co, Ni, As, Br, Rb, Sr, Ag, Sb, I, Cs, Ba, Th and U that were rarely or never studied, as well as the concentrations of classically investigated Mn, Fe and Zn in brown algae Cystoseira barbata C. Ag. and Cystoseira crinita (Desf.) Bory from the coastal waters of marine protected areas (Crimea, Black Sea), were determined using neutron activation analysis. Spatial variation and compartmentalization were studied for all 19 trace elements (TE). Concentrations of most TE were higher in “branches” than in “stems”. Spatial variations of V, Co, Ni and Zn can be related to anthropogenic activities while Al, Sc, Fe, Rb, Cs, Th and U varied depending on chemical peculiarities of the coastal zone rocks. TE concentrations in C. crinita from marine protected areas near Tarkhankut peninsula and Cape Fiolent, identified as the most clean water areas, are submitted as the background concentrations

  20. High Performance Microaccelerometer with Wafer-level Hermetic Packaged Sensing Element and Continuous-time BiCMOS Interface Circuit

    International Nuclear Information System (INIS)

    Ko, Hyoungho; Park, Sangjun; Paik, Seung-Joon; Choi, Byoung-doo; Park, Yonghwa; Lee, Sangmin; Kim, Sungwook; Lee, Sang Chul; Lee, Ahra; Yoo, Kwangho; Lim, Jaesang; Cho, Dong-il

    2006-01-01

    A microaccelerometer with highly reliable, wafer-level packaged MEMS sensing element and fully differential, continuous time, low noise, BiCMOS interface circuit is fabricated. The MEMS sensing element is fabricated on a (111)-oriented SOI wafer by using the SBM (Sacrificial/Bulk Micromachining) process. To protect the silicon structure of the sensing element and enhance the reliability, a wafer level hermetic packaging process is performed by using a silicon-glass anodic bonding process. The interface circuit is fabricated using 0.8 μm BiCMOS process. The capacitance change of the MEMS sensing element is amplified by the continuous-time, fully-differential transconductance input amplifier. A chopper-stabilization architecture is adopted to reduce low-frequency noise including 1/f noise. The fabricated microaccelerometer has the total noise equivalent acceleration of 0.89 μg/√Hz, the bias instability of 490 μg, the input range of ±10 g, and the output nonlinearity of ±0.5 %FSO

  1. Background levels of some trace elements in egyptian soils determined by neutron activation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Sabour, M F [Soil pollution unit, Soil and water dept., Nuclear res.center, Cairo (Egypt); Abdel-Haleen, A S [Hot Labs, Atomic Energy Authority, Cairo (Egypt); Zohny, E E [Physics Dept. Faculty of Science, Cairo Univ. Ain shams Univ., Cairo, (Egypt); Sroor, A [Nuclear Physics Dep., Faculty of Girls, Ain Shams Univ., Cairo (Egypt); Zaghloul, R [Mubarak city for scientific research and technology, Ministry of scientific research, Cairo, (Egypt)

    1997-12-31

    As part of a research program on the influence of agricultural practices and activities on soil content of heavy metals. The present work was carried out to investigate the feasibility of instrumental neutron activation analysis for this purpose. Elements studied were, Fe, Zn, Co, Sc, Sb, As, Cd, Hg and Cr. The soil samples analyzed were from different locations to represent different land uses and types. Results revealed that As, Cd and Hg show a pronounced accumulation in soils especially those exposed to industrial and organic wastes disposal. 2 tabs.

  2. Low-level determination of transuranic elements in marine environment samples

    International Nuclear Information System (INIS)

    Ballestra, S.; Holm, E.; Fukai, R.

    1978-01-01

    The procedures developed and currently employed in the Monaco Laboratory for determining transuranic elements in seawater, marine sediments and organisms are described and discussed. While the standard anion-exchange procedure from the hydrochloric acid medium is used for the separation of plutonium isotopes from americium, purification of americium and curium is achieved by an ion-exchange sorption from the methanol-nitric acid medium, followed by an elution with the methanol-hydrochloric acid mixture. Satisfactory clean-up of plutonium as well as americium and curium can be achieved by applying the described procedures. (author)

  3. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  4. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  5. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  6. System-Level Coupled Modeling of Piezoelectric Vibration Energy Harvesting Systems by Joint Finite Element and Circuit Analysis

    Directory of Open Access Journals (Sweden)

    Congcong Cheng

    2016-01-01

    Full Text Available A practical piezoelectric vibration energy harvesting (PVEH system is usually composed of two coupled parts: a harvesting structure and an interface circuit. Thus, it is much necessary to build system-level coupled models for analyzing PVEH systems, so that the whole PVEH system can be optimized to obtain a high overall efficiency. In this paper, two classes of coupled models are proposed by joint finite element and circuit analysis. The first one is to integrate the equivalent circuit model of the harvesting structure with the interface circuit and the second one is to integrate the equivalent electrical impedance of the interface circuit into the finite element model of the harvesting structure. Then equivalent circuit model parameters of the harvesting structure are estimated by finite element analysis and the equivalent electrical impedance of the interface circuit is derived by circuit analysis. In the end, simulations are done to validate and compare the proposed two classes of system-level coupled models. The results demonstrate that harvested powers from the two classes of coupled models approximate to theoretic values. Thus, the proposed coupled models can be used for system-level optimizations in engineering applications.

  7. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  8. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  9. Combining content and elements of communication into an upper-level biochemistry course.

    Science.gov (United States)

    Whittington, Carli P; Pellock, Samuel J; Cunningham, Rebecca L; Cox, James R

    2014-01-01

    This report describes how a science communication module was incorporated into an advanced biochemistry course. Elements of communication were taught synergistically with biochemistry content in this course in an effort to expose students to a variety of effective oral communication strategies. Students were trained to use these established techniques and incorporated them into various presentations throughout the course. Three students describe their use of specific resources and how the skills learned relate to their future career. The importance and relevance of science communication are receiving unprecedented national attention. The academic scientific community must respond by incorporating more communication-centered instruction and opportunities in the classroom and laboratory. © 2013 by The International Union of Biochemistry and Molecular Biology.

  10. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  11. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  12. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  13. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  14. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  15. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  16. How unit level nursing responsibilities are structured in US hospitals.

    Science.gov (United States)

    Minnick, Ann F; Mion, Lorraine C; Johnson, Mary E; Catrambone, Cathy

    2007-10-01

    To describe (1) the extent to which acute and intensive care units use the elements of nursing models (team, functional, primary, total patient care, patient-focused care, case management) and (2) the deployment of non-unit-based personnel resources. The lack of current data-based behavioral descriptions of the extent to which elements of nursing models are implemented makes it difficult to determine how work models may influence outcomes. Nurse managers of 56 intensive care units and 80 acute care adult units from 40 randomly selected US hospitals participated in a structured interview regarding (1) day-shift use of patient assignment behaviors associated with nursing models and (2) the availability and consistency of assignment of non-unit-based support personnel. No model was implemented fully. Almost all intensive care units reported similar assignment behaviors except in the consistency of patient assignment. Non-intensive care units demonstrated wide variation in assignment patterns. Patterns differed intra-institutionally. There were large differences in the availability and deployment of non-unit-based supportive resources. Administrators must recognize the differences in work models within their institutions as a part of any quality improvement effort. Attempts to test new work models must be rigorous in the measurement of their implementation.

  17. PSA Level 2 as element of an integral safety assessment before plant commissioning

    International Nuclear Information System (INIS)

    Loeffler, H.; Mildenberger, O.; Sonnenkalb, M.; Steinroetter, T.

    2012-01-01

    In Argentina the Central Nuclear Atucha II is near to completion. This is a pressurized heavy water reactor. PSA (Probability Safety Assessment) level 1, level 2 and level 3 have to be performed in order to show compliance with the Argentinean dose limit. Such studies have been done first by the former KWU in the 1980's to get the construction license (FABIAN 1985). Nowadays the plant owner NA-SA performs PSA level 1 and provides information about the core damage states to GRS, who does the subsequent PSA level 2 part. GRS delivers source terms to the environment and the associated frequencies to the Argentinean research institute CNEA, which performs level 3 together with NA-SA. Since GRS is situated in the middle of the chain, interface definition with both ends has been a significant task of the GRS activities. Experience gained during this process will be highlighted in the presentation. The analysis of PSA level 2 proper follows a traditional approach: -) deterministic accident simulation with integral code MELCOR; -) analyses of specific issues which are not covered by MELCOR; and -) probabilistic accident progression analysis with EVNTRE event tree methodology. It appears that MELCOR and EVNTRE and PSA guidelines in general are flexible enough to analyse new or uncommon reactor designs. It also appears that the plant specific design features may require analyses beyond present code capabilities, calling for expert judgment and they can largely determine PSA results. The behaviour of iodine is not yet covered satisfactorily by state-of-the-art models in MELCOR

  18. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  19. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  20. Responses to the low-level-radiation controversy

    International Nuclear Information System (INIS)

    Bond, V.P.

    1981-01-01

    Some data sets dealing with the hazards of low-level radiation are discussed. It is concluded that none of these reports, individually or collectively, changes appreciably or even significantly the evaluations of possible low-level radiation effects that have been made by several authoritative national and international groups

  1. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  2. Barrier response to Holocene sea-level rise

    DEFF Research Database (Denmark)

    Pejrup, Morten; Andersen, Thorbjørn Joest; Johannessen, Peter N

    Normally it is believed that sea-level rise causes coastal barrier retreat. However, sea-level is only one of the parameters determining the long term coastal development of barrier coasts. Sediment supply is an equally important determinant and may overshadow the effects of sea-level rise....... Conceptually this has been known for a long time but for the first time we can show the relative effect of these two parameters. We have studied three neighboring barrier islands in the Wadden Sea, and described their 3D morphological evolution during the last 8000 years. It appears that the barrier islands...... a much stronger component of sea-level control. The distance between the islands is only 50 km, and therefore our study shows that prediction of barrier development during a period of rising sea level may be more complicated than formerly believed....

  3. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  4. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  5. Finite Element Quadrature of Regularized Discontinuous and Singular Level Set Functions in 3D Problems

    Directory of Open Access Journals (Sweden)

    Nicola Ponara

    2012-11-01

    Full Text Available Regularized Heaviside and Dirac delta function are used in several fields of computational physics and mechanics. Hence the issue of the quadrature of integrals of discontinuous and singular functions arises. In order to avoid ad-hoc quadrature procedures, regularization of the discontinuous and the singular fields is often carried out. In particular, weight functions of the signed distance with respect to the discontinuity interface are exploited. Tornberg and Engquist (Journal of Scientific Computing, 2003, 19: 527–552 proved that the use of compact support weight function is not suitable because it leads to errors that do not vanish for decreasing mesh size. They proposed the adoption of non-compact support weight functions. In the present contribution, the relationship between the Fourier transform of the weight functions and the accuracy of the regularization procedure is exploited. The proposed regularized approach was implemented in the eXtended Finite Element Method. As a three-dimensional example, we study a slender solid characterized by an inclined interface across which the displacement is discontinuous. The accuracy is evaluated for varying position of the discontinuity interfaces with respect to the underlying mesh. A procedure for the choice of the regularization parameters is proposed.

  6. Ascertaining serum levels of trace elements in melanoma patients using PIXE and HR-ICPMS

    Science.gov (United States)

    Bernardes, S.; Tabacniks, M. H.; Santos, I. D. A. O.; Oliveira, A. F.; Shie, J. N.; Sarkis, J. E. S.; Oliveira, T.

    2014-01-01

    Melanoma is a serious and deadly form of skin cancer. However, patients' chances of survival and recovery are considerably increased when it is diagnosed and treated in its early stages. In this study, trace element concentrations in serum samples from patients with melanoma were measured using PIXE (Proton Induced X-ray Emission) and HR-ICPMS (High-Resolution Inductively Coupled Plasma Mass Spectrometry), with the purpose of correlating these concentrations with the disease. Blood samples from 30 melanoma patients and 116 healthy donors were collected at São Paulo Hospital (protocol CEP 1036/08 UNIFESP). Relevant clinical information on the patients has also been included in the statistical analysis. Analysis of the control group showed different P and Mg concentrations in individuals above and below 40 years of age. P, S, Ca, Cu and Zn concentrations in healthy individuals differed according to gender, highlighting the necessity to include age and gender variables in the case-control analysis. There were also differences in K, S, Ca and Se concentrations between the control and melanoma groups.

  7. Ascertaining serum levels of trace elements in melanoma patients using PIXE and HR-ICPMS

    Energy Technology Data Exchange (ETDEWEB)

    Bernardes, S., E-mail: suene@if.usp.br [Physics Institute, University of São Paulo (Brazil); Tabacniks, M.H. [Physics Institute, University of São Paulo (Brazil); Santos, I.D.A.O.; Oliveira, A.F.; Shie, J.N. [São Paulo Federal University (UNIFESP), São Paulo (Brazil); Sarkis, J.E.S.; Oliveira, T. [Institute of Energy and Nuclear Research (IPEN), Laboratory of Chemical Characterization (LCQ), Center for Chemistry and the Environment - CQMA, Sao Paulo (Brazil)

    2014-01-01

    Melanoma is a serious and deadly form of skin cancer. However, patients’ chances of survival and recovery are considerably increased when it is diagnosed and treated in its early stages. In this study, trace element concentrations in serum samples from patients with melanoma were measured using PIXE (Proton Induced X-ray Emission) and HR-ICPMS (High-Resolution Inductively Coupled Plasma Mass Spectrometry), with the purpose of correlating these concentrations with the disease. Blood samples from 30 melanoma patients and 116 healthy donors were collected at São Paulo Hospital (protocol CEP 1036/08 UNIFESP). Relevant clinical information on the patients has also been included in the statistical analysis. Analysis of the control group showed different P and Mg concentrations in individuals above and below 40 years of age. P, S, Ca, Cu and Zn concentrations in healthy individuals differed according to gender, highlighting the necessity to include age and gender variables in the case-control analysis. There were also differences in K, S, Ca and Se concentrations between the control and melanoma groups.

  8. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  9. Item Response Theory at Subject- and Group-Level. Research Report 90-1.

    Science.gov (United States)

    Tobi, Hilde

    This paper reviews the literature about item response models for the subject level and aggregated level (group level). Group-level item response models (IRMs) are used in the United States in large-scale assessment programs such as the National Assessment of Educational Progress and the California Assessment Program. In the Netherlands, these…

  10. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  11. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  12. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  13. Population level response of downy brome to soil growing medium

    Science.gov (United States)

    Downy brome (Bromus tectorum) is the most ubiquitous exotic invasive weed in the Intermountain West. A major issue for management is the extreme generalist plastic nature of downy brome. We hypothesized that soil growing medium would effect all measured response variables representing some degree of...

  14. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  15. Haloperidol plasmatic levels and their clinical response to the treatment

    International Nuclear Information System (INIS)

    Cabranes, J.A.; Almoguera, I.; Santos, J.L.; Prieto, P.; Ramos, J.A.

    1988-01-01

    Schizophrenic patients were treated with haloperidol. Their haloperidol levels in plasma were determined with radioimmunoassay (RIA) and radioreceptor assay (RRA). The results obtained are compared with the clinical improvement. (M.C.B.)

  16. Groundwater level responses to precipitation variability in Mediterranean insular aquifers

    Science.gov (United States)

    Lorenzo-Lacruz, Jorge; Garcia, Celso; Morán-Tejeda, Enrique

    2017-09-01

    Groundwater is one of the largest and most important sources of fresh water on many regions under Mediterranean climate conditions, which are exposed to large precipitation variability that includes frequent meteorological drought episodes, and present high evapotranspiration rates and water demand during the dry season. The dependence on groundwater increases in those areas with predominant permeable lithologies, contributing to aquifer recharge and the abundance of ephemeral streams. The increasing pressure of tourism on water resources in many Mediterranean coastal areas, and uncertainty related to future precipitation and water availability, make it urgent to understand the spatio-temporal response of groundwater bodies to precipitation variability, if sustainable use of the resource is to be achieved. We present an assessment of the response of aquifers to precipitation variability based on correlations between the Standardized Precipitation Index (SPI) at various time scales and the Standardized Groundwater Index (SGI) across a Mediterranean island. We detected three main responses of aquifers to accumulated precipitation anomalies: (i) at short time scales of the SPI (24 months). The differing responses were mainly explained by differences in lithology and the percentage of highly permeable rock strata in the aquifer recharge areas. We also identified differences in the months and seasons when aquifer storages are more dependent on precipitation; these were related to climate seasonality and the degree of aquifer exploitation or underground water extraction. The recharge of some aquifers, especially in mountainous areas, is related to precipitation variability within a limited spatial extent, whereas for aquifers located in the plains, precipitation variability influence much larger areas; the topography and geological structure of the island explain these differences. Results indicate large spatial variability in the response of aquifers to precipitation in

  17. Planing of land use of structural elements of ecological network at local level

    Directory of Open Access Journals (Sweden)

    Tretiak V.

    2016-05-01

    Full Text Available and Management projecting of structural elements of land use of the ecological network on the territory of the village council begins with ecological and landscape micro zoning of the territory of village council, held during the preparatory work for the drafting of land and are finished by the formation of environmentally homogeneous regions, to which the system components of ecological network are tied, as well as environmental measures in the form of local environmental restrictions (encumbrances in land usage and other natural resources. Additionally organization and territorial measures are projected that increase the ecological sustainability of the area: key, binders, buffer areas and renewable ecological network. The regional scheme of ecological network is intended for usage while projecting of creation of new territories that fall under special protection, for defining the tasks as for changing the category of land in the land use planning documents, for development of specifications regarding the reproduction of natural systems on conservation ready lands withdrawn from agricultural use, for accounting the problems of formation the areas of ecological network in forest management and land management projects, while development of the projects of areas organization of natural - reserve fund, in the definition of wetlands of international importance, in determining the habitats of various plants and animals of various categories of protection in accordance with international conventions and national laws - regulations, in planning targeted actions in the conservation of landscape and biological diversity. The main stages of designing local ecological network are: • inventory and identification of rights for land and other natural resources, drawing created territories and objects of natural reserve fund and other areas of natural systems on the planning and cartographic materials, which are under special protection; • rationale of

  18. Chemical composition of arctic snow: concentration levels and regional distribution of major elements.

    Science.gov (United States)

    de Caritat, Patrice; Hall, Gwendy; Gìslason, Sigurdur; Belsey, William; Braun, Marlene; Goloubeva, Natalia I; Olsen, Hans Kristian; Scheie, Jon Ove; Vaive, Judy E

    2005-01-05

    At the end of the northern winter 1996/1997, 21 snow samples were collected from 17 arctic localities in Norway, Sweden, Finland, Svalbard, Russia, Alaska, Canada, Greenland and Iceland. Major element concentrations of the filtered (0.45 mum) melted snow indicate that most samples are consistent with a diluted seawater composition. Deviations from this behaviour indicate additional SO(4)(2-) and Cl(-) relative to seawater, suggesting a minor contribution from (probably local) coal combustion emissions (Alaska, Finland, Sweden, Svalbard). The samples with the highest Na and Cl(-) content (Canada, Russia) also have higher Na/SO(4)(2-) and Cl(-)/SO(4)(2-) ratios than seawater, suggesting a slight contamination from (probably local) deicing activities. Local soil or rock dust inputs in the snow are indicated by 'excess' Ca contents (Alaska, Svalbard, Greenland, Sweden). No overall relationship was found between pH (range: 4.6-6.1) and total or non-seasalt SO(4)(2-) (NSS), suggesting that acidification due to long-range transport of SO(2) pollution is not operating on an arctic-wide scale. In a few samples (Alaska, Finland, Sweden, Svalbard), a significant proportion (>50%) of SO(4)(2-) is non-marine in origin. Sources for this non-marine SO(4)(2-) need not all be found in long-range atmospheric transport and more likely sources are local industry (Finland, Sweden), road traffic (Alaska) or minor snow-scooting traffic (one Svalbard locality). A few samples from northern Europe show a relatively weak trend of decreasing pH with increasing NO(3)(-).

  19. A study of the biological effects of rare earth elements at cellular level using nuclear techniques

    International Nuclear Information System (INIS)

    Feng Zhihui; Wang Xi; Zhang Sunxi; An Lizhi; Zhang Jingxia; Yao Huiying

    2001-01-01

    Objective: To investigate the biological effects and the effecting mechanisms of rare earth elements La, Gd and Ce on cultured rat cells. Methods: The biological effects of La 3+ on cultured rat cells and the subcellular distribution of La and Gd and Ce, and the inflow of 45 Ca 2+ into the cells and total cellular calcium were measured by isotopic tracing, Proton Induced X Ray Emission Analysis (PIXE) and the techniques of biochemistry and cellular biology. Results: La 3+ at the concentration of 10- 10( or 10 -9 ) - 10 -6 mol/L significantly increased quantity of incorporation of 3 H-TdR into DNA, total cellular protein and the activity of succinic dehydrogenase of mitochondria. The cell cycle analysis showed that the proportions of cells in S phase were accordingly increased acted by La 3+ at above range of concentration. But these values were significantly decreased when concentration of La 3+ raised to 10 -4 - 10 -3 mol/L. It was further discovered that La, Gd and Ce distributed mostly in the nuclei, and then in membranes. Gd and Ce also promoted the inflow of 45 Ca 2+ into the cells and increased the total calcium content in cells. Conclusions: 1) La 3+ at a wide concentration range of 10 -10 ( or 10 -9 ) - 10 -6 mol/L promotes proliferation of cultured rat cells, but at even higher concentration (10 -4 - 10 -3 mol/L) shows cellular toxicity, and there is a striking dose-effect relationship. 2) La, Gd and Ce can enter the cells and mainly distribute in the nuclei. 3) Gd and Ce can promote the inflow of extracellular Ca 2+ into the cells and increase total cellular calcium

  20. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  1. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  2. The Revised School Culture Elements Questionnaire: Gender and Grade Level Invariant?

    Science.gov (United States)

    DeVaney, Thomas A.; Adams, Nan B.; Hill-Winstead, Flo; Trahan, Mitzi P.

    2012-01-01

    The purpose of this research was to examine the psychometric properties of the RSCEQ with respect to invariance across gender and grade level, using a sample of 901 teachers from 44 schools in southeast Louisiana. Reliability estimates were consistent with previous research and ranged from 0.81 to 0.90 on the actual and 0.83 to 0.92 on the…

  3. SRXRF study of trace elements in hippocampus of pup rats after prenatal and postnatal exposure to low-level mercury

    International Nuclear Information System (INIS)

    Zhang Fang; Feng Weiyue; Chai Zhifang; Wang Meng; Shi Junwen; Huang Yuying; He Wei

    2005-01-01

    Since the pollution of mercury in the environment still keeps high, more and more concerns over mercury toxicity are focused on the potential risk associated with relatively low-dose and long-term mercury exposure in the environment. It is well known that fetus and developing children are the susceptive victims of mercury damage. Therefore, high attention is focused on whether the prenatal and postnatal exposure to relatively low level of mercury will be harmful to children development. Some epidemiological studies reported that the methylmercury-related neuropsychological deficits were mainly found in the domains of cognitional parts, such as language, attention, memory, and so forth, Our previous study found out that high level of mercury was accumulated in the pup hippocampus after their prenatal and postnatal exposure to low dose of inorganic mercury. Synchrotron radiation X-ray fluorescence technique (SRXRF) is characterized of its simultaneous determination of multi-elements, high sensitivity, small sampling amount and microanalysis. SRXRF does not cause the damage of irradiated samples. Thus, it makes possible to measure the distributions of trace elements in a selected area. In this study, in order to study the effects of low-level mercury exposure to pup rat brain, some oxidation-related elements, e.g. Cu, Fe and Mn in pup hippocampus after in utero and weaning exposure to low-level inorganic mercury were determined by SRXRF. The experiment was performed at a synchrotron radiation facility at Institute of High Energy Physics. And the spot size of the beam irradiating on the sample was adjusted to about 100 x 200 μm 2 , Each spot was irradiated for about 100 s. The spectra were analyzed by the AXIL program. Additionally, the activities of some important antioxidant enzymes, such as GSH-Px, SOD, CAT, were also measured together with the content of malondialdehyde (MDA). The results showed that mercury exposure could lead to significant increase of both

  4. Micro-finite-element method to assess elastic properties of trabecular bone at micro- and macroscopic level.

    Science.gov (United States)

    Rieger, R; Auregan, J C; Hoc, T

    2018-03-01

    The objective of the present study is to assess the mechanical behavior of trabecular bone based on microCT imaging and micro-finite-element analysis. In this way two methods are detailed: (i) direct determination of macroscopic elastic property of trabecular bone; (ii) inverse approach to assess mechanical properties of trabecular bone tissue. Thirty-five females and seven males (forty-two subjects) mean aged (±SD) 80±11.7 years from hospitals of Assistance publique-Hôpitaux de Paris (AP-HP) diagnosed with osteoporosis following a femoral neck fracture due to a fall from standing were included in this study. Fractured heads were collected during hip replacement surgery. Standardized bone cores were removed from the femoral head's equator by a trephine in a water bath. MicroCT images acquisition and analysis were performed with CTan ® software and bone volume fraction was then determined. Micro-finite-element simulations were per-formed using Abaqus 6.9-2 ® software in order to determine the macroscopic mechanical behaviour of the trabecular bone. After microCT acquisition, a longitudinal compression test was performed and the experimental macroscopic Young's Modulus was extracted. An inverse approach based on the whole trabecular bone's mechanical response and micro-finite-element analysis was performed to determine microscopic mechanical properties of trabecular bone. In the present study, elasticity of the tissue was shown to be similar to that of healthy tissue but with a lower yield stress. Classical histomorphometric analysis form microCT imaging associated with an inverse micro-finite-element method allowed to assess microscopic mechanical trabecular bone parameters. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Determination of trace element level in different tissues of the leaping mullet (Liza saliens, Mugilidae) collected from Caspian Sea.

    Science.gov (United States)

    Ebrahimzadeh, Mohammad Ali; Eslami, Shahram; Nabavi, Seyed Fazel; Nabavi, Seyed Mohammad

    2011-12-01

    The concentrations of Cr, Cu, Fe, Mn, Ni, Pb, Cd, and Zn were determined in the brain, heart, liver, gill, gonad, spleen, kidney, and red and white muscles of Liza saliens (leaping mullet). Trace element levels in fish samples were analyzed by flame atomic absorption spectrometry. Among the non-essential metals, the levels of Ni and Pb in the tissues were higher than limits for fish proposed by FAO/WHO, EU, and TFC. Generally, the levels of the non-essential metals were much higher than those of manganese in the red and white muscles. Fe distribution pattern in tissues was in order of spleen > liver > heart > gill > brain > kidney > gonad > red muscle > white muscle. Red muscle was not within the safe limits for human consumption because non-essential metal (Ni, Pb) contents were higher than standard limits.

  6. Seismic response of reinforced concrete frames at different damage levels

    Science.gov (United States)

    Morales-González, Merangeli; Vidot-Vega, Aidcer L.

    2017-03-01

    Performance-based seismic engineering is focused on the definition of limit states to represent different levels of damage, which can be described by material strains, drifts, displacements or even changes in dissipating properties and stiffness of the structure. This study presents a research plan to evaluate the behavior of reinforced concrete (RC) moment resistant frames at different performance levels established by the ASCE 41-06 seismic rehabilitation code. Sixteen RC plane moment frames with different span-to-depth ratios and three 3D RC frames were analyzed to evaluate their seismic behavior at different damage levels established by the ASCE 41-06. For each span-to-depth ratio, four different beam longitudinal reinforcement steel ratios were used that varied from 0.85 to 2.5% for the 2D frames. Nonlinear time history analyses of the frames were performed using scaled ground motions. The impact of different span-to-depth and reinforcement ratios on the damage levels was evaluated. Material strains, rotations and seismic hysteretic energy changes at different damage levels were studied.

  7. Learning to attain an advanced level of professional responsibility.

    Science.gov (United States)

    Ter Maten-Speksnijder, Ada; Grypdonck, Mieke; Pool, Aart; Meurs, Pauline; Van Staa, AnneLoes

    2015-08-01

    After graduation, nurse practitioner students are expected to be capable of providing complex, evidence-based nursing care independently, combined with standardized medical care. The students who follow work-study programs have to develop their competencies in a healthcare environment dominated by efficiency policies. This study aims to explore nurse practitioner students' perceptions of their professional responsibility for patient care. This qualitative interpretative study entails a content analysis of 46 reflective case studies written by nurse practitioner students. The students felt responsible for the monitoring of patients' health status, attending to psychosocial problems, emphasizing compliance, and optimizing the family's role as informal caregivers. At the same time, students struggled to understand the complexities of their patients' needs, and they had difficulty applying their knowledge and skills to complex medical, psychological, and social problems. The students' perceptions of their new responsibility were characterized by a strong focus on curative care, while psychosocial components of health and illness concerns were often overlooked. The students experienced difficulties in meeting the criteria of advanced practice nursing described in the Dutch competency framework. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Levels, distribution and bioavailability of transuranic elements released in the Palomares accident (Spain).

    Science.gov (United States)

    Jiménez-Ramos, M C; Vioque, I; García-Tenorio, R; García León, M

    2008-11-01

    The current levels and distribution of the remaining transuranic contamination present in the terrestrial area affected by the nuclear Palomares accident have been evaluated through the determination of the Pu-isotopes and (241)Am concentrations in soils collected 35 years after the accident. In addition, after confirming that most of the contamination is present in particulate form, some bioavailability laboratory-based experiments, based on the use of single extractants, were performed as an essential step in order to study the behaviour of the Pu contamination in the soils from the affected areas.

  9. Volatilization behavior of semivolatile elements in vitrification of high-level liquid waste

    International Nuclear Information System (INIS)

    Igarashi, Hiroshi; Kato, Koh; Takahashi, Takeshi

    1991-11-01

    The effect of temperature on the volatilization of ruthenium, technetium, and selenium was observed in calcination experiments with simulated high-level liquid waste. Technetium and selenium were more volatile as calcining temperature increased. Ruthenium was less volatile when temperature exceeded 300degC. More than 80% of ruthenium that volatilized from room temperature to 500degC occurred between 200 and 300degC. A small amount of ruthenium volatilized above 300degC as well as below 135degC. (author)

  10. Preliminary analysis of levels of arsenic and other metalic elements in PM10 sampled near Copper Smelter Bor (Serbia

    Directory of Open Access Journals (Sweden)

    Renata Kovačević

    2010-09-01

    Full Text Available In this paper, the levels of twenty one elements (Ag, Al, As, B, Ba, Ca, Cd, Cr, Cu, Fe, K, Mg, Mn, Mo, Na, Ni, Pb, S, Se, Sr and Zn in PM10 are presented, as well as SO2 concentration, measured at the sampling site in an urban area of the town of Bor (40,000 inhabitants in eastern Serbia. The sampling site was located in a densely populated city center about 0.65 km away from one of the largest copper mines and copper smelters in Europe. For the first time PM10 was collected using the European standard sampler, during a preliminary campaign in duration of 7 days in early spring 2009. PM10 were sampled on PTFE membrane filters and element concentrations were quantified by GF AAS and ICP AES. Concentration levels and correlations within trace elements, PM10 and SO2 indicated that industrial activities underpinned with meteorological conditions of low wind speed (calm are the main factors that influence air pollution in a densely populated area. It was evident that both PM10 mass concentration and SO2 concentration once exceeded the daily limit values during a measuring period of seven days. Strong relationship was found between PM10 and Mn, Mg, Ca and B daily average concentrations. On the other hand, SO2 correlated strongly with As, Pb, Cd, Cu and S daily average concentrations. These results confirm the relationship between emissions of SO2 from the Copper Smelter Bor and calm meteorological conditions (wind speed less than 0.5 m/sec with the concentration levels of carcinogenic substances of arsenic, lead and cadmium in ambient air.

  11. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  12. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  13. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  14. Response of Anopheles gambiae detoxification enzymes to levels of ...

    African Journals Online (AJOL)

    Some of the sampled larvae were reared to pupae and adult life stages. Levels of 7 physical (pH, temperature, conductivity, transparency, total dissolved solids, dissolved oxygen and biological oxygen demand) and 6 chemical (sulphates, phosphates, nitrites, nitrates, carbon content and oil and grease) environmental ...

  15. Dynamics in Responsible Land Administration; Change at Five Levels

    NARCIS (Netherlands)

    Zevenbergen, Jaap; de Vries, W.T.; Bennett, Rohan

    2018-01-01

    Fundamentally, the term 'administration' suggests bureaucratic, controlled and steady, if not slow, paces of change. However the relations between people and land, that land administration attempts to capture, are the very opposite and are changing rapidly. At all levels of abstraction, land

  16. Individual and population-level responses to ocean acidification.

    Science.gov (United States)

    Harvey, Ben P; McKeown, Niall J; Rastrick, Samuel P S; Bertolini, Camilla; Foggo, Andy; Graham, Helen; Hall-Spencer, Jason M; Milazzo, Marco; Shaw, Paul W; Small, Daniel P; Moore, Pippa J

    2016-01-29

    Ocean acidification is predicted to have detrimental effects on many marine organisms and ecological processes. Despite growing evidence for direct impacts on specific species, few studies have simultaneously considered the effects of ocean acidification on individuals (e.g. consequences for energy budgets and resource partitioning) and population level demographic processes. Here we show that ocean acidification increases energetic demands on gastropods resulting in altered energy allocation, i.e. reduced shell size but increased body mass. When scaled up to the population level, long-term exposure to ocean acidification altered population demography, with evidence of a reduction in the proportion of females in the population and genetic signatures of increased variance in reproductive success among individuals. Such increased variance enhances levels of short-term genetic drift which is predicted to inhibit adaptation. Our study indicates that even against a background of high gene flow, ocean acidification is driving individual- and population-level changes that will impact eco-evolutionary trajectories.

  17. Designing Iranian Model to Assess the Level of Health System Responsiveness.

    Science.gov (United States)

    Askari, Roohollah; Arab, Mohammad; Rashidian, Arash; Akbari-Sari, Ali; Hosseini, Seyed Mostafa; Gharaee, Hojat

    2016-03-01

    Given the rapid pace of changes in community health needs and the mission of healthcare organizations to provide and promote the community's health, the growing need to increase health system responsiveness to people as a key element of observance and fulfillment of justice is felt more than ever. This study was aimed at designing the native model of responsiveness for Iran and to validate the aspects of the proposed model. Our study had a cross-sectional design and was a validation study performed in 2014. In order to define and identify responsiveness model aspects, the first phase recorded the views of 200 key informants from 19 provinces of Iran. Snowball sampling was used to select experts (based on WHO guideline). Then, the opinions of 18 comments were received from service recipients in the form of three focus group discussions and were analyzed by the frame framework analysis (interviewed recipients were selected using the purposive sampling method). Finally, in order to confirm the model's efficacy, a responsiveness questionnaire with 7 aspects (domains) and 52 indicators (items) obtained from the initial proposed model was answered by 600 members of the selected families in the two provinces of Fars and Yazd. A multi-stage cluster sampling approach was used for the household survey. The results were analyzed by the Confirmatory Factor Analysis (CFA) test and through the use of Lisrel software. Confirmatory Factor Analysis, based on the results of the key informant survey and group discussions, showed that according to quantities of GFI = 0.91, CFI = 0.93, NFI = 0.91, RMSEA = 0.074, SRMR = 0.061 and Hoelter (CN) = 178.54 in outpatient services and where GFI = 0.89, CFI = 0.91, NFI = 0.86, RMSEA = 0.064, SRMR = 0.053 and Hoelter (CN) = 158.93 for inpatient services, seven factors (F) (dignity, informed choice, confidentiality, patient training and informing, access to services, quality of basic amenities, and access to social support) are the main

  18. Residential heating contribution to level of air pollutants (PAHs, major, trace, and rare earth elements): a moss bag case study.

    Science.gov (United States)

    Vuković, Gordana; Aničić Urošević, Mira; Pergal, Miodrag; Janković, Milan; Goryainova, Zoya; Tomašević, Milica; Popović, Aleksandar

    2015-12-01

    In areas with moderate to continental climates, emissions from residential heating system lead to the winter air pollution peaks. The EU legislation requires only the monitoring of airborne concentrations of particulate matter, As, Cd, Hg, Ni, and B[a]P. Transition metals and rare earth elements (REEs) have also arisen questions about their detrimental health effects. In that sense, this study examined the level of extensive set of air pollutants: 16 polycyclic aromatic hydrocarbons (PAHs), and 41 major elements, trace elements, and REEs using Sphagnum girgensohnii moss bag technique. During the winter of 2013/2014, the moss bags were exposed across Belgrade (Serbia) to study the influence of residential heating system to the overall air quality. The study was set as an extension to our previous survey during the summer, i.e., non-heating season. Markedly higher concentrations of all PAHs, Sb, Cu, V, Ni, and Zn were observed in the exposed moss in comparison to the initial values. The patterns of the moss REE concentrations normalized to North American Shale Composite and Post-Archean Australian Shales were identical across the study area but enhanced by anthropogenic activities. The results clearly demonstrate the seasonal variations in the moss enrichment of the air pollutants. Moreover, the results point out a need for monitoring of air quality during the whole year, and also of various pollutants, not only those regulated by the EU Directive.

  19. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  20. Integrating plant ecological responses to climate extremes from individual to ecosystem levels.

    Science.gov (United States)

    Felton, Andrew J; Smith, Melinda D

    2017-06-19

    Climate extremes will elicit responses from the individual to the ecosystem level. However, only recently have ecologists begun to synthetically assess responses to climate extremes across multiple levels of ecological organization. We review the literature to examine how plant responses vary and interact across levels of organization, focusing on how individual, population and community responses may inform ecosystem-level responses in herbaceous and forest plant communities. We report a high degree of variability at the individual level, and a consequential inconsistency in the translation of individual or population responses to directional changes in community- or ecosystem-level processes. The scaling of individual or population responses to community or ecosystem responses is often predicated upon the functional identity of the species in the community, in particular, the dominant species. Furthermore, the reported stability in plant community composition and functioning with respect to extremes is often driven by processes that operate at the community level, such as species niche partitioning and compensatory responses during or after the event. Future research efforts would benefit from assessing ecological responses across multiple levels of organization, as this will provide both a holistic and mechanistic understanding of ecosystem responses to increasing climatic variability.This article is part of the themed issue 'Behavioural, ecological and evolutionary responses to extreme climatic events'. © 2017 The Author(s).

  1. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  2. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  3. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  4. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  5. Mangrove Sedimentation and Response to Relative Sea-Level Rise.

    Science.gov (United States)

    Woodroffe, C D; Rogers, K; McKee, K L; Lovelock, C E; Mendelssohn, I A; Saintilan, N

    2016-01-01

    Mangroves occur on upper intertidal shorelines in the tropics and subtropics. Complex hydrodynamic and salinity conditions, related primarily to elevation and hydroperiod, influence mangrove distributions; this review considers how these distributions change over time. Accumulation rates of allochthonous and autochthonous sediment, both inorganic and organic, vary between and within different settings. Abundant terrigenous sediment can form dynamic mudbanks, and tides redistribute sediment, contrasting with mangrove peat in sediment-starved carbonate settings. Sediments underlying mangroves sequester carbon but also contain paleoenvironmental records of adjustments to past sea-level changes. Radiometric dating indicates long-term sedimentation, whereas measurements made using surface elevation tables and marker horizons provide shorter perspectives, indicating shallow subsurface processes of root growth and substrate autocompaction. Many tropical deltas also experience deep subsidence, which augments relative sea-level rise. The persistence of mangroves implies an ability to cope with moderately high rates of relative sea-level rise. However, many human pressures threaten mangroves, resulting in a continuing decline in their extent throughout the tropics.

  6. Income Levels and Response to Contingency Management for Smoking Cessation.

    Science.gov (United States)

    López-Núñez, Carla; Secades-Villa, Roberto; Peña-Suárez, Elsa; Fernández-Artamendi, Sergio; Weidberg, Sara

    2017-06-07

    Contingency management (CM) has demonstrated its efficacy in treating many drug addictions, including nicotine. However, one of the most commonly perceived limitations with regard to its dissemination into community settings is whether this protocol could be equally effective for treating patients across different income levels. This study aimed to examine whether individuals' income levels affect treatment success in a cognitive behavioral treatment (CBT) that included a voucher-based CM protocol for smoking cessation. A total of 92 treatment-seeking smokers in a community setting were randomly assigned to a CBT group (N = 49) or to a CBT plus CM group (N = 43). The CM procedure included a voucher program through which smoking abstinence was reinforced on a schedule of escalating magnitude of reinforcement with a reset contingency. We analyzed the impact of self-reported monthly income, alone and in combination with treatment condition, on short-term (treatment retention) and long-term (self-reported number of days of continuous smoking abstinence at 6-month follow-up) results. Income had no effect on treatment retention and continuous abstinence outcomes at 6-month follow-up in either treatment condition. Treatment modality emerged as the only significant predictor of treatment success. Our findings suggest that treatment-seeking smokers from the general population respond equally well to CM regardless of their income levels. The results of this randomized controlled trial support the generalizability of this evidenced-based program into community settings.

  7. Mangrove sedimentation and response to relative sea-level rise

    Science.gov (United States)

    Woodroffe, CD; Rogers, K.; Mckee, Karen L.; Lovelock, CE; Mendelssohn, IA; Saintilan, N.

    2016-01-01

    Mangroves occur on upper intertidal shorelines in the tropics and subtropics. Complex hydrodynamic and salinity conditions influence mangrove distributions, primarily related to elevation and hydroperiod; this review considers how these adjust through time. Accumulation rates of allochthonous and autochthonous sediment, both inorganic and organic, vary between and within different settings. Abundant terrigenous sediment can form dynamic mudbanks; tides redistribute sediment, contrasting with mangrove peat in sediment-starved carbonate settings. Sediments underlying mangroves sequester carbon, but also contain paleoenvironmental records of adjustments to past sea-level changes. Radiometric dating indicates long-term sedimentation, whereas Surface Elevation Table-Marker Horizon measurements (SET-MH) provide shorter perspectives, indicating shallow subsurface processes of root growth and substrate autocompaction. Many tropical deltas also experience deep subsidence, which augments relative sea-level rise. The persistence of mangroves implies an ability to cope with moderately high rates of relative sea-level rise. However, many human pressures threaten mangroves, resulting in continuing decline in their extent throughout the tropics.

  8. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  9. Chemoreceptor Responsiveness at Sea Level Does Not Predict the Pulmonary Pressure Response to High Altitude.

    Science.gov (United States)

    Hoiland, Ryan L; Foster, Glen E; Donnelly, Joseph; Stembridge, Mike; Willie, Chris K; Smith, Kurt J; Lewis, Nia C; Lucas, Samuel J E; Cotter, Jim D; Yeoman, David J; Thomas, Kate N; Day, Trevor A; Tymko, Mike M; Burgess, Keith R; Ainslie, Philip N

    2015-07-01

    The hypoxic ventilatory response (HVR) at sea level (SL) is moderately predictive of the change in pulmonary artery systolic pressure (PASP) to acute normobaric hypoxia. However, because of progressive changes in the chemoreflex control of breathing and acid-base balance at high altitude (HA), HVR at SL may not predict PASP at HA. We hypothesized that resting oxygen saturation as measured by pulse oximetry (Spo₂) at HA would correlate better than HVR at SL with PASP at HA. In 20 participants at SL, we measured normobaric, isocapnic HVR (L/min · -%Spo₂⁻¹) and resting PASP using echocardiography. Both resting Spo₂ and PASP measures were repeated on day 2 (n = 10), days 4 to 8 (n = 12), and 2 to 3 weeks (n = 8) after arrival at 5,050 m. These data were also collected at 5,050 m in life-long HA residents (ie, Sherpa [n = 21]). Compared with SL, Spo₂ decreased from 98.6% to 80.5% (P HVR at SL was not related to Spo₂ or PASP at any time point at 5,050 m (all P > .05). Sherpa had lower PASP (P .50), there was a weak relationship in the Sherpa (R² = 0.16, P = .07). We conclude that neither HVR at SL nor resting Spo₂ at HA correlates with elevations in PASP at HA.

  10. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  11. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  12. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  13. The effect of phosphorus level in the sheep diet on the element uptake by the erythrocytes

    International Nuclear Information System (INIS)

    Silva Filho, J.C. da; Vitti, D.M.S.S.

    1995-01-01

    A trial with sheep was carried out to investigate the effect of the level of phosphorus in the diet on the 32 P uptake by the red blood cells. Twenty four male sheep were kept in individual cages, during two periods of 45 days each. In the first one the animals received a basal diet without phosphorus supplementation. In the second period the animals were divided in four groups and different amounts of bone meal were offered to supply 1,2 and 3 gP/head/day. The control group received only the basal diet. An in vitro technique was used to incubate total blood and 32 P solution as Na HP O 4 . After 3 hours incubation, the red blood cells were washed thrice with an isotonic saline solution. The solid material was transferred to crucibles, dried at 100 0 C and reduced to ash 500 0 C. Diggestion with 6N H 2 SO 4 solution was followed and radioactivity was detected by Cherenkov effect. The average 32 P uptake were: 6.04± 0.40 and 6.56 ±- 1.94, 6.18± 0.36 and 5.53 ± 1.06, 5.84 ± 0.48 and 6.31 ± 1.32, 6.0 ± 0.80 and 6.03 ± 1.50 at the first and second periods in treatments 0, 1, 2 and 3gP/head/day, respectively. There was no differences between treatments. (author). 22 refs, 1 tab

  14. Nano-level instrumentation for analyzing the dynamic accuracy of a rolling element bearing

    International Nuclear Information System (INIS)

    Yang, Z.; Hong, J.; Zhang, J.; Wang, M. Y.; Zhu, Y.

    2013-01-01

    The rotational performance of high-precision rolling bearings is fundamental to the overall accuracy of complex mechanical systems. A nano-level instrument to analyze rotational accuracy of high-precision bearings of machine tools under working conditions was developed. In this instrument, a high-precision (error motion < 0.15 μm) and high-stiffness (2600 N axial loading capacity) aerostatic spindle was applied to spin the test bearing. Operating conditions could be simulated effectively because of the large axial loading capacity. An air-cylinder, controlled by a proportional pressure regulator, was applied to drive an air-bearing subjected to non-contact and precise loaded axial forces. The measurement results on axial loading and rotation constraint with five remaining degrees of freedom were completely unconstrained and uninfluenced by the instrument's structure. Dual capacity displacement sensors with 10 nm resolution were applied to measure the error motion of the spindle using a double-probe error separation method. This enabled the separation of the spindle's error motion from the measurement results of the test bearing which were measured using two orthogonal laser displacement sensors with 5 nm resolution. Finally, a Lissajous figure was used to evaluate the non-repetitive run-out (NRRO) of the bearing at different axial forces and speeds. The measurement results at various axial loadings and speeds showed the standard deviations of the measurements’ repeatability and accuracy were less than 1% and 2%. Future studies will analyze the relationship between geometrical errors and NRRO, such as the ball diameter differences of and the geometrical errors in the grooves of rings

  15. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  16. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  17. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  18. Manufacturing at industrial level of UO2 pellets for the fuel elements of the Atucha I Nuclear Power Plant

    International Nuclear Information System (INIS)

    Dyment, I.G.; Noguera Rojas, Francisco

    1982-01-01

    The interest to produce fuel elements within a policy of self sufficiency arose with the installation of Atucha I. The first steps towards this goal consisted in processing the uranium oxide, transforming it into fuel pellets of high density. The developments towards the fabrication of said pellets, performed by CNEA since 1968, first at a laboratory level and afterwards on an industrial scale, allowed CNEA to obtain its own technological capability to produce 400 kg of UO 2 per day. The fuel pellets manufacturing method developed by CNEA is a powder-metallurgical process, which, besides conventional equipment, involves the use of special equipment that required the performance of systematic testing programmes, as well as special training at operational level. The developed processes respond to a modern and advanced technology. A general scheme of the process, starting with a directly sinterable UO 2 powder, is described, including compacting of the powder into pellets, sintering, control of the temperature in the sintering and reduction zones and of the time of permanence in both zones, and cylindric rectifying of the pellets. During the whole process, specialized personnel controls the operations, after which the material is released by the Quality Control Department. The national contribution to the manufacturing technology of the pellets for fuel elements of power and research reactors was of 100%. (M.E.L.) [es

  19. A pilot study to measure levels of selected elements in Thai foods by instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Laoharojanaphand, S.; Busamongkol, A.; Permnamtip, V.; Judprasong, K.; Chatt, A.

    2012-01-01

    A pilot study was carried out to evaluate the scope of instrumental neutron activation analysis (INAA) for measuring the levels of selected elements in a few commonly consumed food items in Thailand. Several varieties of rice, beans, aquatic food items, vegetables and soybean products were bought from major distribution centers in Bangkok, Thailand. Samples were prepared according to the protocols prescribed by the nutritionist for food compositional analysis. Levels of As, Br, Ca, Cd, Cl, Cr, Cu, Fe, K, Mg, Mn, and Zn were measured by INAA using the irradiation and counting facilities available at the Thai Research Reactor with the maximum in-core thermal neutron flux of 3 x 10 13 cm -2 s -1 of the Thailand Institute of Nuclear Technology in Bangkok. Selenium was determined by cyclic INAA using the Dalhousie University SLOWPOKE-2 Reactor facilities in Halifax, Canada at a thermal neutron flux of 2.5 x 10 11 cm -2 s -1 . Both cooked and uncooked foods were analyzed. The elemental composition of food products was found to depend significantly on the raw material as well as the preparation technique. (author)

  20. Concentration levels of rare-earth elements and thorium on plants from the Morro de Ferro environment as an indicator for the biological availability of transuranium elements

    International Nuclear Information System (INIS)

    Miekeley, N.; Casartelli, E.A.; Dotto, R.M.

    1994-01-01

    Plants and soils from a natural thorium and rare-earth element occurrence (Morro do Ferro, Brazil) were analyzed by alpha spectrometry (Th) and ICP-AES (REE), after pre-concentration of the elements by solvent extraction, co-precipitation and ion exchange procedures. Leaching experiments with humic acid solutions and different soils were performed to estimate the fraction of elements biologically available. High concentrations of the light rare-earth elements (LREE) and of Th, reaching some hundreds of μg/g-ash, were measured in plant leaves from the areas of the highest concentration of these elements in soil and in near-surface waters. Chondrite normalized REE plots of plant leaves and corresponding soils are very similar, suggesting that there is no significant fractionation between the REE during uptake from the soil solution and incorporation into the leaves. However, Ce-depletion was observed for some plant species, increasing for Solanum ciliatum in the sequence: leaves -3 to 10 -2 . Leaching experiments confirmed the importance of humic acid complexation for the bio-uptake of Th and REE and further showed that only a very small fraction of these elements in soil is leachable. The implications of these results on the calculated CR's will be discussed. (author) 26 refs.; 5 figs.; 5 tabs

  1. Consumer segmentation based on the level of environmental responsibility

    Directory of Open Access Journals (Sweden)

    Marija Ham

    2009-12-01

    Full Text Available Doubtless, there is an environmentally responsible segment of consumers in the market. However, with an increasing number of suppliers entering the green market, it is no longer sufficient to be aware of this fact. What is needed now are complex strategies of segmentation, targeting and positioning. The aim of this paper was to provide a theoretical framework for understanding the key concepts related to the green consumer segment and to help create a clearer picture of Croatia’s green consumers by gathering secondary data from the available literature, previous research and primary data from own research. Primary research was conducted by means of a structured questionnaire on a sample of 552 respondents. The questionnaire was divided into three parts, each measuring, respectively, attitudes, knowledge and activities undertaken. After the segmentation (three segments: green, neutral and brown consumers, a chi-square test was used in an attempt to prove statistically significant differences when comparing the given segment structure with the respondents’ demographic characteristics. The results of this research describe the average green consumer in the Republic of Croatia as a person who is 55 and older, with higher or university education, who is married, who responds to the advertising claims about eco-friendliness of products and is influenced by those claims, who occasionally or frequently makes purchasing decisions and shows readiness to pay a 20 percent mark-up for an environmentally friendly product.

  2. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  4. Blood pressure response to low level static contractions

    DEFF Research Database (Denmark)

    Fallentin, Nils; Jørgensen, Kurt

    1992-01-01

    The present study re-examines the 15% MVC concept, i.e. the existence of a circulatory steady-state in low intensity static contractions below 15% of maximal voluntary contraction (MVC). Mean arterial blood pressure was studied during static endurance contractions of the elbow flexor and extensor...... 0.7) min for elbow extension]. Mean arterial blood pressure exhibited a continuous and progressive increase during the 10% MVC contractions indicating that the 15% MVC concept would not appear to be valid. The terminal blood pressure value recorded at the point of exhaustion in the 10% MVC elbow...... the circulation to the muscles was arrested just prior to the cessation of the contraction, blood pressure only partly recovered and remained elevated for as long as the occlusion persisted, indicating the level of pressure-raising muscle chemoreflexes. Based on blood pressure recordings obtained during...

  5. Low-level wind response to mesoscale pressure systems

    Science.gov (United States)

    Garratt, J. R.; Physick, W. L.

    1983-09-01

    Observations are presented which show a strong correlation between low-level wind behaviour (e.g., rotation near the surface) and the passage of mesoscale pressure systems. The latter are associated with frontal transition zones, are dominated by a pressure-jump line and a mesoscale high pressure area, and produce locally large horizontal pressure gradients. The wind observations are simulated by specifying a time sequence of perturbation pressure gradient and subsequently solving the vertically-integrated momentum equations with appropriate initial conditions. Very good agreement is found between observed and calculated winds; in particular, (i) a 360 ° rotation in wind on passage of the mesoscale high; (ii) wind-shift lines produced dynamically by the pressure-jump line; (iii) rapid linear increase in wind speed on passage of the pressure jump.

  6. Ecosystem Responses To Plant Phenology Across Scales And Trophic Levels

    Science.gov (United States)

    Stoner, D.; Sexton, J. O.; Nagol, J. R.; Ironside, K.; Choate, D.; Longshore, K.; Edwards, T., Jr.

    2015-12-01

    Plant phenology in arid and semi-arid ecoregions is constrained by water availability and governs the life history characteristics of primary and secondary consumers. We related the behavior, demography, and distribution of mammalian herbivores and their principal predator to remotely sensed vegetation and climatological indices across the western United States for the period 2000-2014. Across scales, terrain and topographic position moderates the effects of climatological drought on primary productivity, resulting in differential susceptibility among plant functional types to water stress. At broad scales, herbivores tie parturition to moist sites during the period of maximum increase in local forage production. Consequently, juvenile mortality is highest in regions of extreme phenological variability. Although decoupled from primary production by one or more trophic levels, carnivore home range size and density is negatively correlated to plant productivity and growing season length. At the finest scales, predation influences the behavior of herbivore prey through compromised habitat selection, in which maternal females trade nutritional benefits of high plant biomass for reduced mortality risk associated with increased visibility. Climate projections for the western United States predict warming combined with shifts in the timing and form of precipitation. Our analyses suggest that these changes will propagate through trophic levels as increased phenological variability and shifts in plant distributions, larger consumer home ranges, altered migration behavior, and generally higher volatility in wildlife populations. Combined with expansion and intensification of human land use across the region, these changes will likely have economic implications stemming from increased human-wildlife conflict (e.g., crop damage, vehicle collisions) and changes in wildlife-related tourism.

  7. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  9. Corporate Social Responsibility (CSR) and Leadership in South Africa : What motivates high-level business leaders in South Africa to rive CSR within their companites and beyond

    NARCIS (Netherlands)

    Thum, Anette

    2017-01-01

    The PhD thesis “Corporate social responsibility (CSR) and leadership in South Africa” focused on the question of what motivates high-level business leaders to drive CSR in their organizations and beyond. Next to other elements the support of top executive leaders is known to be highly important for

  10. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  11. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  12. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  13. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  14. Reexamination of $L_{3}$ and $M_{1}$ atomic-level widths of elements 54 $\\le$ Z $\\le$ 77

    CERN Document Server

    Mauron, O; Baechler, S; Berset, M; Maillard, Y P; Raboud, P A; Hoszowska, J

    2003-01-01

    High-resolution measurements of the photoinduced L/sub 3/-M/sub 1/ and L/sub 3/-M/sub 4,5/ X-ray emission lines were performed with a reflection-type bent-crystal spectrometer for a variety of elements ranging from xenon (Z=54) to iridium (Z=77). The measurements were performed at the European Synchrotron Radiation Facility in Grenoble, France. From the observed linewidths of the L/sub 3/-M/sub 1/ x-ray transitions, the widths of the M/sub 1/ levels were determined using the L/sub 3/ level widths extracted from the measured L/sub 3/-M/sub 5/ transitions, and assuming for the M/sub 5/ levels the widths reported recently by Campbell and Papp ÝAt. Data Nucl. Data Tables 77, 1 (2001)¿. In the rare-earth region a Z-dependent broadening of the M/sub 1/ level was observed. (51 refs).

  15. Levels of essential and toxic elements in Porphyra columbina and Ulva sp. from San Jorge Gulf, Patagonia Argentina

    International Nuclear Information System (INIS)

    Perez, Adriana Angela; Farias, Silvia Sara; Strobl, Analia Mabel; Perez, Laura Beatriz; Lopez, Clara Magdalena; Pineiro, Adriana; Roses, Otmaro; Fajardo, Maria Angelica

    2007-01-01

    Baseline concentration levels of As, B, Ca, Cd, Cr, Cu, Co, Fe, Mg, Mn, Mo, Ni, P, Pb, Se, V, and Zn were determined for Porphyra columbina and Ulva sp. collected from three locations along San Jorge Gulf, in Patagonia Argentina. Elements were quantified by inductively coupled plasma-optical emission spectrometry, with the exception of lead and cadmium in some samples which were determined by electrothermal atomic absorption spectrometry. Three stations with different exposure degree to human activities, Bahia Solano, the mouth of Arroyo La Mata stream and Punta Maqueda, were selected as sampling points. The results showed a wide range of metal retention capacity between the two studied species. Regarding the levels of pollutants found in the researched sites, Punta Maqueda seemed to be less influenced by anthropogenic activities than the other two sites except for Cd. Taking into account their toxicities seasonal variations in Pb and Cd levels were studied in both algae in Punta Maqueda. Maximum concentrations of Cd (9.8 μg g -1 dry wt.) were observed in P. columbina during winter, and maximum levels of Pb (0.82 μg g -1 dry wt.) were detected in Ulva sp. during summer. Legislative and health safety aspects were evaluated for Cd and Pb

  16. Levels of essential and toxic elements in Porphyra columbina and Ulva sp. from San Jorge Gulf, Patagonia Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Perez, Adriana Angela [Catedras de Toxicologia y Quimica Legal, Biologia y Bromatologia y Nutricion, Universidad Nacional de la Patagonia San Juan Bosco, Chubut (Argentina); Farias, Silvia Sara [Comision Nacional de Energia Atomica, Gerencia de Tecnologia y Medio Ambiente, Buenos Aires (Argentina); Strobl, Analia Mabel [Catedras de Toxicologia y Quimica Legal, Biologia y Bromatologia y Nutricion, Universidad Nacional de la Patagonia San Juan Bosco, Chubut (Argentina); Perez, Laura Beatriz [Catedras de Toxicologia y Quimica Legal, Biologia y Bromatologia y Nutricion, Universidad Nacional de la Patagonia San Juan Bosco, Chubut (Argentina); Lopez, Clara Magdalena [Catedra de Toxicologia y Quimica Legal, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires (Argentina); Pineiro, Adriana [Catedra de Toxicologia y Quimica Legal, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires (Argentina); Roses, Otmaro [Catedra de Toxicologia y Quimica Legal, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires (Argentina); Fajardo, Maria Angelica [Catedras de Toxicologia y Quimica Legal, Biologia y Bromatologia y Nutricion, Universidad Nacional de la Patagonia San Juan Bosco, Chubut (Argentina)]. E-mail: copipat@sinectis.com.ar

    2007-04-15

    Baseline concentration levels of As, B, Ca, Cd, Cr, Cu, Co, Fe, Mg, Mn, Mo, Ni, P, Pb, Se, V, and Zn were determined for Porphyra columbina and Ulva sp. collected from three locations along San Jorge Gulf, in Patagonia Argentina. Elements were quantified by inductively coupled plasma-optical emission spectrometry, with the exception of lead and cadmium in some samples which were determined by electrothermal atomic absorption spectrometry. Three stations with different exposure degree to human activities, Bahia Solano, the mouth of Arroyo La Mata stream and Punta Maqueda, were selected as sampling points. The results showed a wide range of metal retention capacity between the two studied species. Regarding the levels of pollutants found in the researched sites, Punta Maqueda seemed to be less influenced by anthropogenic activities than the other two sites except for Cd. Taking into account their toxicities seasonal variations in Pb and Cd levels were studied in both algae in Punta Maqueda. Maximum concentrations of Cd (9.8 {mu}g g{sup -1} dry wt.) were observed in P. columbina during winter, and maximum levels of Pb (0.82 {mu}g g{sup -1} dry wt.) were detected in Ulva sp. during summer. Legislative and health safety aspects were evaluated for Cd and Pb.

  17. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  18. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  19. Sulfate-Driven Elemental Sparing Is Regulated at the Transcriptional and Posttranscriptional Levels in a Filamentous Cyanobacterium▿ †

    OpenAIRE

    Gutu, Andrian; Alvey, Richard M.; Bashour, Sami; Zingg, Daniel; Kehoe, David M.

    2011-01-01

    Sulfur is an essential nutrient that can exist at growth-limiting concentrations in freshwater environments. The freshwater cyanobacterium Fremyella diplosiphon (also known as Tolypothrix sp. PCC 7601) is capable of remodeling the composition of its light-harvesting antennae, or phycobilisomes, in response to changes in the sulfur levels in its environment. Depletion of sulfur causes these cells to cease the accumulation of two forms of a major phycobilisome protein called phycocyanin and ini...

  20. Levels of trace elements in green turtle eggs collected from Hong Kong: Evidence of risks due to selenium and nickel

    International Nuclear Information System (INIS)

    Lam, James C.W.; Tanabe, Shinsuke; Chan, Simon K.F.; Lam, Michael H.W.; Martin, Michael; Lam, Paul K.S.

    2006-01-01

    Concentrations of 22 trace elements were determined in green turtle (Chelonia mydas) eggs collected from Hong Kong. Concentrations of selenium, lead and nickel in these eggs were generally higher than those reported in other studies. The predicted no effect concentrations (PNEC; ng/g wet weight) of Pb (1000), Se (340 and 6000 for the worst-case and best-case scenarios, respectively) and Ni (17) in the green turtle eggs were estimated. Hazard quotients (HQs) estimate that Se (HQs: 0.2-24.5) and Ni (HQs: 4.0-26.4) may pose some risks to the turtles. Our study also found that concentrations of Ag, Se, Zn, Hg and Pb in the shell of the turtle eggs were significantly correlated with levels in the whole egg contents (yolk + albumen). Once the precise relationships of specific elements are established, egg-shell concentrations may be used as a non-lethal, non-invasive, surrogate for predicting whole egg burden of certain contaminants in marine turtles. - Concentrations of selenium and nickel in green turtle eggs from Hong Kong might pose some risks to the turtles

  1. Levels of trace elements in green turtle eggs collected from Hong Kong: Evidence of risks due to selenium and nickel

    Energy Technology Data Exchange (ETDEWEB)

    Lam, James C.W. [Center for Coastal Pollution and Conservation, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong (China); Tanabe, Shinsuke [Center for Marine Environmental Studies, Ehime University, Tarumi 3-5-7, Matsuyama 790-8556 (Japan); Chan, Simon K.F. [Agriculture, Fisheries and Conservation Department, Hong Kong SAR Government, Hong Kong, (China); Lam, Michael H.W. [Center for Coastal Pollution and Conservation, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong (China); Martin, Michael [Center for Coastal Pollution and Conservation, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong (China); Lam, Paul K.S. [Center for Coastal Pollution and Conservation, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong (China)]. E-mail: bhpksl@cityu.edu.hk

    2006-12-15

    Concentrations of 22 trace elements were determined in green turtle (Chelonia mydas) eggs collected from Hong Kong. Concentrations of selenium, lead and nickel in these eggs were generally higher than those reported in other studies. The predicted no effect concentrations (PNEC; ng/g wet weight) of Pb (1000), Se (340 and 6000 for the worst-case and best-case scenarios, respectively) and Ni (17) in the green turtle eggs were estimated. Hazard quotients (HQs) estimate that Se (HQs: 0.2-24.5) and Ni (HQs: 4.0-26.4) may pose some risks to the turtles. Our study also found that concentrations of Ag, Se, Zn, Hg and Pb in the shell of the turtle eggs were significantly correlated with levels in the whole egg contents (yolk + albumen). Once the precise relationships of specific elements are established, egg-shell concentrations may be used as a non-lethal, non-invasive, surrogate for predicting whole egg burden of certain contaminants in marine turtles. - Concentrations of selenium and nickel in green turtle eggs from Hong Kong might pose some risks to the turtles.

  2. Investigation of the levels of some element in edible oil samples produced in Turkey by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Mendil, Durali; Uluoezlue, Ozguer Dogan; Tuezen, Mustafa; Soylak, Mustafa

    2009-01-01

    The element contents (Fe, Mn, Zn, Cu, Pb, Co, Cd, Na, K, Ca and Mg) in edible oils (olive oil, hazelnut oil, sunflower oil, margarine, butter and corn oil) from Turkey were determined using atomic absorption spectrometry after microwave digestion. The concentrations of trace element in the samples were found to be 291.0-52.0, 1.64-0.04, 3.08-1.03, 0.71-0.05, 0.03-0.01, 1.30-0.50, 84.0-0.90, 50.1-1.30, 174.2-20.8 and 20.8-0.60 μg/g for iron, manganese, zinc, copper, lead, cobalt, sodium, potassium, calcium, and magnesium, respectively. Cadmium was found to be 4.57-0.09 μg/kg. The high heavy metal and minerals accumulation levels in the samples were found in olive oil for Cu, Pb, Co, margarine for Fe, K, corn oil for Zn, Mn, butter for Na, Mg, sunflower oil for Ca and hazelnut oil for Cd, respectively.

  3. REDOX state analysis of platinoid elements in simulated high-level radioactive waste glass by synchrotron radiation based EXAFS

    Energy Technology Data Exchange (ETDEWEB)

    Okamoto, Yoshihiro, E-mail: okamoto.yoshihiro@jaea.go.jp [Condensed Matter Chemistry Group, Quantum Beam Science Center, Japan Atomic Energy Agency, Shirakata 2-4, Tokai-mura, Ibaraki 319-1195 (Japan); Shiwaku, Hideaki [Quantum Beam Science Center, Japan Atomic Energy Agency, Kouto 1-1-1, Sayo-cho, Hyogo 679-5143 (Japan); Nakada, Masami [Nuclear Engineering Science Center, Japan Atomic Energy Agency, Shirakata 2-4, Tokai-mura, Ibaraki 319-1195 (Japan); Komamine, Satoshi; Ochi, Eiji [Japan Nuclear Fuel Limited, 4-108 Aza Okitsuke, Oaza Obuchi, Rokkasho-mura, Aomori 030-3212 (Japan); Akabori, Mitsuo [Nuclear Engineering Science Center, Japan Atomic Energy Agency, Shirakata 2-4, Tokai-mura, Ibaraki 319-1195 (Japan)

    2016-04-01

    Extended X-ray Absorption Fine Structure (EXAFS) analyses were performed to evaluate REDOX (REDuction and OXidation) state of platinoid elements in simulated high-level nuclear waste glass samples prepared under different conditions of temperature and atmosphere. At first, EXAFS functions were compared with those of standard materials such as RuO{sub 2}. Then structural parameters were obtained from a curve fitting analysis. In addition, a fitting analysis used a linear combination of the two standard EXAFS functions of a given elements metal and oxide was applied to determine ratio of metal/oxide in the simulated glass. The redox state of Ru was successfully evaluated from the linear combination fitting results of EXAFS functions. The ratio of metal increased at more reducing atmosphere and at higher temperatures. Chemical form of rhodium oxide in the simulated glass samples was RhO{sub 2} unlike expected Rh{sub 2}O{sub 3}. It can be estimated rhodium behaves according with ruthenium when the chemical form is oxide.

  4. Levels, spatial variation and compartmentalization of trace elements in brown algae Cystoseira from marine protected areas of Crimea (Black Sea).

    Science.gov (United States)

    Kravtsova, Alexandra V; Milchakova, Nataliya A; Frontasyeva, Marina V

    2015-08-15

    Levels of Al, Sc, V, Co, Ni, As, Br, Rb, Sr, Ag, Sb, I, Cs, Ba, Th and U that were rarely or never studied, as well as the concentrations of classically investigated Mn, Fe and Zn in brown algae Cystoseira barbata C. Ag. and Cystoseira crinita (Desf.) Bory from the coastal waters of marine protected areas (Crimea, Black Sea), were determined using neutron activation analysis. Spatial variation and compartmentalization were studied for all 19 trace elements (TE). Concentrations of most TE were higher in "branches" than in "stems". Spatial variations of V, Co, Ni and Zn can be related to anthropogenic activities while Al, Sc, Fe, Rb, Cs, Th and U varied depending on chemical peculiarities of the coastal zone rocks. TE concentrations in C. crinita from marine protected areas near Tarkhankut peninsula and Cape Fiolent, identified as the most clean water areas, are submitted as the background concentrations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Dose-response relationships and threshold levels in skin and respiratory allergy

    NARCIS (Netherlands)

    Arts, J.H.E.; Mommers, C.; Heer, C.de

    2006-01-01

    A literature study was performed to evaluate dose-response relationships and no-effect levels for sensitization and elicitation in skin- and respiratory allergy. With respect to the skin, dose-response relationships and no-effect levels were found for both intradermal and topical induction, as well

  6. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  7. Backward Response-Level Crosstalk in the Psychological Refractory Period Paradigm

    Science.gov (United States)

    Miller, Jeff; Alderton, Mark

    2006-01-01

    Bottleneck models of psychological refractory period (PRP) tasks suggest that a Task 1 response should be unaffected by the Task 2 response in the same trial, because selection of the former finishes before selection of the latter begins. Contrary to this conception, the authors found backward response-level crosstalk effects in which Task 2…

  8. Item level diagnostics and model - data fit in item response theory ...

    African Journals Online (AJOL)

    Item response theory (IRT) is a framework for modeling and analyzing item response data. Item-level modeling gives IRT advantages over classical test theory. The fit of an item score pattern to an item response theory (IRT) models is a necessary condition that must be assessed for further use of item and models that best fit ...

  9. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  10. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  11. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  12. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  13. Individual and culture-level components of survey response styles: A multi-level analysis using cultural models of selfhood.

    Science.gov (United States)

    Smith, Peter B; Vignoles, Vivian L; Becker, Maja; Owe, Ellinor; Easterbrook, Matthew J; Brown, Rupert; Bourguignon, David; Garðarsdóttir, Ragna B; Kreuzbauer, Robert; Cendales Ayala, Boris; Yuki, Masaki; Zhang, Jianxin; Lv, Shaobo; Chobthamkit, Phatthanakit; Jaafar, Jas Laile; Fischer, Ronald; Milfont, Taciano L; Gavreliuc, Alin; Baguma, Peter; Bond, Michael Harris; Martin, Mariana; Gausel, Nicolay; Schwartz, Seth J; Des Rosiers, Sabrina E; Tatarko, Alexander; González, Roberto; Didier, Nicolas; Carrasco, Diego; Lay, Siugmin; Nizharadze, George; Torres, Ana; Camino, Leoncio; Abuhamdeh, Sami; Macapagal, Ma Elizabeth J; Koller, Silvia H; Herman, Ginette; Courtois, Marie; Fritsche, Immo; Espinosa, Agustín; Villamar, Juan A; Regalia, Camillo; Manzi, Claudia; Brambilla, Maria; Zinkeng, Martina; Jalal, Baland; Kusdil, Ersin; Amponsah, Benjamin; Çağlar, Selinay; Mekonnen, Kassahun Habtamu; Möller, Bettina; Zhang, Xiao; Schweiger Gallo, Inge; Prieto Gil, Paula; Lorente Clemares, Raquel; Campara, Gabriella; Aldhafri, Said; Fülöp, Márta; Pyszczynski, Tom; Kesebir, Pelin; Harb, Charles

    2016-12-01

    Variations in acquiescence and extremity pose substantial threats to the validity of cross-cultural research that relies on survey methods. Individual and cultural correlates of response styles when using 2 contrasting types of response mode were investigated, drawing on data from 55 cultural groups across 33 nations. Using 7 dimensions of self-other relatedness that have often been confounded within the broader distinction between independence and interdependence, our analysis yields more specific understandings of both individual- and culture-level variations in response style. When using a Likert-scale response format, acquiescence is strongest among individuals seeing themselves as similar to others, and where cultural models of selfhood favour harmony, similarity with others and receptiveness to influence. However, when using Schwartz's (2007) portrait-comparison response procedure, acquiescence is strongest among individuals seeing themselves as self-reliant but also connected to others, and where cultural models of selfhood favour self-reliance and self-consistency. Extreme responding varies less between the two types of response modes, and is most prevalent among individuals seeing themselves as self-reliant, and in cultures favouring self-reliance. As both types of response mode elicit distinctive styles of response, it remains important to estimate and control for style effects to ensure valid comparisons. © 2016 International Union of Psychological Science.

  14. Dietary Selenium Levels Affect Selenoprotein Expression and Support the Interferon-γ and IL-6 Immune Response Pathways in Mice

    Directory of Open Access Journals (Sweden)

    Petra A. Tsuji

    2015-08-01

    Full Text Available Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake.

  15. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  16. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  17. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  18. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  19. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  20. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  1. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  2. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  3. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  4. Is Preventative Long-Segment Surgery for Multi-Level Spondylolysis Necessary? A Finite Element Analysis Study.

    Directory of Open Access Journals (Sweden)

    Jianqiang Mo

    Full Text Available For multi-level spondylolysis patients, surgeons commonly choose to fix all the segments with pars interarticularis defect even those without slippage and not responsible for clinical symptoms. In this study, we tried to study the necessity of the preventative long-segment surgery for the defected segment without slippage in treatment of multi-level spondylolysis patients from a biomechanical perspective.We established a bi-level spondylolysis model with pars defects at L4 and L5 segments, and simulated posterior lumbar interbody fusion (PLIF and pedicle screw fixation at L5-S1 level. Then we compared the biomechanical changes at L4 segment before and after surgery in neutral, flexion, extension, lateral bending and axial rotation position.The stress on L4 pars interarticularis was very similar before and after surgery, and reached the highest in axial rotation. The L3-L4 intradiscal pressure was almost the same, while L4-L5 intradiscal pressure changed a little in lateral bending (increase from 1.993 to 2.160 MPa and axial rotation (decrease from 1.639 to 1.307 MPa after surgery. The PLIF surgery caused a little increase of range of motion at adjacent L4-L5 and L3-L4 levels, but the change is very tiny (1 degree.The PLIF surgery will not cause significant biomechanical change at adjacent segment with pars defect in multi-level spondylolysis. On the contrary, excessive long-segment surgery will damage surrounding soft tissues which are important for maintaining the stability of spine. So a preventative long-segment surgery is not necessary for multi-level spondylolysis as long as there are no soft tissue degeneration signs at adjacent level.

  5. Is Preventative Long-Segment Surgery for Multi-Level Spondylolysis Necessary? A Finite Element Analysis Study.

    Science.gov (United States)

    Mo, Jianqiang; Zhang, Wen; Zhong, Dongyan; Xu, Hao; Wang, Lan; Yu, Jia; Luo, Zongping

    2016-01-01

    For multi-level spondylolysis patients, surgeons commonly choose to fix all the segments with pars interarticularis defect even those without slippage and not responsible for clinical symptoms. In this study, we tried to study the necessity of the preventative long-segment surgery for the defected segment without slippage in treatment of multi-level spondylolysis patients from a biomechanical perspective. We established a bi-level spondylolysis model with pars defects at L4 and L5 segments, and simulated posterior lumbar interbody fusion (PLIF) and pedicle screw fixation at L5-S1 level. Then we compared the biomechanical changes at L4 segment before and after surgery in neutral, flexion, extension, lateral bending and axial rotation position. The stress on L4 pars interarticularis was very similar before and after surgery, and reached the highest in axial rotation. The L3-L4 intradiscal pressure was almost the same, while L4-L5 intradiscal pressure changed a little in lateral bending (increase from 1.993 to 2.160 MPa) and axial rotation (decrease from 1.639 to 1.307 MPa) after surgery. The PLIF surgery caused a little increase of range of motion at adjacent L4-L5 and L3-L4 levels, but the change is very tiny (1 degree). The PLIF surgery will not cause significant biomechanical change at adjacent segment with pars defect in multi-level spondylolysis. On the contrary, excessive long-segment surgery will damage surrounding soft tissues which are important for maintaining the stability of spine. So a preventative long-segment surgery is not necessary for multi-level spondylolysis as long as there are no soft tissue degeneration signs at adjacent level.

  6. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  7. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  8. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  9. The element level time domain (ELTD) method for the analysis of nano-optical systems: I. Nondispersive media

    Science.gov (United States)

    Fallahi, Arya; Oswald, Benedikt; Leidenberger, Patrick

    2012-04-01

    We study a 3-dimensional, dual-field, fully explicit method for the solution of Maxwell's equations in the time domain on unstructured, tetrahedral grids. The algorithm uses the element level time domain (ELTD) discretization of the electric and magnetic vector wave equations. In particular, the suitability of the method for the numerical analysis of nanometer structured systems in the optical region of the electromagnetic spectrum is investigated. The details of the theory and its implementation as a computer code are introduced and its convergence behavior as well as conditions for stable time domain integration is examined. Here, we restrict ourselves to non-dispersive dielectric material properties since dielectric dispersion will be treated in a subsequent paper. Analytically solvable problems are analyzed in order to benchmark the method. Eventually, a dielectric microlens is considered to demonstrate the potential of the method. A flexible method of 2nd order accuracy is obtained that is applicable to a wide range of nano-optical configurations and can be a serious competitor to more conventional finite difference time domain schemes which operate only on hexahedral grids. The ELTD scheme can resolve geometries with a wide span of characteristic length scales and with the appropriate level of detail, using small tetrahedra where delicate, physically relevant details must be modeled.

  10. Comparative study on serum levels of macro and trace elements in schizophrenia based on supervised learning methods.

    Science.gov (United States)

    Lin, Tong; Liu, Tiebing; Lin, Yucheng; Yan, Lailai; Chen, Zhongxue; Wang, Jingyu

    2017-09-01

    The etiology and pathophysiology of schizophrenia (SCZ) remain obscure. This study explored the associations between SCZ risk and serum levels of 39 macro and trace elements (MTE). A 1:1 matched case-control study was conducted among 114 schizophrenia patients and 114 healthy controls matched by age, sex and region. Blood samples were collected to determine the concentrations of 39 MTE by ICP-AES and ICP-MS. Both supervised learning methods and classical statistical testing were used to uncover the difference of MTE levels between cases and controls. The best prediction accuracies were 99.21% achieved by support vector machines in the original feature space (without dimensionality reduction), and 98.82% achieved by Naive Bayes with dimensionality reduction. More than half of MTE were found to be significantly different between SCZ patients and the controls. The presented investigation showed that there existed remarkable differences in concentrations of MTE between SCZ patients and healthy controls. The results of this study might be useful to diagnosis and prognosis of SCZ; they also indicated other promising applications in pharmacy and nutrition. However, the results should be interpreted with caution due to limited sample size and the lack of potential confounding factors, such as alcohol, smoking, body mass index (BMI), use of antipsychotics and dietary intakes. In the future the application of the analyses will be useful in designs that have larger sample sizes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  12. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  13. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  14. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  15. Abiotic stressors and stress responses: What commonalities appear between species across biological organization levels?

    International Nuclear Information System (INIS)

    Sulmon, Cécile; Baaren, Joan van; Cabello-Hurtado, Francisco; Gouesbet, Gwenola; Hennion, Françoise; Mony, Cendrine; Renault, David; Bormans, Myriam; El Amrani, Abdelhak; Wiegand, Claudia; Gérard, Claudia

    2015-01-01

    Organisms are regularly subjected to abiotic stressors related to increasing anthropogenic activities, including chemicals and climatic changes that induce major stresses. Based on various key taxa involved in ecosystem functioning (photosynthetic microorganisms, plants, invertebrates), we review how organisms respond and adapt to chemical- and temperature-induced stresses from molecular to population level. Using field-realistic studies, our integrative analysis aims to compare i) how molecular and physiological mechanisms related to protection, repair and energy allocation can impact life history traits of stressed organisms, and ii) to what extent trait responses influence individual and population responses. Common response mechanisms are evident at molecular and cellular scales but become rather difficult to define at higher levels due to evolutionary distance and environmental complexity. We provide new insights into the understanding of the impact of molecular and cellular responses on individual and population dynamics and assess the potential related effects on communities and ecosystem functioning. - Highlights: • Responses to chemical and thermal stressors are reviewed across organization levels. • Common responses between taxa are evident at the molecular and cellular scales. • At individual level, energy allocation connects species-specific stress responses. • Commonality decreases at higher levels due to increasing environmental complexity. - The commonality of stress responses to chemical and thermal stressors among taxa is evident at the molecular and cellular scales but remains unclear at higher levels of organization

  16. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  17. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  18. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  19. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  20. Demonstration of pyropartitioning process by using genuine high-level liquid waste. Reductive-extraction of actinide elements from chlorination product

    International Nuclear Information System (INIS)

    Uozumi, Koichi; Iizuka, Masatoshi; Kurata, Masaki; Ougier, Michel; Malmbeck, Rikard; Winckel, Stefaan van

    2009-01-01

    The pyropartitioning process separates the minor actinide elements (MAs) together with uranium and plutonium from the high-level liquid waste generated at the Purex reprocessing of spent LWR fuel and introduces them to metallic fuel cycle. For the demonstration of this technology, a series experiment using 520g of genuine high-level liquid waste was started and the conversion of actinide elements to their chlorides was already demonstrated by denitration and chlorination. In the present study, a reductive extraction experiment in molten salt/liquid cadmium system to recover actinide elements from the chlorination product of the genuine high-level liquid waste was performed. The results of the experiment are as following; 1) By the addition of the cadmium-lithium alloy reductant, almost all of plutonium and MAs in the initial high-level liquid waste were recovered in the cadmium phase. It means no mass loss during denitration, chlorination, and reductive-extraction. 2) The separation factor values of plutonium, MAs, and rare-earth fission product elements versus uranium agreed with the literature values. Therefore, actinide elements will be separated from fission product elements in the actual system. Hence, the pyropartitioning process was successfully demonstrated. (author)

  1. Evaluation of trace element and mineral status and related to levels of amino acid in children with phenylketonuria.

    Science.gov (United States)

    Gok, Fazilet; Ekin, Suat; Dogan, Murat

    2016-07-01

    The aim of the present study was to examine trace elements (Zn, Cu, Mn, Se, Fe, Co, Cr, Ni, Cd, Pb), minerals (Ca, Mg, K), amino acids status in children with phenylketonuria and also whether they were correlated with each other in phenylketonuric patients. It has been found out that the HPA group was significantly lower than the control group with regards to Zn, Se, K, Ca, Mg and Zn/Cr levels (p<0.001, p<0.01, p<0.001, p<0.01, p<0.01 and p<0.001 respectively). In the patients with HPA, significantly strong positive correlations were observed between magnesium and calcium (r=0.791; p=0.001), also, indicates negative significant correlation between the concentrations of magnesium and phenylalanine (r=-0.591; p=0.026). The results of this study showed that, in the HPA group, phenylalanine-Mg relationship found, the presence of disease will in the evaluation of phenylalanine and other amino acids, together with the value of magnesium is required to consider. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Yeast cytochrome c integrated with electronic elements: a nanoscopic and spectroscopic study down to single-molecule level

    International Nuclear Information System (INIS)

    Delfino, I; Bonanni, B; Andolfi, L; Baldacchini, C; Bizzarri, A R; Cannistraro, S

    2007-01-01

    Various aspects of redox protein integration with nano-electronic elements are addressed by a multi-technique investigation of different yeast cytochrome c (YCC)-based hybrid systems. Three different immobilization strategies on gold via organic linkers are explored, involving either covalent bonding or electrostatic interaction. Specifically, Au surfaces are chemically modified by self-assembled monolayers (SAMs) exposing thiol-reactive groups, or by acid-oxidized single-wall carbon nanotubes (SWNTs). Atomic force microscopy and scanning tunnelling microscopy are employed to characterize the morphology and the electronic properties of single YCC molecules adsorbed on the modified gold surfaces. In each hybrid system, the protein molecules are stably assembled, in a native configuration. A standing-up arrangement of YCC on SAMs is suggested, together with an enhancement of the molecular conduction, as compared to YCC directly assembled on gold. The electrostatic interaction with functionalized SWNTs allows several YCC adsorption geometries, with a preferential high-spin haem configuration, as outlined by Raman spectroscopy. Moreover, the conduction properties of YCC, explored in different YCC nanojunctions by conductive atomic force microscopy, indicate the effectiveness of electrical conduction through the molecule and its dependence on the electrode material. The joint employment of several techniques confirms the key role of a well-designed immobilization strategy, for optimizing biorecognition capabilities and electrical coupling with conductive substrates at the single-molecule level, as a starting point for advanced applications in nano-biotechnology

  3. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  4. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  5. Plasma homovanillic acid levels in first-episode schizophrenia. Psychopathology and treatment response.

    Science.gov (United States)

    Koreen, A R; Lieberman, J; Alvir, J; Mayerhoff, D; Loebel, A; Chakos, M; Amin, F; Cooper, T

    1994-02-01

    To examine plasma homovanillic acid (pHVA) levels in first-episode schizophrenia, to compare pHVA levels in patients and controls, and to assess the association of pHVA levels with psychopathology and treatment response. Forty-one patients entered the study, and pHVA levels were measured at baseline and on a weekly basis for up to 6 weeks of open standardized neuroleptic treatment. Psychopathology was evaluated with the Schedule for Affective Disorders and Schizophrenia, the Scale for Assessment of Negative Symptoms, and the Clinical Global Impressions scale. Ten healthy controls were used for comparison of baseline pHVA levels. No differences were observed between patients and controls. Baseline pHVA level was not associated with psychopathology but was associated with time to reach remission. Baseline pHVA levels and week-1 pHVA levels were higher in responders than nonresponders. Regardless of responsiveness, female participants had higher pHVA levels than male participants throughout the study. The pattern of pHVA levels with treatment was similar in all patients with a short-term rise initially and then a decrease toward baseline values. These findings suggest that pHVA levels have prognostic significance for response and time to reach remission. Qualitative and quantitative differences between first-episode patients' pHVA levels and studies using a long-term, neuroleptic-exposed population suggest that changes occur with neuroleptic treatment or the progression of the illness.

  6. Children's Self-Esteem, Level of Esteem Certainty, and Responsibility for Success and Failure

    Science.gov (United States)

    Piers, Ellen V.

    1977-01-01

    Relationships between children's self esteem, certainty of self esteem appraisal, and intellectual achievement responsibility were examined in boys and girls at the sixth grade and tenth grade levels with use of the Piers-Harris Children's Self Concept Scale and the Intellectual Achievement Responsibility Questionnaire. (MS)

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  8. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  9. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  10. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  11. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  12. Maternal and umbilical cord blood levels of mercury, lead, cadmium, and essential trace elements in Arctic Canada

    International Nuclear Information System (INIS)

    Butler Walker, Jody; Houseman, Jan; Seddon, Laura; McMullen, Ed; Tofflemire, Karen; Mills, Carole; Corriveau, Andre; Weber, Jean-Philippe; LeBlanc, Alain; Walker, Mike; Donaldson, Shawn G.; Van Oostdam, Jay

    2006-01-01

    Maternal and umbilical cord blood levels of mercury (Hg), lead (Pb), cadmium (Cd), and the trace elements copper (Cu), zinc (Zn), and selenium (Se) are reported for Inuit, Dene/Metis, Caucasian, and Other nonaboriginal participants from Arctic Canada. This is the first human tissue monitoring program covering the entire Northwest Territories and Nunavut for multiple contaminants and establishes a baseline upon which future comparisons can be made. Results for chlorinated organic pesticides and PCBs for these participants have been reported elsewhere. Between May 1994 and June 1999, 523 women volunteered to participate by giving their written informed consent, resulting in the collection of 386 maternal blood samples, 407 cord samples, and 351 cord:maternal paired samples. Geometric mean (GM) maternal total mercury (THg) concentrations ranged from 0.87μg/L (SD=1.95) in the Caucasian group of participants (n=134) to 3.51μg/L (SD=8.30) in the Inuit group (n=146). The GM of the Inuit group was 2.6-fold higher than that of the Dene/Metis group (1.35μg/L, SD=1.60, n=92) and significantly higher than those of all other groups (P 8 cigarettes/day) was 7.4-fold higher and 12.5-fold higher, respectively, than in nonsmokers. The high percentage of smokers among Inuit (77%) and Dene/Metis (48%) participants highlights the need for ongoing public health action directed at tobacco prevention, reduction, and cessation for women of reproductive age. Pb and THg were detected in more than 95% of all cord blood samples, with GMs of 21 μg/L and 2.7μg/L, respectively, and Cd was detected in 26% of all cord samples, with a GM of 0.08μg/L. Cord:maternal ratios from paired samples ranged from 0.44 to 4.5 for THg, from 0.5 to 10.3 for MeHg, and 0.1 to 9.0 for Pb. On average, levels of THg, MeHg, and Zn were significantly higher in cord blood than in maternal blood (P<0.0001), whereas maternal Cd, Pb, Se, and Cu levels were significantly higher than those in cord blood (P<0

  13. Heavy Metals Induce Iron Deficiency Responses at Different Hierarchic and Regulatory Levels1[OPEN

    Science.gov (United States)

    2017-01-01

    In plants, the excess of several heavy metals mimics iron (Fe) deficiency-induced chlorosis, indicating a disturbance in Fe homeostasis. To examine the level at which heavy metals interfere with Fe deficiency responses, we carried out an in-depth characterization of Fe-related physiological, regulatory, and morphological responses in Arabidopsis (Arabidopsis thaliana) exposed to heavy metals. Enhanced zinc (Zn) uptake closely mimicked Fe deficiency by leading to low chlorophyll but high ferric-chelate reductase activity and coumarin release. These responses were not caused by Zn-inhibited Fe uptake via IRON-REGULATED TRANSPORTER (IRT1). Instead, Zn simulated the transcriptional response of typical Fe-regulated genes, indicating that Zn affects Fe homeostasis at the level of Fe sensing. Excess supplies of cobalt and nickel altered root traits in a different way from Fe deficiency, inducing only transient Fe deficiency responses, which were characterized by a lack of induction of the ethylene pathway. Cadmium showed a rather inconsistent influence on Fe deficiency responses at multiple levels. By contrast, manganese evoked weak Fe deficiency responses in wild-type plants but strongly exacerbated chlorosis in irt1 plants, indicating that manganese antagonized Fe mainly at the level of transport. These results show that the investigated heavy metals modulate Fe deficiency responses at different hierarchic and regulatory levels and that the interaction of metals with physiological and morphological Fe deficiency responses is uncoupled. Thus, this study not only emphasizes the importance of assessing heavy metal toxicities at multiple levels but also provides a new perspective on how Fe deficiency contributes to the toxic action of individual heavy metals. PMID:28500270

  14. Heavy Metals Induce Iron Deficiency Responses at Different Hierarchic and Regulatory Levels.

    Science.gov (United States)

    Lešková, Alexandra; Giehl, Ricardo F H; Hartmann, Anja; Fargašová, Agáta; von Wirén, Nicolaus

    2017-07-01

    In plants, the excess of several heavy metals mimics iron (Fe) deficiency-induced chlorosis, indicating a disturbance in Fe homeostasis. To examine the level at which heavy metals interfere with Fe deficiency responses, we carried out an in-depth characterization of Fe-related physiological, regulatory, and morphological responses in Arabidopsis ( Arabidopsis thaliana ) exposed to heavy metals. Enhanced zinc (Zn) uptake closely mimicked Fe deficiency by leading to low chlorophyll but high ferric-chelate reductase activity and coumarin release. These responses were not caused by Zn-inhibited Fe uptake via IRON-REGULATED TRANSPORTER (IRT1). Instead, Zn simulated the transcriptional response of typical Fe-regulated genes, indicating that Zn affects Fe homeostasis at the level of Fe sensing. Excess supplies of cobalt and nickel altered root traits in a different way from Fe deficiency, inducing only transient Fe deficiency responses, which were characterized by a lack of induction of the ethylene pathway. Cadmium showed a rather inconsistent influence on Fe deficiency responses at multiple levels. By contrast, manganese evoked weak Fe deficiency responses in wild-type plants but strongly exacerbated chlorosis in irt1 plants, indicating that manganese antagonized Fe mainly at the level of transport. These results show that the investigated heavy metals modulate Fe deficiency responses at different hierarchic and regulatory levels and that the interaction of metals with physiological and morphological Fe deficiency responses is uncoupled. Thus, this study not only emphasizes the importance of assessing heavy metal toxicities at multiple levels but also provides a new perspective on how Fe deficiency contributes to the toxic action of individual heavy metals. © 2017 American Society of Plant Biologists. All Rights Reserved.

  15. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  16. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  17. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  18. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  19. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  20. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  1. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  2. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  3. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Forget the Desk Job: Current Roles and Responsibilities in Entry-Level Reference Job Advertisements

    Science.gov (United States)

    Detmering, Robert; Sproles, Claudene

    2012-01-01

    This study examines the evolving roles and responsibilities of entry-level academic reference positions, as stated in recent job advertisements posted on the American Library Association's JobLIST Web site and other sources. Findings from a content analysis of these advertisements indicate that current entry-level reference positions in academic…

  5. Evaluation of noise pollution level based upon community exposure and response data

    Science.gov (United States)

    Edmiston, R. D.

    1972-01-01

    The results and procedures are reported from an evaluation of noise pollution level as a predictor of annoyance, based on aircraft noise exposure and community response data. The measures of noise exposure presented include composite noise rating, noise exposure forecast, noise and number index. A proposed measure as a universal noise exposure measure for noise pollution level (L sub NP) is discussed.

  6. Interannual variation of rare earth element abundances in corals from northern coast of the South China Sea and its relation with sea-level change and human activities

    Science.gov (United States)

    Liu, Yajing; Peng, Z.; Wei, G.; Chen, T.; Sun, W.; He, J.; Liu, Gaisheng; Chou, C.-L.; Shen, C.-C.

    2011-01-01

    Here we present interannual rare earth element (REE) records spanning the last two decades of the 20th century in two living Porites corals, collected from Longwan Bay, close to the estuarine zones off Wanquan River of Hainan Island and Hong Kong off the Pearl River Delta of Guangdong Province in the northern South China Sea. The results show that both coral REE contents (0.5-40 ng g-1 in Longwan Bay and 2-250 ng g-1 in Hong Kong for La-Lu) are characterized with a declining trend, which are significantly negative correlated with regional sea-level rise (9.4 mm a-1 from 1981 to 1996 in Longwan Bay, 13.7 mm a-1 from 1991 to 2001 in Hong Kong). The REE features are proposed to be resulted from seawater intrusion into the estuaries in response to contemporary sea-level rise. However, the tendency for the coral Er/Nd time series at Hong Kong site is absent and there is no significant relation between Er/Nd and total REEs as found for the coral at Longwan Bay site. The observations are likely attributed to changes of the water discharge and sediment load of Pearl River, which have been significantly affected by intense human activities, such as the construction of dams/reservoirs and riverbed sediment mining, in past decades. The riverine sediment load/discharge ratio of the Pearl River decreased sharply with a rate of 0.02 kg m-3 a-1, which could make significant contribution to the declining trend of coral REE. We propose that coastal corals in Longwan Bay and similar unexplored sites with little influences of river discharge and anthropogenic disruption are ideal candidates to investigate the influence of sea-level change on seawater/coral REE. ?? 2010 Elsevier Ltd.

  7. Thin-Film Magnetic-Field-Response Fluid-Level Sensor for Non-Viscous Fluids

    Science.gov (United States)

    Woodard, Stanley E.; Shams, Qamar A.; Fox, Robert L.; Taylor, Bryant D.

    2008-01-01

    An innovative method has been developed for acquiring fluid-level measurements. This method eliminates the need for the fluid-level sensor to have a physical connection to a power source or to data acquisition equipment. The complete system consists of a lightweight, thin-film magnetic-field-response fluid-level sensor (see Figure 1) and a magnetic field response recorder that was described in Magnetic-Field-Response Measurement-Acquisition System (LAR-16908-1), NASA Tech Briefs, Vol. 30, No. 6 (June 2006), page 28. The sensor circuit is a capacitor connected to an inductor. The response recorder powers the sensor using a series of oscillating magnetic fields. Once electrically active, the sensor responds with its own harmonic magnetic field. The sensor will oscillate at its resonant electrical frequency, which is dependent upon the capacitance and inductance values of the circuit.

  8. A noise level prediction method based on electro-mechanical frequency response function for capacitors.

    Science.gov (United States)

    Zhu, Lingyu; Ji, Shengchang; Shen, Qi; Liu, Yuan; Li, Jinyu; Liu, Hao

    2013-01-01

    The capacitors in high-voltage direct-current (HVDC) converter stations radiate a lot of audible noise which can reach higher than 100 dB. The existing noise level prediction methods are not satisfying enough. In this paper, a new noise level prediction method is proposed based on a frequency response function considering both electrical and mechanical characteristics of capacitors. The electro-mechanical frequency response function (EMFRF) is defined as the frequency domain quotient of the vibration response and the squared capacitor voltage, and it is obtained from impulse current experiment. Under given excitations, the vibration response of the capacitor tank is the product of EMFRF and the square of the given capacitor voltage in frequency domain, and the radiated audible noise is calculated by structure acoustic coupling formulas. The noise level under the same excitations is also measured in laboratory, and the results are compared with the prediction. The comparison proves that the noise prediction method is effective.

  9. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  10. Determination of elemental concentrations at trace levels in alumina by charged particle activation analysis using proton beam from VEC accelerator

    International Nuclear Information System (INIS)

    Datta, J.; Dasgupta, S.; Chowdhury, D.P.; Verma, R.

    2015-01-01

    The elemental impurities have been determined in high purity alumina material used in nuclear reactors at ppb (μg kg -1 ) to ppm (mg kg -1 ) levels by CPAA using proton beam from VEC machine. Proton beam has the advantage of high cross section for (p, n) reaction to produce suitable nuclide for activation analysis by instrumental approach. The cross sections of higher reaction channels like (p, 2n), (p, pn) are found to be less than 1 mb below 13 MeV proton by theoretical calculation using ALICE 91 computer code. Therefore, 13 MeV proton beam was used to irradiate the alumina samples along with standards, Lake (IAEA-SL -1 ) and Marine (PACS-2) sediments, both in pellet and powder forms. The irradiation was carried out with 50 nA to 1μA beam current for 10 min to 10 h depending on types of samples and standards. The beam current was measured by Faraday cup and also checked by putting Ti monitoring foil before the target. Ni is determined by (p, pn) reaction using 18 MeV proton as there is no suitable product from (p, n) reaction. The counting measurements of irradiated samples were performed with a high resolution γ-spectrometer using HPGe detector (relative efficiency - 40%, resolution - 2.0 keV at 1332 keV) coupled to a PC based 8 k MCA. The validation of the CPAA results has been carried out by INAA with the same alumina samples, carried out in Dhruva reactor with neutron flux 10 14 cm 2 s -1 using standards IAEA-SL-1 and PACS-2

  11. Marine CDOM accumulation during a coastal Arctic mesocosm experiment: No response to elevated pCO2 levels

    Science.gov (United States)

    Pavlov, Alexey K.; Silyakova, Anna; Granskog, Mats A.; Bellerby, Richard G. J.; Engel, Anja; Schulz, Kai G.; Brussaard, Corina P. D.

    2014-06-01

    A large-scale multidisciplinary mesocosm experiment in an Arctic fjord (Kongsfjorden, Svalbard; 78°56.2'N) was used to study Arctic marine food webs and biogeochemical elements cycling at natural and elevated future carbon dioxide (CO2) levels. At the start of the experiment, marine-derived chromophoric dissolved organic matter (CDOM) dominated the CDOM pool. Thus, this experiment constituted a convenient case to study production of autochthonous CDOM, which is typically masked by high levels of CDOM of terrestrial origin in the Arctic Ocean proper. CDOM accumulated during the experiment in line with an increase in bacterial abundance; however, no response was observed to increased pCO2 levels. Changes in CDOM absorption spectral slopes indicate that bacteria were most likely responsible for the observed CDOM dynamics. Distinct absorption peaks (at 330 and 360 nm) were likely associated with mycosporine-like amino acids (MAAs). Due to the experimental setup, MAAs were produced in absence of ultraviolet exposure providing evidence for MAAs to be considered as multipurpose metabolites rather than simple photoprotective compounds. We showed that a small increase in CDOM during the experiment made it a major contributor to total absorption in a range of photosynthetically active radiation (PAR, 400-700 nm) and, therefore, is important for spectral light availability and may be important for photosynthesis and phytoplankton groups composition in a rapidly changing Arctic marine ecosystem.

  12. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Science.gov (United States)

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  13. Response of maize ( Zea mays L.) to varied moisture levels under ...

    African Journals Online (AJOL)

    Laboratory and glasshouse trials were used to determine the response of maize plants to varied moisture levels under Striga lutea infestation. Six moisture levels (1.5, 2.0, 2.5, 3.0, 3.5 and 4.0 ml) were applied to striga seed for germination count in the laboratory, while five moisture levels (300, 600, 900, 1200 and 1500 ml) ...

  14. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  15. Differences of the essential mineral element levels in the milk of Croatian Coldblood horse and Littoral-Dinaric donkey

    Directory of Open Access Journals (Sweden)

    Nina Bilandžić

    2014-03-01

    Full Text Available The concentrations of essential elements in the milk of Croatian Coldblood mares and Littoral- Dinaric donkey were measured. The mean element contents in horse milk were (mg/kg: Ca 687.1, Mg 72.1, K 637.7, Na 143.5, Cu 0.126, Fe 0.235, Se 0.01, Zn 2.06, Mn<0.01. In donkey milk, the mean element contents were (mg/kg: Ca 815.4, Mg 80.8, K 887.7, Na 217.6, Cu 0.027, Fe 0.196, Zn 2.36, Mn 0.016. In horse milk, moderate correlations were found between the elements: Ca-K, Mg-Se, Mg-K, Mg-Cu, Se-Cu, Se-Fe, Mn-K. Strong correlations were found among elements in donkey milk: Ca-Na, Ca-K, Ca-Cu, K-Na, K-Cu, Cu-Mn. Significant differences between Na, K and Cu concentrations were obtained between the two species. Other elements concentrations were similar in both species.

  16. Consumer factors predicting level of treatment response to illness management and recovery.

    Science.gov (United States)

    White, Dominique A; McGuire, Alan B; Luther, Lauren; Anderson, Adrienne I; Phalen, Peter; McGrew, John H

    2017-12-01

    This study aims to identify consumer-level predictors of level of treatment response to illness management and recovery (IMR) to target the appropriate consumers and aid psychiatric rehabilitation settings in developing intervention adaptations. Secondary analyses from a multisite study of IMR were conducted. Self-report data from consumer participants of the parent study (n = 236) were analyzed for the current study. Consumers completed prepost surveys assessing illness management, coping, goal-related hope, social support, medication adherence, and working alliance. Correlations and multiple regression analyses were run to identify self-report variables that predicted level of treatment response to IMR. Analyses revealed that goal-related hope significantly predicted level of improved illness self-management, F(1, 164) = 10.93, p consumer-level predictors of level of treatment response have not been explored for IMR. Although 2 significant predictors were identified, study findings suggest more work is needed. Future research is needed to identify additional consumer-level factors predictive of IMR treatment response in order to identify who would benefit most from this treatment program. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  17. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  18. Stathmin protein level, a potential predictive marker for taxane treatment response in endometrial cancer.

    Directory of Open Access Journals (Sweden)

    Henrica M J Werner

    Full Text Available Stathmin is a prognostic marker in many cancers, including endometrial cancer. Preclinical studies, predominantly in breast cancer, have suggested that stathmin may additionally be a predictive marker for response to paclitaxel. We first evaluated the response to paclitaxel in endometrial cancer cell lines before and after stathmin knock-down. Subsequently we investigated the clinical response to paclitaxel containing chemotherapy in metastatic endometrial cancer in relation to stathmin protein level in tumors. Stathmin level was also determined in metastatic lesions, analyzing changes in biomarker status on disease progression. Knock-down of stathmin improved sensitivity to paclitaxel in endometrial carcinoma cell lines with both naturally higher and lower sensitivity to paclitaxel. In clinical samples, high stathmin level was demonstrated to be associated with poor response to paclitaxel containing chemotherapy and to reduced disease specific survival only in patients treated with such combination. Stathmin level increased significantly from primary to metastatic lesions. This study suggests, supported by both preclinical and clinical data, that stathmin could be a predictive biomarker for response to paclitaxel treatment in endometrial cancer. Re-assessment of stathmin level in metastatic lesions prior to treatment start may be relevant. Also, validation in a randomized clinical trial will be important.

  19. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  20. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  1. Application of Wavelet Decomposition to Removing Barometric and Tidal Response in Borehole Water Level

    Institute of Scientific and Technical Information of China (English)

    Yan Rui; Huang Fuqiong; Chen Yong

    2007-01-01

    Wavelet decomposition is used to analyze barometric fluctuation and earth tidal response in borehole water level changes. We apply wavelet analysis method to the decomposition of barometric fluctuation and earth tidal response into several temporal series in different frequency ranges. Barometric and tidal coefficients in different frequency ranges are computed with least squares method to remove barometric and tidal response. Comparing this method with general linear regression analysis method, we find wavelet analysis method can efficiently remove barometric and earth tidal response in borehole water level. Wavelet analysis method is based on wave theory and vibration theories. It not only considers the frequency characteristic of the observed data but also the temporal characteristic, and it can get barometric and tidal coefficients in different frequency ranges. This method has definite physical meaning.

  2. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  3. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  4. The image of a research institution as an important element in shaping the level of competitiveness of the organisation

    Directory of Open Access Journals (Sweden)

    Świeczak Witold

    2017-06-01

    Full Text Available The primary objective of the publication is defining the factors and processes affecting the efficient course of actions undertaken around building a positive image of the organisation. The study raises key aspects of this issue. The diagnosis providing that the recipient is guided in his/her purchasing decisions by the opinions about a given product or service that reach them through all the available content distribution channels is appearing increasingly often in subsequent study findings. The same studies have also confirmed that an inherent feature of a knowledge-based economy is the level of the intangible asset share as regards determining the position of an organisation (brand, reputation. The unbridled increase in competition has led to the generation of a growing volume of advertising offers for buyers, as a result of which standing out among other market players has now become more of an issue. One of the ways to enhance an organisation’s presence in a changing environment includes measures promoting its positive image creation and shaping of favourable (valuable opinions about it. The selection of the appropriate image concept to a constantly changing business environment in terms of competing or consumer preferences requires an effective response to their experiences in the cognitive, emotional and behavioural dimensions. If they are positive, they will contribute to building a favourable mindset among consumers, which in turn will facilitate the formation of a positive image of the organisation.

  5. Variations in Element Levels Accumulated in Different Parts of Boletus edulis Collected from Central Yunnan Province, China

    Directory of Open Access Journals (Sweden)

    Xue-Mei Wang

    2015-01-01

    Full Text Available ICP-AES and microwave assisted digestion were applied to determine P, Mg, Ca, Zn, Na, Cu, Ba, Ni, V, Cd, Sr, Co, and Li in the caps and stipes of Boletus edulis collected from six spatially distant sites in Yunnan province, China. Fruiting bodies of King Bolete are abundant in P, Mg, Ca, Zn, Cu, and Na, followed by Ba, Cd, Ni, V, Li, Sr, and Co. Contents of P, Mg, Zn, and Cu are more abundant in caps than in stipes of King Bolete. However, elements such as Na, Ba, Cd, Ni, V, Li, Sr, and Co prefer to accumulate in stipes of mushrooms from Yaoan, Chuxiong. The results of this study indicate that spatial variations of elements between caps and stipes are mainly related to different bedrock soil geochemistry and enrichment capability for various elements.

  6. Influence determination of social responsibility to the productivity enterprise activity level

    OpenAIRE

    Kavun, Sergii; Zhosan, Ganna

    2016-01-01

    The purpose of this paper is to develop a scientific and methodical approach for determination of the comprehensive social responsibility indicator in this paper based on estimation of influence degree for the economical, ecological, social and labour, standard and legal components. There is allowance for determining of some level of enterprise social responsibility. In addition, there is a basis for development some ways of their increasing. The essence of the used approach is clotting of th...

  7. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  8. Basal blood DHEA-S/cortisol levels predicts EMDR treatment response in adolescents with PTSD.

    Science.gov (United States)

    Usta, Mirac Baris; Gumus, Yusuf Yasin; Say, Gokce Nur; Bozkurt, Abdullah; Şahin, Berkan; Karabekiroğlu, Koray

    2018-04-01

    In literature, recent evidence has shown that the hypothalamic-pituitary-adrenal (HPA) axis can be dysregulated in patients with post-traumatic stress disorder (PTSD) and HPA axis hormones may predict the psychotherapy treatment response in patients with PTSD. In this study, it was aimed to investigate changing cortisol and DHEA-S levels post-eye movement desensitization and reprocessing (EMDR) therapy and the relationship between treatment response and basal cortisol, and DHEA-S levels before treatment. The study group comprised 40 adolescents (age, 12-18 years) with PTSD. The PTSD symptoms were assessed using the Child Depression Inventory (CDI) and Child Post-traumatic Stress Reaction Index (CPSRI) and the blood cortisol and DHEA-S were measured with the chemiluminescence method before and after treatment. A maximum of six sessions of EMDR therapy were conducted by an EMDR level-1 trained child psychiatry resident. Treatment response was measured by the pre- to post-treatment decrease in self-reported and clinical PTSD severity. Pre- and post-treatment DHEA-S and cortisol levels did not show any statistically significant difference. Pre-treatment CDI scores were negatively correlated with pre-treatment DHEA-S levels (r: -0.39). ROC analysis demonstrated that the DHEA-S/cortisol ratio predicts treatment response at a medium level (AUC: 0.703, p: .030, sensitivity: 0.65, specificity: 0.86). The results of this study suggested that the DHEA-S/cortisol ratio may predict treatment response in adolescents with PTSD receiving EMDR therapy. The biochemical parameter of HPA-axis activity appears to be an important predictor of positive clinical response in adolescent PTSD patients, and could be used in clinical practice to predict PTSD treatment in the future.

  9. Response-only modal identification using random decrement algorithm with time-varying threshold level

    International Nuclear Information System (INIS)

    Lin, Chang Sheng; Tseng, Tse Chuan

    2014-01-01

    Modal Identification from response data only is studied for structural systems under nonstationary ambient vibration. The topic of this paper is the estimation of modal parameters from nonstationary ambient vibration data by applying the random decrement algorithm with time-varying threshold level. In the conventional random decrement algorithm, the threshold level for evaluating random dec signatures is defined as the standard deviation value of response data of the reference channel. The distortion of random dec signatures may be, however, induced by the error involved in noise from the original response data in practice. To improve the accuracy of identification, a modification of the sampling procedure in random decrement algorithm is proposed for modal-parameter identification from the nonstationary ambient response data. The time-varying threshold level is presented for the acquisition of available sample time history to perform averaging analysis, and defined as the temporal root-mean-square function of structural response, which can appropriately describe a wide variety of nonstationary behaviors in reality, such as the time-varying amplitude (variance) of a nonstationary process in a seismic record. Numerical simulations confirm the validity and robustness of the proposed modal-identification method from nonstationary ambient response data under noisy conditions.

  10. Transcriptional feedback regulation of YUCCA genes in response to auxin levels in Arabidopsis.

    Science.gov (United States)

    Suzuki, Masashi; Yamazaki, Chiaki; Mitsui, Marie; Kakei, Yusuke; Mitani, Yuka; Nakamura, Ayako; Ishii, Takahiro; Soeno, Kazuo; Shimada, Yukihisa

    2015-08-01

    The IPyA pathway, the major auxin biosynthesis pathway, is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels. The phytohormone auxin plays an important role in plant growth and development, and levels of active free auxin are determined by biosynthesis, conjugation, and polar transport. Unlike conjugation and polar transport, little is known regarding the regulatory mechanism of auxin biosynthesis. We discovered that expression of genes encoding indole-3-pyruvic acid (IPyA) pathway enzymes is regulated by elevated or reduced active auxin levels. Expression levels of TAR2, YUC1, YUC2, YUC4, and YUC6 were downregulated in response to synthetic auxins [1-naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D)] exogenously applied to Arabidopsis thaliana L. seedlings. Concomitantly, reduced levels of endogenous indole-3-acetic acid (IAA) were observed. Alternatively, expression of these YUCCA genes was upregulated by the auxin biosynthetic inhibitor kynurenine in Arabidopsis seedlings, accompanied by reduced IAA levels. These results indicate that expression of YUCCA genes is regulated by active auxin levels. Similar results were also observed in auxin-overproduction and auxin-deficient mutants. Exogenous application of IPyA to Arabidopsis seedlings preincubated with kynurenine increased endogenous IAA levels, while preincubation with 2,4-D reduced endogenous IAA levels compared to seedlings exposed only to IPyA. These results suggest that in vivo conversion of IPyA to IAA was enhanced under reduced auxin levels, while IPyA to IAA conversion was depressed in the presence of excess auxin. Based on these results, we propose that the IPyA pathway is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels.

  11. The contrasting responses of soil microorganisms in two rice cultivars to elevated ground-level ozone

    International Nuclear Information System (INIS)

    Feng, Youzhi; Yu, Yongjie; Tang, Haoye; Zu, Qianhui; Zhu, Jianguo; Lin, Xiangui

    2015-01-01

    Although elevated ground-level O 3 has a species–specific impact on plant growth, the differences in soil biota responses to O 3 pollution among rice cultivars are rarely reported. Using O 3 Free-Air Concentration Enrichment, the responses of the rhizospheric bacterial communities in the O 3 -tolerant (YD6) and the O 3 -sensitive (IIY084) rice cultivars to O 3 pollution and their differences were assessed by pyrosequencing at rice tillering and anthesis stages. Elevated ground-level O 3 negatively influenced the bacterial community in cultivar YD6 at both rice growth stages by decreasing the bacterial phylogenetic diversities and response ratios. In contrast, in cultivar IIY084, the bacterial community responded positively at the rice tillering stage under O 3 pollution. However, several keystone bacterial guilds were consistently negatively affected by O 3 pollution in two rice cultivars. These findings indicate that continuously O 3 pollution would negatively influence rice agroecosystem and the crop cultivar is important in determining the soil biota responses to elevated O 3 . - Highlights: • We investigated the soil biota in two rice cultivars in presence of elevated O 3 . • The contrasting responses of soil biota were found between two rice cultivars. • Some keystone bacterial guilds were consistently negatively affected by O 3 pollution. • The crop cultivar is important in determining soil biota responses to elevated O 3 . - The crop cultivar is important in determining the soil biota responses to elevated O 3

  12. Solving a Location, Allocation, and Capacity Planning Problem with Dynamic Demand and Response Time Service Level

    Directory of Open Access Journals (Sweden)

    Carrie Ka Yuk Lin

    2014-01-01

    Full Text Available Logistic systems with uncertain demand, travel time, and on-site processing time are studied here where sequential trip travel is allowed. The relationship between three levels of decisions: facility location, demand allocation, and resource capacity (number of service units, satisfying the response time requirement, is analysed. The problem is formulated as a stochastic mixed integer program. A simulation-based hybrid heuristic is developed to solve the dynamic problem under different response time service level. An initial solution is obtained from solving static location-allocation models, followed by iterative improvement of the three levels of decisions by ejection, reinsertion procedure with memory of feasible and infeasible service regions. Results indicate that a higher response time service level could be achieved by allocating a given resource under an appropriate decentralized policy. Given a response time requirement, the general trend is that the minimum total capacity initially decreases with more facilities. During this stage, variability in travel time has more impact on capacity than variability in demand arrivals. Thereafter, the total capacity remains stable and then gradually increases. When service level requirement is high, the dynamic dispatch based on first-come-first-serve rule requires smaller capacity than the one by nearest-neighbour rule.

  13. The correlation between osteopontin level and radiation response of malignant gliomas at Cipto Mangunkusumo Hospital

    Directory of Open Access Journals (Sweden)

    Isnaniah Hasan

    2016-12-01

    Full Text Available Osteopontin is an endogenous molecular marker for tumor hypoxia, and hypoxia is one of the factors that determine the aggressiveness of the disease. The purpose of this study is to determine the correlation between osteopontin levels and radiation response in malignant glioma. A retrospective cohort study was conducted on 15 malignant glioma patients who underwent radiation therapy from July 2004 to May 2015 at the RSUPN Dr. Cipto Mangunkusumo Hospital. Osteopontin levels were measured from paraffin-embedded tissue using a commercial ELISA kit. Tumor volume was calculated using computed tomography (CT scan and magnetic resonance imaging (MRI images, based on three-dimensional volume measurements. Tumor response was evaluated by comparing pre- and post-radiation tumor volumes using CT scan and MRI images. The mean osteopontin level was 0.49 ± 0.45 ng/mL and the mean percentage change in tumor volume was 8.59 ± 54.22%, with a 60% enlargement in tumor volume. A progressive disease was found in 26.7% of patients. There was a weak but insignificant negative correlation (r = -0.39, p = 0.146 between the level of osteopontin and radiation response. In contrast, there was a strong but insignificant positive correlation (r = +0.68, p = 0.219 between the level of osteopontin and radiation response in the patient group that used the chemosensitizer temozolamide.

  14. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  15. Effect of climate conditions on the uptake and translocation of trace elements in plants an behavior of ions at cell level

    International Nuclear Information System (INIS)

    Yamagami, Mutsumi; Yanai, Masumi; Hisamatsu, Shun'ichi; Inaba, Jiro

    2003-01-01

    The present investigation was performed in order to look at the effect of various climatic conditions on the uptake and translocation of radionuclides and trace elements in plants. So far we have investigated the following three items; the effect of climate conditions including Yamase (seasonal climatic condition of low temperature, low sunshine and high humidity.) on the elemental transfer factors in rice, the effect of light conditions on the metabolism of elements in plants, and the effect of environmental factors on elemental movement at a cell level, and searched for mutant plant strains to match the elemental requirement. Among these items this paper elaborates about the effect of light condition on the metabolism of elements in plants. Young radishes (Raphanus sativus L.) were grown under various light conditions; white, blue+red and red fluorescent light. Under red light a marked spindly growth of the stem and petiole was observed. Adding blue light to red light reduced the growth to the level under control white light. The concentrations of elements, such as Fe, Cu and Zn, in the plants were affected by the light conditions. The effect of light condition on the spindly growth of hypocotyls with the plant was also studied with Arabidopsis (Arabidopsis thaliana L.), and the results showed that supplementation of blue light approximately 15% red light could control the growth. For a further investigation of the mechanism of these phenomena, several ion channel blockers and metabolic inhibitors were examined in hydroponic plants or protoplasts. The results suggested that both anion and cation channels were related to the elongation. (author)

  16. Effect of backing material on the transmitting response level and bandwidth of a wideband underwater transmitting transducer using 1-3 piezocomposite

    CSIR Research Space (South Africa)

    Nicolaides, K

    2009-01-01

    Full Text Available : Transducer design The 1-3 piezocomposite (40% VF) active element was designed to resonate at around 300 kHz see figure 2. 1-3 piezocomposite material with 40% VF was selected due its excellent wide bandwidth and high transmitting response characteristics... is shown in figure 3(a). These results demonstrate the wide bandwidth characteristics for such a design. The transmitting response and acoustic characteristics (bandwidth and level) of this configuration will be used as our base line and all...

  17. 41 CFR 102-192.150 - What are your general responsibilities as a program level mail manager?

    Science.gov (United States)

    2010-07-01

    ... responsibilities as a program level mail manager? 102-192.150 Section 102-192.150 Public Contracts and Property... general responsibilities as a program level mail manager? Your responsibilities at the program level include— (a) Working closely with the agency mail manager and mail center managers who handle significant...

  18. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Directory of Open Access Journals (Sweden)

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  19. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Science.gov (United States)

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  20. Characterization and simulation of the response of Multi-Pixel Photon Counters to low light levels

    Energy Technology Data Exchange (ETDEWEB)

    Vacheret, A. [Department of Physics, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Barker, G.J. [Department of Physics, University of Warwick, Gibbet Hill Road, Coventry CV4 7AL (United Kingdom); Dziewiecki, M. [Institute of Radioelectronics, Warsaw University of Technology, 15/19 Nowowiejska St., 00-665 Warsaw (Poland); Guzowski, P. [Department of Physics, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Haigh, M.D. [Department of Physics, University of Warwick, Gibbet Hill Road, Coventry CV4 7AL (United Kingdom); Hartfiel, B. [Department of Physics and Astronomy, Louisiana State University, 202 Nicholson Hall, Tower Drive, Baton Rouge, LA 70803 (United States); Izmaylov, A. [Institute for Nuclear Research RAS, 60 October Revolution Pr. 7A, 117312 Moscow (Russian Federation); Johnston, W. [Department of Physics, Colorado State University, Fort Collins, CO 80523 (United States); Khabibullin, M.; Khotjantsev, A.; Kudenko, Yu. [Institute for Nuclear Research RAS, 60 October Revolution Pr. 7A, 117312 Moscow (Russian Federation); Kurjata, R. [Institute of Radioelectronics, Warsaw University of Technology, 15/19 Nowowiejska St., 00-665 Warsaw (Poland); Kutter, T. [Department of Physics and Astronomy, Louisiana State University, 202 Nicholson Hall, Tower Drive, Baton Rouge, LA 70803 (United States); Lindner, T. [Department of Physics and Astronomy, University of British Columbia, 6224 Agricultural Road, Vancouver, Canada, BC V6T 1Z1 (Canada); Masliah, P. [Department of Physics, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Marzec, J. [Institute of Radioelectronics, Warsaw University of Technology, 15/19 Nowowiejska St., 00-665 Warsaw (Poland); Mineev, O.; Musienko, Yu. [Institute for Nuclear Research RAS, 60 October Revolution Pr. 7A, 117312 Moscow (Russian Federation); and others

    2011-11-11

    The calorimeter, range detector and active target elements of the T2K near detectors rely on the Hamamatsu Photonics Multi-Pixel Photon Counters (MPPCs) to detect scintillation light produced by charged particles. Detailed measurements of the MPPC gain, afterpulsing, crosstalk, dark noise, and photon detection efficiency for low light levels are reported. In order to account for the impact of the MPPC behavior on T2K physics observables, a simulation program has been developed based on these measurements. The simulation is used to predict the energy resolution of the detector.

  1. Characterization and simulation of the response of Multi-Pixel Photon Counters to low light levels

    International Nuclear Information System (INIS)

    Vacheret, A.; Barker, G.J.; Dziewiecki, M.; Guzowski, P.; Haigh, M.D.; Hartfiel, B.; Izmaylov, A.; Johnston, W.; Khabibullin, M.; Khotjantsev, A.; Kudenko, Yu.; Kurjata, R.; Kutter, T.; Lindner, T.; Masliah, P.; Marzec, J.; Mineev, O.; Musienko, Yu.

    2011-01-01

    The calorimeter, range detector and active target elements of the T2K near detectors rely on the Hamamatsu Photonics Multi-Pixel Photon Counters (MPPCs) to detect scintillation light produced by charged particles. Detailed measurements of the MPPC gain, afterpulsing, crosstalk, dark noise, and photon detection efficiency for low light levels are reported. In order to account for the impact of the MPPC behavior on T2K physics observables, a simulation program has been developed based on these measurements. The simulation is used to predict the energy resolution of the detector.

  2. Association of basal serum androgen levels with ovarian response and ICSI cycle outcome.

    Science.gov (United States)

    Abide Yayla, C; Ozkaya, E; Kayatas Eser, S; Sanverdi, I; Devranoglu, B; Kutlu, T

    2018-05-01

    The purpose of this study was to assess the predictive value of basal serum testosterone (T) and dehydroepiandrosterone sulfate (DHEAS) levels during follicular phase for ovarian response and outcome in intracytoplasmic sperm injection (ICSI) cycles of women with diminished ovarian reserve. We prospectively gathered data of basal serum androgen levels and ICSI cycle characteristics of 120 women with diminished ovarian reserve. Association of basal serum T and DHEAS levels with ovarian response was analyzed. Basal T and DHEAS levels were similar between pregnant and non-pregnant cases (P > 0.05). There were significant differences between groups with and without successful embryo implantation in terms of serum follicle-stimulating hormone (FSH), anti-Müllerian hormone (AMH), gonadotropin starting and total dose, and peak estradiol level (P stimulation due to unresponsiveness (n = 26, 21.7%), no oocyte at oocyte pickup (n = 11, 9.2%), no mature oocyte (n = 6, 5%), and failure of fertilization or embryo development (n = 15, 12.5%). Basal androgen levels were not significant predictors for any of the cycle outcome. AMH level was a significant predictor for failure of fertilization or embryo development (AUC 0.722, P = 0.01) and cancelation of stimulation (AUC 0.801, P stimulation (AUC 0.774, P basal T and DHEAS levels have no value in predicting any of the cycle outcome parameters.

  3. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Science.gov (United States)

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  4. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Science.gov (United States)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astro