WorldWideScience

Sample records for response elements derived

  1. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  2. Finite element concept to derive isostatic residual maps ...

    A new space-domain operator based on the shape function concept of finite element analysis has been developed to derive the ... not require explicit assumptions on isostatic models. Besides .... This information is implicit in the Bouguer ...

  3. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  4. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  5. Finite element concept to derive isostatic residual maps

    A new space-domain operator based on the shape function concept of finite element analysis has been developed to derive the residual maps of the Gorda Plate of western United States. The technique does not require explicit assumptions on isostatic models. Besides delineating the Gorda Plate boundary, the residual ...

  6. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  7. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  8. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  9. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  10. EMPIRICALLY DERIVED INTEGRATED STELLAR YIELDS OF Fe-PEAK ELEMENTS

    Henry, R. B. C.; Cowan, John J.; Sobeck, Jennifer

    2010-01-01

    We present here the initial results of a new study of massive star yields of Fe-peak elements. We have compiled from the literature a database of carefully determined solar neighborhood stellar abundances of seven iron-peak elements, Ti, V, Cr, Mn, Fe, Co, and Ni, and then plotted [X/Fe] versus [Fe/H] to study the trends as functions of metallicity. Chemical evolution models were then employed to force a fit to the observed trends by adjusting the input massive star metallicity-sensitive yields of Kobayashi et al. Our results suggest that yields of Ti, V, and Co are generally larger as well as anticorrelated with metallicity, in contrast to the Kobayashi et al. predictions. We also find the yields of Cr and Mn to be generally smaller and directly correlated with metallicity compared to the theoretical results. Our results for Ni are consistent with theory, although our model suggests that all Ni yields should be scaled up slightly. The outcome of this exercise is the computation of a set of integrated yields, i.e., stellar yields weighted by a slightly flattened time-independent Salpeter initial mass function and integrated over stellar mass, for each of the above elements at several metallicity points spanned by the broad range of observations. These results are designed to be used as empirical constraints on future iron-peak yield predictions by stellar evolution modelers. Special attention is paid to the interesting behavior of [Cr/Co] with metallicity-these two elements have opposite slopes-as well as the indirect correlation of [Ti/Fe] with [Fe/H]. These particular trends, as well as those exhibited by the inferred integrated yields of all iron-peak elements with metallicity, are discussed in terms of both supernova nucleosynthesis and atomic physics.

  11. Incompressible spectral-element method: Derivation of equations

    Deanna, Russell G.

    1993-01-01

    A fractional-step splitting scheme breaks the full Navier-Stokes equations into explicit and implicit portions amenable to the calculus of variations. Beginning with the functional forms of the Poisson and Helmholtz equations, we substitute finite expansion series for the dependent variables and derive the matrix equations for the unknown expansion coefficients. This method employs a new splitting scheme which differs from conventional three-step (nonlinear, pressure, viscous) schemes. The nonlinear step appears in the conventional, explicit manner, the difference occurs in the pressure step. Instead of solving for the pressure gradient using the nonlinear velocity, we add the viscous portion of the Navier-Stokes equation from the previous time step to the velocity before solving for the pressure gradient. By combining this 'predicted' pressure gradient with the nonlinear velocity in an explicit term, and the Crank-Nicholson method for the viscous terms, we develop a Helmholtz equation for the final velocity.

  12. A Posteriori Finite Element Bounds for Sensitivity Derivatives of Partial-Differential-Equation Outputs. Revised

    Lewis, Robert Michael; Patera, Anthony T.; Peraire, Jaume

    1998-01-01

    We present a Neumann-subproblem a posteriori finite element procedure for the efficient and accurate calculation of rigorous, 'constant-free' upper and lower bounds for sensitivity derivatives of functionals of the solutions of partial differential equations. The design motivation for sensitivity derivative error control is discussed; the a posteriori finite element procedure is described; the asymptotic bounding properties and computational complexity of the method are summarized; and illustrative numerical results are presented.

  13. Cyclic AMP response element binding protein and brain-derived ...

    Madhu

    learning tasks and memory (Bramham and Messaoudi 2005). Thus, BDNF is involved in structural remodeling, neuronal .... in hippocampal-dependent learning and memory (Tyler et al 2002; Mizuno and Giese 2005) may play a ..... neurons in the olfactory bulb; J. Neurosci. 25 10105–10118. Gould E and Tanapat P 1999 ...

  14. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  15. Finite element analysis of an atomistically derived cohesive model for brittle fracture

    Lloyd, J T; McDowell, D L; Zimmerman, J A; Jones, R E; Zhou, X W

    2011-01-01

    In order to apply information from molecular dynamics (MD) simulations in problems governed by engineering length and time scales, a coarse graining methodology must be used. In previous work by Zhou et al (2009 Acta Mater. 57 4671–86), a traction-separation cohesive model was developed using results from MD simulations with atomistic-to-continuum measures of stress and displacement. Here, we implement this cohesive model within a combined finite element/cohesive surface element framework (referred to as a finite element approach or FEA), and examine the ability for the atomistically informed FEA to directly reproduce results from MD. We find that FEA shows close agreement of both stress and crack opening displacement profiles at the cohesive interface, although some differences do exist that can be attributed to the stochastic nature of finite temperature MD. The FEA methodology is then used to study slower loading rates that are computationally expensive for MD. We find that the crack growth process initially exhibits a rate-independent relationship between crack length and boundary displacement, followed by a rate-dependent regime where, at a given amount of boundary displacement, a lower applied strain rate produces a longer crack length. Our method is also extended to larger length scales by simulating a compact tension fracture-mechanics specimen with sub-micrometer dimensions. Such a simulation shows a computational speedup of approximately four orders of magnitude over conventional atomistic simulation, while exhibiting the expected fracture-mechanics response. Finally, differences between FEA and MD are explored with respect to ensemble and temperature effects in MD, and their impact on the cohesive model and crack growth behavior. These results enable us to make several recommendations to improve the methodology used to derive cohesive laws from MD simulations. In light of this work, which has critical implications for efforts to derive continuum laws

  16. A pedagogical derivation of the matrix element method in particle physics data analysis

    Sumowidagdo, Suharyo

    2018-03-01

    The matrix element method provides a direct connection between the underlying theory of particle physics processes and detector-level physical observables. I am presenting a pedagogically-oriented derivation of the matrix element method, drawing from elementary concepts in probability theory, statistics, and the process of experimental measurements. The level of treatment should be suitable for beginning research student in phenomenology and experimental high energy physics.

  17. Parvovirus-derived endogenous viral elements in two South American rodent genomes.

    Arriagada, Gloria; Gifford, Robert J

    2014-10-01

    We describe endogenous viral elements (EVEs) derived from parvoviruses (family Parvoviridae) in the genomes of the long-tailed chinchilla (Chinchilla lanigera) and the degu (Octodon degus). The novel EVEs include dependovirus-related elements and representatives of a clearly distinct parvovirus lineage that also has endogenous representatives in marsupial genomes. In the degu, one dependovirus-derived EVE was found to carry an intact reading frame and was differentially expressed in vivo, with increased expression in the liver. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  19. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  20. Computer finite element analysis of stress derived from particular units of torsionally flexible metal coupling

    Mariusz KUCZAJ

    2010-01-01

    Full Text Available In this article the results of Finite Element Analysis (FEA results of stresses derived from chosen units of torsionally flexible metal coupling are presented. As model and simulation tool for particular component loads is used the Autodesk Inventor Professional 2009 program.

  1. Bifurcation analysis of a noisy vibro-impact oscillator with two kinds of fractional derivative elements

    Yang, YongGe; Xu, Wei; Yang, Guidong

    2018-04-01

    To the best of authors' knowledge, little work was referred to the study of a noisy vibro-impact oscillator with a fractional derivative. Stochastic bifurcations of a vibro-impact oscillator with two kinds of fractional derivative elements driven by Gaussian white noise excitation are explored in this paper. We can obtain the analytical approximate solutions with the help of non-smooth transformation and stochastic averaging method. The numerical results from Monte Carlo simulation of the original system are regarded as the benchmark to verify the accuracy of the developed method. The results demonstrate that the proposed method has a satisfactory level of accuracy. We also discuss the stochastic bifurcation phenomena induced by the fractional coefficients and fractional derivative orders. The important and interesting result we can conclude in this paper is that the effect of the first fractional derivative order on the system is totally contrary to that of the second fractional derivative order.

  2. Derivation of finite element formulation for electrochemical governing equations of ionic polymer actuators

    Kang, Sung Soo

    2013-01-01

    Ionic polymer actuators have recently attracted a great deal of interest as electroactive materials with potentials as soft actuators, sensors, artificial muscles, robotics, and microelectromechanical systems because of their numerous advantages, including low voltage requirement, high compliance, lightness, and flexibility. The platinum-plated Nafion, a perfluorosulfonic acid membrane made by Dupont, is commonly used as a polyelectrolyte in actuator applications. The bending of the ionic polymer actuators in an electric field is dominated by the electro-osmosis of hydrated ions and slow diffusion of free water molecules. The changes in hydration cause a local volumetric strain resulting in bending deformation, such as expansion and contraction. In this study, a two-dimensional finite element (FE) formulation based on the Galerkin method is derived for the governing equations describing these electrochemical responses. In addition, a three-dimensional FE deformation analysis is conducted on the bending behaviors of the platinum-plated ionic polymer actuators. Several numerical studies for ionic polymer actuators, such as plates with various electrode arrangements and disk models in electric field, are performed to confirm the validity of the proposed formulation.

  3. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  4. A SINE-derived element constitutes a unique modular enhancer for mammalian diencephalic Fgf8.

    Akiko Nakanishi

    Full Text Available Transposable elements, including short interspersed repetitive elements (SINEs, comprise nearly half the mammalian genome. Moreover, they are a major source of conserved non-coding elements (CNEs, which play important functional roles in regulating development-related genes, such as enhancing and silencing, serving for the diversification of morphological and physiological features among species. We previously reported a novel SINE family, AmnSINE1, as part of mammalian-specific CNEs. One AmnSINE1 locus, named AS071, showed an enhancer property in the developing mouse diencephalon. Indeed, AS071 appears to recapitulate the expression of diencephalic fibroblast growth factor 8 (Fgf8. Here we established three independent lines of AS071-transgenic mice and performed detailed expression profiling of AS071-enhanced lacZ in comparison with that of Fgf8 across embryonic stages. We demonstrate that AS071 is a distal enhancer that directs Fgf8 expression in the developing diencephalon. Furthermore, enhancer assays with constructs encoding partially deleted AS071 sequence revealed a unique modular organization in which AS071 contains at least three functionally distinct sub-elements that cooperatively direct the enhancer activity in three diencephalic domains, namely the dorsal midline and the lateral wall of the diencephalon, and the ventral midline of the hypothalamus. Interestingly, the AmnSINE1-derived sub-element was found to specify the enhancer activity to the ventral midline of the hypothalamus. To our knowledge, this is the first discovery of an enhancer element that could be separated into respective sub-elements that determine regional specificity and/or the core enhancing activity. These results potentiate our understanding of the evolution of retroposon-derived cis-regulatory elements as well as the basis for future studies of the molecular mechanism underlying the determination of domain-specificity of an enhancer.

  5. Comparison between phase shift derived and exactly calculated nucleon--nucleon interaction matrix elements

    Gregersen, A.W.

    1977-01-01

    A comparison is made between matrix elements calculated using the uncoupled channel Sussex approach to second order in DWBA and matrix elements calculated using a square well potential. The square well potential illustrated the problem of the determining parameter independence balanced with the concept of phase shift difference. The super-soft core potential was used to discuss the systematics of the Sussex approach as a function of angular momentum as well as the relation between Sussex generated and effective interaction matrix elements. In the uncoupled channels the original Sussex method of extracting effective interaction matrix elements was found to be satisfactory. In the coupled channels emphasis was placed upon the 3 S 1 -- 3 D 1 coupled channel matrix elements. Comparison is made between exactly calculated matrix elements, and matrix elements derived using an extended formulation of the coupled channel Sussex method. For simplicity the potential used is a nonseparable cut-off oscillator. The eigenphases of this potential can be made to approximate the realistic nucleon--nucleon phase shifts at low energies. By using the cut-off oscillator test potential, the original coupled channel Sussex method of determining parameter independence was shown to be incapable of accurately reproducing the exact cut-off oscillator matrix elements. The extended Sussex method was found to be accurate to within 10 percent. The extended method is based upon more general coupled channel DWBA and a noninfinite oscillator wave function solution to the cut-off oscillator auxiliary potential. A comparison is made in the coupled channels between matrix elements generated using the original Sussex method and the extended method. Tables of matrix elements generated using the original uncoupled channel Sussex method and the extended coupled channel Sussex method are presented for all necessary angular momentum channels

  6. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  7. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  8. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  9. Agrobacterium tumefaciens responses to plant-derived signaling molecules

    Subramoni, Sujatha; Nathoo, Naeem; Klimov, Eugene; Yuan, Ze-Chun

    2014-01-01

    As a special phytopathogen, Agrobacterium tumefaciens infects a wide range of plant hosts and causes plant tumors also known as crown galls. The complexity of Agrobacterium–plant interaction has been studied for several decades. Agrobacterium pathogenicity is largely attributed to its evolved capabilities of precise recognition and response to plant-derived chemical signals. Agrobacterium perceives plant-derived signals to activate its virulence genes, which are responsible for transferring and integrating its Transferred DNA (T-DNA) from its Tumor-inducing (Ti) plasmid into the plant nucleus. The expression of T-DNA in plant hosts leads to the production of a large amount of indole-3-acetic acid (IAA), cytokinin (CK), and opines. IAA and CK stimulate plant growth, resulting in tumor formation. Agrobacterium utilizes opines as nutrient sources as well as signals in order to activate its quorum sensing (QS) to further promote virulence and opine metabolism. Intriguingly, Agrobacterium also recognizes plant-derived signals including γ-amino butyric acid and salicylic acid (SA) to activate quorum quenching that reduces the level of QS signals, thereby avoiding the elicitation of plant defense and preserving energy. In addition, Agrobacterium hijacks plant-derived signals including SA, IAA, and ethylene to down-regulate its virulence genes located on the Ti plasmid. Moreover, certain metabolites from corn (Zea mays) also inhibit the expression of Agrobacterium virulence genes. Here we outline the responses of Agrobacterium to major plant-derived signals that impact Agrobacterium–plant interactions. PMID:25071805

  10. Agrobacterium tumefaciens responses to plant-derived signaling molecules

    Sujatha eSubramoni

    2014-07-01

    Full Text Available As a special phytopathogen, Agrobacterium tumefaciens infects a wide range of plant hosts and causes plant tumors also known as crown galls. The complexity of Agrobacterium-plant interaction has been studied for several decades. Agrobacterium pathogenicity is largely attributed to its evolved capabilities of precise recognition and response to plant-derived chemical signals. Agrobacterium perceives plant-derived signals to activate its virulence genes, which are responsible for transferring and integrating its T-DNA (Transferred DNA from its Tumour-inducing (Ti plasmid into the plant nucleus. The expression of T-DNA in plant hosts leads to the production of a large amount of indole-3-acetic acid (IAA, cytokinin (CK and opines. IAA and CK stimulate plant growth, resulting in tumor formation. Agrobacterium utilizes opines as nutrient sources as well as signals in order to activate its quorum sensing (QS to further promote virulence and opine metabolism. Intriguingly, Agrobacterium also recognizes plant-derived signals including -amino butyric acid (GABA and salicylic acid (SA to activate quorum quenching that reduces the level of QS signals, thereby avoiding the elicitation of plant defense and preserving energy. In addition, Agrobacterium hijacks plant-derived signals including SA, IAA, and ethylene (ET to down-regulate its virulence genes located on the Ti plasmid. Moreover, certain metabolites from corn (Zea mays also inhibit the expression of Agrobacterium virulence genes. Here we outline the responses of Agrobacterium to major plant-derived signals that impact Agrobacterium-plant interactions.

  11. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  12. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  13. Finite element formulation of viscoelastic sandwich beams using fractional derivative operators

    Galucio, A. C.; Deü, J.-F.; Ohayon, R.

    This paper presents a finite element formulation for transient dynamic analysis of sandwich beams with embedded viscoelastic material using fractional derivative constitutive equations. The sandwich configuration is composed of a viscoelastic core (based on Timoshenko theory) sandwiched between elastic faces (based on Euler-Bernoulli assumptions). The viscoelastic model used to describe the behavior of the core is a four-parameter fractional derivative model. Concerning the parameter identification, a strategy to estimate the fractional order of the time derivative and the relaxation time is outlined. Curve-fitting aspects are focused, showing a good agreement with experimental data. In order to implement the viscoelastic model into the finite element formulation, the Grünwald definition of the fractional operator is employed. To solve the equation of motion, a direct time integration method based on the implicit Newmark scheme is used. One of the particularities of the proposed algorithm lies in the storage of displacement history only, reducing considerably the numerical efforts related to the non-locality of fractional operators. After validations, numerical applications are presented in order to analyze truncation effects (fading memory phenomena) and solution convergence aspects.

  14. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  16. Single-Phase Phase-Locked Loop Based on Derivative Elements

    Guan, Qingxin; Zhang, Yu; Kang, Yong

    2017-01-01

    High-performance phase-locked loops (PLLs) are critical for power control in grid-connected systems. This paper presents a new method of designing a PLL for single-phase systems based on derivative elements (DEs). The quadrature signal generator (QSG) is constructed by two DEs with the same...... PLL to achieve high performance when the grid frequency changes rapidly. This paper presents the model of the PLL and a theoretical performance analysis with respect to both the frequency-domain and time-domain behavior. The error arising from the discretization process is also compensated, ensuring...

  17. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  18. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    Jin, Bangti; Lazarov, Raytcho; Lu, Xiliang; Zhou, Zhi

    2016-01-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  19. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    Jin, Bangti

    2016-02-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  20. Systematic identification and characterization of regulatory elements derived from human endogenous retroviruses.

    Jumpei Ito

    2017-07-01

    Full Text Available Human endogenous retroviruses (HERVs and other long terminal repeat (LTR-type retrotransposons (HERV/LTRs have regulatory elements that possibly influence the transcription of host genes. We systematically identified and characterized these regulatory elements based on publicly available datasets of ChIP-Seq of 97 transcription factors (TFs provided by ENCODE and Roadmap Epigenomics projects. We determined transcription factor-binding sites (TFBSs using the ChIP-Seq datasets and identified TFBSs observed on HERV/LTR sequences (HERV-TFBSs. Overall, 794,972 HERV-TFBSs were identified. Subsequently, we identified "HERV/LTR-shared regulatory element (HSRE," defined as a TF-binding motif in HERV-TFBSs, shared within a substantial fraction of a HERV/LTR type. HSREs could be an indication that the regulatory elements of HERV/LTRs are present before their insertions. We identified 2,201 HSREs, comprising specific associations of 354 HERV/LTRs and 84 TFs. Clustering analysis showed that HERV/LTRs can be grouped according to the TF binding patterns; HERV/LTR groups bounded to pluripotent TFs (e.g., SOX2, POU5F1, and NANOG, embryonic endoderm/mesendoderm TFs (e.g., GATA4/6, SOX17, and FOXA1/2, hematopoietic TFs (e.g., SPI1 (PU1, GATA1/2, and TAL1, and CTCF were identified. Regulatory elements of HERV/LTRs tended to locate nearby and/or interact three-dimensionally with the genes involved in immune responses, indicating that the regulatory elements play an important role in controlling the immune regulatory network. Further, we demonstrated subgroup-specific TF binding within LTR7, LTR5B, and LTR5_Hs, indicating that gains or losses of the regulatory elements occurred during genomic invasions of the HERV/LTRs. Finally, we constructed dbHERV-REs, an interactive database of HERV/LTR regulatory elements (http://herv-tfbs.com/. This study provides fundamental information in understanding the impact of HERV/LTRs on host transcription, and offers insights into

  1. Mantle-derived trace element variability in olivines and their melt inclusions

    Neave, David A.; Shorttle, Oliver; Oeser, Martin; Weyer, Stefan; Kobayashi, Katsura

    2018-02-01

    inclusion suites, and confirm that the Stapafell eruption was fed by lower degree melts from greater depths within the melting region than the Háleyjabunga eruption. Although olivine macrocrysts from Stapafell are slightly richer in Ni than those from Háleyjabunga, their overall CTE systematics (e.g., Ni/(Mg/Fe), Fe/Mn and Zn/Fe) are inconsistent with being derived from olivine-free pyroxenites. However, the major element systematics of Icelandic basalts require lithological heterogeneity in their mantle source in the form of Fe-rich and hence fusible domains. We thus conclude that enriched heterogeneities in the Icelandic mantle are composed of modally enriched, yet nonetheless olivine-bearing, lithologies and that olivine CTE contents provide an incomplete record of lithological heterogeneity in the mantle. Modally enriched peridotites may therefore play a more important role in oceanic magma genesis than previously inferred.

  2. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  3. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  4. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  5. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  6. Biomonitoring of genotoxic effects and elemental accumulation derived from air pollution in community urban gardens.

    Amato-Lourenco, Luís Fernando; Lobo, Debora Jã A; Guimarães, Eliane T; Moreira, Tiana Carla Lopes; Carvalho-Oliveira, Regiani; Saiki, Mitiko; Saldiva, Paulo Hilário Nascimento; Mauad, Thais

    2017-01-01

    Urban gardening is a growing global phenomenon with a positive impact on society. Despite several associated benefits, growing vegetables in urban gardens that are localized in highly polluted areas poses questions about the safety of the produced food. Therefore, the identification of risk factors that result in possible deleterious effects to human health is important for realizing all of the benefits to society. We evaluated the use of two biomonitoring methods in ten urban gardens of Sao Paulo city and one control site: the micronuclei frequencies for early tetrads of Tradescantia pallida (Rose) Hunt. cv. "Purpurea" Boom (hereafter, Trad-MCN) as a short-term indicator of genotoxic response and tree barks to quantify the accumulation of traffic-related chemical elements as a long-term biomarker of air pollution in urban gardens. Mature plants of Tradescantia pallida were exposed in each garden, and their inflorescences were sampled over three months. A random set of 300 early tetrads in 13 to 21 slides per garden were evaluated for micronuclei frequencies. Elemental concentrations in 428 tree barks samples from 107 different trees in the areas surrounding urban gardens were quantified using an energy dispersive X-ray fluorescence spectrometer. The frequency of Trad-MCN has a significant correlation with traffic variables and chemical elements related to road dust and tailpipe emissions deposited in tree barks. Negative associations between Trad-MCN and both the distance through traffic and the presence of vertical obstacles were observed in the community gardens. The Mn/Zn concentrations in tree barks were associated with increased Trad-MCN. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. SP_Ace: a new code to derive stellar parameters and elemental abundances

    Boeche, C.; Grebel, E. K.

    2016-03-01

    Context. Ongoing and future massive spectroscopic surveys will collect large numbers (106-107) of stellar spectra that need to be analyzed. Highly automated software is needed to derive stellar parameters and chemical abundances from these spectra. Aims: We developed a new method of estimating the stellar parameters Teff, log g, [M/H], and elemental abundances. This method was implemented in a new code, SP_Ace (Stellar Parameters And Chemical abundances Estimator). This is a highly automated code suitable for analyzing the spectra of large spectroscopic surveys with low or medium spectral resolution (R = 2000-20 000). Methods: After the astrophysical calibration of the oscillator strengths of 4643 absorption lines covering the wavelength ranges 5212-6860 Å and 8400-8924 Å, we constructed a library that contains the equivalent widths (EW) of these lines for a grid of stellar parameters. The EWs of each line are fit by a polynomial function that describes the EW of the line as a function of the stellar parameters. The coefficients of these polynomial functions are stored in a library called the "GCOG library". SP_Ace, a code written in FORTRAN95, uses the GCOG library to compute the EWs of the lines, constructs models of spectra as a function of the stellar parameters and abundances, and searches for the model that minimizes the χ2 deviation when compared to the observed spectrum. The code has been tested on synthetic and real spectra for a wide range of signal-to-noise and spectral resolutions. Results: SP_Ace derives stellar parameters such as Teff, log g, [M/H], and chemical abundances of up to ten elements for low to medium resolution spectra of FGK-type stars with precision comparable to the one usually obtained with spectra of higher resolution. Systematic errors in stellar parameters and chemical abundances are presented and identified with tests on synthetic and real spectra. Stochastic errors are automatically estimated by the code for all the parameters

  8. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  9. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  10. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  11. Estimating Derived Response Levels at the Savannah River Site for Use with Emergency Response Models

    Simpkins, A.A.

    2002-01-01

    Emergency response computer models at the Savannah River Site (SRS) are coupled with real-time meteorological data to estimate dose to individuals downwind of accidental radioactive releases. Currently, these models estimate doses for inhalation and shine pathways, but do not consider dose due to ingestion of contaminated food products. The Food and Drug Administration (FDA) has developed derived intervention levels (DIL) which refer to the radionuclide-specific concentration in food present throughout the relevant period of time, with no intervention, that could lead to an individual receiving a radiation dose equal to the protective action guide. In the event of an emergency, concentrations in various food types are compared with these levels to make interdictions decisions. Prior to monitoring results being available, concentrations in the environmental media (i.e. soil), called derived response levels (DRLs), can be estimated from the DILs and directly compared with computer output to provide preliminary guidance as to whether intervention is necessary. Site-specific derived response levels (DRLs) are developed for ingestion pathways pertinent to SRS: milk, meat, fish, grain, produce, and beverage. This provides decision-makers with an additional tool for use immediately following an accident prior to the acquisition of food monitoring data

  12. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  13. Astronaut Bone Medical Standards Derived from Finite Element (FE) Models of QCT Scans from Population Studies

    Sibonga, J. D.; Feiveson, A. H.

    2014-01-01

    This work was accomplished in support of the Finite Element [FE] Strength Task Group, NASA Johnson Space Center [JSC], Houston, TX. This group was charged with the task of developing rules for using finite-element [FE] bone-strength measures to construct operating bands for bone health that are relevant to astronauts following exposure to spaceflight. FE modeling is a computational tool used by engineers to estimate the failure loads of complex structures. Recently, some engineers have used this tool to characterize the failure loads of the hip in population studies that also monitored fracture outcomes. A Directed Research Task was authorized in July, 2012 to investigate FE data from these population studies to derive these proposed standards of bone health as a function of age and gender. The proposed standards make use of an FE-based index that integrates multiple contributors to bone strength, an expanded evaluation that is critical after an astronaut is exposed to spaceflight. The current index of bone health used by NASA is the measurement of areal BMD. There was a concern voiced by a research and clinical advisory panel that the sole use of areal BMD would be insufficient to fully evaluate the effects of spaceflight on the hip. Hence, NASA may not have a full understanding of fracture risk, both during and after a mission, and may be poorly estimating in-flight countermeasure efficacy. The FE Strength Task Group - composed of principal investigators of the aforementioned population studies and of FE modelers -donated some of its population QCT data to estimate of hip bone strength by FE modeling for this specific purpose. Consequently, Human Health Countermeasures [HHC] has compiled a dataset of FE hip strengths, generated by a single FE modeling approach, from human subjects (approx.1060) with ages covering the age range of the astronauts. The dataset has been analyzed to generate a set of FE strength cutoffs for the following scenarios: a) Qualify an

  14. Coordination behaviour of some f-block elements with o-vanillin and its derivatives (Paper No. AL-09)

    Agarwala, B.V.; Shukla, M.K.; Hingorani, S.

    1990-02-01

    Five new complexes of La(III), Ce(III) and UO 2 have been prepared with o-vanillin and its derivatives. Their coordination behaviour and structural elucidation have been described by elemental, magnetic moments, IR, electronic spectral and thermal studies. (author). 1 tab

  15. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  16. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  17. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  18. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  19. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  20. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  1. Ion associates of rare earth elements with salicylic acid derivatives and rhodamine B and their analytical application

    Tselik, E I; Poluehktov, N S; Mishchenko, V T [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.

    1979-10-01

    The determination of rare earth elements by extraction photometry (fluorimetric) technique with the use of salicylic acid derivatives and Rhodamine B is reported. The best results in the determination of REE in the form of ionic associates between their acidocomplexes and Rhodamine B are obtained with the use of 3,5-diiodinesalicylic acid. The ratio between components in the compounds formed and the conditions of extraction are determined.

  2. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  4. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  5. Estimation of element deposition derived from road traffic sources by using mosses

    Zechmeister, H.G.; Hohenwallner, D.; Riss, A.; Hanus-Illnar, A.

    2005-01-01

    Sixty moss samples were taken along transects of nine roads in Austria. The concentrations of 17 elements in four moss species were determined. There was a high correlation between several elements like Cu/Sb (0.906), Ni/Co (0.897) or Cr/V (0.898), indicating a common traffic-related source. Enrichment factors were calculated, showing highest enrichment levels for: Cr, Mo, Sb, Zn, As, Fe, V, Cu, Ni, and Co. For these elements, road traffic has to be assumed as a source, which is confirmed by a significant negative correlation of the concentrations in mosses to the distance from the road for most of these metals. The rate of decrease followed a log-shaped curve at most of the investigated transects, although the decline cannot be explained by a single model. Multiple regression analysis highlighted traffic density, distance from and elevation of the road as the most influencing factors for the deposition of the investigated elements. Heavy duty vehicles (HDVs) and light duty vehicles (LDVs) showed different patterns. A comparison of sites likely to be influenced by traffic emissions with average values for the respective regions showed no significant differences for road distances of more than 250 m. Nevertheless, at heavily frequented roads, raised deposition of some elements was found even at a distance of 1000 m. - Cr, Mo, Sb, Zn, As, Fe, V, Cu, Ni, and Co were identified as road traffic emissions and were mainly deposited within a distance of 250 m from major roads

  6. Efficient improvement of virtual crack extension method by a derivative of the finite element stiffness matrix

    Ishikawa, H.; Nakano, S.; Yuuki, R.; Chung, N.Y.

    1991-01-01

    In the virtual crack extension method, the stress intensity factor, K, is obtained from the converged value of the energy release rate by the difference of the finite element stiffness matrix when some crack extension are taken. Instead of the numerical difference of the finite element stiffness, a new method to use a direct dirivative of the finite element stiffness matrix with respect to crack length is proposed. By the present method, the results of some example problems, such as uniform tension problems of a square plate with a center crack and a rectangular plate with an internal slant crack, are obtained with high accuracy and good efficiency. Comparing with analytical results, the present values of the stress intensity factors of the problems are obtained with the error that is less than 0.6%. This shows the numerical assurance of the usefulness of the present method. A personal computer program for the analysis is developed

  7. Variability of total and mobile element contents in ash derived from biomass combustion

    Száková, J.; Ochecová, P.; Hanzlíček, Tomáš; Perná, Ivana; Tlustoš, P.

    2013-01-01

    Roč. 67, č. 11 (2013), s. 1376-1385 ISSN 0366-6352 R&D Projects: GA MZe QI102A207 Institutional support: RVO:67985891 Keywords : biomass combustion * fly ash * bottom ash * element contents Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.193, year: 2013

  8. Quantifying the Fluxes of Atmospherically Derived Trace Elements in the Arctic Ocean/Ice System using 7Be

    Landing, W. M.; Kadko, D. C.; Shelley, R.; Galfond, B.

    2016-02-01

    Aerosol deposition is an important pathway for delivering biologically-essential and anthropogenically-derived trace elements to the Arctic Ocean. Limited field study in the harsh Arctic environment has forced a reliance on poorly constrained models for the atmospheric deposition of trace elements. Here we use the cosmic ray produced radioisotope 7Be to link aerosol concentrations to flux to the Arctic water/ice system. Seawater, ice, snow, melt pond, and aerosol samples were collected during late summer 2011 as part of the RV Polarstern ARK-XXVI/3 campaign. The average 7Be aerosol loading was 0.018 dpm m-3 and we determined an average 7Be flux of 125 dpm m-2 d-1, consistent with results from previous studies in the region. None of the lithogenic aerosol elements showed any significant enrichment above crustal composition, while the pollution-type elements showed varying degrees of enrichment relative to crustal values. In addition to our own measurements, we use two years of continuous aerosol 7Be and trace element data from the Alert (Canada) monitoring site to generate seasonal and annual estimates for the fluxes of 7Be and trace elements to the Arctic water/ice system. Fluxes of 7Be are 30% higher in Winter (Nov-May) than in Summer (Jun-Oct) due to the strong seasonality in aerosol 7Be concentrations. Fluxes of lithogenic elements (Al, Mn, Fe) are 2-3 times higher in Summer, possibly due to local dust sources on Ellesmere Island. Fluxes of V and Pb are strongly correlated and are 2-3 times higher in Winter, while fluxes of Ni, Cu, and Zn are relatively uniform for both seasons.

  9. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  10. A Photonic Basis for Deriving Nonlinear Optical Response

    Andrews, David L.; Bradshaw, David S.

    2009-01-01

    Nonlinear optics is generally first presented as an extension of conventional optics. Typically the subject is introduced with reference to a classical oscillatory electric polarization, accommodating correction terms that become significant at high intensities. The material parameters that quantify the extent of the nonlinear response are cast as…

  11. A Detailed Derivation of Gaussian Orbital-Based Matrix Elements in Electron Structure Calculations

    Petersson, T.; Hellsing, B.

    2010-01-01

    A detailed derivation of analytic solutions is presented for overlap, kinetic, nuclear attraction and electron repulsion integrals involving Cartesian Gaussian-type orbitals. It is demonstrated how s-type orbitals can be used to evaluate integrals with higher angular momentum via the properties of Hermite polynomials and differentiation with…

  12. Supply, storage and handling of elemental sulfur derived from sour gas

    Clark, P.D.; Davis, P.M.; Dowling, N.I.; Calgary Univ., AB

    2003-01-01

    This presentation reviews the supply picture for solid elemental sulfur. It also assesses methods for its storage as well as the disposal of the precursor hydrogen sulfide (H 2 S) by acid gas injection. Both above and below ground block storage is considered environmentally acceptable for sulfur storage as long as measures are taken to minimize the physical and biological breakdown of the sulfur. The preferred option is to store solid elemental sulfur underground, particularly if it is to remain in storage for a prolonged period. Future changes in supply of sulfur will likely be controlled by incremental production of sour gas and utilization of oil sands bitumen. It is expected that future sulfur production from conventional crude oil will remain static or will slowly decrease. The degree to which acid gas injection is applied to large sour gas developments in the Middle East and the Caspian regions will have a significant impact on world sulfur supply. 9 refs., 1 tab., 5 figs

  13. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  14. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  15. Pharmacological response of systemically derived focal epileptic lesions

    Remler, M.P.; Sigvardt, K.; Marcussen, W.H.

    1986-11-01

    Focal epileptic lesions were made in rats by systemic focal epileptogenesis. In this method, a focal lesion of the blood-brain barrier (BBB) is produced by focal alpha irradiation followed by repeated systemic injection of a convulsant drug that cannot cross the normal BBB, resulting in a chronic epileptic focus. Changes in the spike frequency of these foci in response to various drugs was recorded. The controls, saline and chlorpromazine, produced no change. Phenytoin, phenobarbital, chlordiazepoxide, and valproic acid produced the expected decrease in spike frequency. Pentobarbital and diazepam produced a paradoxical increase in spike frequency.

  16. Computer programme for the derivation of transfer functions for multivariable systems (solutions of determinants with polynomial elements)

    Guppy, C.B.

    1962-03-01

    In the methods adopted in this report transfer functions in the form of the ratio of two polynomials of the complex variable s are derived from sets of laplace transformed simultaneous differential equations. The set of algebraic simultaneous equations are solved using Cramer's Rule and this gives rise to determinants having polynomial elements. It is shown how the determinants are formed when transfer functions are specified. The procedure for finding the polynomial coefficients from a given determinant is fully described. The first method adopted is a direct one and reduces a determinant with first degree polynomial elements to secular form and follows this by an application of the similarity transformation to reduce the determinant to a form from which the polynomial coefficients can be read out directly. The programme is able to solve a single determinant with polynomial elements and this can be used to reduce an eigenvalue problem in the form of a secular determinant to polynomial form if the need arises. A description is given of the way in which the data is to be set out for solution by the programme. A description is also given of a method used in an earlier programme for solving polynomial determinants by curve fitting techniques using Chebyshev Polynomials. In this method determinants with polynomial elements of any degree can be solved. (author)

  17. The identification of metallic elements in airborne particulate matter derived from fossil fuels at Puertollano, Spain

    Moreno, Teresa; Alastuey, Andres; Querol, Xavier; Font, Oriol [Institute of Earth Sciences ' ' Jaume Almera' ' , CSIC, C/Lluis Sole i Sabaris s/n, Barcelona 08028 (Spain); Gibbons, Wes [AP 23075, Barcelona 08080 (Spain)

    2007-07-02

    Puertollano is the largest industrial centre in central Spain, and includes fossil fuel burning power plants as well as petrochemical and fertilizer complexes. The coal-fired power plants use locally mined coal from extensive coal deposits which continue to be exploited and used locally. The coal deposits have a distinctive geochemistry, being particularly enriched in Sb and Pb, as well as several other metals/metalloids that include Zn and As. ICP-AES and ICP-MS chemical analysis of particulate matter samples (both PM{sub 10} and PM{sub 2.5}) collected at Puertollano over a 57-week period in 2004-2005 reveals enhanced levels of several metallic trace elements, especially in the finer (PM{sub 2.5}) aerosol fraction. Factor analysis applied to the data indicates that at least some of these metallic elements are likely to originate from hydrocarbon combustion: Sb and Pb are markers linked to the local coals, whereas V and Ni are, at least in the finer (PM{sub 2.5}) fraction, likely associated with other anthropogenic sources. Other factors measured are related to natural sources such as crustal/mineral and sea spray particles. Our study provides an example of how chemical analysis of large numbers of ambient PM samples, combined with statistical factor analysis and coal geochemistry, can reveal airborne emissions from the combustion of specifically identifiable fuels. (author)

  18. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  19. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  20. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  1. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  2. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  3. UiO-66 and its Br-modified derivates for elemental mercury removal.

    Zhang, Xiao; Shen, Boxiong; Zhu, Sheaowen; Xu, Huan; Tian, Linghui

    2016-12-15

    Phenyl bromine-appended metal-organic frameworks (Br-MOFs) were synthesized and applied in elemental mercury (Hg 0 ) removal from simulated flue gas, considering the stability of bromine on the materials at the same time. The techniques of PXRD, nitrogen adsorption, TGA and XPS were used to characterize the materials. Phenyl bromide on the MOFs was the main active site for Hg 0 capture. The optimal Br-MOF showed high Hg 0 removal efficiency of more than 99% for 48h at 200°C, whereas the efficiency of un-functionalized MOF and conventional bromine impregnated active carbon dropped to 59.8% and 91.2% within 5h, respectively. The crystalline integrity of the Br-MOF was maintained after Hg 0 adsorption. Br-MOF exhibited enhanced Hg 0 removal efficiency when SO 2 was introduced to the flue gas. However, exposure Br-MOF to flue gas with steam resulted in low Hg 0 removal efficiency. Bromine leaching experiments proved that Br-MOFs have high bromine stability over the Hg 0 adsorption process, avoiding the possible bromine pollution caused by the conventional bromine impregnated adsorbents. All of these results demonstrated the phenyl bromine-appended MOFs to be potential Hg 0 adsorbent regarding its high Hg 0 capture efficiency and low environmental risk. Copyright © 2016. Published by Elsevier B.V.

  4. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  5. A Hamiltonian-based derivation of Scaled Boundary Finite Element Method for elasticity problems

    Hu Zhiqiang; Lin Gao; Wang Yi; Liu Jun

    2010-01-01

    The Scaled Boundary Finite Method (SBFEM) is a semi-analytical solution approach for solving partial differential equation. For problem in elasticity, the governing equations can be obtained by mechanically based formulation, Scaled-boundary-transformation-based formulation and principle of virtual work. The governing equations are described in the frame of Lagrange system and the unknowns are displacements. But in the solution procedure, the auxiliary variables are introduced and the equations are solved in the state space. Based on the observation that the duality system to solve elastic problem proposed by W.X. Zhong is similar to the above solution approach, the discretization of the SBFEM and the duality system are combined to derive the governing equations in the Hamilton system by introducing the dual variables in this paper. The Precise Integration Method (PIM) used in Duality system is also an efficient method for the solution of the governing equations of SBFEM in displacement and boundary stiffness matrix especially for the case which results some numerical difficulties in the usually uses the eigenvalue method. Numerical examples are used to demonstrate the validity and effectiveness of the PIM for solution of boundary static stiffness.

  6. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  8. Elemental composition of current automotive braking materials and derived air emission factors

    Hulskotte, J. H. J.; Roskam, G. D.; Denier van der Gon, H. A. C.

    2014-12-01

    Wear-related PM emissions are an important constituent of total PM emissions from road transport. Due to ongoing (further) exhaust emission reduction wear emissions may become the dominant PM source from road transport in the near future. The chemical composition of the wear emissions is crucial information to assess the potential health relevance of these PM emissions. Here we provide an elemental composition profile of brake wear emissions as used in the Netherlands in 2012. In total, 65 spent brake pads and 15 brake discs were collected in car maintenance shops from in-use personal cars vehicles and analyzed with XRF for their metal composition (Fe, Cu, Zn, Sn, Al, Si, Zr, Ti, Sb, Cr, Mo, Mn, V, Ni, Bi, W, P, Pb and Co). Since car, engine and safety regulations are not nationally determined but controlled by European legislation the resulting profiles will be representative for the European personal car fleet. The brake pads contained Fe and Cu as the dominant metals but their ratio varied considerably, other relatively important metals were Sn, Zn and Sb. Overall a rather robust picture emerged with Fe, Cu, Zn and Sn together making up about 80-90% of the metals present in brake pads. Because the XRF did not give information on the contents of other material such as carbon, oxygen and sulphur, a representative selection of 9 brake pads was further analyzed by ICP-MS and a carbon and sulphur analyzer. The brake pads contained about 50% of non-metal material (26% C, 3% S and the remainder mostly oxygen and some magnesium). Based on our measurements, the average brake pad profile contained 20% Fe, 10% Cu, 4% Zn and 3% Sn as the dominant metals. The brake discs consisted almost entirely of metal with iron being the dominant metal (>95%) and only traces of other metals (<1% for individual metals). Non-metal components in the discs were 2-3% Silicon and, according to literature, ∼3% carbon. The robust ratio between Fe and Cu as found on kerbsides has been used to

  9. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  10. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  11. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  12. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  13. Induced pluripotent stem cells-derived myeloid-derived suppressor cells regulate the CD8+ T cell response

    Daniel Joyce

    2018-05-01

    Full Text Available Myeloid-derived suppressor cells (MDSCs are markedly increased in cancer patients and tumor-bearing mice and promote tumor growth and survival by inhibiting host innate and adaptive immunity. In this study, we generated and characterized MDSCs from murine-induced pluripotent stem cells (iPSCs. The iPSCs were co-cultured with OP9 cells, stimulated with GM-CSF, and became morphologically heterologous under co-culturing with hepatic stellate cells. Allogeneic and OVA-specific antigen stimulation demonstrated that iPS-MDSCs have a T-cell regulatory function. Furthermore, a popliteal lymph node assay and autoimmune hepatitis model showed that iPS-MDSCs also regulate immune responsiveness in vivo and have a therapeutic effect against hepatitis. Taken together, our results demonstrated a method of generating functional MDSCs from iPSCs and highlighted the potential of iPS-MDSCs as a key cell therapy resource for transplantation and autoimmune diseases. Keywords: Myeloid-derived suppressor cells, Induced pluripotent stem cells, T cell response

  14. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  15. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  16. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  17. T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.

    Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua

    2018-05-09

    B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.

  18. Portland clinker production with carbonatite waste and tire-derived fuel: crystallochemistry of minor and trace elements

    F. R. D. Andrade

    2014-12-01

    Full Text Available This paper presents results on the composition of Portland clinkers produced with non-conventional raw-materials and fuels, focusing on the distribution of selected trace elements. Clinkers produced with three different fuel compositions were sampled in an industrial plant, where all other parameters were kept unchanged. The fuels have chemical fingerprints, which are sulfur for petroleum coke and zinc for TDF (tire-derived fuel. Presence of carbonatite in the raw materials is indicated by high amounts of strontium and phosphorous. Electron microprobe data was used to determine occupation of structural site of both C3S and C2S, and the distribution of trace elements among clinker phases. Phosphorous occurs in similar proportions in C3S and C2S; while considering its modal abundance, C3S is its main reservoir in the clinker. Sulfur is preferentially partitioned toward C2S compared to C3S. Strontium substitutes for Ca2+ mainly in C2S and in non-silicatic phases, compared to C3S.

  19. Behaviour, capture and inertization of some trace elements during combustion of refuse-derived char from municipal solid waste

    Vassilev, S.V.; Braekman-Danheux, C.; Laurent, P.; Thiemann, T.; Fontana, A. [Bulgarian Academy of Sciences, Sofia (Bulgaria). Central Lab. of Mineralogy and Crystallography

    1999-08-01

    An investigation of refuse-derived char (RDC) generated by thermolysis of municipal solid waste (MSW) was undertaken to elucidate the behaviour of some toxic and potentially toxic trace elements (Cr, Cu, Mn, Ni, Pb, Sb and Zn) plus Fe during combustion of RDC. About 87% of Sb, 66% of Pb, 60% of Cu and significant parts of Fe{gt}Zn{gt}Ni{gt}Mn{gt}Cr from the RDC are volatile at 1200{degree}C, and their behaviour in the temperature interval 500-1200{degree}C is characterized. The use of sorbents (zeolite, kaolinite, montmorillonite, coals enriched in kaolinite and calcite, and lime plus portlandite) for capture, solidification and inertization of the most volatile elements during combustion of RDC is also described. Perspective sorbents and inertants for a retention of the most volatile Pb, Sb and Cu in RDC ash are kaolinite and montmorillonite or coals enriched in these minerals. In addition, when there is an effective RDC washing (dechlorination and desulphurization), the use of sorbents for capture of some metals could be reduced or even avoided. Recommendations are given for RDC utilization and improvisation of the collection, separation procedures and removal efficiency of some heavy-metal, chloride and sulphate compounds from MSW and RDC prior to their use. The results show that a long-term strategy based on detailed understanding of the source, formation, behaviour and fate of the elements and their modes of occurrence in MSW, RDC and combustion waste residues is required in order to validate a perspective waste pyrolytic processes development. 55 refs., 3 figs., 6 tabs.

  20. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  1. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  2. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  3. Nonlinear optical response of some Graphene oxide and Graphene fluoride derivatives

    Liaros Nikolaos; Orfanos Ioannis; Papadakis Ioannis; Couris Stelios

    2016-01-01

    The nonlinear optical properties of two graphene derivatives, graphene oxide and graphene fluoride, are investigated by means of the Z-scan technique employing 35 ps and 4 ns, visible (532 nm) laser excitation. Both derivatives were found to exhibit significant third-order nonlinear optical response at both excitation regimes, with the nonlinear absorption being relatively stronger and concealing the presence of nonlinear refraction under ns excitation, while ps excita...

  4. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  5. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  6. Optimizing Combinations of Flavonoids Deriving from Astragali Radix in Activating the Regulatory Element of Erythropoietin by a Feedback System Control Scheme

    Hui Yu

    2013-01-01

    Full Text Available Identifying potent drug combination from a herbal mixture is usually quite challenging, due to a large number of possible trials. Using an engineering approach of the feedback system control (FSC scheme, we identified the potential best combinations of four flavonoids, including formononetin, ononin, calycosin, and calycosin-7-O-β-D-glucoside deriving from Astragali Radix (AR; Huangqi, which provided the best biological action at minimal doses. Out of more than one thousand possible combinations, only tens of trials were required to optimize the flavonoid combinations that stimulated a maximal transcriptional activity of hypoxia response element (HRE, a critical regulator for erythropoietin (EPO transcription, in cultured human embryonic kidney fibroblast (HEK293T. By using FSC scheme, 90% of the work and time can be saved, and the optimized flavonoid combinations increased the HRE mediated transcriptional activity by ~3-fold as compared with individual flavonoid, while the amount of flavonoids was reduced by ~10-fold. Our study suggests that the optimized combination of flavonoids may have strong effect in activating the regulatory element of erythropoietin at very low dosage, which may be used as new source of natural hematopoietic agent. The present work also indicates that the FSC scheme is able to serve as an efficient and model-free approach to optimize the drug combination of different ingredients within a herbal decoction.

  7. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  9. Response of a Duffing—Rayleigh system with a fractional derivative under Gaussian white noise excitation

    Zhang Ran-Ran; Xu Wei; Yang Gui-Dong; Han Qun

    2015-01-01

    In this paper, we consider the response analysis of a Duffing–Rayleigh system with fractional derivative under Gaussian white noise excitation. A stochastic averaging procedure for this system is developed by using the generalized harmonic functions. First, the system state is approximated by a diffusive Markov process. Then, the stationary probability densities are derived from the averaged Itô stochastic differential equation of the system. The accuracy of the analytical results is validated by the results from the Monte Carlo simulation of the original system. Moreover, the effects of different system parameters and noise intensity on the response of the system are also discussed. (paper)

  10. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  11. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  12. Modulation of Immune Responses by Exosomes Derived from Antigen-Presenting Cells

    Botros B. Shenoda

    2016-01-01

    Full Text Available Exosome-mediated signaling is important in mediating the inflammatory response. To exert their biological or pathophysiological functions in the recipient cells, exosomes deliver a diverse array of biomacromolecules including long and short coding and non-coding RNAs, proteins, and lipids. Exosomes secreted by antigen-presenting cells can confer therapeutic benefits by attenuating or stimulating the immune response. Exosomes play a crucial role in carrying and presenting functional major histocompatibility peptide complexes to modulate antigen-specific T cell responses. Exosomes from Dendritic Cells (DCs can activate T and B cells and have been explored for their immunostimulatory properties in cancer therapy. The immunosuppressive properties of exosomes derived from macrophages and DCs can reduce inflammation in animal models for several inflammatory disorders. This review focuses on the protective role of exosomes in attenuating inflammation or augmenting immune response, emphasizing studies on exosomes derived from DCs and macrophages.

  13. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  14. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  15. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  16. Student Response to Faculty Instruction (SRFI): An Empirically Derived Instrument to Measure Student Evaluations of Teaching

    Beitzel, Brian D.

    2013-01-01

    The Student Response to Faculty Instruction (SRFI) is an instrument designed to measure the student perspective on courses in higher education. The SRFI was derived from decades of empirical studies of student evaluations of teaching. This article describes the development of the SRFI and its psychometric attributes demonstrated in two pilot study…

  17. Relation between derived-band auditory brainstem response latencies and behavioral frequency selectivity

    Strelcyk, Olaf; Christoforidis, Dimitrios; Dau, Torsten

    2009-01-01

    response times. For the same listeners, auditory-filter bandwidths at 2 kHz were estimated using a behavioral notched-noise masking paradigm. Generally, shorter derived-band latencies were observed for the HI than for the NH listeners. Only at low click sensation levels, prolonged latencies were obtained...

  18. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  19. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  20. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  1. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  2. Derivation of design response spectra for analysis and testing of components and systems

    Krutzik, N.

    1996-01-01

    Some institutions participating in the Benchmark Project performed parallel calculations for the WWER-1000 Kozloduy NPP. The investigations were based on various mathematical models and procedures for consideration of soil-structure interaction effects, simultaneously applying uniform soil dynamic and seismological input data. The methods, mathematical models and dynamic response results were evaluated and discussed in detail and finally compared by means of different structural models and soil representations with the aim of deriving final enveloped and smoothed dynamic response data (benchmark response spectra). This should be used for requalification by analysis testing of the mechanical and electrical components and systems located in this type of reactor building

  3. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  5. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  6. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  7. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  8. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  9. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  10. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  11. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  12. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  13. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  14. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  15. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  16. Human-derived nanoparticles and vascular response to injury in rabbit carotid arteries: Proof of principle

    Maria A K Schwartz

    2008-06-01

    Full Text Available Maria A K Schwartz1, John C Lieske2, Vivek Kumar2, Gerard Farell-Baril2, Virginia M Miller1,31Departments of Physiology and Biomedical Engineering, Internal Medicine; 2Division of Nephrology, and 3Surgery, Mayo Clinic College of Medicine, Rochester, MN, USAAbstract: Self-calcifying, self-replicating nanoparticles have been isolated from calcified human tissues. However, it is unclear if these nanoparticles participate in disease processes. Therefore, this study was designed to preliminarily test the hypothesis that human-derived nanoparticles are causal to arterial disease processes. One carotid artery of 3 kg male rabbits was denuded of endothelium; the contralateral artery remained unoperated as a control. Each rabbit was injected intravenously with either saline, calcified, or decalcified nanoparticles cultured from calcified human arteries or kidney stones. After 35 days, both injured and control arteries were removed for histological examination. Injured arteries from rabbits injected with saline showed minimal, eccentric intimal hyperplasia. Injured arteries from rabbits injected with calcified kidney stone- and arterial-derived nanoparticles occluded, sometimes with canalization. The calcified kidney stone-derived nanoparticles caused calcifications within the occlusion. Responses to injury in rabbits injected with decalcified kidney stone-derived nanoparticles were similar to those observed in saline-injected animals. However, decalcified arterial-derived nanoparticles produced intimal hyperplasia that varied from moderate to occlusion with canalization and calcifi cation. This study offers the first evidence that there may be a causal relationship between human-derived nanoparticles and response to injury including calcification in arteries with damaged endothelium.Keywords: arterial calcification, endothelial injury, intimal hyperplasia

  17. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  18. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  19. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  20. Transferrin-derived synthetic peptide induces highly conserved pro-inflammatory responses of macrophages.

    Haddad, George; Belosevic, Miodrag

    2009-02-01

    We examined the induction of macrophage pro-inflammatory responses by transferrin-derived synthetic peptide originally identified following digestion of transferrin from different species (murine, bovine, human N-lobe and goldfish) using elastase. The mass spectrometry analysis of elastase-digested murine transferrin identified a 31 amino acid peptide located in the N2 sub-domain of the transferrin N-lobe, that we named TMAP. TMAP was synthetically produced and shown to induce a number of pro-inflammatory genes by quantitative PCR. TMAP induced chemotaxis, a potent nitric oxide response, and TNF-alpha secretion in different macrophage populations; P338D1 macrophage-like cells, mouse peritoneal macrophages, mouse bone marrow-derived macrophages (BMDM) and goldfish macrophages. The treatment of BMDM cultures with TMAP stimulated the production of nine cytokines and chemokines (IL-6, MCP-5, MIP-1 alpha, MIP-1 gamma, MIP-2, GCSF, KC, VEGF, and RANTES) that was measured using cytokine antibody array and confirmed by Western blot. Our results indicate that transferrin-derived peptide, TMAP, is an immunomodulating molecule capable of inducing pro-inflammatory responses in lower and higher vertebrates.

  1. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  2. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  3. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  4. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  6. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  7. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  8. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  9. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  10. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  11. Seaweed Polysaccharides and Derived Oligosaccharides Stimulate Defense Responses and Protection Against Pathogens in Plants

    Alejandra Moenne

    2011-11-01

    Full Text Available Plants interact with the environment by sensing “non-self” molecules called elicitors derived from pathogens or other sources. These molecules bind to specific receptors located in the plasma membrane and trigger defense responses leading to protection against pathogens. In particular, it has been shown that cell wall and storage polysaccharides from green, brown and red seaweeds (marine macroalgae corresponding to ulvans, alginates, fucans, laminarin and carrageenans can trigger defense responses in plants enhancing protection against pathogens. In addition, oligosaccharides obtained by depolymerization of seaweed polysaccharides also induce protection against viral, fungal and bacterial infections in plants. In particular, most seaweed polysaccharides and derived oligosaccharides trigger an initial oxidative burst at local level and the activation of salicylic (SA, jasmonic acid (JA and/or ethylene signaling pathways at systemic level. The activation of these signaling pathways leads to an increased expression of genes encoding: (i Pathogenesis-Related (PR proteins with antifungal and antibacterial activities; (ii defense enzymes such as pheylalanine ammonia lyase (PAL and lipoxygenase (LOX which determine accumulation of phenylpropanoid compounds (PPCs and oxylipins with antiviral, antifugal and antibacterial activities and iii enzymes involved in synthesis of terpenes, terpenoids and/or alkaloids having antimicrobial activities. Thus, seaweed polysaccharides and their derived oligosaccharides induced the accumulation of proteins and compounds with antimicrobial activities that determine, at least in part, the enhanced protection against pathogens in plants.

  12. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  13. Dickkopf-3, a tissue-derived modulator of local T cell responses

    Michael eMeister

    2015-02-01

    Full Text Available The adaptive immune system protects organisms from harmful environmental insults. In parallel, regulatory mechanisms control immune responses in order to assure preservation of organ integrity. Yet, molecules involved in the control of T cell responses in peripheral tissues are poorly characterized. Here, we investigated the function of Dickkopf-3 in the modulation of local T cell reactivity. Dkk3 is a secreted, mainly tissue derived protein with highest expression in organs considered as immune privileged such as the eye, embryo, placenta and brain. While T cell development and activation status in naïve Dkk3 deficient mice was comparable to littermate controls, we found that Dkk3 contributes to the immunosuppressive microenvironment that protects transplanted, class-I mismatched embryoid bodies from T cell mediated rejection. Moreover, genetic deletion or antibody mediated neutralization of Dkk3 led to an exacerbated experimental autoimmune encephalomyelitis (EAE. This phenotype was accompanied by a change of T cell polarization displayed by an increase of IFNγ producing T cells within in the CNS. In the wild type situation, Dkk3 expression in the brain was up-regulated during the course of EAE in an IFNγ dependent manner. In turn, Dkk3 decreased IFNγ activity and served as part of a negative feedback mechanism. Thus, our findings suggest that Dkk3 functions as a tissue-derived modulator of local CD4+ and CD8+ T cell responses.

  14. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  15. Enhancing the Bioconversion of Azelaic Acid to Its Derivatives by Response Surface Methodology

    Nurshafira Khairudin

    2018-02-01

    Full Text Available Azelaic acid (AzA and its derivatives have been known to be effective in the treatment of acne and various cutaneous hyperpigmentary disorders. The esterification of azelaic acid with lauryl alcohol (LA to produce dilaurylazelate using immobilized lipase B from Candida antarctica (Novozym 435 is reported. Response surface methodology was selected to optimize the reaction conditions. A well-fitting quadratic polynomial regression model for the acid conversion was established with regards to several parameters, including reaction time and temperature, enzyme amount, and substrate molar ratios. The regression equation obtained by the central composite design of RSM predicted that the optimal reaction conditions included a reaction time of 360 min, 0.14 g of enzyme, a reaction temperature of 46 °C, and a molar ratio of substrates of 1:4.1. The results from the model were in good agreement with the experimental data and were within the experimental range (R2 of 0.9732.The inhibition zone can be seen at dilaurylazelate ester with diameter 9.0±0.1 mm activities against Staphylococcus epidermidis S273. The normal fibroblasts cell line (3T3 was used to assess the cytotoxicity activity of AzA and AzA derivative, which is dilaurylazelate ester. The comparison of the IC50 (50% inhibition of cell viability value for AzA and AzA derivative was demonstrated. The IC50 value for AzA was 85.28 μg/mL, whereas the IC50 value for AzA derivative was more than 100 μg/mL. The 3T3 cell was still able to survive without any sign of toxicity from the AzA derivative; thus, it was proven to be non-toxic in this MTT assay when compared with AzA.

  16. Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses

    Hiroyuki Mizuguchi

    2011-07-01

    Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.

  17. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  18. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  19. Silicon Damage Response Function Derivation and Verification: Assessment of Impact on ASTM Standard E722

    Depriest, Kendall [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-06-01

    Unsuccessful attempts by members of the radiation effects community to independently derive the Norgett-Robinson-Torrens (NRT) damage energy factors for silicon in ASTM standard E722-14 led to an investigation of the software coding and data that produced those damage energy factors. The ad hoc collaboration to discover the reason for lack of agreement revealed a coding error and resulted in a report documenting the methodology to produce the response function for the standard. The recommended changes in the NRT damage energy factors for silicon are shown to have significant impact for a narrow energy region of the 1-MeV(Si) equivalent fluence response function. However, when evaluating integral metrics over all neutrons energies in various spectra important to the SNL electronics testing community, the change in the response results in a small decrease in the total 1- MeV(Si) equivalent fluence of ~0.6% compared to the E722-14 response. Response functions based on the newly recommended NRT damage energy factors have been produced and are available for users of both the NuGET and MCNP codes.

  20. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  1. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  2. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  3. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  4. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  5. Dendritic cells loaded with HeLa-derived exosomes simulate an antitumor immune response.

    Ren, Guoping; Wang, Yanhong; Yuan, Shexia; Wang, Baolian

    2018-05-01

    The aim of the present study was to investigate the effect of loading dendritic cells (DCs) with HeLa-derived exosomes on cytotoxic T-lymphocyte (CTL) responses, and the cytotoxic effects of CTL responses on the HeLa cell line. Ultrafiltration centrifugation combined with sucrose density gradient ultracentrifugation was applied to isolate exosomes (HeLa-exo) from the supernatant of HeLa cells. Morphological features of HeLa-exo were identified by transmission electron microscopy (TEM), and the expression of cluster of differentiation (CD)63 was detected by western blotting. Next, monocytes were isolated from peripheral blood and cultured with the removal of adherent cells to induce DC proliferation. DCs were then phenotypically characterized by flow cytometry. Finally, MTT assays were performed to analyze the effects of DCs loaded with HeLa-exo on T cell proliferation and cytotoxicity assays to evaluate the effect of CTL responses on HeLa cells. TEM revealed that HeLa-exo exhibit typical cup-shaped morphology with a diameter range of 30-100 nm. It was also identified that the CD63 surface antigen is expressed on HeLa-exo. Furthermore, monocyte-derived DCs were able to express CD1a, suggesting that DC induction was a success. DCs exhibited hair-like protrusions and other typical dendritic cell morphology. Furthermore, DCs loaded with HeLa-exo could enhance CTL proliferation and the cytotoxic activity of CTLs compared with DCs without HeLa-exo (PHeLa-exo may promote T cell proliferation and induce CTL responses to inhibit the growth of cervical cancer cells in vitro .

  6. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  7. Mobility of plume-derived volcanogenic elements in meteoric water at Nyiragongo volcano (Congo) inferred from the chemical composition of single rainfall events

    Liotta, Marcello; Shamavu, Patient; Scaglione, Sarah; D'Alessandro, Walter; Bobrowski, Nicole; Bruno Giuffrida, Giovanni; Tedesco, Dario; Calabrese, Sergio

    2017-11-01

    The chemical composition of single rainfall events was investigated at Nyiragongo volcano (Democratic Republic of Congo) with the aim of determining the relative contributions of plume-derived elements. The different locations of the sampling sites allowed both plume-affected samples (hereafter referred to as ;fumigated samples;) and samples representative of the local background to be collected. The chemical composition of the local background reflects the peculiar geographic features of the area, being influenced by biomass burning, geogenic dust, and biological activity. Conversely, fumigated samples contain large amounts of volcanogenic elements that can be clearly distinguished from the local background. These elements are released into the atmosphere from the persistently boiling lava lake of the Nyiragongo crater and from the neonate lava lake of Nyamulagira. These emissions result in a volcanic plume that includes solid particles, acidic droplets, and gaseous species. The chemical signature of the volcanic emissions appears in falling raindrops as they interact with the plume. HCl and HBr readily dissolve in water, and so their ratio in rain samples reflects that of the volcanic plume. The transport of HF is mediated by the large amount of silicate particles generated at the magma-air interface. SO2 is partially converted into SO42- that dissolves in water. The refractory elements dissolved in rain samples derive from the dissolution of silicate particles, and most of them (Al, Mg, Ca, and Sr) are present at exactly the same molar ratios as in the rocks. In contrast, elements such as Na, K, Rb, Cu, and Pb are enriched relative to the whole-rock composition, suggesting that they are volatilized during magma degassing. After correcting for the dissolution of silicate particles, we can define that the volatility of the elements decreases in the following order: Pb ≫ Rb > K > Na. This finding, which is the first for a volcanic plume, is consistent with

  8. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  9. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  10. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  12. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  13. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  14. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  15. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  16. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  17. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  18. Construction of stably maintained non-mobilizable derivatives of RSF1010 lacking all known elements essential for mobilization

    Tokmakova Irina L

    2007-11-01

    Full Text Available Abstract Background RSF1010 is a well-studied broad-host-range plasmid able to be mobilized to different bacteria and plants. RSF1010-derived plasmid vectors are widely used in both basic research and industrial applications. In the latter case, exploiting of mobilizable plasmids or even the plasmids possessing negligible mobilization frequency, but containing DNA fragments that could promote conjugal transfer, is undesirable because of biosafety considerations. Previously, several mutations significantly decreasing efficiency of RSF1010 mobilization have been selected. Nevertheless, construction of the RSF1010 derivative lacking all known loci involved in the conjugal transfer has not been reported yet. Results Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process have been obtained due to the exploiting of λRed-driven recombination between the plasmid and a constructed in vitro linear DNA fragment. To provide auto-regulated transcription of the essential replication gene, repB, the plasmid loci oriT, mobC and mobA were substituted by the DNA fragment containing PlacUV5→lacI. Mobilization of the obtained RSFmob plasmid was not detected in standard tests. The derivative of RSFmob with increased copy number has been obtained after lacI elimination. High stability of both constructed plasmids has been demonstrated in Escherichia coli and Pantoea ananatis. Design of RSFmob allows easy substitution of PlacUV5 by any desirable promoter for construction of novel derivatives with changed copy number or host range. Conclusion Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process and stably maintained at least in E. coli and P. ananatis have been constructed. The obtained plasmids became the progenitors of new cloning vectors answering all biosafety requirements of genetically modified organisms used in scale-up production.

  19. Integration of Synthetic Aperture Radar (SAR) Imagery and Derived Products into Severe Weather Disaster Response

    Schultz, L. A.; Molthan, A.; Nicoll, J. B.; Bell, J. R.; Gens, R.; Meyer, F. J.

    2017-12-01

    Disaster response efforts leveraging imagery from NASA, USGS, NOAA, and the European Space Agency (ESA) have continued to expand as satellite imagery and derived products offer an enhanced overview of the affected areas, especially in remote areas where terrain and the scale of the damage can inhibit response efforts. NASA's Short-term Prediction Research and Transition (SPoRT) Center has been supporting the NASA Earth Science Disaster Response Program by providing both optical and SAR imagery products to the NWS and FEMA to assist during domestic response efforts. Although optical imagery has dominated, the availability of ESA's Synthetic Aperture Radar (SAR) data from the Sentinel 1-A/B satellites offers a unique perspective to the damage response community as SAR imagery can be collected regardless of the time of day or the presence of clouds, two major hindrances to the use of satellite optical imagery. Through a partnership with the University of Alaska Fairbanks (UAF) and the collocated Alaska Satellite Facility (ASF), NASA's SAR Distributed Active Archive Center (DAAC), SPoRT has been investigating the use of SAR imagery products to support storm damage surveys conducted by the National Weather Service after any severe weather event. Additionally, products are also being developed and tested for FEMA and the National Guard Bureau. This presentation will describe how SAR data from the Sentinel 1A/B satellites are processed and developed into products. Examples from multiple tornado and hail events will be presented highlighting both the strengths and weaknesses of SAR imagery and how it integrates and compliments more traditional optical imagery collected post-event. Specific case study information from a large hail event in South Dakota and a long track tornado near Clear Lake, Wisconsin will be discussed as well as an overview of the work being done to support FEMA and the National Guard.

  20. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  1. Reduced immune responses to purified protein derivative and Candida albicans in oral lichen planus.

    Simark-Mattsson, Charlotte; Eklund, Christina

    2013-10-01

    Impairment of cellular immunity is reported in lichen planus, an autoimmune disease affecting mucosae and skin. Our aim was to investigate immune responses directed against a set of microbial antigens in patients with oral lichen planus and in matched controls. Venous blood was obtained, and the mononuclear cells were enriched by density gradient centrifugation. The proliferation of peripheral blood mononuclear cells was assessed, following stimulation with purified protein derivative (PPD), Candida albicans, phytohemagglutinin or when cells were left unstimulated, after three or six days of cell culture. The production of interleukin-1ß (IL-1ß), IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-17, interferon-γ (IFN-γ), tumour necrosis factor-α (TNF-α), G-CSF, GM-CSF, MCP-1, MIP-ß was assessed in supernatants using the Bio-plex(®) assay and was complemented with ELISA for selected cytokines. Patients with oral lichen planus demonstrated reduced proliferative responses against PPD (P stimulated supernatants from patients with oral lichen planus. Collectively, the findings suggested that memory lymphocytes from patients with oral lichen planus (OLP) may have an impaired functional ability to react against certain recall antigens, as part of a generalized response, which may reflect immune regulatory processes. Further studies are needed to clarify the mechanisms of down-regulation in OLP pathogenesis and progression. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  3. Distinct gut-derived lactic acid bacteria elicit divergent dendritic cell-mediated NK cell responses

    Fink, Lisbeth Nielsen; Zeuthen, Louise Hjerrild; Christensen, Hanne

    2007-01-01

    Lactic acid bacteria (LAB) are abundant in the gastrointestinal tract where they continuously regulate the immune system. NK cells are potently activated by dendritic cells (DCs) matured by inflammatory stimuli, and NK cells are present in the gut epithelium and in mesenteric lymph nodes......, but it is not known how NK-DC interactions are affected by the predominantly non-pathogenic LAB. We demonstrate that human DCs exposed to different strains of gut-derived LAB consistently induce proliferation, cytotoxicity and activation markers in autologous NK cells. On the contrary, strains of LAB differ greatly...... in their ability to induce DC-dependent IFN-gamma production by NK cells. This suggests that DCs stimulated by gut LAB may expand the pool of NK cells and increase their cytotoxic potential. Specific LAB, inducing high levels of IL-12 in DCs, may promote amplification of a type-1 response via potent stimulation...

  4. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  5. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  6. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  7. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  8. Empirically derived personality subtyping for predicting clinical symptoms and treatment response in bulimia nervosa.

    Haynos, Ann F; Pearson, Carolyn M; Utzinger, Linsey M; Wonderlich, Stephen A; Crosby, Ross D; Mitchell, James E; Crow, Scott J; Peterson, Carol B

    2017-05-01

    Evidence suggests that eating disorder subtypes reflecting under-controlled, over-controlled, and low psychopathology personality traits constitute reliable phenotypes that differentiate treatment response. This study is the first to use statistical analyses to identify these subtypes within treatment-seeking individuals with bulimia nervosa (BN) and to use these statistically derived clusters to predict clinical outcomes. Using variables from the Dimensional Assessment of Personality Pathology-Basic Questionnaire, K-means cluster analyses identified under-controlled, over-controlled, and low psychopathology subtypes within BN patients (n = 80) enrolled in a treatment trial. Generalized linear models examined the impact of personality subtypes on Eating Disorder Examination global score, binge eating frequency, and purging frequency cross-sectionally at baseline and longitudinally at end of treatment (EOT) and follow-up. In the longitudinal models, secondary analyses were conducted to examine personality subtype as a potential moderator of response to Cognitive Behavioral Therapy-Enhanced (CBT-E) or Integrative Cognitive-Affective Therapy for BN (ICAT-BN). There were no baseline clinical differences between groups. In the longitudinal models, personality subtype predicted binge eating (p = 0.03) and purging (p = 0.01) frequency at EOT and binge eating frequency at follow-up (p = 0.045). The over-controlled group demonstrated the best outcomes on these variables. In secondary analyses, there was a treatment by subtype interaction for purging at follow-up (p = 0.04), which indicated a superiority of CBT-E over ICAT-BN for reducing purging among the over-controlled group. Empirically derived personality subtyping appears to be a valid classification system with potential to guide eating disorder treatment decisions. © 2016 Wiley Periodicals, Inc.(Int J Eat Disord 2017; 50:506-514). © 2016 Wiley Periodicals, Inc.

  9. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  10. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  11. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  12. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  13. Comparison of tumour age response to radiation for cells derived from tissue culture or solid tumours

    Keng, P.C.; Siemann, D.W.; Rochester Univ., NY; Rochester Univ., NY; Wheeler, K.T.

    1984-01-01

    Direct comparison of the cell age response of 9L and KHT tumour cells derived either from tissue culture or solid tumours was achieved. Cells from dissociated KHT and 9L tumours (the latter implanted either subcutaneously or intracerebrally) and cells from tissue culture were separated into homogenous sized populations by centrifugal elutriation. In both tumour models these homogeneous sized populations correspond to populations enriched at different stages of the cell cycle. The survival of these elutriated cell populations was measured after a single dose of Cs-137 gamma rays. For cells isolated from 9L solid tumours, there was little variation in radiosensitivity throughout the cell cycle; however, a very small but significant increase in resistance was found in late G 1 cells. This lack of a large variation in radiosensitivity through the cell cycle for 9L cells from solid tumours also was seen in 9L cells growing in monolayer tissue culture. When similar experiments were performed using the KHT sarcoma tumour model, the results showed that KHT cells in vitro exhibited a fairly conventional increase in radioresistance in both mid G 1 and late S. However, the cell age response of KHT cells from solid tumours was different; particularly in the late S and G 2 + M phases. (author)

  14. Reversible Chromatic Response of Polydiacetylene Derivative Vesicles in D2O Solvent.

    Shin, Min Jae; Kim, Jong-Duk

    2016-01-26

    The thermal chromatic sensitivity of polydiacetylenes (PDAs) with 10,12-pentacosadiynoic acid (PCDA) derivatives, which have a hydroxyl group (HEEPCDA) and an amine group (APPCDA), were investigated using D2O and H2O as solvents. The vesicle solution with polymerized HEEPCDA exhibited a reversible chromatic response during the heating and cooling cycle in D2O, but not in H2O. On the other hand, the vesicle solution with the polymerized APPCDA exhibited a reversible chromatic response in H2O during the heating and cooling cycle, but the color of the solution did not change much in D2O. The critical vesicle concentration of HEEPCDA was lower in D2O than in H2O, and the chromatic sensitivity of the polymerized vesicles to temperature was slower in D2O than in H2O. We think that it is due to D2O being a more highly structured solvent than H2O with the hydrogen bonding in D2O stronger than that in H2O.

  15. Neutrophil derived LTB4 induces macrophage aggregation in response to encapsulated Streptococcus iniae infection.

    William J B Vincent

    Full Text Available Immune cells sense and react to a multitude of factors including both host and microbe-derived signals. Understanding how cells translate these cues into particular cellular behaviors is a complex yet critical area of study. We have previously shown that both neutrophils and macrophages are important for controlling the fish pathogen Streptococcus iniae. Here, we report both host and bacterial determinants leading to the formation of organized macrophage aggregates as part of the host inflammatory response in a subset of infected larvae. Streptococcal capsule was a required signal for aggregate formation. Macrophage aggregation coincided with NFκB activity, and the formation of these aggregates is mediated by leukotriene B4 (LTB4 produced by neutrophils. Depletion, inhibition, or genetic deletion of leukotriene A4 hydrolase (Lta4h, which catalyzes the last step in LTB4 synthesis, resulted in the absence of macrophage aggregation. Larvae with impaired neutrophil function also had impaired macrophage aggregation; however, aggregate formation was partially rescued with the addition of exogenous LTB4. Neutrophil-specific expression of lta4h was sufficient to rescue macrophage aggregation in Lta4h-deficient larvae and increased host survival following infection. In summary, our findings highlight a novel innate immune response to infection in which specific bacterial products drive neutrophils that modulate macrophage behavior through eicosanoid signaling.

  16. Chemotaxis of primitive hematopoietic cells in response to stromal cell–derived factor-1

    Jo, Deog-Yeon; Rafii, Shahin; Hamada, Tsuneyoshi; Moore, Malcolm A.S.

    2000-01-01

    Stromal cell–derived factor-1 (SDF-1) provides a potent chemotactic stimulus for CD34+ hematopoietic cells. We cultured mobilized peripheral blood (PB) and umbilical cord blood (CB) for up to 5 weeks and examined the migratory activity of cobblestone area–forming cells (CAFCs) and long-term culture–initiating cells (LTC-ICs) in a transwell assay. In this system, SDF-1 or MS-5 marrow stromal cells placed in the lower chamber induced transmembrane and transendothelial migration by 2- and 5-week-old CAFCs and LTC-ICs in 3 hours. Transmigration was blocked by preincubation of input CD34+ cells with antibody to CXCR4. Transendothelial migration of CB CAFCs and LTC-ICs was higher than that of PB. We expanded CD34+ cells from CB in serum-free medium with thrombopoietin, flk-2 ligand, and c-kit ligand, with or without IL-3 and found that CAFCs cultured in the absence of IL-3 had a chemotactic response equivalent to noncultured cells, even after 5 weeks. However, addition of IL-3 to the culture reduced this response by 20–50%. These data indicate that SDF-1 induces chemotaxis of primitive hematopoietic cells signaling through CXCR4 and that the chemoattraction could be downmodulated by culture ex vivo. PMID:10619866

  17. Integrated chemical sensor array platform based on a light emitting diode, xerogel-derived sensor elements, and high-speed pin printing

    Cho, Eun Jeong; Bright, Frank V.

    2002-01-01

    We report a new, solid-state, integrated optical array sensor platform. By using pin printing technology in concert with sol-gel-processing methods, we form discrete xerogel-based microsensor elements that are on the order of 100 μm in diameter and 1 μm thick directly on the face of a light emitting diode (LED). The LED serves as the light source to excite chemically responsive luminophores sequestered within the doped xerogel microsensors and the analyte-dependent emission from within the doped xerogel is detected with a charge coupled device (CCD). We overcome the problem of background illumination from the LED reaching the CCD and the associated biasing that results by coating the LED first with a thin layer of blue paint. The thin paint layer serves as an optical filter, knocking out the LEDs red-edge spectral tail. The problem of the spatially-dependent fluence across the LED face is solved entirely by performing ratiometric measurements. We illustrate the performance of the new sensor scheme by forming an array of 100 discrete O 2 -responsive sensing elements on the face of a single LED. The combination of pin printing with an integrated sensor and light source platform results in a rapid method of forming (∼1 s per sensor element) reusable sensor arrays. The entire sensor array can be calibrated using just one sensor element. Array-to-array reproducibly is <8%. Arrays can be formed using single or multiple pins with indistinguishable analytical performance

  18. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  19. Monocyte-Derived Signals Activate Human Natural Killer Cells in Response to Leishmania Parasites

    Messlinger, Helena; Sebald, Heidi; Heger, Lukas; Dudziak, Diana; Bogdan, Christian; Schleicher, Ulrike

    2018-01-01

    Activated natural killer (NK) cells release interferon (IFN)-γ, which is crucial for the control of intracellular pathogens such as Leishmania. In contrast to experimental murine leishmaniasis, the human NK cell response to Leishmania is still poorly characterized. Here, we investigated the interaction of human blood NK cells with promastigotes of different Leishmania species (Leishmania major, Leishmania mexicana, Leishmania infantum, and Leishmania donovani). When peripheral blood mononuclear cells or purified NK cells and monocytes (all derived from healthy blood donors from Germany without a history of leishmaniasis) were exposed to promastigotes, NK cells showed increased surface expression of the activation marker CD69. The extent of this effect varied depending on the Leishmania species; differences between dermotropic and viscerotropic L. infantum strains were not observed. Upregulation of CD69 required direct contact between monocytes and Leishmania and was partly inhibitable by anti-interleukin (IL)-18. Unexpectedly, IL-18 was undetectable in most of the supernatants (SNs) of monocyte/parasite cocultures. Confocal fluorescence microscopy of non-permeabilized cells revealed that Leishmania-infected monocytes trans-presented IL-18 to NK cells. Native, but not heat-treated SNs of monocyte/Leishmania cocultures also induced CD69 on NK cells, indicating the involvement of a soluble heat-labile factor other than IL-18. A role for the NK cell-activating cytokines IL-1β, IL-2, IL-12, IL-15, IL-21, and IFN-α/β was excluded. The increase of CD69 was not paralleled by NK cell IFN-γ production or enhanced cytotoxicity. However, prior exposure of NK cells to Leishmania parasites synergistically increased their IFN-γ release in response to IL-12, which was dependent on endogenous IL-18. CD1c+ dendritic cells were identified as possible source of Leishmania-induced IL-12. Finally, we observed that direct contact between Leishmania and NK cells reduced the

  20. Monocyte-Derived Signals Activate Human Natural Killer Cells in Response to Leishmania Parasites

    Helena Messlinger

    2018-01-01

    Full Text Available Activated natural killer (NK cells release interferon (IFN-γ, which is crucial for the control of intracellular pathogens such as Leishmania. In contrast to experimental murine leishmaniasis, the human NK cell response to Leishmania is still poorly characterized. Here, we investigated the interaction of human blood NK cells with promastigotes of different Leishmania species (Leishmania major, Leishmania mexicana, Leishmania infantum, and Leishmania donovani. When peripheral blood mononuclear cells or purified NK cells and monocytes (all derived from healthy blood donors from Germany without a history of leishmaniasis were exposed to promastigotes, NK cells showed increased surface expression of the activation marker CD69. The extent of this effect varied depending on the Leishmania species; differences between dermotropic and viscerotropic L. infantum strains were not observed. Upregulation of CD69 required direct contact between monocytes and Leishmania and was partly inhibitable by anti-interleukin (IL-18. Unexpectedly, IL-18 was undetectable in most of the supernatants (SNs of monocyte/parasite cocultures. Confocal fluorescence microscopy of non-permeabilized cells revealed that Leishmania-infected monocytes trans-presented IL-18 to NK cells. Native, but not heat-treated SNs of monocyte/Leishmania cocultures also induced CD69 on NK cells, indicating the involvement of a soluble heat-labile factor other than IL-18. A role for the NK cell-activating cytokines IL-1β, IL-2, IL-12, IL-15, IL-21, and IFN-α/β was excluded. The increase of CD69 was not paralleled by NK cell IFN-γ production or enhanced cytotoxicity. However, prior exposure of NK cells to Leishmania parasites synergistically increased their IFN-γ release in response to IL-12, which was dependent on endogenous IL-18. CD1c+ dendritic cells were identified as possible source of Leishmania-induced IL-12. Finally, we observed that direct contact between Leishmania and NK cells

  1. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  2. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  3. Transcription Profiling Demonstrates Epigenetic Control of Non-retroviral RNA Virus-Derived Elements in the Human Genome

    Kozue Sofuku

    2015-09-01

    Full Text Available Endogenous bornavirus-like nucleoprotein elements (EBLNs are DNA sequences in vertebrate genomes formed by the retrotransposon-mediated integration of ancient bornavirus sequence. Thus, EBLNs evidence a mechanism of retrotransposon-mediated RNA-to-DNA information flow from environment to animals. Although EBLNs are non-transposable, they share some features with retrotransposons. Here, to test whether hosts control the expression of EBLNs similarly to retrotransposons, we profiled the transcription of all Homo sapiens EBLNs (hsEBLN-1 to hsEBLN-7. We could detect transcription of all hsEBLNs in at least one tissue. Among them, hsEBLN-1 is transcribed almost exclusively in the testis. In most tissues, expression from the hsEBLN-1 locus is silenced epigenetically. Finally, we showed the possibility that hsEBLN-1 integration at this locus affects the expression of a neighboring gene. Our results suggest that hosts regulate the expression of endogenous non-retroviral virus elements similarly to how they regulate the expression of retrotransposons, possibly contributing to new transcripts and regulatory complexity to the human genome.

  4. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  5. Guild-specific responses of avian species richness to LiDAR-derived habitat heterogeneity

    Weisberg, Peter J.; Dilts, Thomas E.; Becker, Miles E.; Young, Jock S.; Wong-Kone, Diane C.; Newton, Wesley E.; Ammon, Elisabeth M.

    2014-01-01

    Ecological niche theory implies that more heterogeneous habitats have the potential to support greater biodiversity. Positive heterogeneity-diversity relationships have been found for most studies investigating animal taxa, although negative relationships also occur and the scale dependence of heterogeneity-diversity relationships is little known. We investigated multi-scale, heterogeneity-diversity relationships for bird communities in a semi-arid riparian landscape, using airborne LiDAR data to derive key measures of structural habitat complexity. Habitat heterogeneity-diversity relationships were generally positive, although the overall strength of relationships varied across avian life history guilds (R2 range: 0.03–0.41). Best predicted were the species richness indices of cavity nesters, habitat generalists, woodland specialists, and foliage foragers. Heterogeneity-diversity relationships were also strongly scale-dependent, with strongest associations at the 200-m scale (4 ha) and weakest associations at the 50-m scale (0.25 ha). Our results underscore the value of LiDAR data for fine-grained quantification of habitat structure, as well as the need for biodiversity studies to incorporate variation among life-history guilds and to simultaneously consider multiple guild functional types (e.g. nesting, foraging, habitat). Results suggest that certain life-history guilds (foliage foragers, cavity nesters, woodland specialists) are more susceptible than others (ground foragers, ground nesters, low nesters) to experiencing declines in local species richness if functional elements of habitat heterogeneity are lost. Positive heterogeneity-diversity relationships imply that riparian conservation efforts need to not only provide high-quality riparian habitat locally, but also to provide habitat heterogeneity across multiple scales.

  6. Satellite-derived SIF and CO2 Observations Show Coherent Responses to Interannual Climate Variations

    Butterfield, Z.; Hogikyan, A.; Kulawik, S. S.; Keppel-Aleks, G.

    2017-12-01

    Gross primary production (GPP) is the single largest carbon flux in the Earth system, but its sensitivity to changes in climate is subject to significant uncertainty. Satellite measurements of solar-induced chlorophyll fluorescence (SIF) offer insight into spatial and temporal patterns in GPP at a global scale and, combined with other satellite-derived datasets, provide unprecedented opportunity to explore interactions between atmospheric CO2, GPP, and climate variability. To explore potential drivers of GPP in the Northern Hemisphere (NH), we compare monthly-averaged SIF data from the Global Ozone Monitoring Experiment 2 (GOME-2) with observed anomalies in temperature (T; CRU-TS), liquid water equivalent (LWE) from the Gravity Recovery and Climate Experiment (GRACE), and photosynthetically active radiation (PAR; CERES SYN1deg). Using observations from 2007 through 2015 for several NH regions, we calculate month-specific sensitivities of SIF to variability in T, LWE, and PAR. These sensitivities provide insight into the seasonal progression of how productivity is affected by climate variability and can be used to effectively model the observed SIF signal. In general, we find that high temperatures are beneficial to productivity in the spring, but detrimental in the summer. The influences of PAR and LWE are more heterogeneous between regions; for example, higher LWE in North American temperate forest leads to decreased springtime productivity, while exhibiting a contrasting effect in water-limited regions. Lastly, we assess the influence of variations in terrestrial productivity on atmospheric carbon using a new lower tropospheric CO2 product derived from the Greenhouse Gases Observing Satellite (GOSAT). Together, these data shed light on the drivers of interannual variability in the annual cycle of NH atmospheric CO2, and may provide improved constraints on projections of long-term carbon cycle responses to climate change.

  7. Transposition of a Ds element from a plasmid into the plant genome in Nicotiana plumbaginifolia protoplast-derived cells.

    Houba-Hérin, N; Domin, M; Pédron, J

    1994-07-01

    Nicotiana plumbaginifolia haploid protoplasts were co-transformed with two plasmids, one with a NPT-II/Ds element and one with a gene encoding an amino-terminal truncated Ac transposase. It is shown that Ds can efficiently transpose from extrachromosomal DNA to N. plumbaginifolia chromosomes when the Ac transposase gene is present in trans. Ds has been shown to have transposed into the plant genome in a limited number of copies (1.9 copies per genome), for 21/32 transgenic lines tested. The flanking sequences present in the original plasmid are missing in these 21 plants. In only two of 21 plants was part of the transposase construct integrated. By segregation analysis of transgenic progeny, Ds was shown to be present in the heterozygous state in 10 lines even though haploid protoplasts had been originally transformed. This observation could indicate that integration occurred after or during DNA replication that leads to protoplast diploidization.

  8. Carrier element-free coprecipitation (CEFC) method for the separation, preconcentration and speciation of chromium using an isatin derivative

    Bulut, Volkan Numan; Ozdes, Duygu; Bekircan, Olcay; Gundogdu, Ali; Duran, Celal [Department of Chemistry, Karadeniz Technical University, Faculty of Arts and Sciences, 61080 Trabzon (Turkey); Soylak, Mustafa [Department of Chemistry, Erciyes University, Faculty of Arts and Sciences, 38039 Kayseri (Turkey)], E-mail: soylak@erciyes.edu.tr

    2009-01-19

    A new, simple, rapid and sensitive separation, preconcentration and speciation procedure for chromium in environmental liquid and solid samples has been established. The present speciation procedure for Cr(III) and Cr(VI) is based on combination of carrier element-free coprecipitation (CEFC) and flame atomic absorption spectrometric (FAAS) determinations. In this method a newly synthesized organic coprecipitant, 5-chloro-3-[4-(trifluoromethoxy) phenylimino]indolin-2-one (CFMEPI), was used without adding any carrier element for coprecipitation of chromium(III). After reduction of chromium(VI) by concentrated H{sub 2}SO{sub 4} and ethanol, the procedure was applied for the determination of total chromium. Chromium(VI) was calculated as the difference between the amount of total chromium and chromium(III). The optimum conditions for coprecipitation and speciation processes were investigated on several commonly tested experimental parameters, such as pH of the solution, amount of coprecipitant, sample volume, etc. No considerable interference was observed from the other investigated anions and cations, which may be found in natural water samples. The preconcentration factor was found to be 40. The detection limit for chromium(III) corresponding to three times the standard deviation of the blank (N = 10) was found 0.7 {mu}g L{sup -1}. The present procedure was successfully applied for speciation of chromium in several liquid and solid environmental samples. In order to support the accuracy of the method, the certified reference materials (CRM-TMDW-500 Drinking Water and CRM-SA-C Sandy Soil C) were analyzed, and standard APDC-MIBK liquid-liquid extraction method was performed. The results obtained were in good agreement with the certified values.

  9. Carrier element-free coprecipitation (CEFC) method for the separation, preconcentration and speciation of chromium using an isatin derivative

    Bulut, Volkan Numan; Ozdes, Duygu; Bekircan, Olcay; Gundogdu, Ali; Duran, Celal; Soylak, Mustafa

    2009-01-01

    A new, simple, rapid and sensitive separation, preconcentration and speciation procedure for chromium in environmental liquid and solid samples has been established. The present speciation procedure for Cr(III) and Cr(VI) is based on combination of carrier element-free coprecipitation (CEFC) and flame atomic absorption spectrometric (FAAS) determinations. In this method a newly synthesized organic coprecipitant, 5-chloro-3-[4-(trifluoromethoxy) phenylimino]indolin-2-one (CFMEPI), was used without adding any carrier element for coprecipitation of chromium(III). After reduction of chromium(VI) by concentrated H 2 SO 4 and ethanol, the procedure was applied for the determination of total chromium. Chromium(VI) was calculated as the difference between the amount of total chromium and chromium(III). The optimum conditions for coprecipitation and speciation processes were investigated on several commonly tested experimental parameters, such as pH of the solution, amount of coprecipitant, sample volume, etc. No considerable interference was observed from the other investigated anions and cations, which may be found in natural water samples. The preconcentration factor was found to be 40. The detection limit for chromium(III) corresponding to three times the standard deviation of the blank (N = 10) was found 0.7 μg L -1 . The present procedure was successfully applied for speciation of chromium in several liquid and solid environmental samples. In order to support the accuracy of the method, the certified reference materials (CRM-TMDW-500 Drinking Water and CRM-SA-C Sandy Soil C) were analyzed, and standard APDC-MIBK liquid-liquid extraction method was performed. The results obtained were in good agreement with the certified values

  10. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  11. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  12. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  13. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  14. Transcriptome Profile of the Response of Paracoccidioides spp. to a Camphene Thiosemicarbazide Derivative.

    Lívia do Carmo Silva

    Full Text Available Paracoccidioidomycosis (PCM is a systemic granulomatous human mycosis caused by fungi of the genus Paracoccidioides, which is geographically restricted to Latin America. Inhalation of spores, the infectious particles of the fungus, is a common route of infection. The PCM treatment of choice is azoles such as itraconazole, but sulfonamides and amphotericin B are used in some cases despite their toxicity to mammalian cells. The current availability of treatments highlights the need to identify and characterize novel targets for antifungal treatment of PCM as well as the need to search for new antifungal compounds obtained from natural sources or by chemical synthesis. To this end, we evaluated the antifungal activity of a camphene thiosemicarbazide derivative (TSC-C compound on Paracoccidioides yeast. To determine the response of Paracoccidioides spp. to TSC-C, we analyzed the transcriptional profile of the fungus after 8 h of contact with the compound. The results demonstrate that Paracoccidioides lutzii induced the expression of genes related to metabolism; cell cycle and DNA processing; biogenesis of cellular components; cell transduction/signal; cell rescue, defense and virulence; cellular transport, transport facilities and transport routes; energy; protein synthesis; protein fate; transcription; and other proteins without classification. Additionally, we observed intensely inhibited genes related to protein synthesis. Analysis by fluorescence microscopy and flow cytometry revealed that the compound induced the production of reactive oxygen species. Using an isolate with down-regulated SOD1 gene expression (SOD1-aRNA, we sought to determine the function of this gene in the defense of Paracoccidioides yeast cells against the compound. Mutant cells were more susceptible to TSC-C, demonstrating the importance of this gene in response to the compound. The results presented herein suggest that TSC-C is a promising candidate for PCM treatment.

  15. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  16. Investigating the Mechanical Function of the Cervix during Pregnancy using Finite Element Models derived from High Resolution 3D MRI

    Fernandez, M.; House, M.; Jambawalikar, S.; Zork, N.; Vink, J.; Wapner, R.; Myers, K.

    2015-01-01

    Preterm birth is a strong contributor to perinatal mortality, and preterm infants that survive are at risk for long-term morbidities. During most of pregnancy appropriate mechanical function of the cervix is required to maintain the developing fetus in utero. Premature cervical softening and subsequent cervical shortening are hypothesized to cause preterm birth. Presently, there is a lack of understanding of the structural and material factors that influence the mechanical function of the cervix during pregnancy. In this study we build finite element (FE) models of the pregnant uterus, cervix, and fetal membrane based on magnetic resonance imagining (MRI) data in order to examine the mechanical function of the cervix under the physiologic loading conditions of pregnancy. We calculate the mechanical loading state of the cervix for two pregnant patients: 22 weeks gestational age with a normal cervical length and 28 weeks with a short cervix. We investigate the influence of 1) anatomical geometry 2) cervical material properties, and 3) fetal membrane material properties, including its adhesion properties, on the mechanical loading state of the cervix under physiologically relevant intrauterine pressures. Our study demonstrates that membrane-uterus interaction, cervical material modeling, and membrane mechanical properties are factors that must be deliberately and carefully handled in order to construct a high quality mechanical simulation of pregnancy. PMID:25970655

  17. Response of Ustilago maydis against the Stress Caused by Three Polycationic Chitin Derivatives

    Dario Rafael Olicón-Hernández

    2017-12-01

    Full Text Available Chitosan is a stressing molecule that affects the cells walls and plasma membrane of fungi. For chitosan derivatives, the action mode is not clear. In this work, we used the yeast Ustilago maydis to study the effects of these molecules on the plasma membrane, focusing on physiologic and stress responses to chitosan (CH, oligochitosan (OCH, and glycol-chitosan (GCH. Yeasts were cultured with each of these molecules at 1 mg·mL−1 in minimal medium. To compare plasma membrane damage, cells were cultivated in isosmolar medium. Membrane potential (Δψ as well as oxidative stress were measured. Changes in the total plasma membrane phospholipid and protein profiles were analyzed using standard methods, and fluorescence-stained mitochondria were observed. High osmolarity did not protect against CH inhibition and neither affected membrane potential. The OCH did produce higher oxidative stress. The effects of these molecules were evidenced by modifications in the plasma membrane protein profile. Also, mitochondrial damage was evident for CH and OCH, while GCH resulted in thicker cells with fewer mitochondria and higher glycogen accumulation.

  18. Ibrutinib enhances IL-17 response by modulating the function of bone marrow derived dendritic cells.

    Natarajan, Gayathri; Terrazas, Cesar; Oghumu, Steve; Varikuti, Sanjay; Dubovsky, Jason A; Byrd, John C; Satoskar, Abhay R

    Ibrutinib (PCI-32765) is an irreversible dual Btk/Itk inhibitor shown to be effective in treating several B cell malignancies. However, limited studies have been conducted to study the effect of this drug on myeloid cell function. Hence, we studied the effect of ibrutinib treatment on TLR-4 mediated activation of bone marrow derived dendritic cell culture (DCs). Upon ibrutinib treatment, LPS-treated DCs displayed lower synthesis of TNF-α and nitric oxide (NO) and higher induction of IL-6, TGF-β, IL-10 and IL-18. While ibrutinib dampened MHC-II and CD86 expression on DCs, CD80 expression was upregulated. Further, ibrutinib-treated DCs promoted T cell proliferation and enhanced IL-17 production upon co-culture with nylon wool enriched T cells. Taken together, our results indicate that ibrutinib modulates TLR-4 mediated DC activation to promote an IL-17 response. We describe a novel mode of action for ibrutinib on DCs which should be explored to treat other forms of cancer besides B cell malignancies.

  19. Phenotypic responses to interspecies competition and commensalism in a naturally-derived microbial co-culture

    Khan, Nymul; Maezato, Yukari; McClure, Ryan S.; Brislawn, Colin J.; Mobberley, Jennifer M.; Isern, Nancy; Chrisler, William B.; Markillie, Lye Meng; Barney, Brett M.; Song, Hyun-Seob; Nelson, William C.; Bernstein, Hans C.

    2018-01-10

    The fundamental question of whether different microbial species will co-exist or compete in a given environment depends on context, composition and environmental constraints. Model microbial systems can yield some general principles related to this question. In this study we employed a naturally occurring co-culture composed of heterotrophic bacteria, Halomonas sp. HL-48 and Marinobacter sp. HL-58, to ask two fundamental scientific questions: 1) how do the phenotypes of two naturally co-existing species respond to partnership as compared to axenic growth? and 2) how do growth and molecular phenotypes of these species change with respect to competitive and commensal interactions? We hypothesized – and confirmed – that co-cultivation under glucose as the sole carbon source would result in a competitive interactions. Similarly, when glucose was swapped with xylose, the interactions became commensal because Marinobacter HL-58 was supported by metabolites derived from Halomonas HL-48. Each species responded to partnership by changing both its growth and molecular phenotype as assayed via batch growth kinetics and global transcriptomics. These phenotypic responses depended nutrient availability and so the environment ultimately controlled how they responded to each other. This simplified model community revealed that microbial interactions are context-specific and different environmental conditions dictate how interspecies partnerships will unfold.

  20. Root maturation and dentin–pulp response to enamel matrix derivative in pulpotomized permanent teeth

    Sherif S Darwish

    2014-01-01

    Full Text Available The success of pulpotomy of young permanent teeth depends on the proper selection of dressing materials. This study aimed to evaluate the histological and histomorphometric response of dentin–pulp complex to the enamel matrix derivative (Emdogain® gel compared to that of calcium hydroxide when used as a pulp dressing in immature young permanent dogs’ teeth. Dentin-like tissues bridging the full width of the coronal pulp at the interface between the injured and healthy pulp tissues were seen after 1 month in both groups. With time, the dentin bridge increased in thickness for calcium hydroxide but disintegrated and fully disappeared for Emdogain-treated group. Progressive inflammation and total pulp degeneration were only evident with Emdogain-treated group. The root apices of Emdogain-treated teeth became matured and closed by cementum that attached to new alveolar bone by a well-oriented periodontal ligament. In young permanent dentition, Emdogain could be a good candidate for periodontium but not dentino–pulpal complex regeneration.

  1. Dietary flavonoid derivatives enhance chemotherapeutic effect by inhibiting the DNA damage response pathway

    Kuo, Ching-Ying; Zupkó, István; Chang, Fang-Rong; Hunyadi, Attila; Wu, Chin-Chung; Weng, Teng-Song; Wang, Hui-Chun

    2016-01-01

    Flavonoids are the most common group of polyphenolic compounds and abundant in dietary fruits and vegetables. Diet high in vegetables or dietary flavonoid supplements is associated with reduced mortality rate for patients with breast cancer. Many studies have been proposed for mechanisms linking flavonoids to improving chemotherapy efficacy in many types of cancers, but data on this issue is still limited. Herein, we report on a new mechanism through which dietary flavonoids inhibit DNA damage checkpoints and repair pathways. We found that dietary flavonoids could inhibit Chk1 phosphorylation and decrease clonogenic cell growth once breast cancer cells receive ultraviolet irradiation, cisplatin, or etoposide treatment. Since the ATR-Chk1 pathway mainly involves response to DNA replication stress, we propose that flavonoid derivatives reduce the side effect of chemotherapy by improving the sensitivity of cycling cells. Therefore, we propose that increasing intake of common dietary flavonoids is beneficial to breast cancer patients who are receiving DNA-damaging chemotherapy, such as cisplatin or etoposide-based therapy. - Highlights: • First report on inhibition of both DNA damage and repair by dietary flavonoids • Dietary flavonoids inhibit cisplatin- and UV-induced Chk1 phosphorylation. • Flavonoids combined with cisplatin or UV treatment show notable growth inhibition. • Promising treatment proposal for patients who are receiving adjuvant chemotherapy

  2. Molecular profiling of prostate cancer derived exosomes may reveal a predictive signature for response to docetaxel.

    Kharaziha, Pedram; Chioureas, Dimitris; Rutishauser, Dorothea; Baltatzis, George; Lennartsson, Lena; Fonseca, Pedro; Azimi, Alireza; Hultenby, Kjell; Zubarev, Roman; Ullén, Anders; Yachnin, Jeffrey; Nilsson, Sten; Panaretakis, Theocharis

    2015-08-28

    Docetaxel is a cornerstone treatment for metastatic, castration resistant prostate cancer (CRPC) which remains a leading cause of cancer-related deaths, worldwide. The clinical usage of docetaxel has resulted in modest gains in survival, primarily due to the development of resistance. There are currently no clinical biomarkers available that predict whether a CRPC patient will respond or acquire resistance to this therapy. Comparative proteomics analysis of exosomes secreted from DU145 prostate cancer cells that are sensitive (DU145 Tax-Sen) or have acquired resistance (DU145 Tax-Res) to docetaxel, demonstrated significant differences in the amount of exosomes secreted and in their molecular composition. A panel of proteins was identified by proteomics to be differentially enriched in DU145 Tax-Res compared to DU145 Tax-Sen exosomes and was validated by western blotting. Importantly, we identified MDR-1, MDR-3, Endophilin-A2 and PABP4 that were enriched only in DU145 Tax-Res exosomes. We validated the presence of these proteins in the serum of a small cohort of patients. DU145 cells that have uptaken DU145 Tax-Res exosomes show properties of increased matrix degradation. In summary, exosomes derived from DU145 Tax-Res cells may be a valuable source of biomarkers for response to therapy.

  3. Inhibition of the mitogenic response to platelet-derived growth factor by terbinafine

    St Denny, I.H.; Glinka, K.G.; Nemecek, G.M.; Stuetz, A.

    1987-01-01

    Terbinafine (T;(E)-N-(6,6-dimethyl-2-hepten-4-ynyl)-N-methyl-1-naphthalenemethanamine), an antimycotic which inhibits fungal squalene epoxidase activity, was examined for its effects on platelet-derived growth factor (PDGF)-stimulated mitogenesis. The inclusion of 1.5-5μM T in fibroblast incubation media was associated with increased [ 3 H]thymidine incorporation into DNA in the presence and absence of PDGF. However, T at concentrations above 6μM reduced DNA synthesis in control and PDGF-exposed cultures to nearly undetectable levels. Under a phase-contrast microscope, fibroblasts appeared morphologically normal at T concentrations as high as 25 μM. Neither the uptake of [ 3 H]thymidine nor the specific binding of 125 I-PDGF to fibroblast receptors was significantly affected by 10 μM T. Furthermore, concentrations of T which antagonized the mitogenic response to PDGF also interfered with fibroblast growth factor-induced mitogenesis. Together, these data suggest that T has the ability to inhibit the in vitro action of PDGF via a post-receptor mechanism

  4. Inhibition of the mitogenic response to platelet-derived growth factor by terbinafine

    St. Denny, I.H.; Glinka, K.G.; Nemecek, G.M. (Sandoz Research Institute, East Hanover, NJ (USA)); Stuetz, A. (Sandoz Forschungsinstitut, Vienna (Austria))

    1987-05-01

    Terbinafine (T;(E)-N-(6,6-dimethyl-2-hepten-4-ynyl)-N-methyl-1-naphthalenemethanamine), an antimycotic which inhibits fungal squalene epoxidase activity, was examined for its effects on platelet-derived growth factor (PDGF)-stimulated mitogenesis. The inclusion of 1.5-5{mu}M T in fibroblast incubation media was associated with increased ({sup 3}H)thymidine incorporation into DNA in the presence and absence of PDGF. However, T at concentrations above 6{mu}M reduced DNA synthesis in control and PDGF-exposed cultures to nearly undetectable levels. Under a phase-contrast microscope, fibroblasts appeared morphologically normal at T concentrations as high as 25 {mu}M. Neither the uptake of ({sup 3}H)thymidine nor the specific binding of {sup 125}I-PDGF to fibroblast receptors was significantly affected by 10 {mu}M T. Furthermore, concentrations of T which antagonized the mitogenic response to PDGF also interfered with fibroblast growth factor-induced mitogenesis. Together, these data suggest that T has the ability to inhibit the in vitro action of PDGF via a post-receptor mechanism.

  5. Dietary flavonoid derivatives enhance chemotherapeutic effect by inhibiting the DNA damage response pathway

    Kuo, Ching-Ying [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Zupkó, István [Department of Pharmacodynamics and Biopharmacy, University of Szeged, Eötvös Utca 6, Szeged H-6720 (Hungary); Chang, Fang-Rong [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Hunyadi, Attila [Institute of Pharmacognosy, Faculty of Pharmacy, University of Szeged, Eötvös Utca 6, Szeged H-6720 (Hungary); Wu, Chin-Chung; Weng, Teng-Song [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Wang, Hui-Chun, E-mail: wanghc@kmu.edu.tw [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); PhD Program in Translational Medicine, College of Medicine and PhD Program in Toxicology, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Research Center for Natural Product and Drug Development, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Translational Research Center and Cancer Center, Kaohsiung Medical University Hospital, Kaohsiung 80756, Taiwan (China); Department of Marine Biotechnology and Resources, National Sun Yat-Sen University, Kaohsiung 80424, Taiwan (China); Department of Fragrance and Cosmetic Science, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2016-11-15

    Flavonoids are the most common group of polyphenolic compounds and abundant in dietary fruits and vegetables. Diet high in vegetables or dietary flavonoid supplements is associated with reduced mortality rate for patients with breast cancer. Many studies have been proposed for mechanisms linking flavonoids to improving chemotherapy efficacy in many types of cancers, but data on this issue is still limited. Herein, we report on a new mechanism through which dietary flavonoids inhibit DNA damage checkpoints and repair pathways. We found that dietary flavonoids could inhibit Chk1 phosphorylation and decrease clonogenic cell growth once breast cancer cells receive ultraviolet irradiation, cisplatin, or etoposide treatment. Since the ATR-Chk1 pathway mainly involves response to DNA replication stress, we propose that flavonoid derivatives reduce the side effect of chemotherapy by improving the sensitivity of cycling cells. Therefore, we propose that increasing intake of common dietary flavonoids is beneficial to breast cancer patients who are receiving DNA-damaging chemotherapy, such as cisplatin or etoposide-based therapy. - Highlights: • First report on inhibition of both DNA damage and repair by dietary flavonoids • Dietary flavonoids inhibit cisplatin- and UV-induced Chk1 phosphorylation. • Flavonoids combined with cisplatin or UV treatment show notable growth inhibition. • Promising treatment proposal for patients who are receiving adjuvant chemotherapy.

  6. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  7. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  8. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  9. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  10. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  11. An empirically-derived approach for investigating Health Information Technology: the Elementally Entangled Organisational Communication (EEOC) framework.

    Georgiou, Andrew; Westbrook, Johanna I; Braithwaite, Jeffrey

    2012-07-12

    The purpose of this paper is to illustrate the Elementally Entangled Organisational Communication (EEOC) framework by drawing on a set of three case studies which assessed the impact of new Health Information Technology (HIT) on a pathology service. The EEOC framework was empirically developed as a tool to tackle organisational communication challenges in the implementation and evaluation of health information systems. The framework was synthesised from multiple research studies undertaken across a major metropolitan hospital pathology service during the period 2005 to 2008. These studies evaluated the impact of new HIT systems in pathology departments (Laboratory Information System) and an Emergency Department (Computerised Provider Order Entry) located in Sydney, Australia. Key dimensions of EEOC are illustrated by the following case studies: 1) the communication infrastructure between the Blood Bank and the ward for the coordination and distribution of blood products; 2) the organisational environment in the Clinical Chemistry and Haematology departments and their attempts to organise, plan and control the processing of laboratory specimens; and 3) the temporal make up of the organisation as revealed in changes to the way the Central Specimen Reception allocated, sequenced and synchronised work tasks. The case studies not only highlight the pre-existing communication architecture within the organisation but also the constitutive role communication plays in the way organisations go about addressing their requirements. HIT implementation involves a mutual transformation of the organisation and the technology. This is a vital consideration because of the dangers associated with poor organisational planning and implementation of HIT, and the potential for unintended adverse consequences, workarounds and risks to the quality and safety of patient care. The EEOC framework aims to account for the complex range of contextual factors and triggers that play a role in the

  12. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  13. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  15. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  16. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  17. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  18. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  19. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  20. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  1. Plant-derived pectin nanocoatings to prevent inflammatory cellular response of osteoblasts following Porphyromonas gingivalis infection

    Meresta A

    2017-01-01

    Full Text Available Anna Meresta,1 Justyna Folkert,1 Timo Gaber,2 Korneliusz Miksch,1 Frank Buttgereit,2 Jacqueline Detert,2 Nicole Pischon,3,* Katarzyna Gurzawska3,4,* 1Environmental Biotechnology Department, Faculty of Power and Environmental, Silesian University of Technology, Gliwice, Poland; 2Department of Rheumatology and Clinical Immunology, 3Department of Periodontology, Charité University Medicine, Berlin, Germany; 4Oral Surgery Department, The School of Dentistry, University of Birmingham, Birmingham, UK *These authors contributed equally to this work Background: Bioengineered plant-derived Rhamnogalacturonan-Is (RG-Is from pectins are potential candidates for surface nanocoating of medical devices. It has recently been reported that RG-I nanocoatings may prevent bacterial infection and improve the biocompatibility of implants. The aim of the study was to evaluate in vitro impact of bioengineered RG-I nanocoatings on osteogenic capacity and proinflammatory cytokine response of murine osteoblasts following Porphyromonas gingivalis infection.Methods: Murine MC3T3-E1 osteoblasts and isolated primary calvarial osteoblasts from C57BL/6J (B6J osteoblasts mice were infected with P. gingivalis and incubated on tissue culture polystyrene plates with or without nanocoatings of unmodified RG-Is isolated from potato pulps (PU or dearabinanated RG-Is (PA. To investigate a behavior of infected osteoblasts cultured on RG-Is cell morphology, proliferation, metabolic activity, mineralization and osteogenic and pro-inflammatory gene expression were examined.Results: Following P. gingivalis infection, PA, but not PU, significantly promoted MC3T3-E1 and BJ6 osteoblasts proliferation, metabolic activity, and calcium deposition. Moreover, Il-1b, Il-6, TNF-α, and Rankl gene expressions were downregulated in cells cultured on PU and to a higher extent on PA as compared to the corresponding control, whereas Runx, Alpl, Col1a1, and Bglap gene expressions were upregulated vice

  2. Fibroblasts derived from human pluripotent stem cells activate angiogenic responses in vitro and in vivo.

    Yulia Shamis

    Full Text Available Human embryonic and induced pluripotent stem cells (hESC/hiPSC are promising cell sources for the derivation of large numbers of specific cell types for tissue engineering and cell therapy applications. We have describe a directed differentiation protocol that generates fibroblasts from both hESC and hiPSC (EDK/iPDK that support the repair and regeneration of epithelial tissue in engineered, 3D skin equivalents. In the current study, we analyzed the secretory profiles of EDK and iPDK cells to investigate the production of factors that activate and promote angiogenesis. Analysis of in vitro secretion profiles from EDK and iPDK cells demonstrated the elevated secretion of pro-angiogenic soluble mediators, including VEGF, HGF, IL-8, PDGF-AA, and Ang-1, that stimulated endothelial cell sprouting in a 3D model of angiogenesis in vitro. Phenotypic analysis of EDK and iPDK cells during the course of differentiation from hESCs and iPSCs revealed that both cell types progressively acquired pericyte lineage markers NG2, PDGFRβ, CD105, and CD73 and demonstrated transient induction of pericyte progenitor markers CD31, CD34, and Flk1/VEGFR2. Furthermore, when co-cultured with endothelial cells in 3D fibrin-based constructs, EDK and iPDK cells promoted self-assembly of vascular networks and vascular basement membrane deposition. Finally, transplantation of EDK cells into mice with hindlimb ischemia significantly reduced tissue necrosis and improved blood perfusion, demonstrating the potential of these cells to stimulate angiogenic responses in vivo. These findings demonstrate that stable populations of pericyte-like angiogenic cells can be generated with high efficiency from hESC and hiPSC using a directed differentiation approach. This provides new cell sources and opportunities for vascular tissue engineering and for the development of novel strategies in regenerative medicine.

  3. Assessment of Brain Derived Neurotrophic Factor in hair to study stress responses: A pilot investigation.

    Harb, H; González-de-la-Vara, M; Thalheimer, L; Klein, U; Renz, H; Rose, M; Kruse, J; Potaczek, D P; Peters, E M J

    2017-12-01

    To study pathogenic stress-effects in health and disease, it is paramount to define easy access parameters for non-invasive analysis of biological change in response to stress. Hair samples successfully provide this access for the study of hypothalamus-pituitary-adrenal axis (HPA) changes. In this study, we assess the hair expression and corresponding epigenetic changes of a neurotrophin essential for autonomic nervous system function and mental health: brain derived neurotrophic factor (BDNF). In three independent studies in healthy academic volunteers (study I: German students, N=36; study II, German academic population sample, N=28; study III: Mexican students, N=115), BDNF protein expression or BDNF gene (BDNF) histone acetylation was determined. Simultaneously, mental distress and distress-associated somatic complaints were assessed by self-report. In study I, we found a negative correlation between hair-BDNF protein level and hair-cortisol as well as between hair-BDNF and somatic complaints, while hair-cortisol correlated positively with mental distress. In study II, we found a negative correlation between H4 histone acetylation at the BDNF gene P4-promoter and somatic complaints. Regression analysis confirmed confounder stability of associations in both studies. In study III, we confirmed study I and found lower hair-BDNF protein level in volunteers with high somatic complaints, who also reported higher mental distress during the end of term exams. The results indicate that BDNF protein levels can be detected in clipped hair and are associated with somatic complaints and stress in life. In addition, we concluded that plucked hair can provide material for the study of epigenetic changes in stress-affected tissues. These tools can prove valuable for future studies on distress, both under experimental and field conditions. Copyright © 2017. Published by Elsevier Ltd.

  4. Molecular Mechanisms Responsible for Neuron-Derived Conditioned Medium (NCM-Mediated Protection of Ischemic Brain.

    Chi-Hsin Lin

    Full Text Available The protective value of neuron-derived conditioned medium (NCM in cerebral ischemia and the underlying mechanism(s responsible for NCM-mediated brain protection against cerebral ischemia were investigated in the study. NCM was first collected from the neuronal culture growing under the in vitro ischemic condition (glucose-, oxygen- and serum-deprivation or GOSD for 2, 4 or 6 h. Through the focal cerebral ischemia (bilateral CCAO/unilateral MCAO animal model, we discovered that ischemia/reperfusion (I/R-induced brain infarction was significantly reduced by NCM, given directly into the cistern magna at the end of 90 min of CCAO/MCAO. Immunoblocking and chemical blocking strategies were applied in the in vitro ischemic studies to show that NCM supplement could protect microglia, astrocytes and neurons from GOSD-induced cell death, in a growth factor (TGFβ1, NT-3 and GDNF and p-ERK dependent manner. Brain injection with TGFβ1, NT3, GDNF and ERK agonist (DADS alone or in combination, therefore also significantly decreased the infarct volume of ischemic brain. Moreover, NCM could inhibit ROS but stimulate IL-1β release from GOSD-treated microglia and limit the infiltration of IL-β-positive microglia into the core area of ischemic brain, revealing the anti-oxidant and anti-inflammatory activities of NCM. In overall, NCM-mediated brain protection against cerebral ischemia has been demonstrated for the first time in S.D. rats, due to its anti-apoptotic, anti-oxidant and potentially anti-glutamate activities (NCM-induced IL-1β can inhibit the glutamate-mediated neurotoxicity and restriction upon the infiltration of inflammatory microglia into the core area of ischemic brain. The therapeutic potentials of NCM, TGFβ1, GDNF, NT-3 and DADS in the control of cerebral ischemia in human therefore have been suggested and require further investigation.

  5. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  6. Response analysis of a class of quasi-linear systems with fractional derivative excited by Poisson white noise

    Yang, Yongge; Xu, Wei; Yang, Guidong; Jia, Wantao

    2016-08-01

    The Poisson white noise, as a typical non-Gaussian excitation, has attracted much attention recently. However, little work was referred to the study of stochastic systems with fractional derivative under Poisson white noise excitation. This paper investigates the stationary response of a class of quasi-linear systems with fractional derivative excited by Poisson white noise. The equivalent stochastic system of the original stochastic system is obtained. Then, approximate stationary solutions are obtained with the help of the perturbation method. Finally, two typical examples are discussed in detail to demonstrate the effectiveness of the proposed method. The analysis also shows that the fractional order and the fractional coefficient significantly affect the responses of the stochastic systems with fractional derivative.

  7. Response analysis of a class of quasi-linear systems with fractional derivative excited by Poisson white noise

    Yang, Yongge; Xu, Wei; Yang, Guidong; Jia, Wantao

    2016-01-01

    The Poisson white noise, as a typical non-Gaussian excitation, has attracted much attention recently. However, little work was referred to the study of stochastic systems with fractional derivative under Poisson white noise excitation. This paper investigates the stationary response of a class of quasi-linear systems with fractional derivative excited by Poisson white noise. The equivalent stochastic system of the original stochastic system is obtained. Then, approximate stationary solutions are obtained with the help of the perturbation method. Finally, two typical examples are discussed in detail to demonstrate the effectiveness of the proposed method. The analysis also shows that the fractional order and the fractional coefficient significantly affect the responses of the stochastic systems with fractional derivative.

  8. Generation of glucose-responsive, insulin-producing cells from human umbilical cord blood-derived mesenchymal stem cells.

    Prabakar, Kamalaveni R; Domínguez-Bendala, Juan; Molano, R Damaris; Pileggi, Antonello; Villate, Susana; Ricordi, Camillo; Inverardi, Luca

    2012-01-01

    We sought to assess the potential of human cord blood-derived mesenchymal stem cells (CB-MSCs) to derive insulin-producing, glucose-responsive cells. We show here that differentiation protocols based on stepwise culture conditions initially described for human embryonic stem cells (hESCs) lead to differentiation of cord blood-derived precursors towards a pancreatic endocrine phenotype, as assessed by marker expression and in vitro glucose-regulated insulin secretion. Transplantation of these cells in immune-deficient animals shows human C-peptide production in response to a glucose challenge. These data suggest that human cord blood may be a promising source for regenerative medicine approaches for the treatment of diabetes mellitus.

  9. Response analysis of a class of quasi-linear systems with fractional derivative excited by Poisson white noise

    Yang, Yongge; Xu, Wei, E-mail: weixu@nwpu.edu.cn; Yang, Guidong; Jia, Wantao [Department of Applied Mathematics, Northwestern Polytechnical University, Xi' an 710072 (China)

    2016-08-15

    The Poisson white noise, as a typical non-Gaussian excitation, has attracted much attention recently. However, little work was referred to the study of stochastic systems with fractional derivative under Poisson white noise excitation. This paper investigates the stationary response of a class of quasi-linear systems with fractional derivative excited by Poisson white noise. The equivalent stochastic system of the original stochastic system is obtained. Then, approximate stationary solutions are obtained with the help of the perturbation method. Finally, two typical examples are discussed in detail to demonstrate the effectiveness of the proposed method. The analysis also shows that the fractional order and the fractional coefficient significantly affect the responses of the stochastic systems with fractional derivative.

  10. Stochastic response of van der Pol oscillator with two kinds of fractional derivatives under Gaussian white noise excitation

    Yang Yong-Ge; Xu Wei; Sun Ya-Hui; Gu Xu-Dong

    2016-01-01

    This paper aims to investigate the stochastic response of the van der Pol (VDP) oscillator with two kinds of fractional derivatives under Gaussian white noise excitation. First, the fractional VDP oscillator is replaced by an equivalent VDP oscillator without fractional derivative terms by using the generalized harmonic balance technique. Then, the stochastic averaging method is applied to the equivalent VDP oscillator to obtain the analytical solution. Finally, the analytical solutions are validated by numerical results from the Monte Carlo simulation of the original fractional VDP oscillator. The numerical results not only demonstrate the accuracy of the proposed approach but also show that the fractional order, the fractional coefficient and the intensity of Gaussian white noise play important roles in the responses of the fractional VDP oscillator. An interesting phenomenon we found is that the effects of the fractional order of two kinds of fractional derivative items on the fractional stochastic systems are totally contrary. (paper)

  11. Effect of sodium butyrate treatment on the granule morphology, histamine level and elemental content of the bone marrow-derived mast cell

    Rydzynski, K. [Inst. of Occupational Medicine, Lodz (Poland); Dalen, H. [Bergen Univ. (Norway)

    1994-12-31

    Mast cells derived from the bone marrow of BALB/c mice (BMMC) were cultures and their growth ceased with sodium butyrate. Sodium butyrate treatment (1 mM, 4 days) caused maturation of the granules, and increased histamine content from approx. 1 pg/cell to 4 pg/cell. X-ray microanalysis revealed that maturation of the granules was accompanied by the increase in relative weight percent of sodium, phosphorus and sulphur, with concomitant decrease in chloride. The sulphur to potassium ratio increased three-fold in butyrate-treated mast cells. The existence of a different elemental composition during mast cell maturation may provide additional parameter for rapid discrimination of mast cell subpopulations. (author). 28 refs, 6 figs.

  12. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  13. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  14. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  16. CHARACTERIZING THE HEAVY ELEMENTS IN GLOBULAR CLUSTER M22 AND AN EMPIRICAL s-PROCESS ABUNDANCE DISTRIBUTION DERIVED FROM THE TWO STELLAR GROUPS

    Roederer, I. U.; Marino, A. F.; Sneden, C.

    2011-01-01

    We present an empirical s-process abundance distribution derived with explicit knowledge of the r-process component in the low-metallicity globular cluster M22. We have obtained high-resolution, high signal-to-noise spectra for six red giants in M22 using the Magellan Inamori Kyocera Echelle spectrograph on the Magellan-Clay Telescope at Las Campanas Observatory. In each star we derive abundances for 44 species of 40 elements, including 24 elements heavier than zinc (Z = 30) produced by neutron-capture reactions. Previous studies determined that three of these stars (the 'r+s group') have an enhancement of s-process material relative to the other three stars (the 'r-only group'). We confirm that the r+s group is moderately enriched in Pb relative to the r-only group. Both groups of stars were born with the same amount of r-process material, but s-process material was also present in the gas from which the r+s group formed. The s-process abundances are inconsistent with predictions for asymptotic giant branch (AGB) stars with M ≤ 3 M ☉ and suggest an origin in more massive AGB stars capable of activating the 22 Ne(α,n) 25 Mg reaction. We calculate the s-process 'residual' by subtracting the r-process pattern in the r-only group from the abundances in the r+s group. In contrast to previous r- and s-process decompositions, this approach makes no assumptions about the r- and s-process distributions in the solar system and provides a unique opportunity to explore s-process yields in a metal-poor environment.

  17. Characterizing the Heavy Elements in Globular Cluster M22 and an Empirical s-process Abundance Distribution Derived from the Two Stellar Groups

    Roederer, I. U.; Marino, A. F.; Sneden, C.

    2011-11-01

    We present an empirical s-process abundance distribution derived with explicit knowledge of the r-process component in the low-metallicity globular cluster M22. We have obtained high-resolution, high signal-to-noise spectra for six red giants in M22 using the Magellan Inamori Kyocera Echelle spectrograph on the Magellan-Clay Telescope at Las Campanas Observatory. In each star we derive abundances for 44 species of 40 elements, including 24 elements heavier than zinc (Z = 30) produced by neutron-capture reactions. Previous studies determined that three of these stars (the "r+s group") have an enhancement of s-process material relative to the other three stars (the "r-only group"). We confirm that the r+s group is moderately enriched in Pb relative to the r-only group. Both groups of stars were born with the same amount of r-process material, but s-process material was also present in the gas from which the r+s group formed. The s-process abundances are inconsistent with predictions for asymptotic giant branch (AGB) stars with M <= 3 M ⊙ and suggest an origin in more massive AGB stars capable of activating the 22Ne(α,n)25Mg reaction. We calculate the s-process "residual" by subtracting the r-process pattern in the r-only group from the abundances in the r+s group. In contrast to previous r- and s-process decompositions, this approach makes no assumptions about the r- and s-process distributions in the solar system and provides a unique opportunity to explore s-process yields in a metal-poor environment. This paper includes data gathered with the 6.5 m Magellan Telescopes located at Las Campanas Observatory, Chile.

  18. Serum brain-derived neurotrophic factor and glucocorticoid receptor levels in lymphocytes as markers of antidepressant response in major depressive patients: a pilot study.

    Rojas, Paulina Soledad; Fritsch, Rosemarie; Rojas, Romina Andrea; Jara, Pablo; Fiedler, Jenny Lucy

    2011-09-30

    Depressive patients often have altered cortisol secretion, an effect that likely derives from impaired activity of the glucocorticoid receptor (GR), the main regulator of the hypothalamus-pituitary-adrenal (HPA) axis. Glucocorticoids reduce the levels of brain-derived neurotrophic factor (BDNF), a downstream target of antidepressants. Antidepressants promote the transcriptional activity of cyclic adenosine monophosphate (cAMP) response element binding protein (CREB), a regulator of BDNF expression. To identify potential biomarkers for the onset of antidepressant action in depressive patients, GR and phospho-CREB (pCREB) levels in lymphocytes and serum BDNF levels were repeatedly measured during the course of antidepressant treatment. Thirty-four depressed outpatients (10 male and 24 female) were treated with venlafaxine (75mg/day), and individuals exhibiting a 50% reduction in their baseline 17-Item Hamilton Depression Rating Scale score by the 6th week of treatment were considered responders. Responders showed an early improvement in parallel with a rise in BDNF levels during the first two weeks of treatment. Non-responders showed increased GR levels by the third week and reduced serum BDNF by the sixth week of treatment. In contrast, venlafaxine did not affect levels of pCREB. We conclude that levels of BDNF in serum and GR levels in lymphocytes may represent biomarkers that could be used to predict responses to venlafaxine treatment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  1. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  2. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  3. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  4. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  5. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  6. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  7. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  8. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  9. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  10. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  11. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  12. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  13. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  14. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  15. δ-Tocotrienol Oxazine Derivative Antagonizes Mammary Tumor Cell Compensatory Response to CoCl2-Induced Hypoxia

    Suryatheja Ananthula

    2014-01-01

    Full Text Available In response to low oxygen supply, cancer cells elevate production of HIF-1α, a hypoxia-inducible transcription factor that subsequently acts to stimulate blood vessel formation and promote survival. Studies were conducted to determine the role of δ-tocotrienol and a semisynthetic δ-tocotrienol oxazine derivative, compound 44, on +SA mammary tumor cell hypoxic response. Treatment with 150 µM CoCl2 induced a hypoxic response in +SA mammary tumor cells as evidenced by a large increase in HIF-1α levels, and combined treatment with compound 44 attenuated this response. CoCl2-induced hypoxia was also associated with a large increase in Akt/mTOR signaling, activation of downstream targets p70S6K and eIF-4E1, and a significant increase in VEGF production, and combined treatment with compound 44 blocked this response. Additional in vivo studies showed that intralesional treatment with compound 44 in BALB/c mice bearing +SA mammary tumors significantly decreased the levels of HIF-1α, and this effect was associated with a corresponding decrease in Akt/mTOR signaling and activation of downstream targets p70S6kinase and eIF-4E1. These findings demonstrate that treatment with the δ-tocotrienol oxazine derivative, compound 44, significantly attenuates +SA mammary tumor cell compensatory responses to hypoxia and suggests that this compound may provide benefit in the treatment of rapidly growing solid breast tumors.

  16. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  17. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  18. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  19. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  20. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  1. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  2. Stochastic responses of Van der Pol vibro-impact system with fractional derivative damping excited by Gaussian white noise

    Xiao, Yanwen; Xu, Wei, E-mail: weixu@nwpu.edu.cn; Wang, Liang [Department of Applied Mathematics, Northwestern Polytechnical University, Xi' an 710072 (China)

    2016-03-15

    This paper focuses on the study of the stochastic Van der Pol vibro-impact system with fractional derivative damping under Gaussian white noise excitation. The equations of the original system are simplified by non-smooth transformation. For the simplified equation, the stochastic averaging approach is applied to solve it. Then, the fractional derivative damping term is facilitated by a numerical scheme, therewith the fourth-order Runge-Kutta method is used to obtain the numerical results. And the numerical simulation results fit the analytical solutions. Therefore, the proposed analytical means to study this system are proved to be feasible. In this context, the effects on the response stationary probability density functions (PDFs) caused by noise excitation, restitution condition, and fractional derivative damping are considered, in addition the stochastic P-bifurcation is also explored in this paper through varying the value of the coefficient of fractional derivative damping and the restitution coefficient. These system parameters not only influence the response PDFs of this system but also can cause the stochastic P-bifurcation.

  3. Stochastic responses of Van der Pol vibro-impact system with fractional derivative damping excited by Gaussian white noise.

    Xiao, Yanwen; Xu, Wei; Wang, Liang

    2016-03-01

    This paper focuses on the study of the stochastic Van der Pol vibro-impact system with fractional derivative damping under Gaussian white noise excitation. The equations of the original system are simplified by non-smooth transformation. For the simplified equation, the stochastic averaging approach is applied to solve it. Then, the fractional derivative damping term is facilitated by a numerical scheme, therewith the fourth-order Runge-Kutta method is used to obtain the numerical results. And the numerical simulation results fit the analytical solutions. Therefore, the proposed analytical means to study this system are proved to be feasible. In this context, the effects on the response stationary probability density functions (PDFs) caused by noise excitation, restitution condition, and fractional derivative damping are considered, in addition the stochastic P-bifurcation is also explored in this paper through varying the value of the coefficient of fractional derivative damping and the restitution coefficient. These system parameters not only influence the response PDFs of this system but also can cause the stochastic P-bifurcation.

  4. An inverse method based on finite element model to derive the plastic flow properties from non-standard tensile specimens of Eurofer97 steel

    S. Knitel

    2016-12-01

    Full Text Available A new inverse method was developed to derive the plastic flow properties of non-standard disk tensile specimens, which were so designed to fit irradiation rods used for spallation irradiations in SINQ (Schweizer Spallations Neutronen Quelle target at Paul Scherrer Institute. The inverse method, which makes use of MATLAB and the finite element code ABAQUS, is based upon the reconstruction of the load-displacement curve by a succession of connected small linear segments. To do so, the experimental engineering stress/strain curve is divided into an elastic and a plastic section, and the plastic section is further divided into small segments. Each segment is then used to determine an associated pair of true stress/plastic strain values, representing the constitutive behavior. The main advantage of the method is that it does not rely on a hypothetic analytical expression of the constitutive behavior. To account for the stress/strain gradients that develop in the non-standard specimen, the stress and strain were weighted over the volume of the deforming elements. The method was validated with tensile tests carried out at room temperature on non-standard flat disk tensile specimens as well as on standard cylindrical specimens made of the reduced-activation tempered martensitic steel Eurofer97. While both specimen geometries presented a significant difference in terms of deformation localization during necking, the same true stress/strain curve was deduced from the inverse method. The potential and usefulness of the inverse method is outlined for irradiated materials that suffer from a large uniform elongation reduction.

  5. Identification of a cyclin B1-derived CTL epitope eliciting spontaneous responses in both cancer patients and healthy donors

    Andersen, Rikke Sick; Sørensen, Rikke Bæk; Ritter, Cathrin

    2011-01-01

    . Furthermore, blood from cancer patients and healthy donors was screened for spontaneous T-cell reactivity against the peptide in IFN-γ ELISPOT assays. Patients with breast cancer, malignant melanoma, or renal cell carcinoma hosted powerful and high-frequency T-cell responses against the peptide. In addition......, when blood from healthy donors was tested, similar responses were observed. Ultimately, serum from cancer patients and healthy donors was analyzed for anti-cyclin B1 antibodies. Humoral responses against cyclin B1 were frequently detected in both cancer patients and healthy donors. In conclusion......, a high-affinity cyclin B1-derived HLA-A2-restricted CTL epitope was identified, which was presented on the cell surface of cancer cells, and elicited spontaneous T-cell responses in cancer patients and healthy donors....

  6. Identification of a cyclin B1-derived CTL epitope eliciting spontaneous responses in both cancer patients and healthy donors

    Andersen, Rikke Sick; Sørensen, Rikke Bæk; Ritter, Cathrin

    2011-01-01

    . Furthermore, blood from cancer patients and healthy donors was screened for spontaneous T-cell reactivity against the peptide in IFN-¿ ELISPOT assays. Patients with breast cancer, malignant melanoma, or renal cell carcinoma hosted powerful and high-frequency T-cell responses against the peptide. In addition......, when blood from healthy donors was tested, similar responses were observed. Ultimately, serum from cancer patients and healthy donors was analyzed for anti-cyclin B1 antibodies. Humoral responses against cyclin B1 were frequently detected in both cancer patients and healthy donors. In conclusion......, a high-affinity cyclin B1-derived HLA-A2-restricted CTL epitope was identified, which was presented on the cell surface of cancer cells, and elicited spontaneous T-cell responses in cancer patients and healthy donors....

  7. Transcription Factor Networks derived from Breast Cancer Stem Cells control the immune response in the Basal subtype

    da Silveira, W A; Palma, P V B; Sicchieri, R D

    2017-01-01

    Breast cancer is the most common cancer in women worldwide and metastatic dissemination is the principal factor related to death by this disease. Breast cancer stem cells (bCSC) are thought to be responsible for metastasis and chemoresistance. In this study, based on whole transcriptome analysis...... of these networks in patient tumours is predictive of engraftment success. Our findings point out a potential molecular mechanism underlying the balance between immune surveillance and EMT activation in breast cancer. This molecular mechanism may be useful to the development of new target therapies....... and IKZF3 transcription factors which correspond to immune response modulators. Immune response network expression is correlated with pathological response to chemotherapy, and in the Basal subtype is related to better recurrence-free survival. In patient-derived xenografts, the expression...

  8. Severe malaria not responsive to artemisinin derivatives in man returning from Angola to Vietnam.

    Van Hong, Nguyen; Amambua-Ngwa, Alfred; Tuan, Nguyen Quang; Cuong, Do Duy; Giang, Nguyen Thi Huong; Van Dung, Nguyen; Tinh, Ta Thi; Van Tien, Nguyen; Phuc, Bui Quang; Duong, Tran Thanh; Rosanas-Urgell, Anna; D'Alessandro, Umberto; Van Geertruyden, Jean-Pierre; Erhart, Annette

    2014-07-01

    Resistance to artemisinin derivatives, the most potent antimalarial drugs currently used, has emerged in Southeast Asia and threatens to spread to Africa. We report a case of malaria in a man who returned to Vietnam after 3 years in Angola that did not respond to intravenous artesunate and clindamycin or an oral artemisinin-based combination.

  9. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  10. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  11. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  12. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  13. K-shell absorption jump factors and jump ratios in elements between Tm ( Z = 69) and Os ( Z = 76) derived from new mass attenuation coefficient measurements

    Kaya, Necati; Tıraşoğlu, Engin; Apaydın, Gökhan; Aylıkcı, Volkan; Cengiz, Erhan

    2007-08-01

    The K-shell absorption jump factors and jump ratios were derived from new mass attenuation coefficients measured using an energy dispersive X-ray fluorescence (EDXRF) spectrometer for Tm, Yb elements being Tm 2O 3, Yb 2O 3 compounds and pure Lu, Hf, Ta, W, Re and Os. The measurements, in the region 56-77 keV, were done in a transmission geometry utilizing the K α1 , K α2 , K β1 and K β2 X- rays from different secondary source targets (Yb, Ta, Os, W, Re and Ir, etc.) excited by the 123.6 keV γ-photons from an 57Co annular source and detected by an Ultra-LEGe solid state detector with a resolution of 150 eV at 5.9 keV. Experimental results have been compared with theoretically calculated values. The measured values of Tm, Yb, Lu, Hf, Ta, W, Re and Os are reported here for the first time.

  14. K-shell absorption jump factors and jump ratios in elements between Tm (Z = 69) and Os (Z = 76) derived from new mass attenuation coefficient measurements

    Kaya, Necati; Tirasoglu, Engin; Apaydin, Goekhan; Aylikci, Volkan; Cengiz, Erhan

    2007-01-01

    The K-shell absorption jump factors and jump ratios were derived from new mass attenuation coefficients measured using an energy dispersive X-ray fluorescence (EDXRF) spectrometer for Tm, Yb elements being Tm 2 O 3 , Yb 2 O 3 compounds and pure Lu, Hf, Ta, W, Re and Os. The measurements, in the region 56-77 keV, were done in a transmission geometry utilizing the K α1 , K α2 , K β1 and K β2 X- rays from different secondary source targets (Yb, Ta, Os, W, Re and Ir, etc.) excited by the 123.6 keV γ-photons from an 57 Co annular source and detected by an Ultra-LEGe solid state detector with a resolution of 150 eV at 5.9 keV. Experimental results have been compared with theoretically calculated values. The measured values of Tm, Yb, Lu, Hf, Ta, W, Re and Os are reported here for the first time

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  16. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  17. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  18. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  19. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.

    Jennifer Paijo

    2016-04-01

    Full Text Available Human cytomegalovirus (HCMV infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING and thus induces antiviral type I interferon (IFN-I responses. We found that plasmacytoid dendritic cells (pDC as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages.

  20. Response of a benzoxainone derivative linked to monoaza-15-crown-5 with divalent heavy metals.

    Addleman, R S; Bennett, J; Tweedy, S H; Elshani, S; Wai, C M

    1998-08-01

    The response of a monoaza-15-crown-5 with an optically active aminobenzoxazinone moiety to divalent cations was investigated. The crown ether was found to undergo a strong emission shift to the blue when complexed with specific divalent metals that have ionic diameters between 1.9-2.4 A. Consequently the photoactive macrocycle is responsive to Mg(2+), Ca(2+), Ba(2+), Sr(2+), Cd(2+), and particularly responsive to Hg(2+)and Pb(2+). Macrocycle emission spectra are shown to be a function of cation concentration. Alkaline metal cations and smaller transition metals ions such as Ni(2+), Co(2+)and Zn(2+)do not cause significant changes in the macrocycle emission spectra. Emission, absorption, and complex stability constants are determined. Mechanisms of cation selectivity and spectral emission shifts are discussed. Challenges involving immobilization of the macrocycle while preserving its spectral response to cations are explored.

  1. Glucosinolate-derived isothiocyanates impact mitochondrial function in fungal cells and elicit an oxidative stress response necessary for growth recovery

    Benoit eCalmes

    2015-06-01

    Full Text Available Glucosinolates are brassicaceous secondary metabolites that have long been considered as chemical shields against pathogen invasion. Isothiocyanates, are glucosinolate-breakdown products that have negative effects on the growth of various fungal species. We explored the mechanism by which isothiocyanates could cause fungal cell death using Alternaria brassicicola, a specialist Brassica pathogens, as model organism. Exposure of the fungus to isothiocyanates led to a decreased oxygen consumption rate, intracellular accumulation of reactive oxygen species and mitochondrial-membrane depolarization. We also found that two major regulators of the response to oxidative stress, i.e. the MAP kinase AbHog1 and the transcription factor AbAP1, were activated in the presence of isothiocyanates. Once activated by isothiocyanate-derived reactive oxygen species, AbAP1 was found to promote the expression of different oxidative-response genes. This response might play a significant role in the protection of the fungus against isothiocyanates as mutants deficient in AbHog1 or AbAP1 were found to be hypersensitive to these metabolites. Moreover, the loss of these genes was accompanied by a significant decrease in aggressiveness on Brassica. We suggest that the robust protection response against isothiocyanate-derived oxidative stress might be a key adaptation mechanism for successful infection of host plants by Brassicaceae-specialist necrotrophs like A. brassicicola.

  2. Classical genetic analyses of responses to nicotine and ethanol in crosses derived from long- and short-sleep mice.

    de Fiebre, C M; Collins, A C

    1992-04-01

    A classical (Mendelian) genetic analysis of responses to ethanol and nicotine was conducted in crosses derived from mouse lines which were selectively bred for differential duration of loss of the righting response (sleep-time) after ethanol. Dose-response curves for these mice, the long- and short-sleep mouse lines, as well as the derived F1, F2 and backcross (F1 x long-sleep and F1 x short-sleep) generations were generated for several measures of nicotine and ethanol sensitivity. Ethanol sensitivity was assessed using the sleep-time measure. Nicotine sensitivity was tested using a battery of behavioral and physiological tests which included measures of seizure activity, respiration rate, acoustic startle response, Y-maze activities (both crossing and rearing activities), heart rate and body temperature. The inheritance of sensitivities to both of these agents appears to be polygenic and inheritance can be explained primarily by additive genetic effects with some epistasis. Sensitivity to the ethanol sleep-time measure was genetically correlated with sensitivity to both nicotine-induced hypothermia and seizures; the correlation was greater between sleep-time and hypothermia. These data indicate that there is overlap in the genetic regulation of sensitivity to both ethanol and nicotine as measured by some, but not all, tests.

  3. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  4. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  5. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  6. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  7. Genetic control of eosinophilia in mice: gene(s) expressed in bone marrow-derived cells control high responsiveness

    Vadas, M.A.

    1982-01-01

    A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy

  8. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  9. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  10. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  11. Osteocyte-derived insulin-like growth factor I is not essential for the bone repletion response in mice.

    Kin-Hing William Lau

    Full Text Available The present study sought to evaluate the functional role of osteocyte-derived IGF-I in the bone repletion process by determining whether deficient expression of Igf1 in osteocytes would impair the bone repletion response to one week of dietary calcium repletion after two weeks of dietary calcium deprivation. As expected, the two-week dietary calcium depletion led to hypocalcemia, secondary hyperparathyroidism, and increases in bone resorption and bone loss in both Igf1 osteocyte conditional knockout (cKO mutants and WT control mice. Thus, conditional disruption of Igf1 in osteocytes did not impair the calcium depletion-induced bone resorption. After one week of calcium repletion, both cKO mutants and WT littermates showed an increase in endosteal bone formation attended by the reduction in osteoclast number, indicating that deficient Igf1 expression in osteocytes also did not have deleterious effects on the bone repletion response. The lack of an effect of deficient osteocyte-derived IGF-I expression on bone repletion is unexpected since previous studies show that these Igf1 osteocyte cKO mice exhibited impaired developmental growth and displayed complete resistance to bone anabolic effects of loading. These studies suggest that there is a dichotomy between the mechanisms necessary for anabolic responses to mechanical loading and the regulatory hormonal and anabolic skeletal repletion following low dietary calcium challenge. In conclusion, to our knowledge this study has demonstrated for the first time that osteocyte-derived IGF-I, which is essential for anabolic bone response to mechanical loading, is not a key regulatory factor for bone repletion after a low calcium challenge.

  12. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  13. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  14. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  15. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  16. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  17. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  18. The synthetic NCAM-derived peptide, FGL, modulates the transcriptional response to traumatic brain injury

    Pedersen, Martin Volmer; Helweg-Larsen, Rehannah Borup; Nielsen, Finn Cilius

    2008-01-01

    Cerebral responses to traumatic brain injury (TBI) include up- and downregulation of a vast number of proteins involved in endogenous inflammatory responses and defense mechanisms developing postinjury. The present study analyzed the global gene expression profile in response to cryo-induced TBI...... at various time-points postlesion (6 h, 1 day and 4 days). The effects of injury, treatment, and injury-treatment interaction were observed. TBI alone rendered a large number of genes affected. Analysis of lesion and treatment interactions resulted in a clear effect of the interaction between injury and FGL......-treatment compared to injury and placebo-treatment. Genes affected by TBI alone included inflammation markers, protein kinases, ion channel members and growth factors. Genes encoding regulators of apoptosis, signal transduction and metabolism were altered by the interaction between FGL-treatment and TBI. FGL...

  19. Tumour-Derived Interleukin-1 Beta Induces Pro-inflammatory Response in Human Mesenchymal Stem Cells

    Alajez, Nehad M; Al-toub, Mashael; Almusa, Abdulaziz

    ’ secreted factors as represented by a panel of human cancer cell lines (breast (MCF7 and MDA-MB-231); prostate (PC-3); lung (NCI-H522); colon (HT-29) and head & neck (FaDu)) on the biological characteristics of MSCs. Background Over the past several years, significant amount of research has emerged......, the goal of this study was to assess the cellular and molecular changes in MSCs in response to secreted factors present in conditioned media (CM) from a panel of human tumor cell lines covering a spectrum of human cancers (Breast, Prostate, Lung, colon, and head and neck). Research Morphological changes...... with bipolar processes. In association with phenotypic changes, genome-wide gene expression and bioinformatics analysis revealed an enhanced pro-inflammatory response of those MSCs. Pharmacological inhibitions of FAK and MAPKK severely impaired the pro-inflammatory response of MSCs to tumor CM (~80-99%, and 55...

  20. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  1. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  2. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  3. Telematic Requirements for Emergency and Disaster Response derived from Enterprise Models

    Widya, I.A.; Vierhout, P.A.M.; Vierhout, P.A.M.; Jones, Valerie M.; Bults, Richard G.A.; van Halteren, Aart; Peuscher, J.; Konstantas, D.; Istepanian, R.S.H.; Laxminarayan, S.; Pattichis, C.S.

    2006-01-01

    One of the prime objectives in disaster response management is to achieve full control of the situation as rapidly as possible. Coordination and communication facility therefore plays an essential role in managing disasters. This chapter discusses Enterprise Models that capture the invariant

  4. Is the temperature gradient or the derivative of the density gradient responsible for drift solitons?

    Salat, A.

    1990-01-01

    In conventional drift wave theory the density gradient κ n =d lnn/dχ determines the linear phase velocity, and the (electron) temperature gradient κ T =d lnT/dχ gives rise to a nonlinear term which leads to the existence of soliton-type solutions and solitary waves. LAKHIN, MIKHAILOVSKI and ONISHCHENKO, Phys. Lett. A 119, 348 (1987) and Plasma Phys. and Contr. Fus. 30, 457 (1988), recently claimed that it is not κ T but essentially the derivative of the density gradient, dκ n /dχ, that is relevant. This claim is refuted by means of an expansion scheme in ε=eΦ/T≤1, where Φ is the drift wave potential. (orig.)

  5. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  6. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  7. Equine allogeneic bone marrow-derived mesenchymal stromal cells elicit antibody responses in vivo.

    Pezzanite, Lynn M; Fortier, Lisa A; Antczak, Douglas F; Cassano, Jennifer M; Brosnahan, Margaret M; Miller, Donald; Schnabel, Lauren V

    2015-04-12

    This study tested the hypothesis that Major Histocompatibility Complex (MHC) incompatible equine mesenchymal stromal cells (MSCs) would induce cytotoxic antibodies to donor MHC antigens in recipient horses after intradermal injection. No studies to date have explored recipient antibody responses to allogeneic donor MSC transplantation in the horse. This information is critical because the horse is a valuable species for assessing the safety and efficacy of MSC treatment prior to human clinical application. Six MHC heterozygote horses were identified as non-ELA-A2 haplotype by microsatellite typing and used as allogeneic MHC-mismatched MSC recipients. MHC homozygote horses of known ELA-A2 haplotype were used as MSC and peripheral blood leukocyte (PBL) donors. One MHC homozygote horse of the ELA-A2 haplotype was the recipient of ELA-A2 donor MSCs as an MHC-matched control. Donor MSCs, which were previously isolated and immunophenotyped, were thawed and culture expanded to achieve between 30x10(6) and 50x10(6) cells for intradermal injection into the recipient's neck. Recipient serum was collected and tested for the presence of anti-donor antibodies prior to MSC injection and every 7 days after MSC injection for the duration of the 8-week study using the standard two-stage lymphocyte microcytotoxicity dye-exclusion test. In addition to anti-ELA-A2 antibodies, recipient serum was examined for the presence of cross-reactive antibodies including anti-ELA-A3 and anti-RBC antibodies. All MHC-mismatched recipient horses produced anti-ELA-A2 antibodies following injection of ELA-A2 MSCs and developed a wheal at the injection site that persisted for the duration of the experiment. Anti-ELA-A2 antibody responses were varied both in terms of strength and timing. Four recipient horses had high-titered anti-ELA-A2 antibody responses resulting in greater than 80% donor PBL death in the microcytotoxicity assays and one of these horses also developed antibodies that cross

  8. Global Ecosystem Response Types Derived from the Standardized Precipitation Evapotranspiration Index and FPAR3g Series

    Ivits, Eva; Horion, Stéphanie Marie Anne F; Fensholt, Rasmus

    2014-01-01

    Observing trends in global ecosystem dynamics is an important first step, but attributing these trends to climate variability represents a further step in understanding Earth system changes. In the present study, we classified global Ecosystem Response Types (ERTs) based on common spatio-temporal......Observing trends in global ecosystem dynamics is an important first step, but attributing these trends to climate variability represents a further step in understanding Earth system changes. In the present study, we classified global Ecosystem Response Types (ERTs) based on common spatio...... were observed in Asia and North America. These ERTs complement traditional pixel based methods by enabling the combined assessment of the location, timing, duration, frequency and severity of climatic and vegetation anomalies with the joint assessment of wetting and drying climatic conditions. The ERTs...

  9. Sustainable responsible business conscience as derived from the Chumash: Hermeneutic henomenological perspective

    Sivave Mashingaidze

    2015-07-01

    Full Text Available The Chumash (Five books of Moses has potential from which conventional models and theories could leverage for public wellbeing. Considering the moral and ethical magnitude of business/corporate social responsibility (CSR or Sustainable Responsible Business, understanding this concept from the religious stand-point could help strengthen CSR compliance, where religions play direct and indirect role in corporate governance and people’s lifestyle. This article explores epigraphic sources to provide answer to the questions: Does CSR have theological foundation from the Chumash? Can faith strengthen CSR and fortify compliance? The researcher sourced the required qualitative data from journal articles, Judaic sources and Chumash (Bible texts as well as relevant online resources on the subject. The extractions from epigraphic sources were critically and methodically examined carefully using hermeneutic from which answers to the two questions were established. The findings indicate that CSR has theological foundation in the Chumash, and religious ethics and values have great influence for strengthening CSR.

  10. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  11. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  12. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  13. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  14. Bacillus megaterium strains derived from water and soil exhibit differential responses to the herbicide mesotrione.

    Dobrzanski, Tatiane; Gravina, Fernanda; Steckling, Bruna; Olchanheski, Luiz R; Sprenger, Ricardo F; Espírito Santo, Bruno C; Galvão, Carolina W; Reche, Péricles M; Prestes, Rosilene A; Pileggi, Sônia A V; Campos, Francinete R; Azevedo, Ricardo A; Sadowsky, Michael J; Beltrame, Flávio L; Pileggi, Marcos

    2018-01-01

    The intense use of herbicides for weed control in agriculture causes selection pressure on soil microbiota and water ecosystems, possibly resulting in changes to microbial processes, such as biogeochemical cycles. These xenobiotics may increase the production of reactive oxygen species and consequently affect the survival of microorganisms, which need to develop strategies to adapt to these conditions and maintain their ecological functionality. This study analyzed the adaptive responses of bacterial isolates belonging to the same species, originating from two different environments (water and soil), and subjected to selection pressure by herbicides. The effects of herbicide Callisto and its active ingredient, mesotrione, induced different adaptation strategies on the cellular, enzymatic, and structural systems of two Bacillus megaterium isolates obtained from these environments. The lipid saturation patterns observed may have affected membrane permeability in response to this herbicide. Moreover, this may have led to different levels of responses involving superoxide dismutase and catalase activities, and enzyme polymorphisms. Due to these response systems, the strain isolated from water exhibited higher growth rates than did the soil strain, in evaluations made in oligotrophic culture media, which would be more like that found in semi-pristine aquatic environments. The influence of the intracellular oxidizing environments, which changed the mode of degradation of mesotrione in our experimental model and produced different metabolites, can also be observed in soil and water at sites related to agriculture. Since the different metabolites may present different levels of toxicity, we suggest that this fact should be considered in studies on the fate of agrochemicals in different environments.

  15. Defining Hepatocellular Carcinoma Subtypes and Treatment Responses in Patient-Derived Tumorgrafts

    2017-10-01

    Specific AIM 2: Determine the efficacy of small RNA therapeutics against the LIN28B/LET-7 pathway in PDXs activating this oncogenic pathway Major...Task 1: Identify and deliver small RNAs to target PDX populations (ongoing). Major Task 2: Define response to small RNAs in target PDX populations...Allow time to receive the regulatory approval for animal use (IACUC and DoD ACURO). This task was performed by Drs. Yopp, Singal, and Zhu. We

  16. Brain-derived neurotrophic factor (BDNF) Val66Met polymorphism interacts with gender to influence cortisol responses to mental stress.

    Jiang, Rong; Babyak, Michael A; Brummett, Beverly H; Siegler, Ilene C; Kuhn, Cynthia M; Williams, Redford B

    2017-05-01

    Brain-derived neurotrophic factor (BDNF) Val66Met polymorphism has been associated with cortisol responses to stress with gender differences reported, although the findings are not entirely consistent. To evaluate the role of Val66Met genotype and gender on cortisol responses to stress, we conducted a 45-min mental stress protocol including four tasks and four rest periods. Blood cortisol was collected for assay immediately before and after each task and rest period. A significant two-way interaction of Val66Met genotype×gender (P=0.022) was observed on the total area under the curve (AUC), a total cortisol response over time, such that the Val/Val genotype was associated with a larger cortisol response to stress as compared to the Met group in women but not in men. Further contrast analyses between the Val/Val and Met group for each stress task showed a similar increased cortisol pattern among women Val/Val genotype but not among men. The present findings indicate the gender differences in the effect of Val66Met genotype on the cortisol responses to stress protocol, and extend the evidence for the importance of gender and the role of Val66Met in the modulation of stress reactivity and subsequent depression prevalence. Further studies and the underlying mechanism need to be investigated, which may provide an insight for prevention, intervention, and treatment strategies that target those at high risk. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Differential responses to radiation and hyperthermia of cloned cell lines derived from a single human melanoma xenograft

    Rofstad, E.K.; Brustad, T.

    1984-01-01

    One uncloned and five cloned cell lines were derived from a single human melanoma xenograft. Cells from passages 7-12 were exposed to either radiation or hyperthermia (42.5 0 C, pH = 7.4) under aerobic conditions and the colony forming ability of the cells was assayed in soft agar. The five cloned lines showed individual and characteristic responses to radiation as well as to hyperthermia. The variation in the response to radiation was mainly reflected in the size of the shoulders of the survival curves rather than in the D 0 -values. The variation in the response to hyperthermia was mainly reflected in the terminal slopes of the survival curves. The survival curve of cells from the uncloned line, both when exposed to radiation and hyperthermia, was positioned in the midst of those of the cloned lines. The response of the cloned lines to radiation did not correlate with the response to hyperthermia, indicating that tumor cell subpopulations which are resistant to radiation may respond well to hyperthermia

  18. On the Relationship Between Transfer Function-derived Response Times and Hydrograph Analysis Timing Parameters: Are there Similarities?

    Bansah, S.; Ali, G.; Haque, M. A.; Tang, V.

    2017-12-01

    The proportion of precipitation that becomes streamflow is a function of internal catchment characteristics - which include geology, landscape characteristics and vegetation - and influence overall storage dynamics. The timing and quantity of water discharged by a catchment are indeed embedded in event hydrographs. Event hydrograph timing parameters, such as the response lag and time of concentration, are important descriptors of how long it takes the catchment to respond to input precipitation and how long it takes the latter to filter through the catchment. However, the extent to which hydrograph timing parameters relate to average response times derived from fitting transfer functions to annual hydrographs is unknown. In this study, we used a gamma transfer function to determine catchment average response times as well as event-specific hydrograph parameters across a network of eight nested watersheds ranging from 0.19 km2 to 74.6 km2 prairie catchments located in south central Manitoba (Canada). Various statistical analyses were then performed to correlate average response times - estimated using the parameters of the fitted gamma transfer function - to event-specific hydrograph parameters. Preliminary results show significant interannual variations in response times and hydrograph timing parameters: the former were in the order of a few hours to days, while the latter ranged from a few days to weeks. Some statistically significant relationships were detected between response times and event-specific hydrograph parameters. Future analyses will involve the comparison of statistical distributions of event-specific hydrograph parameters with that of runoff response times and baseflow transit times in order to quantity catchment storage dynamics across a range of temporal scales.

  19. Enhancement of radiation response of a murine mammary carcinoma by two nitrofuran derivatives

    Stone, H.B.; Withers, H.R.

    1975-01-01

    Two nitrofuran derivatives, NF-131 [1-(5-nitro-2-furyl)-3-piperidino-1-propanone semicarbazone hydrochloride], and nifuroxime (anti-5-nitro-2-furaldoxime), have been tested for their effect on the TCD50 of a C3H mouse mammary carcinoma and on murine jejunal epithelium. NF-131, at a dose of 2 mg/mouse, caused a reduction in the TCD50 by a factor of 1.21 to 1.23 when administered iv 3, 10, or 30 min before irradiation. This drug dose had no effect on tumor growth and only a minimal effect on the radioresponse of jejunal epithelium, but caused death in about 3 percent of the mice. Nifuroxime, at a dose of 0.05 mg/g body weight, reduced the TCD50 by a factor of 1.36 when administered ip 10 min before irradiation, but was lethal for 22 percent of the mice. A dose of 0.10 mg/g enhanced the tumor radioresponse by a factor of 1.48 when administered 10 min before irradiation, but by lesser factors at 3 and 30 min. This dose was lethal to 37 percent of the mice. Both doses of nifuroxime inhibited tumor growth temporarily, but neither enhanced the radioresponse of jejunal epithelium

  20. Microbial Community Response to Terrestrially Derived Dissolved Organic Matter in the Coastal Arctic

    Rachel E. Sipler

    2017-06-01

    Full Text Available Warming at nearly twice the global rate, higher than average air temperatures are the new ‘normal’ for Arctic ecosystems. This rise in temperature has triggered hydrological and geochemical changes that increasingly release carbon-rich water into the coastal ocean via increased riverine discharge, coastal erosion, and the thawing of the semi-permanent permafrost ubiquitous in the region. To determine the biogeochemical impacts of terrestrially derived dissolved organic matter (tDOM on marine ecosystems we compared the nutrient stocks and bacterial communities present under ice-covered and ice-free conditions, assessed the lability of Arctic tDOM to coastal microbial communities from the Chukchi Sea, and identified bacterial taxa that respond to rapid increases in tDOM. Once thought to be predominantly refractory, we found that ∼7% of dissolved organic carbon and ∼38% of dissolved organic nitrogen from tDOM was bioavailable to receiving marine microbial communities on short 4 – 6 day time scales. The addition of tDOM shifted bacterial community structure toward more copiotrophic taxa and away from more oligotrophic taxa. Although no single order was found to respond universally (positively or negatively to the tDOM addition, this study identified 20 indicator species as possible sentinels for increased tDOM. These data suggest the true ecological impact of tDOM will be widespread across many bacterial taxa and that shifts in coastal microbial community composition should be anticipated.

  1. Apoptotic-cell-derived membrane microparticles and IFN-α induce an inflammatory immune response.

    Niessen, Anna; Heyder, Petra; Krienke, Stefan; Blank, Norbert; Tykocinski, Lars-Oliver; Lorenz, Hanns-Martin; Schiller, Martin

    2015-07-15

    A dysregulation in the clearance of apoptotic material is considered a major pathogenetic factor for the emergence of autoimmune diseases. Apoptotic-cell-derived membrane microparticles (AdMPs), which are released from the cell surface during apoptosis, have been implicated in the pathogenesis of autoimmunity. Also of importance are cytokines, such as interferon-α (IFN-α), which is known to be a major player in patients with systemic lupus erythematosus (SLE). This study investigates the combined effect of AdMPs and IFN-α on professional phagocytes. In the presence of IFN-α, phagocytosis of AdMPs by human monocytes was significantly increased in a dose-dependent manner. The combination of AdMPs and raised IFN-α concentrations resulted in an increase in the secretion of pro-inflammatory cytokines and an upregulation of surface molecule expression involved in antigen uptake. In addition, macrophage polarisation was shifted towards a more inflammatory type of cell. The synergism between IFN-α and AdMPs seemed to be mediated by an upregulation of phosphorylated STAT1. Our results indicate that IFN-α, together with AdMPs, amplify the initiation and maintenance of inflammation. This mechanism might especially play a crucial role in disorders with a defective clearance of apoptotic material. © 2015. Published by The Company of Biologists Ltd.

  2. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  3. Female mice deficient in alpha-fetoprotein show female-typical neural responses to conspecific-derived pheromones.

    Olivier Brock

    Full Text Available The neural mechanisms controlling sexual behavior are sexually differentiated by the perinatal actions of sex steroid hormones. We recently observed using female mice deficient in alpha-fetoprotein (AFP-KO and which lack the protective actions of AFP against maternal estradiol, that exposure to prenatal estradiol completely defeminized the potential to show lordosis behavior in adulthood. Furthermore, AFP-KO females failed to show any male-directed mate preferences following treatment with estradiol and progesterone, indicating a reduced sexual motivation to seek out the male. In the present study, we asked whether neural responses to male- and female-derived odors are also affected in AFP-KO female mice. Therefore, we compared patterns of Fos, the protein product of the immediate early gene, c-fos, commonly used as a marker of neuronal activation, between wild-type (WT and AFP-KO female mice following exposure to male or estrous female urine. We also tested WT males to confirm the previously observed sex differences in neural responses to male urinary odors. Interestingly, AFP-KO females showed normal, female-like Fos responses, i.e. exposure to urinary odors from male but not estrous female mice induced equivalent levels of Fos protein in the accessory olfactory pathways (e.g. the medial part of the preoptic nucleus, the bed nucleus of the stria terminalis, the amygdala, and the lateral part of the ventromedial hypothalamic nucleus as well as in the main olfactory pathways (e.g. the piriform cortex and the anterior cortical amygdaloid nucleus, as WT females. By contrast, WT males did not show any significant induction of Fos protein in these brain areas upon exposure to either male or estrous female urinary odors. These results thus suggest that prenatal estradiol is not involved in the sexual differentiation of neural Fos responses to male-derived odors.

  4. Lentinula edodes-derived polysaccharide rejuvenates mice in terms of immune responses and gut microbiota.

    Xu, Xiaofei; Yang, Jiguo; Ning, Zhengxiang; Zhang, Xuewu

    2015-08-01

    Aging is characterized by impaired immunity and unbalanced gut microbiota. Prebiotics have the capability to prevent or reverse age-related declines in health by modulating gut microbiota. Mushroom polysaccharides have been suggested to be potential prebiotics. However, their effects on the immunity and gut microbiota in aged mice have not been determined. This study firstly assessed the effects of a heteropolysaccharide L2 isolated from the fruit body of L. edodes on the immune response of aged mice, and then compared the composition of fecal microbiota in adult (N), old (O) and L2-treated old (Oa) mice using the high-throughput pyrosequencing technique. The results showed that L2 can restore the age-attenuated immune responses by increasing cytokine levels in peripheral blood. Moreover, L2 can partly reverse the age-altered composition of gut microbiota. The Euclidean distances (De) among 3 groups (N, O and Oa) are determined to be De(O, N) = 0.19, De(O, Oa) = 0.20, and De(N, Oa) = 0.10, i.e. there is a marked reduction in the distance from 0.19 to 0.1 by L2. This suggests the beneficial effects of L2 on enhancing immunity and improving gut health.

  5. Mitochondrial-Derived Oxidants and Cellular Responses to Low Dose/Low LET Ionizing Radiation

    Spitz, Douglas R.

    2009-01-01

    Exposure to ionizing radiation results in the immediate formation of free radicals and other reactive oxygen species (ROS). It has been assumed that the subsequent injury processes leading to genomic instability and carcinogenesis following radiation, derive from the initial oxidative damage caused by these free radicals and ROS. It is now becoming increasingly obvious that metabolic oxidation/reduction (redox) reactions can be altered by irradiation leading to persistent increases in steady-state levels of intracellular free radicals and ROS that contribute to the long term biological effects of radiation exposure by causing chronic oxidative stress. The objective during the last period of support (DE-FG02-05ER64050; 5/15/05-12/31/09) was to determine the involvement of mitochondrial genetic defects in metabolic oxidative stress and the biological effects of low dose/low LET radiation. Aim 1 was to determine if cells with mutations in succinate dehydrogenase (SDH) subunits C and D (SDHC and SDHD in mitochondrial complex II) demonstrated increases in steady-state levels of reactive oxygen species (ROS; O 2 - and H 2 O 2 ) as well as demonstrating increased sensitivity to low dose/low LET radiation (10 cGy) in cultured mammalian cells. Aim No.2 was to determine if mitochondrially-derived ROS contributed to increased sensitivity to low dose/low LET radiation in mammalian cells containing mutations in SDH subunits. Aim No.3 was to determine if a causal relationship existed between increases in mitochondrial ROS production, alterations in electron transport chain proteins, and genomic instability in the progeny of irradiated cells. Evidence gathered in the 2005-2009 period of support demonstrated that mutations in genes coding for mitochondrial electron transport chain proteins (ETC); either Succinate Dehydrogenase (SDH) subunit C (SDHC) or subunit D (SDHD); caused increased ROS production, increased genomic instability, and increased sensitivity to low dose/low LET

  6. Growth on elastic silicone substrate elicits a partial myogenic response in periodontal ligament derived stem cells

    Daniel Pelaez

    2016-12-01

    Full Text Available The processes of cellular differentiation and phenotypic maintenance can be influenced by stimuli from a variety of different factors. One commonly overlooked factor is the mechanical properties of the growth substrate in which stem cells are maintained or differentiated down various lineages. Here we explored the effect that growth on an elastic silicone substrate had on the myogenic expression and cytoskeletal morphology of periodontal ligament derived stem cells. Cells were grown on either collagen I coated tissue culture polystyrene plates or collagen I coated elastic silicone membranes for a period of 4 days without further induction from soluble factors in the culture media. Following the 4-day growth, gene expression and immunohistochemical analysis for key cardiomyogenic markers was performed along with a morphological assessment of cytoskeletal organization. Results show that cells grown on the elastic substrate significantly upregulate key markers associated with contractile activity in muscle tissues. Namely, the myosin light chain polypeptides 2 and 7, as well as the myosin heavy chain polypeptide 7 genes underwent a statistically significant upregulation in the cells grown on elastic silicone membranes. Similarly, the cells on the softer elastic substrate stained positive for both sarcomeric actin and cardiac troponin t proteins following just 4 days of growth on the softer material. Cytoskeletal analysis showed that substrate stiffness had a marked effect on the organization and distribution of filamentous actin fibers within the cell body. Growth on silicone membranes produced flatter and shorter cellular morphologies with filamentous actin fibers projecting anisotropically throughout the cell body. These results demonstrate how crucial the mechanical properties of the growth substrate of cells can be on the ultimate cellular phenotype. These observations highlight the need to further optimize differentiation protocols to enhance

  7. The effect of processing history on physical behavior and cellular response for tyrosine-derived polyarylates

    Doddi, S; Patlolla, A; Shanumunsgarundum, S; Jaffe, M; Collins, G; Arinzeh, T Livingston

    2009-01-01

    Polyarylates have shown promise as fully degradable polymers for drug delivery as well as for structural implant applications due to their range of physicomechanical properties. Processing history, however, could have a significant impact on their overall performance in biologically relevant environments. More specifically, structural changes at the molecular level can occur that will affect a polymer's physical properties and subsequent, cell attachment and growth. The present study was aimed at comparing cell growth on tyrosine-derived polyarylates with that of polylactic acid (PLLA) in their original state and after processing (i.e. undrawn and drawn forms). Two polyarylates having distinct molecular structures were chosen. Strictly, amorphous poly(DTE adipate), denoted as poly(DT 2,4), and poly(DTD) dodecandioate, denoted as poly(DT 12,10), having a more complex, non-crystalline organization, were compared with semi-crystalline PLLA. The degree of shrinkage, thermal characterization, air-water contact angle and surface morphology were determined for each polymer in its undrawn and drawn states. Poly(DT 2,4) and PLLA after processing resulted in greater shrinkage and a slight decrease in hydrophilicity whereas poly(DT 12,10) had minimal shrinkage and became slightly more hydrophilic in its drawn state. Surface morphology or roughness was also altered by processing. In turn, the rate of cell growth and overall cell numbers were reduced significantly on drawn forms of poly(DT 2,4) and PLLA, whereas more favorable growth rates were supported on drawn poly(DT 12,10). These findings indicate that processing effects in amorphous as well as oriented polymeric structures can significantly alter their biological performance.

  8. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  9. Boundary Element Analysis of the Steady-state Response of an Elastic Half-Space to a Moving Force on its Surface

    Andersen, Lars; Nielsen, Søren R. K.

    2003-01-01

    The paper deals with the boundary element method formulation of the steady-state wave propagation through elastic media due to a source moving with constant velocity. The Greens' function for the three-dimensional full-space is formulated in a local frame of reference following the source...... is approximated, but the error which is introduced in this way is insignificant. Numerical examples are given for a moving rectangular load on an elastic half-space. The result from a boundary element code based on the derived Green's function are compared with a semi-analytic solution....

  10. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  11. Molecular characterization of a rice mutator-phenotype derived from an incompatible cross-pollination reveals transgenerational mobilization of multiple transposable elements and extensive epigenetic instability

    Xu Chunming

    2009-05-01

    Full Text Available Abstract Background Inter-specific hybridization occurs frequently in plants, which may induce genetic and epigenetic instabilities in the resultant hybrids, allopolyploids and introgressants. It remains unclear however whether pollination by alien pollens of an incompatible species may impose a "biological stress" even in the absence of genome-merger or genetic introgression, whereby genetic and/or epigenetic instability of the maternal recipient genome might be provoked. Results We report here the identification of a rice mutator-phenotype from a set of rice plants derived from a crossing experiment involving two remote and apparently incompatible species, Oryza sativa L. and Oenothera biennis L. The mutator-phenotype (named Tong211-LP showed distinct alteration in several traits, with the most striking being substantially enlarged panicles. Expectably, gel-blotting by total genomic DNA of the pollen-donor showed no evidence for introgression. Characterization of Tong211-LP (S0 and its selfed progenies (S1 ruled out contamination (via seed or pollen or polyploidy as a cause for its dramatic phenotypic changes, but revealed transgenerational mobilization of several previously characterized transposable elements (TEs, including a MITE (mPing, and three LTR retrotransposons (Osr7, Osr23 and Tos17. AFLP and MSAP fingerprinting revealed extensive, transgenerational alterations in cytosine methylation and to a less extent also genetic variation in Tong211-LP and its immediate progenies. mPing mobility was found to correlate with cytosine methylation alteration detected by MSAP but not with genetic variation detected by AFLP. Assay by q-RT-PCR of the steady-state transcript abundance of a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, and small interference RNA (siRNA pathway-related proteins showed that, relative to the rice parental line, heritable perturbation in expression of 12 out of

  12. In vitro induction of lymphocyte responsiveness by a Strongylus vulgaris-derived mitogen.

    Bailey, M; Lloyd, S; Martin, S C; Soulsby, E J

    1984-01-01

    Proliferation in vitro of peripheral blood lymphocytes both from horses infected with Strongylus vulgaris and from helminth-free ponies was observed in the presence of extracts of the fourth and fifth stage larvae and adults of S. vulgaris. In addition, S. vulgaris extracts induced transformation in cultures of peripheral blood lymphocytes from sheep and dogs and in mouse spleen cell cultures. Nylon wool non-adherent, T cell enriched fractions of lymphocytes from both mice and horses were stimulated by the S. vulgaris larval mitogen while no proliferation was observed in cultures containing nylon wool adherent, B cell enriched fractions. Macrophage co-operation appeared not to be necessary for S. vulgaris mitogen-induced transformation of spleen cells. The S. vulgaris mitogen stimulated a subpopulation of mouse spleen cells different from those responsive to PHA, Con A and LPS. These cells might be T helper cells since B cells were stimulated to proliferate in the presence of both T cells and S. vulgaris larval mitogen. In addition, the supernatant of in vitro cultured larvae of S. vulgaris induced slight, but significant transformation of equine peripheral blood lymphocytes. Therefore, it is possible that the S. vulgaris mitogen released by both viable parasites and degenerating larvae might induce T cell dependent production of immunoglobulin in vivo and account for the beta-globulinaemia, of which IgG(T) is a major component, in S vulgaris infected horses.

  13. An antimicrobial helix A-derived peptide of heparin cofactor II blocks endotoxin responses in vivo.

    Papareddy, Praveen; Kalle, Martina; Singh, Shalini; Mörgelin, Matthias; Schmidtchen, Artur; Malmsten, Martin

    2014-05-01

    Host defense peptides are key components of the innate immune system, providing multi-facetted responses to invading pathogens. Here, we describe that the peptide GKS26 (GKSRIQRLNILNAKFAFNLYRVLKDQ), corresponding to the A domain of heparin cofactor II (HCII), ameliorates experimental septic shock. The peptide displays antimicrobial effects through direct membrane disruption, also at physiological salt concentration and in the presence of plasma and serum. Biophysical investigations of model lipid membranes showed the antimicrobial action of GKS26 to be mirrored by peptide incorporation into, and disordering of, bacterial lipid membranes. GKS26 furthermore binds extensively to bacterial lipopolysaccharide (LPS), as well as its endotoxic lipid A moiety, and displays potent anti-inflammatory effects, both in vitro and in vivo. Thus, for mice challenged with ip injection of LPS, GKS26 suppresses pro-inflammatory cytokines, reduces vascular leakage and infiltration in lung tissue, and normalizes coagulation. Together, these findings suggest that GKS26 may be of interest for further investigations as therapeutic against severe infections and septic shock. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  15. Association study of a brain-derived neurotrophic factor polymorphism and short-term antidepressant response in major depressive disorders

    Lung-Cheng Huang

    2008-10-01

    Full Text Available Eugene Lin1,7, Po See Chen2,6,7, Lung-Cheng Huang3,4, Sen-Yen Hsu51Vita Genomics, Inc., Wugu Shiang, Taipei, Taiwan; 2Department of Psychiatry, Hospital and College of Medicine, National Cheng Kung University, Tainan, Taiwan; 3Department of Psychiatry, National Taiwan University Hospital Yun-Lin Branch, Taiwan; 4Graduate Institute of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; 5Department of Psychiatry, Chi Mei Medical Center, Liouying, Tainan, Taiwan; 6Department of Psychiatry, National Cheng Kung University Hospital, Dou-liou Branch, Yunlin, Taiwan; 7These authors contributed equally to this workAbstract: Major depressive disorder (MDD is one of the most common mental disorders worldwide. Single nucleotide polymorphisms (SNPs can be used in clinical association studies to determine the contribution of genes to drug efficacy. A common SNP in the brain-derived neurotrophic factor (BDNF gene, a methionine (Met substitution for valine (Val at codon 66 (Val66Met, is a candidate SNP for influencing antidepressant treatment outcome. In this study, our goal was to determine the relationship between the Val66Met polymorphism in the BDNF gene and the rapid antidepressant response to venlafaxine in a Taiwanese population with MDD. Overall, the BDNF Val66Met polymorphism was found not to be associated with short-term venlafaxine treatment outcome. However, the BDNF Val66Met polymorphism showed a trend to be associated with rapid venlafaxine treatment response in female patients. Future research with independent replication in large sample sizes is needed to confirm the role of the BDNF Val66Met polymorphism identified in this study.Keywords: antidepressant response, brain-derived neurotrophic factor, major depressive disorder, serotonin and norepinephrine reuptake inhibitor, single nucleotide polymorphisms

  16. Alleviation of collagen-induced arthritis by the benzoxathiole derivative BOT-4-one in mice: Implication of the Th1- and Th17-cell-mediated immune responses.

    Kim, Byung-Hak; Yoon, Bo Ruem; Kim, Eun Kyoung; Noh, Kum Hee; Kwon, Sun-Ho; Yi, Eun Hee; Lee, Hyun Gyu; Choi, Jung Sook; Kang, Seong Wook; Park, In-Chul; Lee, Won-Woo; Ye, Sang-Kyu

    2016-06-15

    Autoimmune rheumatoid arthritis is characterized by chronic inflammation and hyperplasia in the synovial joints. Although the cause of rheumatoid arthritis is largely unknown, substantial evidence has supported the importance of immune cells and inflammatory cytokines in the initiation and progression of this disease. Herein, we demonstrated that the benzoxathiole derivative 2-cyclohexylimino-6-methyl-6,7-dihydro-5H-benzo[1,3]oxathiol-4-one (BOT-4-one) alleviated type II collagen-induced arthritis in a mouse model. The levels of pro-inflammatory cytokines are elevated in both human patients with rheumatoid arthritis and mice with collagen-induced arthritis. BOT-4-one treatment reduced the levels of pro-inflammatory cytokines in mice and endotoxin-stimulated macrophages. BOT-4-one treatment suppressed the polarization of Th1- and Th17-cell subsets by inhibiting the expression and production of their lineage-specific master transcription factors and cytokines, as well as activation of signal transducer and activator of transcription proteins. In addition, BOT-4-one inhibited mitogen-activated protein kinase and NF-kappaB signaling as well as the transcriptional activities and DNA-binding of transcription factors, including activator protein-1, cAMP response element-binding protein and NF-kappaB. Our results suggest that BOT-4-one may have therapeutic potential for the treatment of chronic inflammation associated with autoimmune rheumatoid arthritis. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  18. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  19. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  20. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  1. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  2. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  3. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  5. Aquaporin 3 (AQP3) participates in the cytotoxic response to nucleoside-derived drugs

    Pérez-Torras, Sandra; Casado, F Javier; Pastor-Anglada, Marçal

    2012-01-01

    Nucleoside analogs used in the chemotherapy of solid tumors, such as the capecitabine catabolite 5 ′ -deoxy-5-fluorouridine (5 ′ -DFUR) trigger a transcriptomic response that involves the aquaglyceroporin aquaporin 3 along with other p53-dependent genes. Here, we examined whether up-regulation of aquaporin 3 (AQP3) mRNA in cancer cells treated with 5 ′ -DFUR represents a collateral transcriptomic effect of the drug, or conversely, AQP3 participates in the activity of genotoxic agents. The role of AQP3 in cell volume increase, cytotoxicity and cell cycle arrest was analyzed using loss-of-function approaches. 5 ′ -DFUR and gemcitabine, but not cisplatin, stimulated AQP3 expression and cell volume, which was partially and significantly blocked by knockdown of AQP3. Moreover, AQP3 siRNA significantly blocked other effects of nucleoside analogs, including G 1 /S cell cycle arrest, p21 and FAS up-regulation, and cell growth inhibition. Short incubations with 5-fluorouracil (5-FU) also induced AQP3 expression and increased cell volume, and the inhibition of AQP3 expression significantly blocked growth inhibition triggered by this drug. To further establish whether AQP3 induction is related to cell cycle arrest and apoptosis, cells were exposed to long incubations with escalating doses of 5-FU. AQP3 was highly up-regulated at doses associated with cell cycle arrest, whereas at doses promoting apoptosis induction of AQP3 mRNA expression was reduced. Based on the results, we propose that the aquaglyceroporin AQP3 is required for cytotoxic activity of 5’-DFUR and gemcitabine in the breast cancer cell line MCF7 and the colon adenocarcinoma cell line HT29, and is implicated in cell volume increase and cell cycle arrest

  6. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  7. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  8. A cannabigerol derivative suppresses immune responses and protects mice from experimental autoimmune encephalomyelitis.

    Carrillo-Salinas, Francisco J; Navarrete, Carmen; Mecha, Miriam; Feliú, Ana; Collado, Juan A; Cantarero, Irene; Bellido, María L; Muñoz, Eduardo; Guaza, Carmen

    2014-01-01

    Phytocannabinoids that do not produce psychotropic effects are considered of special interest as novel therapeutic agents in CNS diseases. A cannabigerol quinone, the compound VCE-003, has been shown to alleviate symptoms in a viral model of multiple sclerosis (MS). Hence, we studied T cells and macrophages as targets for VCE-003 and its efficacy in an autoimmune model of MS. Proliferation, cell cycle, expression of activation markers was assessed by FACs in human primary T cells, and cytokine and chemokine production was evaluated. Transcription was studied in Jurkat cells and RAW264.7 cells were used to study the effects of VCE-003 on IL-17-induced macrophage polarization to a M1 phenotype. Experimental autoimmune encephalomyelitis (EAE) was induced by myelin oligodendrocyte glycoprotein (MOG₃₅₋₅₅) immunization and spinal cord pathology was assessed by immunohistochemistry. Neurological impairment was evaluated using disease scores. We show here that VCE-003 inhibits CD3/CD28-induced proliferation, cell cycle progression and the expression of the IL-2Rα and ICAM-1 activation markers in human primary T cells. VCE-003 inhibits the secretion of Th1/Th17 cytokines and chemokines in primary murine T cells, and it reduces the transcriptional activity of the IL-2, IL-17 and TNFα promoters induced by CD3/CD28. In addition, VCE-003 and JWH-133, a selective CB2 agonist, dampened the IL-17-induced polarization of macrophages to a pro-inflammatory M1 profile. VCE-003 also prevented LPS-induced iNOS expression in microglia. VCE-003 ameliorates the neurological defects and the severity of MOG-induced EAE in mice through CB2 and PPARγ receptor activation. A reduction in cell infiltrates, mainly CD4+ T cells, was observed, and Th1 and Th17 responses were inhibited in the spinal cord of VCE-003-treated mice, accompanied by weaker microglial activation, structural preservation of myelin sheets and reduced axonal damage. This study highlights the therapeutic potential

  9. A cannabigerol derivative suppresses immune responses and protects mice from experimental autoimmune encephalomyelitis.

    Francisco J Carrillo-Salinas

    Full Text Available Phytocannabinoids that do not produce psychotropic effects are considered of special interest as novel therapeutic agents in CNS diseases. A cannabigerol quinone, the compound VCE-003, has been shown to alleviate symptoms in a viral model of multiple sclerosis (MS. Hence, we studied T cells and macrophages as targets for VCE-003 and its efficacy in an autoimmune model of MS. Proliferation, cell cycle, expression of activation markers was assessed by FACs in human primary T cells, and cytokine and chemokine production was evaluated. Transcription was studied in Jurkat cells and RAW264.7 cells were used to study the effects of VCE-003 on IL-17-induced macrophage polarization to a M1 phenotype. Experimental autoimmune encephalomyelitis (EAE was induced by myelin oligodendrocyte glycoprotein (MOG₃₅₋₅₅ immunization and spinal cord pathology was assessed by immunohistochemistry. Neurological impairment was evaluated using disease scores. We show here that VCE-003 inhibits CD3/CD28-induced proliferation, cell cycle progression and the expression of the IL-2Rα and ICAM-1 activation markers in human primary T cells. VCE-003 inhibits the secretion of Th1/Th17 cytokines and chemokines in primary murine T cells, and it reduces the transcriptional activity of the IL-2, IL-17 and TNFα promoters induced by CD3/CD28. In addition, VCE-003 and JWH-133, a selective CB2 agonist, dampened the IL-17-induced polarization of macrophages to a pro-inflammatory M1 profile. VCE-003 also prevented LPS-induced iNOS expression in microglia. VCE-003 ameliorates the neurological defects and the severity of MOG-induced EAE in mice through CB2 and PPARγ receptor activation. A reduction in cell infiltrates, mainly CD4+ T cells, was observed, and Th1 and Th17 responses were inhibited in the spinal cord of VCE-003-treated mice, accompanied by weaker microglial activation, structural preservation of myelin sheets and reduced axonal damage. This study highlights the

  10. Biological role of Trichoderma harzianum-derived platelet-activating factor acetylhydrolase (PAF-AH) on stress response and antagonism.

    Yu, Chuanjin; Fan, Lili; Wu, Qiong; Fu, Kehe; Gao, Shigang; Wang, Meng; Gao, Jinxin; Li, Yaqian; Chen, Jie

    2014-01-01

    We investigated the properties of platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum. The enzyme, comprised of 572 amino acids, shares high homology with PAF-AH proteins from T. koningii and other microbial species. The optimum enzymatic activity of PAF-AH occurred at pH 6 in the absence of Ca2+ and it localized in the cytoplasm, and we observed the upregulation of PAF-AH expression in response to carbon starvation and strong heat shock. Furthermore, PAF-AH knockout transformant growth occurred more slowly than wild type cells and over-expression strains grown in SM medium at 37°C and 42°C. In addition, PAF-AH expression significantly increased under a series of maize root induction assay. Eicosanoic acid and ergosterol levels decreased in the PAF-AH knockouts compared to wild type cells, as revealed by GC/MS analysis. We also determined stress responses mediated by PAF-AH were related to proteins HEX1, Cu/Zn superoxide dismutase, and cytochrome c. Finally, PAF-AH exhibited antagonistic activity against Rhizoctonia solani in plate confrontation assays. Our results indicate PAF-AH may play an important role in T. harzianum stress response and antagonism under diverse environmental conditions.

  11. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  12. Dissecting the Contributions of Cooperating Gene Mutations to Cancer Phenotypes and Drug Responses with Patient-Derived iPSCs

    Chan-Jung Chang

    2018-05-01

    Full Text Available Summary: Connecting specific cancer genotypes with phenotypes and drug responses constitutes the central premise of precision oncology but is hindered by the genetic complexity and heterogeneity of primary cancer cells. Here, we use patient-derived induced pluripotent stem cells (iPSCs and CRISPR/Cas9 genome editing to dissect the individual contributions of two recurrent genetic lesions, the splicing factor SRSF2 P95L mutation and the chromosome 7q deletion, to the development of myeloid malignancy. Using a comprehensive panel of isogenic iPSCs—with none, one, or both genetic lesions—we characterize their relative phenotypic contributions and identify drug sensitivities specific to each one through a candidate drug approach and an unbiased large-scale small-molecule screen. To facilitate drug testing and discovery, we also derive SRSF2-mutant and isogenic normal expandable hematopoietic progenitor cells. We thus describe here an approach to dissect the individual effects of two cooperating mutations to clinically relevant features of malignant diseases. : Papapetrou and colleagues develop a comprehensive panel of isogenic iPSC lines with SRSF2 P95L mutation and chr7q deletion. They use these cells to identify cellular phenotypes contributed by each genetic lesion and therapeutic vulnerabilities specific to each one and develop expandable hematopoietic progenitor cell lines to facilitate drug discovery. Keywords: induced pluripotent stem cells, myelodysplastic syndrome, CRISPR/Cas9, gene editing, mutational cooperation, splicing factor mutations, spliceosomal mutations, SRSF2, chr7q deletion

  13. TRAM-Derived Decoy Peptides inhibits the inflammatory response in mouse mammary epithelial cells and a mastitis model in mice.

    Hu, Xiaoyu; Tian, Yuan; Wang, Tiancheng; Zhang, Wenlong; Wang, Wei; Gao, Xuejiao; Qu, Shihui; Cao, Yongguo; Zhang, Naisheng

    2015-10-05

    It has been proved that TRAM-Derived Decoy peptides have anti-inflammatory properties. In this study, we synthesized a TRAM-Derived decoy peptide (TM6), belongs to TRAM TIR domain, of which sequence is "N"-RQIKIWFQNRRMKWK, KENFLRDTWCNFQFY-"C" and evaluated the effects of TM6 on lipopolysaccharide-induced mastitis in mice. In vivo, LPS-induced mice mastitis model was established by injection of LPS through the duct of mammary gland. TM6 was injected 1h before or after LPS treatment. In vitro, primary mouse mammary epithelial cells were used to investigate the effects of TM6 on LPS-induced inflammatory responses. The results showed that TM6 inhibited LPS-induced mammary gland histopathologic changes, MPO activity, and TNF-α, IL-1β and IL-6 production in mice. In vitro, TM6 significantly inhibited LPS-induced TNF-α and IL-6 production, as well as NF-κB and MAPKs activation. In conclusion, this study demonstrated that TM6 had protective effects on LPS-mastitis and may be a promising therapeutic reagent for mastitis treatment. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Functional Characterization and Drug Response of Freshly Established Patient-Derived Tumor Models with CpG Island Methylator Phenotype.

    Claudia Maletzki

    Full Text Available Patient-individual tumor models constitute a powerful platform for basic and translational analyses both in vitro and in vivo. However, due to the labor-intensive and highly time-consuming process, only few well-characterized patient-derived cell lines and/or corresponding xenografts exist. In this study, we describe successful generation and functional analysis of novel tumor models from patients with sporadic primary colorectal carcinomas (CRC showing CpG island methylator phenotype (CIMP. Initial DNA fingerprint analysis confirmed identity with the patient in all four cases. These freshly established cells showed characteristic features associated with the CIMP-phenotype (HROC40: APCwt, TP53 mut, KRAS mut; 3/8 marker methylated; HROC43: APC mut, TP53 mut, KRAS mut; 4/8 marker methylated; HROC60: APCwt, TP53 mut, KRASwt; 4/8 marker methylated; HROC183: APC mut, TP53 mut, KRAS mut; 6/8 marker methylated. Cell lines were of epithelial origin (EpCAM+ with distinct morphology and growth kinetics. Response to chemotherapeutics was quite individual between cells, with stage I-derived cell line HROC60 being most susceptible towards standard clinically approved chemotherapeutics (e.g. 5-FU, Irinotecan. Of note, most cell lines were sensitive towards "non-classical" CRC standard drugs (sensitivity: Gemcitabin > Rapamycin > Nilotinib. This comprehensive analysis of tumor biology, genetic alterations and assessment of chemosensitivity towards a broad range of (chemo- therapeutics helps bringing forward the concept of personalized tumor therapy.

  15. Amazon rainforest responses to elevated CO2: Deriving model-based hypotheses for the AmazonFACE experiment

    Rammig, A.; Fleischer, K.; Lapola, D.; Holm, J.; Hoosbeek, M.

    2017-12-01

    Increasing atmospheric CO2 concentration is assumed to have a stimulating effect ("CO2 fertilization effect") on forest growth and resilience. Empirical evidence, however, for the existence and strength of such a tropical CO2 fertilization effect is scarce and thus a major impediment for constraining the uncertainties in Earth System Model projections. The implications of the tropical CO2 effect are far-reaching, as it strongly influences the global carbon and water cycle, and hence future global climate. In the scope of the Amazon Free Air CO2 Enrichment (FACE) experiment, we addressed these uncertainties by assessing the CO2 fertilization effect at ecosystem scale. AmazonFACE is the first FACE experiment in an old-growth, highly diverse tropical rainforest. Here, we present a priori model-based hypotheses for the experiment derived from a set of 12 ecosystem models. Model simulations identified key uncertainties in our understanding of limiting processes and derived model-based hypotheses of expected ecosystem responses to elevated CO2 that can directly be tested during the experiment. Ambient model simulations compared satisfactorily with in-situ measurements of ecosystem carbon fluxes, as well as carbon, nitrogen, and phosphorus stocks. Models consistently predicted an increase in photosynthesis with elevated CO2, which declined over time due to developing limitations. The conversion of enhanced photosynthesis into biomass, and hence ecosystem carbon sequestration, varied strongly among the models due to different assumptions on nutrient limitation. Models with flexible allocation schemes consistently predicted an increased investment in belowground structures to alleviate nutrient limitation, in turn accelerating turnover rates of soil organic matter. The models diverged on the prediction for carbon accumulation after 10 years of elevated CO2, mainly due to contrasting assumptions in their phosphorus cycle representation. These differences define the expected

  16. Analysis of the bovine monocyte-derived macrophage response to Mycobacterium avium subspecies paratuberculosis infection using RNA-seq

    Maura E Casey

    2015-02-01

    Full Text Available Johne’s disease, caused by infection with Mycobacterium avium subsp. paratuberculosis, (MAP, is a chronic intestinal disease of ruminants with serious economic consequences for cattle production in the United States and elsewhere. During infection, MAP bacilli are phagocytosed and subvert host macrophage processes, resulting in subclinical infections that can lead to immunopathology and dissemination of disease. Analysis of the host macrophage transcriptome during infection can therefore shed light on the molecular mechanisms and host-pathogen interplay associated with Johne’s disease. Here we describe results of an in vitro study of the bovine monocyte-derived macrophage (MDM transcriptome response during MAP infection using RNA-seq. MDM were obtained from seven age- and sex-matched Holstein-Friesian cattle and were infected with MAP across a six-hour infection time course with non-infected controls. We observed 245 and 574 differentially expressed genes in MAP-infected versus non-infected control samples (adjusted P value ≤ 0.05 at 2 and 6 hours post-infection, respectively. Functional analyses of these differentially expressed genes, including biological pathway enrichment, highlighted potential functional roles for genes that have not been previously described in the host response to infection with MAP bacilli. In addition, differential expression of pro- and anti-inflammatory cytokine genes, such as those associated with the IL-10 signaling pathway, and other immune-related genes that encode proteins involved in the bovine macrophage response to MAP infection emphasize the balance between protective host immunity and bacilli survival and proliferation. Systematic comparisons of RNA-seq gene expression results with Affymetrix® microarray data generated from the same experimental samples also demonstrated that RNA-seq represents a superior technology for studying host transcriptional responses to intracellular infection.

  17. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  18. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  19. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  20. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  1. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  3. Serum brain-derived neurotrophic factor and interleukin-6 response to high-volume mechanically demanding exercise.

    Verbickas, Vaidas; Kamandulis, Sigitas; Snieckus, Audrius; Venckunas, Tomas; Baranauskiene, Neringa; Brazaitis, Marius; Satkunskiene, Danguole; Unikauskas, Alvydas; Skurvydas, Albertas

    2018-01-01

    The aim of this study was to follow circulating brain-derived neurotrophic factor (BDNF) and interleukin-6 (IL-6) levels in response to severe muscle-damaging exercise. Young healthy men (N = 10) performed a bout of mechanically demanding stretch-shortening cycle exercise consisting of 200 drop jumps. Voluntary and electrically induced knee extension torque, serum BDNF levels, and IL-6 levels were measured before and for up to 7 days after exercise. Muscle force decreased by up to 40% and did not recover by 24 hours after exercise. Serum BDNF was decreased 1 hour and 24 hours after exercise, whereas IL-6 increased immediately and 1 hour after but recovered to baseline by 24 hours after exercise. IL-6 and 100-Hz stimulation torque were correlated (r = -0.64, P exercise. In response to acute, severe muscle-damaging exercise, serum BDNF levels decrease, whereas IL-6 levels increase and are associated with peripheral fatigue. Muscle Nerve 57: E46-E51, 2018. © 2017 Wiley Periodicals, Inc.

  4. AWRK6, A Synthetic Cationic Peptide Derived from Antimicrobial Peptide Dybowskin-2CDYa, Inhibits Lipopolysaccharide-Induced Inflammatory Response

    Qiuyu Wang

    2018-02-01

    Full Text Available Lipopolysaccharides (LPS are major outer membrane components of Gram-negative bacteria and produce strong inflammatory responses in animals. Most antibiotics have shown little clinical anti-endotoxin activity while some antimicrobial peptides have proved to be effective in blocking LPS. Here, the anti-LPS activity of the synthetic peptide AWRK6, which is derived from antimicrobial peptide dybowskin-2CDYa, has been investigated in vitro and in vivo. The positively charged α-helical AWRK6 was found to be effective in blocking the binding of LBP (LPS binding protein with LPS in vitro using ELISA. In a murine endotoxemia model, AWRK6 offered satisfactory protection efficiency against endotoxemia death, and the serum levels of LPS, IL-1β, IL-6, and TNF-α were found to be attenuated using ELISA. Further, histopathological analysis suggested that AWRK6 could improve the healing of liver and lung injury in endotoxemia mice. The results of real-time PCR and Western blotting showed that AWRK6 significantly reversed LPS-induced TLR4 overexpression and IκB depression, as well as the enhanced IκB phosphorylation. Additionally, AWRK6 did not produce any significant toxicity in vivo and in vitro. In summary, AWRK6 showed efficacious protection from LPS challenges in vivo and in vitro, by blocking LPS binding to LBP, without obvious toxicity, providing a promising strategy against LPS-induced inflammatory responses.

  5. Human-induced pluripotent stem cell-derived macrophages and their immunological function in response to tuberculosis infection.

    Hong, Danping; Ding, Jiongyan; Li, Ouyang; He, Quan; Ke, Minxia; Zhu, Mengyi; Liu, Lili; Ou, Wen-Bin; He, Yulong; Wu, Yuehong

    2018-02-26

    Induced pluripotent stem cells (iPS) represent an innovative source for the standardized in vitro generation of macrophages (Mφ). Mφ show great promise in disease pathogenesis, particularly tuberculosis. However, there is no information about human iPS-derived (hiPS) macrophages (hiPS-Mφ) in response to tuberculosis infection. In the present study, macrophages derived from hiPS were established via embryoid body (EB) formation by using feeder-free culture conditions, and the human monocyte cell line THP-1 (THP-1-Mφ) was used as control. iPS-Mφ were characterized by using morphology, Giemsa staining, nonspecific esterase staining (α-NAE), phagocytosis, and surface phenotype. Additionally, after treatment with Bacillus Calmette-Guérin (BCG) for 24 h, cell apoptosis was detected by using an Annexin V-FITC Apoptosis Detection assay. The production of nitric oxide (NO), expression of tumor necrosis factor alpha (TNF-α), activity of apoptosis-related protein cysteine-3 (Caspase-3) and expression of B-cell lymphoma-2 (Bcl-2) were analyzed. With respect to morphology, surface phenotype, and function, the iPS-Mφ closely resembled their counterparts generated in vitro from a human monocyte cell line. iPS-Mφ exhibited the typically morphological characteristics of macrophages, such as round, oval, fusiform and irregular characteristics. The cells were Giemsa-stained-positive, α-NAE-positive, and possessed phagocytic ability. iPS-Mφ express high levels of CD14, CD11b, CD40, CD68, and major histocompatibility complex II (MHC-II). Moreover, with regard to the apoptotic rate, the production of NO, expression of TNF-α, and activity of Caspase-3 and Bcl-2, iPS-Mφ closely resemble that of their counterparts generated in vitro from human monocyte cell line in response to BCG infection. The rate of apoptosis of BCG-treated iPS-Mφ was 37.77 ± 7.94% compared to that of the untreated group at 4.97 ± 1.60% (P immunological function in response to Bacillus Calmette

  6. Utilization of a hybrid finite-element based registration method to quantify heterogeneous tumor response for adaptive treatment for lung cancer patients

    Sharifi, Hoda; Zhang, Hong; Bagher-Ebadian, Hassan; Lu, Wei; Ajlouni, Munther I.; Jin, Jian-Yue; (Spring Kong, Feng-Ming; Chetty, Indrin J.; Zhong, Hualiang

    2018-03-01

    Tumor response to radiation treatment (RT) can be evaluated from changes in metabolic activity between two positron emission tomography (PET) images. Activity changes at individual voxels in pre-treatment PET images (PET1), however, cannot be derived until their associated PET-CT (CT1) images are appropriately registered to during-treatment PET-CT (CT2) images. This study aimed to investigate the feasibility of using deformable image registration (DIR) techniques to quantify radiation-induced metabolic changes on PET images. Five patients with non-small-cell lung cancer (NSCLC) treated with adaptive radiotherapy were considered. PET-CTs were acquired two weeks before RT and 18 fractions after the start of RT. DIR was performed from CT1 to CT2 using B-Spline and diffeomorphic Demons algorithms. The resultant displacements in the tumor region were then corrected using a hybrid finite element method (FEM). Bitmap masks generated from gross tumor volumes (GTVs) in PET1 were deformed using the four different displacement vector fields (DVFs). The conservation of total lesion glycolysis (TLG) in GTVs was used as a criterion to evaluate the quality of these registrations. The deformed masks were united to form a large mask which was then partitioned into multiple layers from center to border. The averages of SUV changes over all the layers were 1.0  ±  1.3, 1.0  ±  1.2, 0.8  ±  1.3, 1.1  ±  1.5 for the B-Spline, B-Spline  +  FEM, Demons and Demons  +  FEM algorithms, respectively. TLG changes before and after mapping using B-Spline, Demons, hybrid-B-Spline, and hybrid-Demons registrations were 20.2%, 28.3%, 8.7%, and 2.2% on average, respectively. Compared to image intensity-based DIR algorithms, the hybrid FEM modeling technique is better in preserving TLG and could be useful for evaluation of tumor response for patients with regressing tumors.

  7. Immune responses of mature chicken bone-marrow-derived dendritic cells infected with Newcastle disease virus strains with differing pathogenicity.

    Xiang, Bin; Zhu, Wenxian; Li, Yaling; Gao, Pei; Liang, Jianpeng; Liu, Di; Ding, Chan; Liao, Ming; Kang, Yinfeng; Ren, Tao

    2018-06-01

    Infection of chickens with virulent Newcastle disease virus (NDV) is associated with severe pathology and increased morbidity and mortality. The innate immune response contributes to the pathogenicity of NDV. As professional antigen-presenting cells, dendritic cells (DCs) play a unique role in innate immunity. However, the contribution of DCs to NDV infection has not been investigated in chickens. In this study, we selected two representative NDV strains, i.e., the velogenic NDV strain Chicken/Guangdong/GM/2014 (GM) and the lentogenic NDV strain La Sota, to investigate whether NDVs could infect LPS-activated chicken bone-derived marrow DCs (mature chicken BM-DCs). We compared the viral titres and innate immune responses in mature chicken BM-DCs following infection with those strains. Both NDV strains could infect mature chicken BM-DC, but the GM strain showed stronger replication capacity than the La Sota strain in mature chicken BM-DCs. Gene expression profiling showed that MDA5, LGP2, TLR3, TLR7, IFN-α, IFN-β, IFN-γ, IL-1β, IL-6, IL-18, IL-8, CCL5, IL-10, IL-12, MHC-I, and MHC-II levels were altered in mature DCs after infection with NDVs at all evaluated times postinfection. Notably, the GM strain triggered stronger innate immune responses than the La Sota strain in chicken BM-DCs. However, both strains were able to suppress the expression of some cytokines, such as IL-6 and IFN-α, in mature chicken DCs at 24 hpi. These data provide a foundation for further investigation of the role of chicken DCs in NDV infection.

  8. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  9. Source-pathway-receptor investigation of the fate of trace elements derived from shotgun pellets discharged in terrestrial ecosystems managed for game shooting

    Sneddon, Jennifer; Clemente, Rafael; Riby, Philip; Lepp, Nicholas W.

    2009-01-01

    Spent shotgun pellets may contaminate terrestrial ecosystems. We examined the fate of elements originating from shotgun pellets in pasture and woodland ecosystems. Two source-receptor pathways: i) soil-soil pore water-plant and ii) whole earthworm/worm gut contents - washed and unwashed small mammal hair were investigated. Concentrations of Pb and associated contaminants were higher in soils from shot areas than controls. Arsenic and lead concentrations were positively correlated in soils, soil pore water and associated biota. Element concentrations in biota were below statutory levels in all locations. Bioavailability of lead to small mammals, based on concentrations in washed body hair was low. Lead movement from soil water to higher trophic levels was minor compared to lead adsorbed onto body surfaces. Lead was concentrated in earthworm gut and some plants. Results indicate that managed game shooting presents minimal risk in terms of element transfer to soils and their associated biota. - Source-receptor pathway analysis of a managed game shooting site showed no environmental risk of trace element transfer.

  10. Source-pathway-receptor investigation of the fate of trace elements derived from shotgun pellets discharged in terrestrial ecosystems managed for game shooting

    Sneddon, Jennifer [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom); Clemente, Rafael, E-mail: rclemente@cebas.csic.e [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom); Riby, Philip [School of Pharmacy and Chemistry, Liverpool John Moores University, Liverpool L3 3AF (United Kingdom); Lepp, Nicholas W., E-mail: n.w.lepp@ljmu.ac.u [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom)

    2009-10-15

    Spent shotgun pellets may contaminate terrestrial ecosystems. We examined the fate of elements originating from shotgun pellets in pasture and woodland ecosystems. Two source-receptor pathways: i) soil-soil pore water-plant and ii) whole earthworm/worm gut contents - washed and unwashed small mammal hair were investigated. Concentrations of Pb and associated contaminants were higher in soils from shot areas than controls. Arsenic and lead concentrations were positively correlated in soils, soil pore water and associated biota. Element concentrations in biota were below statutory levels in all locations. Bioavailability of lead to small mammals, based on concentrations in washed body hair was low. Lead movement from soil water to higher trophic levels was minor compared to lead adsorbed onto body surfaces. Lead was concentrated in earthworm gut and some plants. Results indicate that managed game shooting presents minimal risk in terms of element transfer to soils and their associated biota. - Source-receptor pathway analysis of a managed game shooting site showed no environmental risk of trace element transfer.

  11. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  12. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  13. Metabolite Profiling and Transcript Analysis Reveal Specificities in the Response of a Berry Derived Cell Culture to Abiotic Stresses

    Biruk eAyenew

    2015-09-01

    Full Text Available As climate changes, there is a need to understand the expected effects on viticulture. In nature, stresses exist in a combined manner, hampering the elucidation of the effect of individual cues on grape berry metabolism. Cell suspension culture originated from pea-size Gamy Red grape berry was used to harness metabolic response to high light (2500 µmol m-2s-1, high temperature (40 0C and their combination in comparison to 25 0C and 100 µmol m-2s-1 under controlled condition. When LC-MS and GC-MS based metabolite profiling was implemented and integrated with targeted RT-qPCR transcript analysis specific responses were observed to the different cues. High light enhanced polyphenol metabolism while high temperature and its combination with high light induced amino acid and organic acid metabolism with additional effect on polyphenols. The trend of increment in TCA cycle genes like ATCs, ACo1 and IDH in the combined treatment might support the observed increment in organic acids, GABA shunt, and their derivatives. The apparent phenylalanine reduction with polyphenol increment under high light suggests enhanced fueling of the precursor towards the downstream phenylpropanoid pathway. In the polyphenol metabolism, a differential pattern of expression of flavonoid 3’,5’ hydroxylase and flavonoid 3’ hydroxylase was observed under high light and combined cues which were accompanied by characteristic metabolite profiles. High temperature decreased glycosylated cyanidin and peonidin forms while the combined cues increased acetylated and coumarylated peonidin forms. Transcription factors regulating anthocyanin metabolism and their methylation, MYB, OMT, UFGT and DFR, were expressed differentially among the treatments, overall in agreement with the metabolite profiles. Taken together these data provide insights into the coordination of central and secondary metabolism in relation to multiple abiotic stresses.

  14. Terminal-Nerve-Derived Neuropeptide Y Modulates Physiological Responses in the Olfactory Epithelium of Hungry Axolotls (Ambystoma mexicanum)

    Mousley, Angela; Polese, Gianluca; Marks, Nikki J.; Eisthen, Heather L.

    2007-01-01

    The vertebrate brain actively regulates incoming sensory information, effectively filtering input and focusing attention toward environmental stimuli that are most relevant to the animal's behavioral context or physiological state. Such centrifugal modulation has been shown to play an important role in processing in the retina and cochlea, but has received relatively little attention in olfaction. The terminal nerve, a cranial nerve that extends underneath the lamina propria surrounding the olfactory epithelium, displays anatomical and neurochemical characteristics that suggest that it modulates activity in the olfactory epithelium. Using immunocytochemical techniques, we demonstrate that neuropeptide Y (NPY) is abundantly present in the terminal nerve in the axolotl (Ambystoma mexicanum), an aquatic salamander. Because NPY plays an important role in regulating appetite and hunger in many vertebrates, we investigated the possibility that NPY modulates activity in the olfactory epithelium in relation to the animal's hunger level. We therefore characterized the full length NPY gene from axolotls to enable synthesis of authentic axolotl NPY for use in electrophysiological experiments. We find that axolotl NPY modulates olfactory epithelial responses evoked by L-glutamic acid, a food-related odorant, but only in hungry animals. Similarly, whole-cell patch-clamp recordings demonstrate that bath application of axolotl NPY enhances the magnitude of a tetrodotoxin-sensitive inward current, but only in hungry animals. These results suggest that expression or activity of NPY receptors in the olfactory epithelium may change with hunger level, and that terminal nerve-derived peptides modulate activity in the olfactory epithelium in response to an animal's changing behavioral and physiological circumstances. PMID:16855098

  15. Terminal nerve-derived neuropeptide y modulates physiological responses in the olfactory epithelium of hungry axolotls (Ambystoma mexicanum).

    Mousley, Angela; Polese, Gianluca; Marks, Nikki J; Eisthen, Heather L

    2006-07-19

    The vertebrate brain actively regulates incoming sensory information, effectively filtering input and focusing attention toward environmental stimuli that are most relevant to the animal's behavioral context or physiological state. Such centrifugal modulation has been shown to play an important role in processing in the retina and cochlea, but has received relatively little attention in olfaction. The terminal nerve, a cranial nerve that extends underneath the lamina propria surrounding the olfactory epithelium, displays anatomical and neurochemical characteristics that suggest that it modulates activity in the olfactory epithelium. Using immunocytochemical techniques, we demonstrate that neuropeptide Y (NPY) is abundantly present in the terminal nerve in the axolotl (Ambystoma mexicanum), an aquatic salamander. Because NPY plays an important role in regulating appetite and hunger in many vertebrates, we investigated the possibility that NPY modulates activity in the olfactory epithelium in relation to the animal's hunger level. We therefore characterized the full-length NPY gene from axolotls to enable synthesis of authentic axolotl NPY for use in electrophysiological experiments. We find that axolotl NPY modulates olfactory epithelial responses evoked by l-glutamic acid, a food-related odorant, but only in hungry animals. Similarly, whole-cell patch-clamp recordings demonstrate that bath application of axolotl NPY enhances the magnitude of a tetrodotoxin-sensitive inward current, but only in hungry animals. These results suggest that expression or activity of NPY receptors in the olfactory epithelium may change with hunger level, and that terminal nerve-derived peptides modulate activity in the olfactory epithelium in response to an animal's changing behavioral and physiological circumstances.

  16. Role of Serum Brain Derived Neurotrophic Factor and Central N-Acetylaspartate for Clinical Response under Antidepressive Pharmacotherapy

    Sarah Nase

    2016-02-01

    Full Text Available Background: The predictive therapeutic value of brain derived neurotrophic factor (BDNF and its changes associated with the use of specific antidepressants are still unclear. In this study, we examined BDNF as a peripheral and NAA as a central biomarker over the time course of antidepressant treatment to specify both of their roles in the response to the medication and clinical outcome. Methods: We examined serum BDNF (ELISA kit in a sample of 76 (47 female and 29 male depressed patients in a naturalistic setting. BDNF was assessed before medication and subsequently after two, four and six weeks of antidepressant treatment. Additionally, in fifteen patients, N-acetylaspartate (NAA was measured in the anterior cingulate cortex (ACC with magnetic resonance spectroscopy (MRS. Over a time course of six weeks BDNF and NAA were also examined in a group of 41 healthy controls. Results: We found significant lower serum BDNF concentrations in depressed patients compared to the sample of healthy volunteers before and after medication. BDNF and clinical symptoms decreased significantly in the patients over the time course of antidepressant treatment. Serum BDNF levels at baseline predicted the symptom outcome after eight weeks. Specifically, responders and remitters had lower serum BDNF at baseline than the nonresponders and nonremitters. NAA was slightly decreased but not significantly lower in depressed patients when compared with healthy controls. During treatment period, NAA showed a tendency to increase. Limitations: A relative high drop-out rate and possibly, a suboptimal observation period for BDNF. Conclusion: Our data confirm serum BDNF as a biomarker of depression with a possible role in response prediction. However, our findings argue against serum BDNF increase being a prerequisite to depressive symptom reduction.

  17. Metabolic Symbiosis and Immunomodulation: How Tumor Cell-Derived Lactate May Disturb Innate and Adaptive Immune Responses

    Alexandre Morrot

    2018-03-01

    Full Text Available The tumor microenvironment (TME is composed by cellular and non-cellular components. Examples include the following: (i bone marrow-derived inflammatory cells, (ii fibroblasts, (iii blood vessels, (iv immune cells, and (v extracellular matrix components. In most cases, this combination of components may result in an inhospitable environment, in which a significant retrenchment in nutrients and oxygen considerably disturbs cell metabolism. Cancer cells are characterized by an enhanced uptake and utilization of glucose, a phenomenon described by Otto Warburg over 90 years ago. One of the main products of this reprogrammed cell metabolism is lactate. “Lactagenic” or lactate-producing cancer cells are characterized by their immunomodulatory properties, since lactate, the end product of the aerobic glycolysis, besides acting as an inducer of cellular signaling phenomena to influence cellular fate, might also play a role as an immunosuppressive metabolite. Over the last 10 years, it has been well accepted that in the TME, the lactate secreted by transformed cells is able to compromise the function and/or assembly of an effective immune response against tumors. Herein, we will discuss recent advances regarding the deleterious effect of high concentrations of lactate on the tumor-infiltrating immune cells, which might characterize an innovative way of understanding the tumor-immune privilege.

  18. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  19. New approach to nonleptonic weak interactions. I. Derivation of asymptotic selection rules for the two-particle weak ground-state-hadron matrix elements

    Tanuma, T.; Oneda, S.; Terasaki, K.

    1984-01-01

    A new approach to nonleptonic weak interactions is presented. It is argued that the presence and violation of the Vertical BarΔIVertical Bar = 1/2 rule as well as those of the quark-line selection rules can be explained in a unified way, along with other fundamental physical quantities [such as the value of g/sub A/(0) and the smallness of the isoscalar nucleon magnetic moments], in terms of a single dynamical asymptotic ansatz imposed at the level of observable hadrons. The ansatz prescribes a way in which asymptotic flavor SU(N) symmetry is secured levelwise for a certain class of chiral algebras in the standard QCD model. It yields severe asymptotic constraints upon the two-particle hadronic matrix elements of nonleptonic weak Hamiltonians as well as QCD currents and their charges. It produces for weak matrix elements the asymptotic Vertical BarΔIVertical Bar = 1/2 rule and its charm counterpart for the ground-state hadrons, while for strong matrix elements quark-line-like approximate selection rules. However, for the less important weak two-particle vertices involving higher excited states, the Vertical BarΔIVertical Bar = 1/2 rule and its charm counterpart are in general violated, providing us with an explicit source of the violation of these selection rules in physical processes

  20. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  1. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  2. Clonorchis sinensis adult-derived proteins elicit Th2 immune responses by regulating dendritic cells via mannose receptor.

    Lu Zhao

    2018-03-01

    Full Text Available Clonorchis sinensis (C. sinensis is the most widespread human liver fluke in East Asia including China and Korea. Clonorchiasis as a neglected tropical zoonosis, leads to serious economic and public health burden in China. There are considerable evidences for an etiological relation between chronic clonorchiasis and liver fibrosis in human beings. Liver fibrosis is a highly conserved and over-protected response to hepatic tissue injury. Immune cells including CD4+ T cell as well as dendritic cell (DC, and pro-fibrogenic cytokines like interleukin 4 (IL-4, IL-13 have been identified as vital manipulators in liver fibrogenesis. Our previous studies had a mere glimpse of T helper type 2 (Th2 dominant immune responses as key players in liver fibrosis induced by C. sinensis infection, but little is known about the involved mechanisms in this pathological process.By flow cytometry (FACS, adult-derived total proteins of C. sinensis (CsTPs down-regulated the expression of surface markers CD80, CD86 and major histocompatibility complex class II (MHC-II on lipopolysaccharide (LPS induced DC. ELISA results demonstrated that CsTPs inhibited IL-12p70 release from LPS-treated bone marrow-derived dendritic cells (BMDC. IL-10 level increased in a time-dependent manner in LPS-treated BMDCs after incubation with CsTPs. CD4+ T cells incubated with LPS-treated BMDCs plus CsTPs could significantly elevate IL-4 level by ELISA. Meanwhile, elevated expression of pro-fibrogenic mediators including IL-13 and IL-4 were detected in a co-culture system of LPS-activated BMDCs and naive T cells containing CsTPs. In vivo, CsTPs-immunized mice enhanced expression of type 2 cytokines IL-13, IL-10 and IL-4 in both splenocytes and hepatic tissue. Exposure of BMDCs to CsTPs activated expression of mannose receptor (MR but not toll like receptor 2 (TLR2, TLR4, C-type lectin receptor DC-SIGN and Dectin-2 on the cell surface by RT-PCR and FACS. Blockade of MR almost completely

  3. A case report of spontaneous mutation (C33>U) in the iron-responsive element of L-ferritin causing hyperferritinemia-cataract syndrome.

    Cao, Wei

    2010-01-15

    The hereditary hyperferritinemia cataract syndrome (HHCS) is an autosomal dominant disorder characterized by juvenile-onset cataracts and elevated serum ferritin levels. It is caused by mutation in the iron response element (IRE) within the 5\\'UTR of L-ferritin gene. The mutation results in a loss of post-transcriptional negative feedback exerted by the interaction between iron regulatory proteins 1, 2 (IRP1 and IRP2) and IRE, which leads to uncontrolled expression of L-ferritin. In this paper, we describe the molecular pathogenesis of non-hereditary hyperferritinemia cataract syndrome (non-H-HCS) in a patient with typical HHCS ocular lens morphology and high ferritin levels without obvious family history. Initial sequencing of the full-length L-ferritin cloned from genomic DNA demonstrated a mutation (C33>T) in the IRE of the affected patient but not in her unaffected family members. The mutation (C\\/T heterozygote) was also detected in cDNA derived from her blood mononuclear cells. Structure-prediction-modeling indicates that this mutation would significantly alter the secondary structure of the IRE, resulting in a loss of the interaction between IRP and IRE. By using IRP1\\/IRP2-human IgG1 Fc fusion proteins, we established a novel in vitro report system (modified ELISA) to verify impaired IRE\\/IRP binding. Both the C33>U and A40G mutations (the first identified mutation for HHCS) showed a dramatically decreased binding to IRP1\\/IRP2 protein, compared to the normal IRE RNA. Surprisingly, a decrease in L-ferritin mRNA levels was observed in the affected patient compared to controls suggesting a mechanism of transcriptional negative feedback by high intracellular L-ferritin protein levels not described heretofore. Taken together, spontaneous mutation in the IRE of L-ferritin may cause non-H-HCS by the same mechanism as HHCS. In addition, under abnormal circumstances, the protein level of L-ferritin may be principally controlled by post

  4. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  5. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  6. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  7. Plant-derived SAC domain of PAR-4 (Prostate Apoptosis Response 4 exhibits growth inhibitory effects in prostate cancer cells

    Shayan eSarkar

    2015-10-01

    Full Text Available The gene Par-4 (Prostate Apoptosis Response 4 was originally identified in prostate cancer cells undergoing apoptosis and its product Par-4 showed cancer specific pro-apoptotic activity. Particularly, the SAC domain of Par-4 (SAC-Par-4 selectively kills cancer cells leaving normal cells unaffected. The therapeutic significance of bioactive SAC-Par-4 is enormous in cancer biology; however, its large scale production is still a matter of concern. Here we report the production of SAC-Par-4-GFP fusion protein coupled to translational enhancer sequence (5′ AMV and apoplast signal peptide (aTP in transgenic Nicotiana tabacum cv. Samsun NN plants under the control of a unique recombinant promoter M24. Transgene integration was confirmed by genomic DNA PCR, Southern and Northern blotting, Real-time PCR and Nuclear run-on assays. Results of Western blot analysis and ELISA confirmed expression of recombinant SAC-Par-4-GFP protein and it was as high as 0.15% of total soluble protein. In addition, we found that targeting of plant recombinant SAC-Par-4-GFP to the apoplast and endoplasmic reticulum (ER was essential for the stability of plant recombinant protein in comparison to the bacterial derived SAC-Par-4. Deglycosylation analysis demonstrated that ER-targeted SAC-Par-4-GFP-SEKDEL undergoes O-linked glycosylation unlike apoplast-targeted SAC-Par-4-GFP. Furthermore, various in vitro studies like mammalian cells proliferation assay (MTT, apoptosis induction assays, and NF-κB suppression suggested the cytotoxic and apoptotic properties of plant-derived SAC-Par-4-GFP against multiple prostate cancer cell lines. Additionally, pre-treatment of MAT-LyLu prostate cancer cells with purified SAC-Par-4-GFP significantly delayed the onset of tumor in a syngeneic rat prostate cancer model. Taken altogether, we proclaim that plant made SAC-Par-4 may become a useful alternate therapy for effectively alleviating cancer in the new era.

  8. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  9. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  10. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  11. Studies on synthesis of a kind of new colour reagents bromophosphonobisazo derivatives of chromotropic acid and the effect of their constitution on colour behaviours with rare earth elements

    Bincai, W.; Yuxin, Q.; Hengchuan, L.

    1985-01-01

    Based on the previous systematic studies, this paper reports to the original constitution of chlorophosphonazo type of colour reagents, has been reformed, and a kind of 14 new asymmetrical bromophosphonobisazo colour reagents of chromotropic acid have been designed and synthesized. In the meanwhile, the relationship between constitution of colour reagents and its behaviour in colour reaction with rare earth elements has been investigated. In addition, the general colour behaviours of these reagents and the influence of organic solvents and surfactants have been preliminarily studied

  12. 68Ga-PSMA-11 PET/CT-derived metabolic parameters for determination of whole-body tumor burden and treatment response in prostate cancer.

    Schmidkonz, Christian; Cordes, Michael; Schmidt, Daniela; Bäuerle, Tobias; Goetz, Theresa Ida; Beck, Michael; Prante, Olaf; Cavallaro, Alexander; Uder, Michael; Wullich, Bernd; Goebell, Peter; Kuwert, Torsten; Ritt, Philipp

    2018-05-03

    We aimed at evaluating the role of 68 Ga-PSMA-11 PET/CT-derived metabolic parameters for assessment of whole-body tumor burden and its capability to determine therapeutic response in patients with prostate cancer. A total of 142 patients with biochemical recurrence of prostate cancer underwent PET/CT with [ 68 Ga]Ga-PSMA-HBED-CC ( 68 Ga-PSMA-11). Quantitative assessment of all 641 68 Ga-PSMA-11-positive lesions in the field of view was performed to calculate PSMA-derived parameters, including whole-body PSMA tumor volume (PSMA-TV) and whole-body total lesion PSMA (TL-PSMA), as well as the established SUVmax and SUVmean values. All PET-derived parameters were tested for correlation with serum PSA levels and for association with Gleason scores. In 23 patients who underwent 68 Ga-PSMA-11 PET/CT before and after therapy with either external beam radiation, androgen deprivation, or docetaxel chemotherapy, SUVmax and TL-PSMA were compared to radiographic response assessment of CT images based on RECIST 1.1 criteria and to biochemical response determined by changes of serum PSA levels. PSMA-TV and TL-PSMA demonstrated a significant correlation with serum PSA levels (P PET and biochemical response was 87% (95% confidence interval, 0.66-0.97; Cohen's κ = 0.78; P PET and CT were most likely due to limitations of CT and RECIST in rating small lymph nodes as metastases, as well as bone involvement, which was sometimes not detectable in CT. 68 Ga-PSMA-11 PET/CT-derived metabolic tumor parameters showed promising results for evaluation of treatment response. Especially, TL-PSMA demonstrated higher agreement rates with biochemical response compared to SUVmax. Larger, ideally prospective trials are needed to help to reveal the full potential of metabolic parameters derived from PET imaging with 68 Ga-PSMA-11.

  13. Interaction of inflammatory and anti-inflammatory responses in microglia by Staphylococcus aureus-derived lipoteichoic acid

    Huang, Bor-Ren; Tsai, Cheng-Fang; Lin, Hsiao-Yun; Tseng, Wen-Pei; Huang, Shiang-Suo; Wu, Chi-Rei; Lin, Chingju; Yeh, Wei-Lan; Lu, Dah-Yuu

    2013-01-01

    We investigated the interaction between proinflammatory and inflammatory responses caused by Staphylococcus aureus-derived lipoteichoic acid (LTA) in primary cultured microglial cells and BV-2 microglia. LTA induced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) protein levels increase in a concentration- and time-dependent manner. Meanwhile, LTA also increased nitric oxide (NO) and PGE 2 production in microglia. Administration of TLR2 antagonist effectively inhibited LTA-induced NO, iNOS, and COX-2 expression. Moreover, treatment of cells with LTA caused a time-dependent activation of ERK, p38, JNK, as well as AKT. We also found that LTA-induced iNOS and COX-2 up-regulation were attenuated by p38, JNK, and PI3-kinase inhibitors. On the other hand, LTA-enhanced HO-1 expression was attenuated by p38 and PI3-kinase inhibitors. Treatment of cells with NF-κB and AP-1 inhibitors antagonized LTA-induced iNOS and COX-2 expression. However, only NF-κB inhibitors reduced LTA-induced HO-1 expression in microglia. Furthermore, stimulation of cells with LTA also activated IκBα phosphorylation, p65 phosphorylation at Ser 536 , and c-Jun phosphorylation. Moreover, LTA-induced increases of κB-DNA and AP-1-DNA binding activity were inhibited by p38, JNK, and PI3-kinase inhibitors. HO-1 activator CoPP IX dramatically reversed LTA-induced iNOS expression. Our results provided mechanisms linking LTA and inflammation/anti-inflammation, and indicated that LTA plays a regulatory role in microglia activation. - Highlights: • LTA causes an increase in iNOS, COX-2, and HO-1 expression in microglia. • LTA induces iNOS and COX-2 expression through TLR-2/NF-κB and AP-1 pathways. • HO-1 expression is regulated through p38, JNK, PI3K/AKT and AP-1 pathways. • Induced HO-1 reduces LTA-induced iNOS expression. • LTA plays a regulatory role on inflammatory/anti-inflammatory responses

  14. Interaction of inflammatory and anti-inflammatory responses in microglia by Staphylococcus aureus-derived lipoteichoic acid

    Huang, Bor-Ren [Department of Neurosurgery, Buddhist Tzu Chi General Hospital, Taichung Branch, Taichung, Taiwan (China); Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Tsai, Cheng-Fang [Department of Biotechnology, Asia University, Taichung, Taiwan (China); Lin, Hsiao-Yun [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan (China); Tseng, Wen-Pei [Graduate Institute of Sports and Health, National Changhua University of Education, Changhua County, Taiwan (China); Huang, Shiang-Suo [Department of Pharmacology and Institute of Medicine, College of Medicine, Chung Shan Medical University, Taiwan (China); Wu, Chi-Rei [Graduate Institute of Chinese Pharmaceutical Sciences, College of Pharmacy, China Medical University, Taiwan (China); Lin, Chingju [Department of Physiology, School of Medicine, China Medical University, Taichung, Taiwan (China); Yeh, Wei-Lan [Cancer Research Center, Department of Medical Research, Changhua Christian Hospital, Changhua, Taiwan (China); Lu, Dah-Yuu, E-mail: dahyuu@mail.cmu.edu.tw [Graduate Institute of Neural and Cognitive Sciences, China Medical University, Taichung, Taiwan (China)

    2013-05-15

    We investigated the interaction between proinflammatory and inflammatory responses caused by Staphylococcus aureus-derived lipoteichoic acid (LTA) in primary cultured microglial cells and BV-2 microglia. LTA induced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) protein levels increase in a concentration- and time-dependent manner. Meanwhile, LTA also increased nitric oxide (NO) and PGE{sub 2} production in microglia. Administration of TLR2 antagonist effectively inhibited LTA-induced NO, iNOS, and COX-2 expression. Moreover, treatment of cells with LTA caused a time-dependent activation of ERK, p38, JNK, as well as AKT. We also found that LTA-induced iNOS and COX-2 up-regulation were attenuated by p38, JNK, and PI3-kinase inhibitors. On the other hand, LTA-enhanced HO-1 expression was attenuated by p38 and PI3-kinase inhibitors. Treatment of cells with NF-κB and AP-1 inhibitors antagonized LTA-induced iNOS and COX-2 expression. However, only NF-κB inhibitors reduced LTA-induced HO-1 expression in microglia. Furthermore, stimulation of cells with LTA also activated IκBα phosphorylation, p65 phosphorylation at Ser{sup 536}, and c-Jun phosphorylation. Moreover, LTA-induced increases of κB-DNA and AP-1-DNA binding activity were inhibited by p38, JNK, and PI3-kinase inhibitors. HO-1 activator CoPP IX dramatically reversed LTA-induced iNOS expression. Our results provided mechanisms linking LTA and inflammation/anti-inflammation, and indicated that LTA plays a regulatory role in microglia activation. - Highlights: • LTA causes an increase in iNOS, COX-2, and HO-1 expression in microglia. • LTA induces iNOS and COX-2 expression through TLR-2/NF-κB and AP-1 pathways. • HO-1 expression is regulated through p38, JNK, PI3K/AKT and AP-1 pathways. • Induced HO-1 reduces LTA-induced iNOS expression. • LTA plays a regulatory role on inflammatory/anti-inflammatory responses.

  15. Immobilized Burkholderia cepacia Lipase on pH-Responsive Pullulan Derivatives with Improved Enantioselectivity in Chiral Resolution

    Li Xu

    2018-01-01

    Full Text Available A kind of pH-responsive particle was synthesized using modified pullulan polysaccharide. The synthesized particle possessed a series of merits, such as good dispersity, chemical stability and variability of particle size, making it a suitable carrier for enzyme immobilization. Then, Burkholderia cepacia lipase (BCL, a promising biocatalyst in transesterification reaction, was immobilized on the synthesized particle. The highest catalytic activity and immobilization efficiency were achieved at pH 6.5 because the particle size was obviously enlarged and correspondingly the adsorption surface for BCL was significantly increased. The immobilization enzyme loading was further optimized, and the derivative lipase was applied in chiral resolution. Under the optimal reaction conditions, the immobilized BCL showed a very good performance and significantly shortened the reaction equilibrium time from 30 h of the free lipase to 2 h with a conversion rate of 50.0% and ees at 99.2%. The immobilized lipase also exhibited good operational stability; after being used for 10 cycles, it still retained over 80% of its original activity. Moreover, it could keep more than 80% activity after storage for 20 days at room temperature in a dry environment. In addition, to learn the potential mechanism, the morphology of the particles and the immobilized lipase were both characterized with a scanning electron microscope and confocal laser scanning microscopy. It was found that the enlarged spherical surface of the particle in low pH values probably led to high immobilized efficiency, resulting in the improvement of enantioselectivity activity in chiral resolution.

  16. Homology-guided mutational analysis reveals the functional requirements for antinociceptive specificity of collapsin response mediator protein 2-derived peptides.

    Moutal, Aubin; Li, Wennan; Wang, Yue; Ju, Weina; Luo, Shizhen; Cai, Song; François-Moutal, Liberty; Perez-Miller, Samantha; Hu, Jackie; Dustrude, Erik T; Vanderah, Todd W; Gokhale, Vijay; Khanna, May; Khanna, Rajesh

    2017-02-05

    N-type voltage-gated calcium (Ca v 2.2) channels are critical determinants of increased neuronal excitability and neurotransmission accompanying persistent neuropathic pain. Although Ca v 2.2 channel antagonists are recommended as first-line treatment for neuropathic pain, calcium-current blocking gabapentinoids inadequately alleviate chronic pain symptoms and often exhibit numerous side effects. Collapsin response mediator protein 2 (CRMP2) targets Ca v 2.2 channels to the sensory neuron membrane and allosterically modulates their function. A 15-amino-acid peptide (CBD3), derived from CRMP2, disrupts the functional protein-protein interaction between CRMP2 and Ca v 2.2 channels to inhibit calcium influx, transmitter release and acute, inflammatory and neuropathic pain. Here, we have mapped the minimal domain of CBD3 necessary for its antinociceptive potential. Truncated as well as homology-guided mutant versions of CBD3 were generated and assessed using depolarization-evoked calcium influx in rat dorsal root ganglion neurons, binding between CRMP2 and Ca v 2.2 channels, whole-cell voltage clamp electrophysiology and behavioural effects in two models of experimental pain: post-surgical pain and HIV-induced sensory neuropathy induced by the viral glycoprotein 120. The first six amino acids within CBD3 accounted for all in vitro activity and antinociception. Spinal administration of a prototypical peptide (TAT-CBD3-L5M) reversed pain behaviours. Homology-guided mutational analyses of these six amino acids identified at least two residues, Ala1 and Arg4, as being critical for antinociception in two pain models. These results identify an antinociceptive scaffold core in CBD3 that can be used for development of low MW mimetics of CBD3. © 2017 The British Pharmacological Society.

  17. Transfer RNA Derived Small RNAs Targeting Defense Responsive Genes Are Induced during Phytophthora capsici Infection in Black Pepper (Piper nigrum L.).

    Asha, Srinivasan; Soniya, Eppurath V

    2016-01-01

    Small RNAs derived from transfer RNAs were recently assigned as potential gene regulatory candidates for various stress responses in eukaryotes. In this study, we report on the cloning and identification of tRNA derived small RNAs from black pepper plants in response to the infection of the quick wilt pathogen, Phytophthora capsici. 5'tRFs cloned from black pepper were validated as highly expressed during P. capsici infection. A high-throughput systematic analysis of the small RNAome (sRNAome) revealed the predominance of 5'tRFs in the infected leaf and root. The abundance of 5'tRFs in the sRNAome and the defense responsive genes as their potential targets indicated their regulatory role during stress response in black pepper. The 5'Ala(CGC) tRF mediated cleavage was experimentally mapped at the tRF binding sites on the mRNA targets of Non-expresser of pathogenesis related protein (NPR1), which was down-regulated during pathogen infection. Comparative sRNAome further demonstrated sequence conservation of 5'Ala tRFs across the angiosperm plant groups, and many important genes in the defense response were identified in silico as their potential targets. Our findings uncovered the diversity, differential expression and stress responsive functional role of tRNA-derived small RNAs during Phytophthora infection in black pepper.

  18. Radiological safety aspects in the fabrication of mixed oxide fuel elements. [Derived working limits in air and water for plutonium, enriched uranium and their mixture

    Krishnamurthi, T.N.; Janardhanan, S.; Soman, S.D. (Bhabha Atomic Research Centre, Bombay (India). Health Physics Div.)

    The problems of radiological safety in the fabrication of (U, Pu)O/sub 2/ fuel assemblies for fast reactors utilising high exposure plutonium are discussed. Derived working limits for plutonium as a function of the burn-up of RAPS (Rajasthan Atomic Power Station) fuel, external gamma and neutron exposures from feed product batches, finished fuel pins and assemblies are presented. Shielding requirements for the various glove box operations are also indicated. In general, high exposure plutonium handling calls for remote fabrication and automation at various stages would play a key role in minimising exposures to personnel in a large production plant.

  19. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  20. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  1. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  2. Cordance derived from REM sleep EEG as a biomarker for treatment response in depression--a naturalistic study after antidepressant medication

    Adamczyk, M.; Gazea, M.; Wollweber, B.; Holsboer, F.; Dresler, M.; Steiger, A.; Pawlowski, M.

    2015-01-01

    OBJECTIVE: To evaluate whether prefrontal cordance in theta frequency band derived from REM sleep EEG after the first week of antidepressant medication could characterize the treatment response after 4 weeks of therapy in depressed patients. METHOD: 20 in-patients (15 females, 5 males) with a

  3. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  4. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  5. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  6. Comparative analysis of mosquito (Diptera: Culicidae: Aedes aegypti Liston) responses to the insecticide Temephos and plant derived essential oil derived from Piper betle L.

    Vasantha-Srinivasan, Prabhakaran; Senthil-Nathan, Sengottayan; Ponsankar, Athirstam; Thanigaivel, Annamalai; Edwin, Edward-Sam; Selin-Rani, Selvaraj; Chellappandian, Muthiah; Pradeepa, Venkatraman; Lija-Escaline, Jalasteen; Kalaivani, Kandaswamy; Hunter, Wayne B; Duraipandiyan, Veeramuthu; Al-Dhabi, Naif Abdullah

    2017-05-01

    Resistance to treatments with Temephos or plant derived oil, Pb-CVO, between a field collected Wild Strain (WS) and a susceptible Laboratory Strain (LS) of Ae. aegypti were measured. The Temephos (0.1mg/L) showed the greatest percentage of mosquito mortality compared to Pb-CVO (1.5mg/L) in LS Ae. aegypti. However, WS Ae. aegypti was not significantly affected by Temephos (0.1mg/L) treatment compare to the Pb-CVO (1.5mg/L). However, both strains (LS and WS) when treated with Pb-CVO (1.5mg/L) displayed steady larval mortality rate across all instars. The LC 50 of Temephos was 0.027mg in LS, but increased in WS to 0.081mg/L. The LC 50 of Pb-CVO treatment was observed at concentrations of 0.72 and 0.64mg/L for LS and WS strains respectively. The enzyme level of α- and β-carboxylesterase was reduced significantly in both mosquito strains treated with Pb-CVO. Whereas, there was a prominent deviation in the enzyme ratio observed between LS and WS treated with Temephos. The GST and CYP450 levels were upregulated in the LS, but decreased in WS, after treatment with Temephos. However, treatment with Pb-CVO caused both enzyme levels to increase significantly in both the strains. Visual observations of the midgut revealed cytotoxicity from sub-lethal concentrations of Temephos (0.04mg/L) and Pb-CVO (1.0mg/L) in both strains of Ae. aegypti compared to the control. The damage caused by Temephos was slightly less in WS compared to LS mosquito strains. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  8. Radiographic element

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  9. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  10. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  11. A new adenovirus based vaccine vector expressing an Eimeria tenella derived TLR agonist improves cellular immune responses to an antigenic target.

    Daniel M Appledorn

    2010-03-01

    Full Text Available Adenoviral based vectors remain promising vaccine platforms for use against numerous pathogens, including HIV. Recent vaccine trials utilizing Adenovirus based vaccines expressing HIV antigens confirmed induction of cellular immune responses, but these responses failed to prevent HIV infections in vaccinees. This illustrates the need to develop vaccine formulations capable of generating more potent T-cell responses to HIV antigens, such as HIV-Gag, since robust immune responses to this antigen correlate with improved outcomes in long-term non-progressor HIV infected individuals.In this study we designed a novel vaccine strategy utilizing an Ad-based vector expressing a potent TLR agonist derived from Eimeria tenella as an adjuvant to improve immune responses from a [E1-]Ad-based HIV-Gag vaccine. Our results confirm that expression of rEA elicits significantly increased TLR mediated innate immune responses as measured by the influx of plasma cytokines and chemokines, and activation of innate immune responding cells. Furthermore, our data show that the quantity and quality of HIV-Gag specific CD8(+ and CD8(- T-cell responses were significantly improved when coupled with rEA expression. These responses also correlated with a significantly increased number of HIV-Gag derived epitopes being recognized by host T cells. Finally, functional assays confirmed that rEA expression significantly improved antigen specific CTL responses, in vivo. Moreover, we show that these improved responses were dependent upon improved TLR pathway interactions.The data presented in this study illustrate the potential utility of Ad-based vectors expressing TLR agonists to improve clinical outcomes dependent upon induction of robust, antigen specific immune responses.

  12. Glucose concentrations modulate brain-derived neurotrophic factor responsiveness of neurones in the paraventricular nucleus of the hypothalamus.

    McIsaac, W; Ferguson, A V

    2017-04-01

    The hypothalamic paraventricular nucleus (PVN) is critical for normal energy balance and has been shown to contain high levels of both brain-derived neurotrophic factor (BDNF) and tropomyosin-receptor kinase B mRNA. Microinjections of BDNF into the PVN increase energy expenditure, suggesting that BDNF plays an important role in energy homeostasis through direct actions in this nucleus. The present study aimed to examine the postsynaptic effects of BDNF on the membrane potential of PVN neurones, and also to determine whether extracellular glucose concentrations modulated these effects. We used hypothalamic PVN slices from male Sprague-Dawley rats to perform whole cell current-clamp recordings from PVN neurones. BDNF was bath applied at a concentration of 2 nmol L -1 and the effects on membrane potential determined. BDNF caused depolarisations in 54% of neurones (n=25; mean±SEM, 8.9±1.2 mV) and hyperpolarisations in 23% (n=11; -6.7±1.4 mV), whereas the remaining cells were unaffected. These effects were maintained in the presence of tetrodotoxin (n=9; 56% depolarised, 22% hyperpolarised, 22% nonresponders), or the GABA a antagonist bicuculline (n=12; 42% depolarised, 17% hyperpolarised, 41% nonresponders), supporting the conclusion that these effects on membrane potential were postsynaptic. Current-clamp recordings from PVN neurones next examined the effects of BDNF on these neurones at varying extracellular glucose concentrations. Larger proportions of PVN neurones hyperpolarised in response to BDNF as the glucose concentrations decreased [10 mmol L -1 glucose 23% (n=11) of neurones hyperpolarised, whereas, at 0.2 mmol L -1 glucose, 71% showed hyperpolarising effects (n=12)]. Our findings reveal that BDNF has direct GABA A independent effects on PVN neurones, which are modulated by local glucose concentrations. The latter observation further emphasises the critical importance of using physiologically relevant conditions in an investigation of the central

  13. Matrix- and plasma-derived peptides promote tissue-specific injury responses and wound healing in diabetic swine.

    Sheets, Anthony R; Massey, Conner J; Cronk, Stephen M; Iafrati, Mark D; Herman, Ira M

    2016-07-02

    Non-healing wounds are a major global health concern and account for the majority of non-traumatic limb amputations worldwide. However, compared to standard care practices, few advanced therapeutics effectively resolve these injuries stemming from cardiovascular disease, aging, and diabetes-related vasculopathies. While matrix turnover is disrupted in these injuries, debriding enzymes may promote healing by releasing matrix fragments that induce cell migration, proliferation, and morphogenesis, and plasma products may also stimulate these processes. Thus, we created matrix- and plasma-derived peptides, Comb1 and UN3, which induce cellular injury responses in vitro, and accelerate healing in rodent models of non-healing wounds. However, the effects of these peptides in non-healing wounds in diabetes are not known. Here, we interrogated whether these peptides stimulate healing in a diabetic porcine model highly reminiscent of human healing impairments in type 1 and type 2-diabetes. After 3-6 weeks of streptozotocin-induced diabetes, full-thickness wounds were surgically created on the backs of adult female Yorkshire swine under general anesthesia. Comb1 and UN3 peptides or sterile saline (negative control) were administered to wounds daily for 3-7 days. Following sacrifice, wound tissues were harvested, and quantitative histological and immunohistochemical analyses were performed for wound closure, angiogenesis and granulation tissue deposition, along with quantitative molecular analyses of factors critical for angiogenesis, epithelialization, and dermal matrix remodeling. Comb1 and UN3 significantly increase re-epithelialization and angiogenesis in diabetic porcine wounds, compared to saline-treated controls. Additionally, fluorescein-conjugated Comb1 labels keratinocytes, fibroblasts, and vascular endothelial cells in porcine wounds, and Far western blotting reveals these cell populations express multiple fluorescein-Comb1-interacting proteins in vitro. Further

  14. Large magnetic coils-design accompanying calculation and optimization. Regarding orthotropic interlayers, temperature and elastic supports-derivation of a special finite element

    Stelzer, J.F.; Sievers, A.; Welzel, R.

    1976-10-01

    This paper deals with finite element calculations of large coils as they are used as main coils in Tokamaks. They consist of copper layers with glass fibre reinforced resin interlayers inbedded in a strong steel ring. In a first analysis model the several epoxy layers are condensed to only one the tickness of which is equal to the sum of the single sizes. This fictitious layer is assumed to lie in the middle of the copper and is treated as an orthotropic material. In a following changed model the epoxy layer is situated between the steel ring and the copper. In this location the epoxy was suspected to suffer from the highest shear stresses. Both models employ springy trusses as supporting features which simulate the real elastic behaviour of a sustaining vault. Special attentions are given a) to the shear stresses in the epoxy, b) to the hot and cold states of the coils, and c) to the forces transferred from the coils to the sustaining vault. An optimal structure design is carried out concerning the steel ring. (orig./GG) [de

  15. Investigating the mechanical function of the cervix during pregnancy using finite element models derived from high-resolution 3D MRI.

    Fernandez, M; House, M; Jambawalikar, S; Zork, N; Vink, J; Wapner, R; Myers, K

    2016-01-01

    Preterm birth is a strong contributor to perinatal mortality, and preterm infants that survive are at risk for long-term morbidities. During most of pregnancy, appropriate mechanical function of the cervix is required to maintain the developing fetus in utero. Premature cervical softening and subsequent cervical shortening are hypothesized to cause preterm birth. Presently, there is a lack of understanding of the structural and material factors that influence the mechanical function of the cervix during pregnancy. In this study we build finite element models of the pregnant uterus, cervix, and fetal membrane based on magnetic resonance imagining data in order to examine the mechanical function of the cervix under the physiologic loading conditions of pregnancy. We calculate the mechanical loading state of the cervix for two pregnant patients: 22 weeks gestational age with a normal cervical length and 28 weeks with a short cervix. We investigate the influence of (1) anatomical geometry, (2) cervical material properties, and (3) fetal membrane material properties, including its adhesion properties, on the mechanical loading state of the cervix under physiologically relevant intrauterine pressures. Our study demonstrates that membrane-uterus interaction, cervical material modeling, and membrane mechanical properties are factors that must be deliberately and carefully handled in order to construct a high quality mechanical simulation of pregnancy.

  16. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  17. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  18. Standard elements; Elements standards

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  19. A mammalian conserved element derived from SINE displays enhancer properties recapitulating Satb2 expression in early-born callosal projection neurons.

    Kensuke Tashiro

    Full Text Available Short interspersed repetitive elements (SINEs are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered "junk DNA". However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2(+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2(+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1(-/NPY(+ portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum

  20. ICESat-derived lithospheric flexure as caused by an endorheic lake's expansion on the Tibetan Plateau and the comparison to modeled flexural responses

    Madson, Austin; Sheng, Yongwei; Song, Chunqiao

    2017-10-01

    A substantial and rapid expansion beginning in the late 1990s of Siling Co, the largest endorheic lake on the central Tibetan Plateau (TP), has caused a measurable lithospheric deflection in the region adjacent to the lake. Current broad-scale measuring of this flexural response is mainly derived from InSAR processing techniques or time-consuming field campaigns. The rheological constraints of the lithosphere from the underlying lithospheric response to large lake loads in this region are not well understood. This paper highlights a more efficient spaceborne LiDAR remote sensing technique to measure the deflection in the vicinity of Siling Co and to investigate the mechanisms of the observed lithospheric response in order to garner a better understanding of the local rheology. A lake-adjacent deflection rate and Siling Co water load variations are calculated utilizing the Geoscience Laser Altimeter System (GLAS) onboard NASA's Ice, Cloud and land Elevation Satellite (ICESat) and the joint NASA/USGS Landsat series of Earth observing satellites. A downward deflection rate of ∼5.6 mm/yr for the first 4 km of lake-adjacent land is calculated from the GLAS instrument, and this response is compared to the flexural outputs from a spherically symmetric, non-rotating, elastic, and isotropic (SNREI) Earth model in order to better understand the underlying mechanisms of the lithospheric response to the rapid increase of Siling Co loads. The modeled elastic response is ∼6.9 times lower than the GLAS derived flexure, thereby providing further evidence that a purely elastic lithospheric response cannot explain the deflection in this region. The relationship between the modeled elastic response and the GLAS derived flexure is applied to a long-term lake load change dataset to create the longest-running flexural response curve as caused by the last ∼40 years of Siling Co load variations, and these results show an accumulated lake-adjacent flexure of ∼12.6 cm from an

  1. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  2. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  3. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  4. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  5. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  6. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  7. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  8. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  9. Neurons derived from patients with bipolar disorder divide into intrinsically different sub-populations of neurons, predicting the patients' responsiveness to lithium.

    Stern, S; Santos, R; Marchetto, M C; Mendes, A P D; Rouleau, G A; Biesmans, S; Wang, Q-W; Yao, J; Charnay, P; Bang, A G; Alda, M; Gage, F H

    2017-02-28

    Bipolar disorder (BD) is a progressive psychiatric disorder with more than 3% prevalence worldwide. Affected individuals experience recurrent episodes of depression and mania, disrupting normal life and increasing the risk of suicide greatly. The complexity and genetic heterogeneity of psychiatric disorders have challenged the development of animal and cellular models. We recently reported that hippocampal dentate gyrus (DG) neurons differentiated from induced pluripotent stem cell (iPSC)-derived fibroblasts of BD patients are electrophysiologically hyperexcitable. Here we used iPSCs derived from Epstein-Barr virus-immortalized B-lymphocytes to verify that the hyperexcitability of DG-like neurons is reproduced in this different cohort of patients and cells. Lymphocytes are readily available for research with a large number of banked lines with associated patient clinical description. We used whole-cell patch-clamp recordings of over 460 neurons to characterize neurons derived from control individuals and BD patients. Extensive functional analysis showed that intrinsic cell parameters are very different between the two groups of BD neurons, those derived from lithium (Li)-responsive (LR) patients and those derived from Li-non-responsive (NR) patients, which led us to partition our BD neurons into two sub-populations of cells and suggested two different subdisorders. Training a Naïve Bayes classifier with the electrophysiological features of patients whose responses to Li are known allows for accurate classification with more than 92% success rate for a new patient whose response to Li is unknown. Despite their very different functional profiles, both populations of neurons share a large, fast after-hyperpolarization (AHP). We therefore suggest that the large, fast AHP is a key feature of BD and a main contributor to the fast, sustained spiking abilities of BD neurons. Confirming our previous report with fibroblast-derived DG neurons, chronic Li treatment reduced

  10. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  11. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  12. A dramatic response to a single dose of infliximab in a patient with prolonged pustular psoriasis derived from inverse psoriasis.

    Li, Mengmeng; Dai, Weiwei; Yan, Wei; Liu, Yuanzhen; Wang, Lian; Li, Wei

    2017-07-01

    We report a case of a 25-year-old Chinese man with an exceptionally prolonged history of pustular psoriasis derived from inverse psoriasis who was unsatisfied with conventional treatment and was successfully treated with a single dose of infliximab without noticeable adverse effects. No recurrence or flaring was observed after 3 months of follow-up. This case illustrates that infliximab may be an effective and safe therapeutic option for patients with refractory pustular psoriasis derived from inverse psoriasis. © 2017 Wiley Periodicals, Inc.

  13. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  15. Effects of intestinal bacteria-derived p-cresyl sulfate on Th1-type immune response in vivo and in vitro

    Shiba, Takahiro; Kawakami, Koji; Sasaki, Takashi; Makino, Ikuyo; Kato, Ikuo; Kobayashi, Toshihide; Uchida, Kazumi; Kaneko, Kimiyuki

    2014-01-01

    Protein fermentation by intestinal bacteria generates various compounds that are not synthesized by their hosts. An example is p-cresol, which is produced from tyrosine. Patients with chronic kidney disease (CKD) accumulate high concentrations of intestinal bacteria-derived p-cresyl sulfate (pCS), which is the major metabolite of p-cresol, in their blood, and this accumulation contributes to certain CKD-associated disorders. Immune dysfunction is a CKD-associated disorder that frequently contributes to infectious diseases among CKD patients. Although some studies imply pCS as an etiological factor, the relation between pCS and immune systems is poorly understood. In the present study, we investigated the immunological effects of pCS derived from intestinal bacteria in mice. For this purpose, we fed mice a tyrosine-rich diet that causes the accumulation of pCS in their blood. The mice were shown to exhibit decreased Th1-driven 2, 4-dinitrofluorobenzene-induced contact hypersensitivity response. The concentration of pCS in blood was negatively correlated with the degree of the contact hypersensitivity response. In contrast, the T cell-dependent antibody response was not influenced by the accumulated pCS. We also examined the in vitro cytokine responses by T cells in the presence of pCS. The production of IFN-γ was suppressed by pCS. Further, pCS decreased the percentage of IFN-γ-producing Th1 cells. Our results suggest that intestinal bacteria-derived pCS suppressesTh1-type cellular immune responses. - Highlights: • Mice fed a tyrosine-rich diet accumulated p-cresyl sulfate in their blood. • p-Cresyl sulfate negatively correlated with contact hypersensitivity response. • The in vitro production of IFN-γ was suppressed by p-cresyl sulfate. • p-Cresyl sulfate decreased the percentage of IFN-γ-producing Th1 cells in vitro

  16. Effects of intestinal bacteria-derived p-cresyl sulfate on Th1-type immune response in vivo and in vitro

    Shiba, Takahiro, E-mail: takahiro-shiba@yakult.co.jp; Kawakami, Koji; Sasaki, Takashi; Makino, Ikuyo; Kato, Ikuo; Kobayashi, Toshihide; Uchida, Kazumi; Kaneko, Kimiyuki

    2014-01-15

    Protein fermentation by intestinal bacteria generates various compounds that are not synthesized by their hosts. An example is p-cresol, which is produced from tyrosine. Patients with chronic kidney disease (CKD) accumulate high concentrations of intestinal bacteria-derived p-cresyl sulfate (pCS), which is the major metabolite of p-cresol, in their blood, and this accumulation contributes to certain CKD-associated disorders. Immune dysfunction is a CKD-associated disorder that frequently contributes to infectious diseases among CKD patients. Although some studies imply pCS as an etiological factor, the relation between pCS and immune systems is poorly understood. In the present study, we investigated the immunological effects of pCS derived from intestinal bacteria in mice. For this purpose, we fed mice a tyrosine-rich diet that causes the accumulation of pCS in their blood. The mice were shown to exhibit decreased Th1-driven 2, 4-dinitrofluorobenzene-induced contact hypersensitivity response. The concentration of pCS in blood was negatively correlated with the degree of the contact hypersensitivity response. In contrast, the T cell-dependent antibody response was not influenced by the accumulated pCS. We also examined the in vitro cytokine responses by T cells in the presence of pCS. The production of IFN-γ was suppressed by pCS. Further, pCS decreased the percentage of IFN-γ-producing Th1 cells. Our results suggest that intestinal bacteria-derived pCS suppressesTh1-type cellular immune responses. - Highlights: • Mice fed a tyrosine-rich diet accumulated p-cresyl sulfate in their blood. • p-Cresyl sulfate negatively correlated with contact hypersensitivity response. • The in vitro production of IFN-γ was suppressed by p-cresyl sulfate. • p-Cresyl sulfate decreased the percentage of IFN-γ-producing Th1 cells in vitro.

  17. pH-responsive artemisinin derivatives and lipid nanoparticle formulations inhibit growth of breast cancer cells in vitro and induce down-regulation of HER family members.

    Yitong J Zhang

    Full Text Available Artemisinin (ART dimers show potent anti-proliferative activities against breast cancer cells. To facilitate their clinical development, novel pH-responsive artemisinin dimers were synthesized for liposomal nanoparticle formulations. A new ART dimer was designed to become increasingly water-soluble as pH declines. The new artemisinin dimer piperazine derivatives (ADPs remained tightly associated with liposomal nanoparticles (NPs at neutral pH but were efficiently released at acidic pH's that are known to exist within solid tumors and organelles such as endosomes and lysosomes. ADPs incorporated into nanoparticles down regulated the anti-apoptotic protein, survivin, and cyclin D1 when incubated at low concentrations with breast cancer cell lines. We demonstrate for the first time, for any ART derivative, that ADP NPs can down regulate the oncogenic protein HER2, and its counterpart, HER3 in a HER2+ cell line. We also show that the wild type epidermal growth factor receptor (EGFR or HER1 declines in a triple negative breast cancer (TNBC cell line in response to ADP NPs. The declines in these proteins are achieved at concentrations of NP109 at or below 1 µM. Furthermore, the new artemisinin derivatives showed improved cell-proliferation inhibition effects compared to known dimer derivatives.

  18. A dual-responsive colorimetric and fluorescent chemosensor based on diketopyrrolopyrrole derivative for naked-eye detection of Fe3 + and its practical application

    Zhang, Shanshan; Sun, Tao; Xiao, Dejun; Yuan, Fang; Li, Tianduo; Wang, Enhua; Liu, Haixia; Niu, Qingfen

    2018-01-01

    A novel dual-responsive colorimetric and fluorescent chemosensor L based on diketopyrrolopyrrole derivative for Fe3 + detection was designed and synthesized. In presence of Fe3 +, sensor L displayed strong colorimetric response as amaranth to rose pink and significant fluorescence enhancement and chromogenic change, which served as a naked-eye indicator by an obvious color change from purple to red. The binding constant for L-Fe3 + complex was found as 2.4 × 104 with the lower detection limit of 14.3 nM. The sensing mechanism was investigated in detail by fluorescence measurements, IR and 1H NMR spectra. Sensor L for Fe3 + detection also exhibited high anti-interference performance, good reversibility, wide pH response range and instantaneous response time. Furthermore, the sensor L has been used to quantify Fe3 + ions in practical water samples with good recovery.

  19. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  20. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  1. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  2. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  3. HBV-Derived Synthetic Long Peptide Can Boost CD4+ and CD8+ T-Cell Responses in Chronic HBV Patients Ex Vivo.

    Dou, Yingying; van Montfoort, Nadine; van den Bosch, Aniek; de Man, Robert A; Zom, Gijs G; Krebber, Willem-Jan; Melief, Cornelis J M; Buschow, Sonja I; Woltman, Andrea M

    2018-02-14

    Vaccination with synthetic long peptides (SLP) is a promising new treatment strategy for chronic hepatitis B virus (CHB). SLP can induce broad T-cell responses for all HLA types. Here we investigated the ability of a prototype HBV-core (HBc)-sequence-derived SLP to boost HBV-specific T cells in CHB patients ex vivo. HBc-SLP was used to assess cross-presentation by monocyte-derived dendritic cells (moDC) and BDCA1+ blood myeloid DC (mDC) to engineered HBV-specific CD8+ T cells. Autologous SLP-loaded and toll-like receptor (TLR)-stimulated DC were used to activate patient HBc-specific CD8+ and CD4+ T cells. HBV-SLP was cross-presented by moDC, which was further enhanced by adjuvants. Patient-derived SLP-loaded moDC significantly increased autologous HBcAg18-27-specific CD8+ T cells and CD4+ T cells ex vivo. HBV-specific T cells were functional as they synthesized tumor necrosis factor-alpha and interferon-gamma. In 6/7 of patients blockade of PD-L1 further increased SLP effects. Also, importantly, patient-derived BDCA1+ mDC cross-presented and activated autologous T-cell responses ex vivo. As a proof of concept, we showed a prototype HBc-SLP can boost T-cell responses in patients ex vivo. These results pave the way for the development of a therapeutic SLP-based vaccine to induce effective HBV-specific adaptive immune responses in CHB patients. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  4. Behavioural responses of diamondback moth Plutella xylostella (Lepidoptera: Plutellidae) to extracts derived from Melia azedarach and Azadirachta indica

    Charleston, D.S.; Kfir, R.; Vet, L.E.M.; Dicke, M.

    2005-01-01

    The impact of three different doses of botanical insecticide derived from the syringa tree, Melia azedarach and the neem tree, Azadirachta indica was tested on the behaviour of the diamondback moth, Plutella xylostella (Linnaeus). Both botanical insecticides had a significant impact on larval

  5. In Vitro Activity of the Histatin Derivative P-113 against Multidrug-Resistant Pathogens Responsible for Pneumonia in Immunocompromised Patients

    Giacometti, Andrea; Cirioni, Oscar; Kamysz, Wojciech; D'Amato, Giuseppina; Silvestri, Carmela; Prete, Maria Simona Del; Licci, Alberto; Riva, Alessandra; Łukasiak, Jerzy; Scalise, Giorgio

    2005-01-01

    The in vitro activity of the histatin derivative P-113, alone or combined with eight antibiotics, was investigated against multidrug-resistant strains isolated from clinical specimens of immunocompromised patients with pneumonia. The gram-negative isolates were susceptible to P-113. S. aureus showed less susceptibility. Synergy was demonstrated when P-113 was combined with beta-lactams against gram-negative organisms.

  6. A time course study of glucose levels and innate immune response in gilthead seabream (Sparus aurata L.) after exposure to clove oil-eugenol derived anaesthetic.

    Bahi, A; Guardiola, F A; Esteban, M A

    2018-06-01

    Clove oil is used as an anaesthetic for many species of fish worldwide; however, relatively few studies have assessed its effects on the innate immune response on these species. The present work aimed to investigate the effects of clove oil-eugenol derived anaesthetic on some humoral and cellular immune response in gilthead seabream (Sparus aurata L.). To compare with an unexposed control group, fish were exposed to 55 ppm clove oil for 5 min, before being sampled at 1, 24 and 48 h post-exposure. Serum glucose level was also measured to obtain information on the fish physiological response after clove oil anaesthesia. One hour after exposure the haemolytic complement activity of fish was lower than in the unexposed group. By contrast, the leucocyte peroxidase activity in head-kidney was significantly stimulated 24 h after exposure to clove oil-eugenol. The rest of innate immune parameters evaluated and the glucose levels not were affected by clove oil exposure at any sampling point. Overall, the use of clove oil at 55 ppm as anaesthetic did not seem to alter the innate immune response and neither did it trigger a stress response. The use of clove oil-eugenol derived had become common practice in aquaculture, and its use with gilthead seabream can be considered safe as it does not cause immunodepression in anesthetized fish. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  8. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  9. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  10. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  11. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  12. Galvanic element. Galvanisches Element

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  13. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  14. Cellular aspects of tolerance. V. The in vivo cooperative role of acceessory and thymus derived cells in responsiveness and unresponsiveness of SJL mice

    Fujiwara, M.; Cinader, B.

    1974-01-01

    Adult (8-week-old) SJL mice reach a relatively low degree of tolerance when injected with aggregate free rabbit γ-globulin (RGG). To analyze this phenomenon, we first examined indirect plaque-forming responses (PFC) in terms of participation of accessory and thymus-derived cells. Double transfer experiments were used; accessory cells were removed from donor cells by filtration over glasswool and their capacity reduced in recipients by 3 day preirradiation or by horse erythrocyte-mediated blockage. Using this type of experimental arrangement we found that the antibody response to RGG required the cooperation of accessory and thymus-derived cells. The induction of tolerance was affected by the presence of accessory cells. Preirradiated secondary recipients were reconstituted with spleen cells from accessory cell-deprived donors which had received thymus and bone marrow cells. In some experiments, the thymus and bone marrow cells were passed over glasswool. The primary recipients were left untreated or were given tolerogen. A more profound state of tolerance (reduction in plaque forming response) was the consequence of the incapacitation or removal of accessory cells. The magnitude of the reduction in PFC was directly related to the completeness of accessory cell removal and incapacitation. Responsiveness could be restored by administration of irradiated spleen cells as a source of accessory cells. The need for thymus-derived (T) cells in the antibody response was demonstrated by double transfer experiments in which the primary recipient was restored with thymus cells alone, bone marrow cells alone, or with a mixture of cell types

  15. Adjuvant effect of Asparagus racemosus Willd. derived saponins in antibody production, allergic response and pro-inflammatory cytokine modulation.

    Tiwari, Nimisha; Gupta, Vivek Kumar; Pandey, Pallavi; Patel, Dinesh Kumar; Banerjee, Suchitra; Darokar, Mahendra Pandurang; Pal, Anirban

    2017-02-01

    The study manifests the immunoadjuvant potential of saponin rich fraction from Asparagus racemosus in terms of cellular and humoral immune response that can be exploited against microbial infections. Asparagus racemosus (AR) has been attributed as an adaptogen and rasayana in traditional medication systems for enhancing the host defence mechanism. Spectrophotometric and HPTLC analysis ensured the presence of saponins. The saponin rich fractions were tested for immunoadjuvant property in ovalbumin immunised mice for the humoral response, quantified in terms of prolonged antibody production upto a duration of 56days. Proinflammatory cytokines (IL-6 and TNF) were estimated for the cellular immune response in LPS stimulated primary murine macrophages. The safety evaluation in terms of cytotoxicity and allergic response has also been evaluated through in-vitro (MTT) and in-vivo (IgE) respectively. ARS significantly inhibited the pro-inflammatory cytokines, in LPS stimulated murine macrophages with no intrinsic cytotoxicity. The significant increase in IgG production infers the utility of ARS for prolonged humoral response. Further, the antigen specific response of IL-12 at early stage and IgE titres also suggests the generation of cellular immune response and low allergic reaction respectively, as compared to conventional adjuvants. IL-6 and TNF fluctuations in LPS stimulated and non-stimulated macrophages along with IgG and IL-12 also confirmed the Th1/Th2 modulating effect of ARS. The study indicates potential effect of ARS as an adjuvant for the stimulation of cellular immune response in addition to generating a sustained adaptive response without any adverse effects paving way for further validation with pathogenic organisms. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. The Response to P-Derived from Phosphate Rock and TSP by Crops Grown in a Simulated Crop Rotation System

    Sisworo, Elsye L; Sisworo, Widjang H; Havid-Rasjid; Syamsul-Rizal; Komarudin-Idris

    2002-01-01

    A green house experiment was carried out on a simulated crop rotation system of upland rice-soybean-mungbean to determine the effect of P-derived from different phosphate rock (PR) sources and TSP using 32 P. The data obtained reveal that all the P-sources has a significant effect on the growth of all the three crops, expressed in dry weight, % P-total and total P-uptake (mg P pot -1 ). For the P-source it was shown that % P-derived from PR/TSP and their uptake (mg P pot -1 ) was quite high, showing that the PR s applied were of good reactivity. The residue of the PR s has also still a good effect on plant growth than that of TSP. The efficiency of PR s was far below that of TSP. This apparently was due to the high rate of application, ten times the rate of TSP. (author)

  17. Auditory evoked responses to binaural beat illusion: stimulus generation and the derivation of the Binaural Interaction Component (BIC).

    Ozdamar, Ozcan; Bohorquez, Jorge; Mihajloski, Todor; Yavuz, Erdem; Lachowska, Magdalena

    2011-01-01

    Electrophysiological indices of auditory binaural beats illusions are studied using late latency evoked responses. Binaural beats are generated by continuous monaural FM tones with slightly different ascending and descending frequencies lasting about 25 ms presented at 1 sec intervals. Frequency changes are carefully adjusted to avoid any creation of abrupt waveform changes. Binaural Interaction Component (BIC) analysis is used to separate the neural responses due to binaural involvement. The results show that the transient auditory evoked responses can be obtained from the auditory illusion of binaural beats.

  18. Ultrafast responses of dipolar and V-shaped dipicolinate derivatives with potential applications in the labeling of biomolecules

    Wang, Yaochuan; Liu, Siyuan; Liu, Dajun; Wang, Guiqiu; Xiao, Haibo

    2016-02-01

    A dipolar dipicolinate derivative, trans-dimethyl-4-[4'-(N,N-diphenylamino)-styry1]-pyridin-2,6-dicarboxylate (P-1), and a P-1based V-shaped compound, {4-[(E)-2-(2,6-dimethoxycarbonylpyridin-4-yl) vinyl]}-N-phenyl-N-{4-[(E)-2-(2,6-dimethoxycarbonylpyridin-4-yl)vinylphenyl]}aniline (P-2), with intense two-photon fluorescence emission properties were systematically investigated by using steady-state absorption and fluorescence spectroscopy, open-aperture Z-scans, and two-photon excited fluorescence (TPF). The two-photon absorption cross-section of the V-shaped compound P-2 in tetrahydrofuran (THF) was determined to be 208 GM, which represents a 6.5-fold enhancement compared with its dipolar counterpart P-1 (32 GM). Extension of the intramolecular charge transfer (ICT) in the V-shaped dipicolinate derivative has been suggested as the mechanism of enhancement. The excited state dynamics from transient absorption spectroscopy were analyzed and discussed. The formation and relaxation lifetimes of the ICT state for these dipicolinate derivatives in THF solutions were found to be several picoseconds and several hundred picoseconds, respectively. The results show an increased ICT character of the V-shaped compound and a potential application for this compound in two-photon fluorescence imaging fields.

  19. Ultrafast responses of dipolar and V-shaped dipicolinate derivatives with potential applications in the labeling of biomolecules

    Yaochuan Wang

    2016-02-01

    Full Text Available A dipolar dipicolinate derivative, trans-dimethyl-4-[4′-(N,N-diphenylamino-styry1]-pyridin-2,6-dicarboxylate (P-1, and a P-1based V-shaped compound, {4-[(E-2-(2,6-dimethoxycarbonylpyridin-4-yl vinyl]}-N-phenyl-N-{4-[(E-2-(2,6-dimethoxycarbonylpyridin-4-ylvinylphenyl]}aniline (P-2, with intense two-photon fluorescence emission properties were systematically investigated by using steady-state absorption and fluorescence spectroscopy, open-aperture Z-scans, and two-photon excited fluorescence (TPF. The two-photon absorption cross-section of the V-shaped compound P-2 in tetrahydrofuran (THF was determined to be 208 GM, which represents a 6.5-fold enhancement compared with its dipolar counterpart P-1 (32 GM. Extension of the intramolecular charge transfer (ICT in the V-shaped dipicolinate derivative has been suggested as the mechanism of enhancement. The excited state dynamics from transient absorption spectroscopy were analyzed and discussed. The formation and relaxation lifetimes of the ICT state for these dipicolinate derivatives in THF solutions were found to be several picoseconds and several hundred picoseconds, respectively. The results show an increased ICT character of the V-shaped compound and a potential application for this compound in two-photon fluorescence imaging fields.

  20. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent