WorldWideScience

Sample records for response elements cre

  1. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  2. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  3. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  4. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  5. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-01-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...

  6. Neuropilin-2 genomic elements drive cre recombinase expression in primitive blood, vascular and neuronal lineages.

    Wiszniak, Sophie; Scherer, Michaela; Ramshaw, Hayley; Schwarz, Quenten

    2015-11-01

    We have established a novel Cre mouse line, using genomic elements encompassing the Nrp2 locus, present within a bacterial artificial chromosome clone. By crossing this Cre driver line to R26R LacZ reporter mice, we have documented the temporal expression and lineage traced tissues in which Cre is expressed. Nrp2-Cre drives expression in primitive blood cells arising from the yolk sac, venous and lymphatic endothelial cells, peripheral sensory ganglia, and the lung bud. This mouse line will provide a new tool to researchers wishing to study the development of various tissues and organs in which this Cre driver is expressed, as well as allow tissue-specific knockout of genes of interest to study protein function. This work also presents the first evidence for expression of Nrp2 protein in a mesodermal progenitor with restricted hematopoietic potential, which will significantly advance the study of primitive erythropoiesis. genesis 53:709-717, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  7. Cre-dependent DNA recombination activates a STING-dependent innate immune response

    Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit

    2016-01-01

    Abstract Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376

  8. A CRE1- regulated cluster is responsible for light dependent production of dihydrotrichotetronin in Trichoderma reesei.

    Alberto Alonso Monroy

    Full Text Available Changing light conditions, caused by the rotation of earth resulting in day and night or growth on the surface or within a substrate, result in considerably altered physiological processes in fungi. For the biotechnological workhorse Trichoderma reesei, regulation of glycoside hydrolase gene expression, especially cellulase expression was shown to be a target of light dependent gene regulation. Analysis of regulatory targets of the carbon catabolite repressor CRE1 under cellulase inducing conditions revealed a secondary metabolite cluster to be differentially regulated in light and darkness and by photoreceptors. We found that this cluster is involved in production of trichodimerol and that the two polyketide synthases of the cluster are essential for biosynthesis of dihydrotrichotetronine (syn. bislongiquinolide or bisorbibutenolide. Additionally, an indirect influence on production of the peptaibol antibiotic paracelsin was observed. The two polyketide synthetase genes as well as the monooxygenase gene of the cluster were found to be connected at the level of transcription in a positive feedback cycle in darkness, but negative feedback in light, indicating a cellular sensing and response mechanism for the products of these enzymes. The transcription factor TR_102497/YPR2 residing within the cluster regulates the cluster genes in a light dependent manner. Additionally, an interrelationship of this cluster with regulation of cellulase gene expression was detected. Hence the regulatory connection between primary and secondary metabolism appears more widespread than previously assumed, indicating a sophisticated distribution of resources either to degradation of substrate (feed or to antagonism of competitors (fight, which is influenced by light.

  9. Lactoferricin B Inhibits the Phosphorylation of the Two-Component System Response Regulators BasR and CreB*

    Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

    2012-01-01

    Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548

  10. Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB.

    Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

    2012-04-01

    Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.

  11. Cre/loxP-mediated adenovirus type 5 packaging signal excision demonstrates that core element VI is sufficient for virus packaging

    Maeda, Yasushi; Kimura, En; Uchida, Yuji; Nishida, Yasuto; Yamashita, Satoshi; Arima, Toshiyuki; Uchino, Makoto

    2003-01-01

    Previous analyses have demonstrated that packaging of the adenovirus type 5 (Ad5) genome is dependent on at least seven cis-acting elements, called AI to AVII, which are located in the left-end region of the genome. These elements have different packaging efficiencies, and without AI through AV, viral DNA cannot be packaged. Here we report the identification of the cis-acting Ad5 packaging domain in vivo by using the Cre/loxP system. We found that an adenoviral DNA fragment (nt 192 to nt 358), which includes elements AI to AV, is excised by Cre recombinase and packaged into capsids. Furthermore, this mutant adenovirus replicated so efficiently by repetitive propagation that its purification by CsCI equilibrium gradient was possible. This study clarified that the region from nt 358 to nt 454 on the viral genome is sufficient for packaging. Recently, the helper-dependent adenoviral vector (HDAd) construction system has been developed for the purpose of gene therapy. This system uses a helper virus with two parallel loxP sites flanking the packaging signal. This region is eliminated by Cre-mediated excision, which prevents helper virus packaging. Our data provide useful information regarding factors affecting efficient elimination

  12. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  13. A Novel Dual-cre Motif Enables Two-Way Autoregulation of CcpA in Clostridium acetobutylicum.

    Zhang, Lu; Liu, Yanqiang; Yang, Yunpeng; Jiang, Weihong; Gu, Yang

    2018-04-15

    The master regulator CcpA (catabolite control protein A) manages a large and complex regulatory network that is essential for cellular physiology and metabolism in Gram-positive bacteria. Although CcpA can affect the expression of target genes by binding to a cis -acting catabolite-responsive element ( cre ), whether and how the expression of CcpA is regulated remain poorly explored. Here, we report a novel dual- cre motif that is employed by the CcpA in Clostridium acetobutylicum , a typical solventogenic Clostridium species, for autoregulation. Two cre sites are involved in CcpA autoregulation, and they reside in the promoter and coding regions of CcpA. In this dual- cre motif, cre P , in the promoter region, positively regulates ccpA transcription, whereas cre ORF , in the coding region, negatively regulates this transcription, thus enabling two-way autoregulation of CcpA. Although CcpA bound cre P more strongly than cre ORF in vitro , the in vivo assay showed that cre ORF -based repression dominates CcpA autoregulation during the entire fermentation. Finally, a synonymous mutation of cre ORF was made within the coding region, achieving an increased intracellular CcpA expression and improved cellular performance. This study provides new insights into the regulatory role of CcpA in C. acetobutylicum and, moreover, contributes a new engineering strategy for this industrial strain. IMPORTANCE CcpA is known to be a key transcription factor in Gram-positive bacteria. However, it is still unclear whether and how the intracellular CcpA level is regulated, which may be essential for maintaining normal cell physiology and metabolism. We discovered here that CcpA employs a dual- cre motif to autoregulate, enabling dynamic control of its own expression level during the entire fermentation process. This finding answers the questions above and fills a void in our understanding of the regulatory network of CcpA. Interference in CcpA autoregulation leads to improved cellular

  14. Hydrodynamic Delivery of Cre Protein to Lineage-Mark or Time-Stamp Mouse Hepatocytes In situ

    Sonsteng, Katherine M.; Prigge, Justin R.; Talago, Emily A.; June, Ronald K.; Schmidt, Edward E.

    2014-01-01

    Cre-responsive fluorescent marker alleles are powerful tools for cell lineage tracing in mice; however their utility is limited by regulation of Cre activity. When targeting hepatocytes, hydrodynamic delivery of a Cre-expression plasmid can convert Cre-responsive alleles without inducing the intracellular or systemic antiviral responses often associated with viral-derived Cre-expression vectors. In this method, rapid high-volume intravenous inoculation induces hepatocyte-targeted uptake of extracellular molecules. Here we tested whether hydrodynamic delivery of Cre protein or Cre fused to the HIV-TAT cell-penetrating peptide could convert Cre-responsive reporters in hepatocytes of mice. Hydrodynamic delivery of 2 nmol of either Cre or TAT-Cre protein converted the reporter allele in 5 to 20% of hepatocytes. Neither protein gave detectable Cre activity in endothelia, non-liver organs, or non-hepatocyte cells in liver. Using mice homozygous for a Cre-responsive marker that directs red- (Cre-naïve) or green- (Cre-converted) fluorescent proteins to the nucleus, we assessed sub-saturation Cre-activity. One month after hydrodynamic inoculation with Cre protein, 58% of hepatocyte nuclei that were green were also red, indicating that less than half of the hepatocytes that had obtained enough Cre to convert one marker allele to green were able to convert all alleles. For comparison, one month after hydrodynamic delivery of a Cre-expression plasmid with a weak promoter, only 26% of the green nuclei were also red. Our results show that hydrodynamic delivery of Cre protein allows rapid allelic conversion in hepatocytes, but Cre-activity is sub-saturating so many cells will not convert multiple Cre-responsive alleles. PMID:24626158

  15. Conditional transgenesis using Dimerizable Cre (DiCre).

    Jullien, Nicolas; Goddard, Isabelle; Selmi-Ruby, Samia; Fina, Jean-Luc; Cremer, Harold; Herman, Jean-Paul

    2007-12-26

    Cre recombinase is extensively used to engineer the genome of experimental animals. However, its usefulness is still limited by the lack of an efficient temporal control over its activity. We have recently developed a conceptually new approach to regulate Cre recombinase, that we have called Dimerizable Cre or DiCre. It is based on splitting Cre into two inactive moieties and fusing them to FKBP12 (FK506-binding protein) and FRB (binding domain of the FKBP12-rapamycin associated protein), respectively. These latter can be efficiently hetero-dimerized by rapamycin, leading to the reinstatement of Cre activity. We have been able to show, using in vitro approaches, that this ligand-induced dimerization is an efficient way to regulate Cre activity, and presents a low background activity together with a high efficiency of recombination following dimerization. To test the in vivo performance of this system, we have, in the present work, knocked-in DiCre into the Rosa26 locus of mice. To evaluate the performance of the DiCre system, mice have been mated with indicator mice (Z/EG or R26R) and Cre-induced recombination was examined following activation of DiCre by rapamycin during embryonic development or after birth of progenies. No recombination could be observed in the absence of treatment of the animals, indicating a lack of background activity of DiCre in the absence of rapamycin. Postnatal rapamycin treatment (one to five daily injection, 10 mg/kg i.p) induced recombination in a number of different tissues of progenies such as liver, heart, kidney, muscle, etc. On the other hand, recombination was at a very low level following in utero treatment of DiCrexR26R mice. In conclusion, DiCre has indeed the potentiality to be used to establish conditional Cre-deleter mice. An added advantage of this system is that, contrary to other modulatable Cre systems, it offers the possibility of obtaining regulated recombination in a combinatorial manner, i.e. induce recombination at

  16. Conditional transgenesis using Dimerizable Cre (DiCre.

    Nicolas Jullien

    Full Text Available Cre recombinase is extensively used to engineer the genome of experimental animals. However, its usefulness is still limited by the lack of an efficient temporal control over its activity. We have recently developed a conceptually new approach to regulate Cre recombinase, that we have called Dimerizable Cre or DiCre. It is based on splitting Cre into two inactive moieties and fusing them to FKBP12 (FK506-binding protein and FRB (binding domain of the FKBP12-rapamycin associated protein, respectively. These latter can be efficiently hetero-dimerized by rapamycin, leading to the reinstatement of Cre activity. We have been able to show, using in vitro approaches, that this ligand-induced dimerization is an efficient way to regulate Cre activity, and presents a low background activity together with a high efficiency of recombination following dimerization. To test the in vivo performance of this system, we have, in the present work, knocked-in DiCre into the Rosa26 locus of mice. To evaluate the performance of the DiCre system, mice have been mated with indicator mice (Z/EG or R26R and Cre-induced recombination was examined following activation of DiCre by rapamycin during embryonic development or after birth of progenies. No recombination could be observed in the absence of treatment of the animals, indicating a lack of background activity of DiCre in the absence of rapamycin. Postnatal rapamycin treatment (one to five daily injection, 10 mg/kg i.p induced recombination in a number of different tissues of progenies such as liver, heart, kidney, muscle, etc. On the other hand, recombination was at a very low level following in utero treatment of DiCrexR26R mice. In conclusion, DiCre has indeed the potentiality to be used to establish conditional Cre-deleter mice. An added advantage of this system is that, contrary to other modulatable Cre systems, it offers the possibility of obtaining regulated recombination in a combinatorial manner, i.e. induce

  17. Relationship of the CreBC two-component regulatory system and inner membrane protein CreD with swimming motility in Stenotrophomonas maltophilia.

    Hsin-Hui Huang

    Full Text Available The CreBC two-component system (TCS is a conserved regulatory system found in Escherichia coli, Aeromonas spp., Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. In this study, we determined how CreBC TCS regulates secreted protease activities and swimming motility using creB, creC, and creBC in-frame deletion mutants (KJΔCreB, KJΔCreC, and KJΔBC of S. maltophilia KJ. Compared to wild-type KJ, KJΔCreB had a comparable secreted protease activity; however, the secreted protease activities were obviously reduced in KJΔCreC and KJΔBC, suggesting that CreC works together with another unidentified response regulator (not CreB to regulate secreted protease activity. Single gene inactivation of creB or creC resulted in mutants with an enhanced swimming motility, and this phenotype was exacerbated in a double mutant KJΔBC. To elucidate the underlying mechanism responsible for the ΔcreBC-mediated swimming enhancement, flagella morphology observation, RNA-seq based transcriptome assay, qRT-PCR, and membrane integrity and potential assessment were performed. Flagella morphological observation ruled out the possibility that swimming enhancement was due to altered flagella morphology. CreBC inactivation upregulated the expression of creD and flagella-associated genes encoding the basal body- and motor-associated proteins. Furthermore, KJΔBC had an increased membrane susceptibility to Triton X-100 and CreD upregulation in KJΔBC partially alleviated the compromise of membrane integrity. The impact of creBC TCS on bacterial membrane potential was assessed by carbonyl cyanide m-chlorophenyl hydrazine (CCCP50 concentration at which 50% of bacterial swimming is inhibited. CCCP50 of wild-type KJ increased when creBC was deleted, indicating an association between the higher membrane potential of KJΔBC cells and enhanced motility. Upregulation of the basal body- and motor-associated genes of flagella in KJΔBC cells may explain the increased

  18. Osterix-Cre transgene causes craniofacial bone development defect

    Wang, Li; Mishina, Yuji; Liu, Fei

    2015-01-01

    The Cre/loxP system has been widely used to generate tissue-specific gene knockout mice. Inducible (Tet-off) Osx-GFP::Cre (Osx-Cre) mouse line that targets osteoblasts is widely used in the bone research field. In this study, we investigated the effect of Osx-Cre on craniofacial bone development. We found that newborn Osx-Cre mice showed severe hypomineralization in parietal, frontal, and nasal bones as well as the coronal sutural area when compared to control mice. As the mice matured the intramembranous bone hypomineralization phenotype became less severe. The major hypomineralization defect in parietal, frontal, and nasal bones had mostly disappeared by postnatal day 21, but the defect in sutural areas persisted. Importantly, Doxycycline treatment eliminated cranial bone defects at birth which indicates that Cre expression may be responsible for the phenotype. In addition, we showed that the primary calvarial osteoblasts isolated from neonatal Osx-Cre mice had comparable differentiation ability compared to their littermate controls. This study reinforces the idea that Cre positive litter mates are indispensable controls in studies using conditional gene deletion. PMID:25550101

  19. System's flips in climate-related energy (CRE) systems

    Ramos, Maria-Helena; Creutin, Jean-Dominique; Engeland, Kolbjørn; François, Baptiste; Renard, Benjamin

    2014-05-01

    Several modern environmental questions invite to explore the complex relationships between natural phenomena and human behaviour at a range of space and time scales. This usually involves a number of cause-effect (causal) relationships, linking actions and events. In lay terms, 'effect' can be defined as 'what happened' and 'cause', 'why something happened.' In a changing world or merely moving from one scale to another, shifts in perspective are expected, bringing some phenomena into the foreground and putting others to the background. Systems can thus flip from one set of causal structures to another in response to environmental perturbations and human innovations or behaviors, for instance, as space-time signatures are modified. The identification of these flips helps in better understanding and predicting how societies and stakeholders react to a shift in perspective. In this study, our motivation is to investigate possible consequences of the shift to a low carbon economy in terms of socio-technico systems' flips. The focus is on the regional production of Climate-Related Energy (CRE) (hydro-, wind- and solar-power). We search for information on historic shifts that may help defining the forcing conditions of abrupt changes and extreme situations. We identify and present a series of examples in which we try to distinguish the various tipping points, thresholds, breakpoints and regime shifts that are characteristic of complex systems in the CRE production domain. We expect that with these examples our comprehension of the question will be enriched, providing us the elements needed to better validate modeling attempts, to predict and manage flips of complex CRE production systems. The work presented is part of the FP7 project COMPLEX (Knowledge based climate mitigation systems for a low carbon economy; http://www.complex.ac.uk/).

  20. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  1. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  2. Nerve growth factor enhances the CRE-dependent transcriptional activity activated by nobiletin in PC12 cells.

    Takito, Jiro; Kimura, Junko; Kajima, Koji; Uozumi, Nobuyuki; Watanabe, Makoto; Yokosuka, Akihito; Mimaki, Yoshihiro; Nakamura, Masanori; Ohizumi, Yasushi

    2016-07-01

    Prevention and treatment of Alzheimer disease are urgent problems for elderly people in developed countries. We previously reported that nobiletin, a poly-methoxylated flavone from the citrus peel, improved the symptoms in various types of animal models of memory loss and activated the cAMP responsive element (CRE)-dependent transcription in PC12 cells. Nobiletin activated the cAMP/PKA/MEK/Erk/MAPK signaling pathway without using the TrkA signaling activated by nerve growth factor (NGF). Here, we examined the effect of combination of nobiletin and NGF on the CRE-dependent transcription in PC12 cells. Although NGF alone had little effect on the CRE-dependent transcription, NGF markedly enhanced the CRE-dependent transcription induced by nobiletin. The NGF-induced enhancement was neutralized by a TrkA antagonist, K252a. This effect of NGF was effective on the early signaling event elicited by nobiletin. These results suggested that there was crosstalk between NGF and nobiletin signaling in activating the CRE-dependent transcription in PC12 cells.

  3. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  4. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  5. Foxn1[Cre] Expression in the Male Germline.

    Shi, Jianjun; Getun, Irina; Torres, Bivian; Petrie, Howard T

    2016-01-01

    Foxn1 (forkhead box N1), also known as the nude gene or winged-helix nude (Whn), is a forkhead transcription factor thought to be restricted to keratinocytes in the skin and thymus. Consistent with this tissue distribution, spontaneous or targeted mutation of Foxn1 results in the absence of both hair and a thymus. Genetic manipulation of the Foxn1 locus thus represents a powerful tool for tissue specific gene control in the skin and thymus, and tools such as Cre recombinase under control of the Foxn1 locus are widely used for this purpose. Unexpectedly, we show that Foxn1[Cre] exhibits unexpected activity in male germ cells, resulting in ubiquitous targeting of loxP-flanked alleles in all tissues in offspring from Foxn1[Cre] expressing male mice. Inheritance of recombined loxP alleles occurs independently of Cre inheritance (i.e., offspring lacking Cre nonetheless exhibit recombined alleles), suggesting that Foxn1[Cre] induced recombination in male germ cells must occur prior to meiosis in diploid germ cells. Together with previously published data, our results show that Foxn1, and alleles under its control, are expressed in the pre-meiotic male germline, revealing a new tool for germline targeting of genes, and raising important concerns for gender selection when using Foxn1 regulatory elements.

  6. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  7. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  8. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  9. Generation of chickens expressing Cre recombinase.

    Leighton, Philip A; Pedersen, Darlene; Ching, Kathryn; Collarini, Ellen J; Izquierdo, Shelley; Jacob, Roy; van de Lavoir, Marie-Cecile

    2016-10-01

    Cre recombinase has been extensively used for genome engineering in transgenic mice yet its use in other species has been more limited. Here we describe the generation of transgenic chickens expressing Cre recombinase. Green fluorescent protein (GFP)-positive chicken primordial germ cells were stably transfected with β-actin-Cre-recombinase using phiC31 integrase and transgenic chickens were generated. Cre recombinase activity was verified by mating Cre birds to birds carrying a floxed transgene. Floxed sequences were only excised in offspring from roosters that inherited the Cre recombinase but were excised in all offspring from hens carrying the Cre recombinase irrespective of the presence of the Cre transgene. The Cre recombinase transgenic birds were healthy and reproductively normal. The Cre and GFP genes in two of the lines were closely linked whereas the genes segregated independently in a third line. These founders allowed development of GFP-expressing and non-GFP-expressing Cre recombinase lines. These lines of birds create a myriad of opportunities to study developmentally-regulated and tissue-specific expression of transgenes in chickens.

  10. cre siklusu ve kanser

    Cabadak, Hülya

    2008-01-01

    cre çogalması ve hücre siklusunun ilerlemesi büyümenin kontrolünde rolü olan genlerin ekspresyonu ile baglantılıdır. Ökaryot hücre siklusuM(mitoz) G , S ve G fazlarından olusmaktadır. Bu süreçte hücre uyarımı ve büyüme meydana gelir veya hücre G fazında durmaktadır. Hücre siklusunda G -S geçisinde, G -Mgeçisinde ve metafaz-anafaz geçisinde kontrol noktaları bulunmaktadır. Hücre siklusu siklin bagımlı kinazlar (cdk, katalitik altbirim) ve siklin (cyc, düzenleyici altbirim) tarafı...

  11. Tamoxifen-Containing Eye Drops Successfully Trigger Cre-Mediated Recombination in the Entire Eye.

    Schlecht, Anja; Leimbeck, Sarah V; Tamm, Ernst R; Braunger, Barbara M

    2016-01-01

    Embryonic lethality in mice with targeted gene deletion is a major issue that can be circumvented by using Cre-loxP-based animal models. Various inducible Cre systems are available, e.g. such that are activated following tamoxifen treatment, and allow deletion of a specific target gene at any desired time point during the life span of the animal. In this study, we describe the efficiency of topical tamoxifen administration by eye drops using a Cre- reporter mouse strain (R26R). We report that tamoxifen-responsive CAGGCre-ER (TM) mice show a robust Cre- mediated recombination throughout the entire eye.

  12. Chromosomal localisation of the CD4cre transgene in B6·Cg-Tg(Cd4-cre)1Cwi mice.

    Westendorf, Kerstin; Durek, Pawel; Ayew, Samia; Mashreghi, Mir-Farzin; Radbruch, Andreas

    2016-09-01

    The B6·Cg-Tg(Cd4-cre)1Cwi line expresses CRE recombinase under the control of the promoter and regulatory elements of the Cd4 gene. Here we show that CRE recombinase expression reduces the number and frequencies of CD4 positive subsets in a dose-dependent manner and localize the integration site of the transgenic construct to position 60335693-60341285 (qD) of chromosome 3. The insert contains at least 15 complete sequential copies of the transgenic construct. Based on this information we describe a novel PCR assay for genetic typing of transgenic mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  14. Preserved dopaminergic homeostasis and dopamine-related behaviour in hemizygous TH-Cre mice.

    Runegaard, Annika H; Jensen, Kathrine L; Fitzpatrick, Ciarán M; Dencker, Ditte; Weikop, Pia; Gether, Ulrik; Rickhag, Mattias

    2017-01-01

    Cre-driver mouse lines have been extensively used as genetic tools to target and manipulate genetically defined neuronal populations by expression of Cre recombinase under selected gene promoters. This approach has greatly advanced neuroscience but interpretations are hampered by the fact that most Cre-driver lines have not been thoroughly characterized. Thus, a phenotypic characterization is of major importance to reveal potential aberrant phenotypes prior to implementation and usage to selectively inactivate or induce transgene expression. Here, we present a biochemical and behavioural assessment of the dopaminergic system in hemizygous tyrosine hydroxylase (TH)-Cre mice in comparison to wild-type (WT) controls. Our data show that TH-Cre mice display preserved dopaminergic homeostasis with unaltered levels of TH and dopamine as well as unaffected dopamine turnover in striatum. TH-Cre mice also show preserved dopamine transporter expression and function supporting sustained dopaminergic transmission. In addition, TH-Cre mice demonstrate normal responses in basic behavioural paradigms related to dopaminergic signalling including locomotor activity, reward preference and anxiolytic behaviour. Our results suggest that TH-Cre mice represent a valid tool to study the dopamine system, though careful characterization must always be performed to prevent false interpretations following Cre-dependent transgene expression and manipulation of selected neuronal pathways. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  15. Generation of NSE-MerCreMer transgenic mice with tamoxifen inducible Cre activity in neurons.

    Mandy Ka Man Kam

    Full Text Available To establish a genetic tool for conditional deletion or expression of gene in neurons in a temporally controlled manner, we generated a transgenic mouse (NSE-MerCreMer, which expressed a tamoxifen inducible type of Cre recombinase specifically in neurons. The tamoxifen inducible Cre recombinase (MerCreMer is a fusion protein containing Cre recombinase with two modified estrogen receptor ligand binding domains at both ends, and is driven by the neural-specific rat neural specific enolase (NSE promoter. A total of two transgenic lines were established, and expression of MerCreMer in neurons of the central and enteric nervous systems was confirmed. Transcript of MerCreMer was detected in several non-neural tissues such as heart, liver, and kidney in these lines. In the background of the Cre reporter mouse strain Rosa26R, Cre recombinase activity was inducible in neurons of adult NSE-MerCreMer mice treated with tamoxifen by intragastric gavage, but not in those fed with corn oil only. We conclude that NSE-MerCreMer lines will be useful for studying gene functions in neurons for the conditions that Cre-mediated recombination resulting in embryonic lethality, which precludes investigation of gene functions in neurons through later stages of development and in adult.

  16. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  17. Teh CRE system applied to continuous irradiation. A Physician's view. Chapter 30

    Watson, E.R.

    1980-01-01

    The CRE system, used in radiotherapy, is an attempt at a simple, empirical model predicting the response of tissue to irradiation. The two basic formulae used in the CRE system are given followed by a consideration of a number of variable factors which may influence the CRE values. The Cathetron afterloading radiotherapy device demands a completely different schedule from those to which the CRE system is normally applied. The problem of converting a continuous intracavitary schedule to one of fractionated intracavitary treatment for the Cathetron is considered particularly in relation to the volume effect of continuous radiation and also to the wide variation of dose across the volume. It is concluded that in the present state of knowledge it would be unwise to make confident predictions of Cathetron doses on the basis of empirical descriptions such as the CRE. (U.K.)

  18. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  19. Structural and functional characterization of the coxsackievirus B3 CRE(2C): role of CRE(2C) in negative- and positive-strand RNA synthesis.

    Ooij, M.J.M. van; Vogt, D.A.; Paul, A.; Castro, C.; Kuijpers, J.M.; Kuppeveld, F.J.M. van; Cameron, C.E.; Wimmer, E.; Andino, R.; Melchers, W.J.G.

    2006-01-01

    A stem-loop element located within the 2C-coding region of the coxsackievirus B3 (CVB3) genome has been proposed to function as a cis-acting replication element (CRE). It is shown here that disruption of this structure indeed interfered with viral RNA replication in vivo and abolished uridylylation

  20. Knockin of Cre Gene at Ins2 Locus Reveals No Cre Activity in Mouse Hypothalamic Neurons.

    Li, Ling; Gao, Lin; Wang, Kejia; Ma, Xianhua; Chang, Xusheng; Shi, Jian-Hui; Zhang, Ye; Yin, Kai; Liu, Zhimin; Shi, Yuguang; Xie, Zhifang; Zhang, Weiping J

    2016-02-02

    The recombination efficiency and cell specificity of Cre driver lines are critical for exploring pancreatic β cell biology with the Cre/LoxP approach. Some commonly used Cre lines are based on the short Ins2 promoter fragment and show recombination activity in hypothalamic neurons; however, whether this stems from endogenous Ins2 promoter activity remains controversial. In this study, we generated Ins2-Cre knockin mice with a targeted insertion of IRES-Cre at the Ins2 locus and demonstrated with a cell lineage tracing study that the Ins2 gene is not transcriptionally active in the hypothalamus. The Ins2-Cre driver line displayed robust Cre expression and activity in pancreatic β cells without significant alterations in insulin expression. In the brain, Cre activity was mainly restricted to the choroid plexus, without significant recombination detected in the hippocampus or hypothalamus by the LacZ or fluorescent tdTomato reporters. Furthermore, Ins2-Cre mice exhibited normal glucose tolerance and insulin secretion upon glucose stimulation in vivo. In conclusion, this Ins2-Cre driver line allowed high-fidelity detection of endogenous Ins2 promoter activity in vivo, and the negative activity in the hypothalamus demonstrated that this system is a promising alternative tool for studying β cell biology.

  1. Specific and spatial labeling of P0-Cre versus Wnt1-Cre in cranial neural crest in early mouse embryos.

    Chen, Guiqian; Ishan, Mohamed; Yang, Jingwen; Kishigami, Satoshi; Fukuda, Tomokazu; Scott, Greg; Ray, Manas K; Sun, Chenming; Chen, Shi-You; Komatsu, Yoshihiro; Mishina, Yuji; Liu, Hong-Xiang

    2017-06-01

    P0-Cre and Wnt1-Cre mouse lines have been widely used in combination with loxP-flanked mice to label and genetically modify neural crest (NC) cells and their derivatives. Wnt1-Cre has been regarded as the gold standard and there have been concerns about the specificity of P0-Cre because it is not clear about the timing and spatial distribution of the P0-Cre transgene in labeling NC cells at early embryonic stages. We re-visited P0-Cre and Wnt1-Cre models in the labeling of NC cells in early mouse embryos with a focus on cranial NC. We found that R26-lacZ Cre reporter responded to Cre activity more reliably than CAAG-lacZ Cre reporter during early embryogenesis. Cre immunosignals in P0-Cre and reporter (lacZ and RFP) activity in P0-Cre/R26-lacZ and P0-Cre/R26-RFP embryos was detected in the cranial NC and notochord regions in E8.0-9.5 (4-19 somites) embryos. P0-Cre transgene expression was observed in migrating NC cells and was more extensive in the forebrain and hindbrain but not apparent in the midbrain. Differences in the Cre distribution patterns of P0-Cre and Wnt1-Cre were profound in the midbrain and hindbrain regions, that is, extensive in the midbrain of Wnt1-Cre and in the hindbrain of P0-Cre embryos. The difference between P0-Cre and Wnt1-Cre in labeling cranial NC may provide a better explanation of the differential distributions of their NC derivatives and of the phenotypes caused by Cre-driven genetic modifications. © 2017 Wiley Periodicals, Inc.

  2. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  3. Somatostatin-IRES-Cre Mice: Between Knockout and Wild-Type?

    Viollet, Cécile; Simon, Axelle; Tolle, Virginie; Labarthe, Alexandra; Grouselle, Dominique; Loe-Mie, Yann; Simonneau, Michel; Martel, Guillaume; Epelbaum, Jacques

    2017-01-01

    The neuropeptide somatostatin (SOM) is widely expressed in rodent brain and somatostatin-IRES-Cre (SOM-cre) mouse strains are increasingly used to unravel the physiology of SOM-containing neurons. However, while knock-in targeting strategy greatly improves Cre-Lox system accuracy, recent reports have shown that genomic insertion of Cre construct per se can markedly affect physiological function. We show that Cre transgene insertion into the 3'UTR of the somatostatin gene leads to the selective and massive depletion of endogenous SOM in all tested brain regions. It also strongly impacts SOM-related neuroendocrine responses in a similar manner to what has been reported for SST KO mice: increased corticosterone levels after 30-min restraint stress, decreased amplitude and regularity of ultradian growth hormone secretory patterns accompanied by changes in sexually dimorphic liver gene expression ( serpina1, Cyp2b9, Cyp2a4, Cyp2d9, and Cyp7b1 ). In addition to demonstrating the need for examination of the consequences of Cre transgenesis, these results also reveal how this SOM-cre strain may be a useful tool in studying the functional consequences of moderate to low SOM levels as reported in neurological and psychiatric disorders.

  4. Rapid Increase in Prevalence of Carbapenem-Resistant Enterobacteriaceae (CRE) and Emergence of Colistin Resistance Gene mcr-1 in CRE in a Hospital in Henan, China.

    Li, Yi; Sun, Qiao-Ling; Shen, Yingbo; Zhang, Yangjunna; Yang, Jun-Wen; Shu, Ling-Bin; Zhou, Hong-Wei; Wang, Yang; Wang, Bing; Zhang, Rong; Wang, Shaolin; Shen, Zhangqi

    2018-04-01

    The global spread of carbapenem-resistant Enterobacteriaceae (CRE) is one of the most severe threats to human health in a clinical setting. The recent emergence of plasmid-mediated colistin resistance gene mcr-1 among CRE strains greatly compromises the use of colistin as a last resort for the treatment of infections caused by CRE. This study aimed to understand the current epidemiological trends and characteristics of CRE from a large hospital in Henan, the most populous province in China. From 2014 to 2016, a total of 7,249 Enterobacteriaceae isolates were collected from clinical samples, among which 18.1% (1,311/7,249) were carbapenem resistant. Carbapenem-resistant Klebsiella pneumoniae and carbapenem-resistant Escherichia coli were the two most common CRE species, with Klebsiella pneumoniae carbapenemases (KPC) and New Delhi metallo-β-lactamases (NDM), respectively, responsible for the carbapenem resistance of the two species. Notably, >57.0% ( n = 589) of the K. pneumoniae isolates from the intensive care unit were carbapenem resistant. Furthermore, bla NDM-5 and mcr-1 were found to coexist in one E. coli isolate, which exhibited resistance to almost all tested antibiotics. Overall, we observed a significant increase in the prevalence of CRE isolates during the study period and suggest that carbapenems may no longer be considered to be an effective treatment for infections caused by K. pneumoniae in the studied hospital. Copyright © 2018 American Society for Microbiology.

  5. The generation and characterization of novel Col1a1FRT-Cre-ER-T2-FRT and Col1a1FRT-STOP-FRT-Cre-ER-T2 mice for sequential mutagenesis

    Zhang, Minsi; Kirsch, David G.

    2015-01-01

    ABSTRACT Novel genetically engineered mouse models using the Cre-loxP or the Flp-FRT systems have generated useful reagents to manipulate the mouse genome in a temporally-regulated and tissue-specific manner. By incorporating a constitutive Cre driver line into a mouse model in which FRT-regulated genes in other cell types are regulated by Flp-FRT recombinase, gene expression can be manipulated simultaneously in separate tissue compartments. This application of dual recombinase technology can be used to dissect the role of stromal cells in tumor development and cancer therapy. Generating mice in which Cre-ERT2 is expressed under Flp-FRT-mediated regulation would enable step-wise manipulation of the mouse genome using dual recombinase technology. Such next-generation mouse models would enable sequential mutagenesis to better model cancer and define genes required for tumor maintenance. Here, we generated novel genetically engineered mice that activate or delete Cre-ERT2 in response to Flp recombinase. To potentially utilize the large number of Cre-loxP-regulated transgenic alleles that have already been targeted into the Rosa26 locus, such as different reporters and mutant genes, we targeted the two novel Cre-ERT2 alleles into the endogenous Col1a1 locus for ubiquitous expression. In the Col1a1FRT-Cre-ER-T2-FRT mice, Flp deletes Cre-ERT2, so that Cre-ERT2 is only expressed in cells that have never expressed Flp. In contrast, in the Col1a1FRT-STOP-FRT-Cre-ER-T2 mice, Flp removes the STOP cassette to allow Cre-ERT2 expression so that Cre-ERT2 is only expressed in cells that previously expressed Flp. These two new novel mouse strains will be complementary to each other and will enable the exploration of complex biological questions in development, normal tissue homeostasis and cancer. PMID:26183214

  6. The generation and characterization of novel Col1a1FRT-Cre-ER-T2-FRT and Col1a1FRT-STOP-FRT-Cre-ER-T2 mice for sequential mutagenesis

    Minsi Zhang

    2015-09-01

    Full Text Available Novel genetically engineered mouse models using the Cre-loxP or the Flp-FRT systems have generated useful reagents to manipulate the mouse genome in a temporally-regulated and tissue-specific manner. By incorporating a constitutive Cre driver line into a mouse model in which FRT-regulated genes in other cell types are regulated by Flp-FRT recombinase, gene expression can be manipulated simultaneously in separate tissue compartments. This application of dual recombinase technology can be used to dissect the role of stromal cells in tumor development and cancer therapy. Generating mice in which Cre-ERT2 is expressed under Flp-FRT-mediated regulation would enable step-wise manipulation of the mouse genome using dual recombinase technology. Such next-generation mouse models would enable sequential mutagenesis to better model cancer and define genes required for tumor maintenance. Here, we generated novel genetically engineered mice that activate or delete Cre-ERT2 in response to Flp recombinase. To potentially utilize the large number of Cre-loxP-regulated transgenic alleles that have already been targeted into the Rosa26 locus, such as different reporters and mutant genes, we targeted the two novel Cre-ERT2 alleles into the endogenous Col1a1 locus for ubiquitous expression. In the Col1a1FRT-Cre-ER-T2-FRT mice, Flp deletes Cre-ERT2, so that Cre-ERT2 is only expressed in cells that have never expressed Flp. In contrast, in the Col1a1FRT-STOP-FRT-Cre-ER-T2 mice, Flp removes the STOP cassette to allow Cre-ERT2 expression so that Cre-ERT2 is only expressed in cells that previously expressed Flp. These two new novel mouse strains will be complementary to each other and will enable the exploration of complex biological questions in development, normal tissue homeostasis and cancer.

  7. Fshb-iCre mice are efficient and specific Cre deleters for the gonadotrope lineage.

    Wang, Huizhen; Hastings, Richard; Miller, William L; Kumar, T Rajendra

    2016-01-05

    Genetic analysis of development and function of the gonadotrope cell lineage within mouse anterior pituitary has been greatly facilitated by at least three currently available Cre strains in which Cre was either knocked into the Gnrhr locus or expressed as a transgene from Cga and Lhb promoters. However, in each case there are some limitations including CRE expression in thyrotropes within pituitary or ectopic expression outside of pituitary, for example in some populations of neurons or gonads. Hence, these Cre strains often pose problems with regard to undesirable deletion of alleles in non-gonadotrope cells, fertility and germline transmission of mutant alleles. Here, we describe generation and characterization of a new Fshb-iCre deleter strain using 4.7 kb of ovine Fshb promoter regulatory sequences driving iCre expression exclusively in the gonadotrope lineage within anterior pituitary. Fshb-iCre mice develop normally, display no ectopic CRE expression in gonads and are fertile. When crossed onto a loxP recombination-mediated red to green color switch reporter mouse genetic background, in vivo CRE recombinase activity is detectable in gonadotropes at more than 95% efficiency and the GFP-tagged gonadotropes readily purified by fluorescence activated cell sorting. We demonstrate the applicability of this Fshb-iCre deleter strain in a mouse model in which Dicer is efficiently and selectively deleted in gonadotropes. We further show that loss of DICER-dependent miRNAs in gonadotropes leads to profound suppression of gonadotropins resulting in male and female infertility. Thus, Fshb-iCre mice serve as a new genetic tool to efficiently manipulate gonadotrope-specific gene expression in vivo. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Physiological characterisation of recombinant Aspergillus nidulans strains with different creA genotypes expressing A-oryzae alpha-amylase

    Agger, Teit; Petersen, J.B.; O'Connor, S.M.

    2002-01-01

    The physiology of three strains of Aspergillus nidulans was examined-a creA deletion strain, a wild type creA genotype and a strain containing extra copies of the creA gene, all producing Aspergillus oryzae alpha-amylase. The strains were cultured in batch and continuous cultivations and the biom......The physiology of three strains of Aspergillus nidulans was examined-a creA deletion strain, a wild type creA genotype and a strain containing extra copies of the creA gene, all producing Aspergillus oryzae alpha-amylase. The strains were cultured in batch and continuous cultivations...... and the biomass formation and alpha-amylase production was characterised. Overexpression of the creA gene resulted in a lower maximum specific growth rate and a slightly higher repression of the alpha-amylase production during conditions with high glucose concentration. No expression of creA also resulted...... in a decreased maximum specific growth rate, but also in drastic changes in morphology. Furthermore, the expression of alpha-amylase was completely derepressed and creA thus seems to be the only regulatory protein responsible for glucose repression of alpha-amylase expression. The effect of different carbon...

  9. Viral Cre-LoxP tools aid genome engineering in mammalian cells.

    Sengupta, Ranjita; Mendenhall, Amy; Sarkar, Nandita; Mukherjee, Chandreyee; Afshari, Amirali; Huang, Joseph; Lu, Biao

    2017-01-01

    Targeted nucleases have transformed genome editing technology, providing more efficient methods to make targeted changes in mammalian genome. In parallel, there is an increasing demand of Cre-LoxP technology for complex genome manipulation such as large deletion, addition, gene fusion and conditional removal of gene sequences at the target site. However, an efficient and easy-to-use Cre-recombinase delivery system remains lacking. We designed and constructed two sets of expression vectors for Cre-recombinase using two highly efficient viral systems, the integrative lentivirus and non-integrative adeno associated virus. We demonstrate the effectiveness of those methods in Cre-delivery into stably-engineered HEK293 cells harboring LoxP-floxed red fluorescent protein (RFP) and puromycin (Puro) resistant reporters. The delivered Cre recombinase effectively excised the floxed RFP-Puro either directly or conditionally, therefore validating the function of these molecular tools. Given the convenient options of two selections markers, these viral-based systems offer a robust and easy-to-use tool for advanced genome editing, expanding complicated genome engineering to a variety of cell types and conditions. We have developed and functionally validated two viral-based Cre-recombinase delivery systems for efficient genome manipulation in various mammalian cells. The ease of gene delivery with the built-in reporters and inducible element enables live cell monitoring, drug selection and temporal knockout, broadening applications of genome editing.

  10. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. A CRE/AP-1-like motif is essential for induced syncytin-2 expression and fusion in human trophoblast-like model.

    Chirine Toufaily

    Full Text Available Syncytin-2 is encoded by the envelope gene of Endogenous Retrovirus-FRD (ERVFRD-1 and plays a critical role in fusion of placental trophoblasts leading to the formation of the multinucleated syncytiotrophoblast. Its expression is consequently regulated in a strict manner. In the present study, we have identified a forskolin-responsive region located between positions -300 to -150 in the Syncytin-2 promoter region. This 150 bp region in the context of a minimal promoter mediated an 80-fold induction of promoter activity following forskolin stimulation. EMSA analyses with competition experiments with nuclear extracts from forskolin-stimulated BeWo cells demonstrated that the -211 to -177 region specifically bound two forskolin-induced complexes, one of them containing a CRE/AP-1-like motif. Site-directed mutagenesis of the CRE/AP-1 binding site in the context of the Syncytin-2 promoter or a heterologous promoter showed that this motif was mostly essential for forskolin-induced promoter activity. Transfection experiments with dominant negative mutants and constitutively activated CREB expression vectors in addition to Chromatin Immunoprecipitation suggested that a CREB family member, CREB2 was binding and acting through the CRE/AP-1 motif. We further demonstrated the binding of JunD to this same motif. Similar to forskolin and soluble cAMP, CREB2 and JunD overexpression induced Syncytin-2 promoter activity in a CRE/AP-1-dependent manner and Syncytin-2 expression. In addition, BeWo cell fusion was induced by both CREB2 and JunD overexpression, while being repressed following silencing of either gene. These results thereby demonstrate that induced expression of Syncytin-2 is highly dependent on the interaction of bZIP-containing transcription factors to a CRE/AP-1 motif and that this element is important for the regulation of Syncytin-2 expression, which results in the formation of the peripheral syncytiotrophoblast layer.

  12. Targeted knock-in of CreER T2 in zebrafish using CRISPR/Cas9.

    Kesavan, Gokul; Hammer, Juliane; Hans, Stefan; Brand, Michael

    2018-04-01

    New genome-editing approaches, such as the CRISPR/Cas system, have opened up great opportunities to insert or delete genes at targeted loci and have revolutionized genetics in model organisms like the zebrafish. The Cre-loxp recombination system is widely used to activate or inactivate genes with high spatial and temporal specificity. Using a CRISPR/Cas9-mediated knock-in strategy, we inserted a zebrafish codon-optimized CreER T2 transgene at the otx2 gene locus to generate a conditional Cre-driver line. We chose otx2 as it is a patterning gene of the anterior neural plate that is expressed during early development. By knocking in CreER T2 upstream of the endogenous ATG of otx2, we utilized this gene's native promoter and enhancer elements to perfectly match CreER T2 and endogenous otx2 expression patterns. Next, by combining this novel driver line with a Cre-dependent reporter line, we show that only in the presence of tamoxifen can efficient Cre-loxp-mediated recombination be achieved in the anterior neural plate-derived tissues like the telencephalon, the eye and the optic tectum. Our results imply that the otx2:CreER T2 transgenic fish will be a valuable tool for lineage tracing and conditional mutant studies in larval and adult zebrafish.

  13. Commission for Energy regulation (CRE) - Activity report June 2005

    2005-01-01

    texts specify the competitive framework); Opening of the gas markets (Opening of the markets in European Union countries, Opening of the French gas market); CRE: regulator of the French gas market (Major obstacles to efficient operation of the French gas market were raised during 2004 and early 2005, Changes in natural gas regulated sales tariffs, Regulated infrastructure tariffs and utilisation conditions, Gaz de France and Total commitments made to the European Commission, Opening of the non-household market on 1 July 2004 and work of the 2004 Gas Working Group (GTG 2004), Audits of the un-bundled accounts of integrated gas operators, CRE's opinions on the regulatory texts, Codes of good conduct for network operators); The work programme (Independence of network operators, Feedback, Preparation of total opening on 1 July 2007, Preparation of the new tariffs for use of regulated gas infrastructures, Comparison of offers of access to storage facilities in Europe, Distribution system operators' investment criteria, Works in the European context); C - Regulation of the electricity market: actors and electricity markets; access to public power networks; the public electric utility in the regulated market; D - The working of CRE: How CRE exercises its jurisdiction (A working method based on responsiveness, consultation and transparency, Disputes solved help to guarantee the right of access to networks for consumers, suppliers and producers, Control and sanction powers); Tools (Professionalism and a multi-disciplinary approach, Some resources remain insufficient to meet the deadline for total opening of the energy markets on 1 July 2007, Independence and budgetary structure); European and international activity (Relations with European Union institutions, Relations with other regulators, Other international relations); E - Glossary, Acronyms, Units and conversions, Index of insets, tables and figures, Council of European Energy Regulators (CEER)

  14. Prolactin receptors in Rip-cre cells, but not in AgRP neurones, are involved in energy homeostasis.

    Ladyman, S R; MacLeod, M A; Khant Aung, Z; Knowles, P; Phillipps, H R; Brown, R S E; Grattan, D R

    2017-10-01

    Among its many functions, prolactin has been implicated in energy homeostasis, particularly during pregnancy and lactation. The arcuate nucleus is a key site in the regulation of energy balance. The present study aimed to examine whether arcuate nucleus neuronal populations involved in energy homeostasis are prolactin responsive and whether they can mediate the effects of prolactin on energy homeostasis. To determine whether Agrp neurones or Rip-Cre neurones are prolactin responsive, transgenic mice expressing the reporter td-tomato in Agrp neurones (td-tomato/Agrp-Cre) or Rip-Cre neurones (td-tomato/Rip-Cre) were treated with prolactin and perfused 45 minutes later. Brains were processed for double-labelled immunohistochemistry for pSTAT5, a marker of prolactin-induced intracellular signalling, and td-tomato. In addition, Agrp-Cre mice and Rip-Cre mice were crossed with mice in which the prolactin receptor gene (Prlr) was flanked with LoxP sites (Prlr lox/lox mice). The Prlr lox/lox construct was designed such that Cre-mediated recombination resulted in deletion of the Prlr and expression of green fluorescent protein (GFP) in its place. In td-tomato/Rip-Cre mice, prolactin-induced pSTAT5 was co-localised with td-tomato, indicating that there is a subpopulation of Rip-Cre neurones in the arcuate nucleus that respond to prolactin. Furthermore, mice with a specific deletion of Prlr in Rip-Cre neurones had lower body weights, increased oxygen consumption, increased running wheel activity and numerous cells in the arcuate nucleus had positive GFP staining indicating deletion of Prlr from Rip-Cre neurones. By contrast, no co-localisation of td-tomato and pSTAT5 was observed in td-tomato/Agrp-Cre mice after prolactin treatment. Moreover, Prlr lox/lox /Agrp-Cre mice had no positive GFP staining in the arcuate nucleus and did not differ in body weight compared to littermate controls. Overall, these results indicate that Rip-Cre neurones in the arcuate nucleus are

  15. Spontaneous chondroma formation in CD2-Cre-driven Erk-deficient mice.

    Shiokawa, Moe; Lu, Xiuyuan; Miyake, Yasunobu; Ishikawa, Eri; Pagès, Gilles; Pouysségur, Jacques; Ogata, Masato; Yamasaki, Sho

    2017-12-18

    Lineage-specific Cre Tg mice are widely used to delineate the functions of genes in a tissue-specific manner. Several T-cell-specific promoter cassettes have been developed; however, the activities of those promoters in non-T cells have not been investigated extensively. Here, we report that CD2-Cre-mediated deletion of Erk proteins by generating CD2-Cre × Erk1-/-Erk2flox/flox (Erk∆CD2-Cre) mice results in abnormal cartilage hyperplasia. Histological analysis revealed that this abnormality is caused by aberrant hyperplasia of chondrocytes. The presence of Erk-deficient T cells is not required for this chondroma formation, as it was similarly observed in the absence of T cells in a CD3ε-deficient background. In addition, adoptive transfer of bone marrow cells from Erk∆CD2-Cre mice to wild-type recipients did not cause chondroma formation, suggesting that Erk-deficient non-immune cells are responsible for this abnormality. By tracing Cre-expressed tissues using a ROSA26-STOP-RFP allele, we found that the chondroma emitted RFP fluorescence, indicating that functional Cre is expressed in hyperplastic chondrocytes in Erk∆CD2-Cre mice. Furthermore, RFP+ chondrocytes were also found in an Erk-sufficient background, albeit without aberrant growth. These results suggest that unexpected expression of CD2-driven Cre in chondrocytes generates Erk-deficient chondrocytes, resulting in hyperplastic cartilage formation. Recently, two independent reports showed that CD4-Cre-mediated Ras-Erk signaling ablation led to similar abnormal cartilage formation (Guittard, G., Gallardo, D. L., Li, W. et al. 2017. Unexpected cartilage phenotype in CD4-Cre-conditional SOS-deficient mice. Front. Immunol. 8:343; Wehenkel, M., Corr, M., Guy, C. S. et al. 2017. Extracellular signal-regulated kinase signaling in CD4-expressing cells inhibits osteochondromas. Front. Immunol. 8:482). Together with these reports, our study suggests that an unexpected link exists between T-like cell and

  16. Beyond knockouts: cre resources for conditional mutagenesis

    Murray, Stephen A.; Eppig, Janan T.; Smedley, Damian; Simpson, Elizabeth M.; Rosenthal, Nadia

    2013-01-01

    With the effort of the International Phenotyping Consortium (IMPC) to produce thousands of strains with conditional potential gathering steam, there is growing recognition that it must be supported by a rich toolbox of cre driver strains. The approaches to build cre strains have evolved in both sophistication and reliability, replacing first generation strains with tools that can target individual cell populations with incredible precision and specificity. The modest set of cre drivers generated by individual labs over the past 15+ years is now growing rapidly, thanks to a number of large-scale projects to produce new cre strains for the community. The power of this growing resource, however, depends upon the proper deep characterization of strain function, as even the best designed strain can display a variety of undesirable features that must be considered in experimental design. This must be coupled with the parallel development of informatics tools to provide functional data to the user, and facilitated access to the strains through public repositories. We will discuss the current progress on all of these fronts and the challenges that remain to ensure the scientific community can capitalize on the tremendous number of mouse resources at their disposal. PMID:22926223

  17. Isoeffect lines using TDF and CRE concepts

    Supe, S.J.; Sasane, J.B.; Supe, D.S.

    1980-01-01

    Isoeffect lines based on Ellis' Nominal Standard Dose concept, Orton's Time Dose and Fractionation Factor (TDF) concept, and Kirk et al's Cumulative Radiation Effect (CRE) concept give differing results of treatment planning. Experience with isoeffect lines based on the above concepts in planning in case of radiotherapy for carcinoma of bladder and carcinoma of uterine cervix is narrated. (M.G.B.)

  18. An X-linked Myh11-CreERT2 mouse line resulting from Y to X chromosome-translocation of the Cre allele.

    Liao, Mingmei; Zhou, Junmei; Wang, Fen; Ali, Yasmin H; Chan, Kelvin L; Zou, Fei; Offermanns, Stefan; Jiang, Zhisheng; Jiang, Zhihua

    2017-09-01

    The Myh11-CreER T2 mouse line (Cre + ) has gained increasing application because of its high lineage specificity relative to other Cre drivers targeting smooth muscle cells (SMCs). This Cre allele, however, was initially inserted into the Y chromosome (X/Y Cre+ ), which excluded its application in female mice. Our group established a Cre + colony from male ancestors. Surprisingly, genotype screening identified female carriers that stably transmitted the Cre allele to the following generations. Crossbreeding experiments revealed a pattern of X-linked inheritance for the transgene (k > 1000), indicating that these female carries acquired the Cre allele through a mechanism of Y to X chromosome translocation. Further characterization demonstrated that in hemizygous X/X Cre+ mice Cre activity was restricted to a subset arterial SMCs, with Cre expression in arteries decreased by 50% compared to X/Y Cre+ mice. This mosaicism, however, diminished in homozygous X Cre+ /X Cre+ mice. In a model of aortic aneurysm induced by a SMC-specific Tgfbr1 deletion, the homozygous X Cre+ /X Cre+ Cre driver unmasked the aortic phenotype that is otherwise subclinical when driven by the hemizygous X/X Cre+ Cre line. In conclusion, the Cre allele carried by this female mouse line is located on the X chromosome and subjected to X-inactivation. The homozygous X Cre+ /X Cre+ mice produce uniform Cre activity in arterial SMCs. © 2017 Wiley Periodicals, Inc.

  19. Cre-expressing neurons in the cortical white matter of Ntsr1-Cre GN220 mice.

    Sundberg, Sofie C; Granseth, Björn

    2018-03-23

    Genetically modified mouse strains that express Cre-recombinase in specific neuronal sub-populations have become widely used tools for investigating neuronal function. The Ntsr1-Cre GN220 mouse expresses this enzyme in corticothalamic neurons in layer 6 of cerebral cortex. We observed that about 7% of Cre-expressing cells in the primary visual cortex are found within the white matter bordering layer 6. By using the immunohistochemical marker for layer 6 neurons, Forkhead box protein 2 (FoxP2), and fluorescently conjugated latex beads injected into the dorsal lateral geniculate nucleus, we show that about half of these cells are similar to and could belong to the layer 6 corticothalamic neuron population. The other half seems to be a distinct white matter (WM) neuron sub-population that we estimate to constitute 2-4% of the total cortical Cre-expressing population. Staining for the neuronal marker Neuronal nuclei (NeuN) revealed that about 15-40% of WM neurons are Cre-expressing. Thus, the potential contribution from WM neurons needs to be considered when interpreting the results from experiments using the Ntsr1-Cre GN220 mouse for investigating corticothalamic neuronal function. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Tg(Th-Cre)FI172Gsat (Th-Cre) defines neurons that are required for full hypercapnic and hypoxic reflexes.

    Sun, Jenny J; Ray, Russell S

    2017-08-15

    The catecholaminergic (CA) system has been implicated in many facets of breathing control and offers an important target to better comprehend the underlying etiologies of both developmental and adult respiratory pathophysiologies. Here, we used a noninvasive DREADD-based pharmacogenetic approach to acutely perturb Tg(Th-Cre)FI172Gsat ( Th-Cre )-defined neurons in awake and unrestrained mice in an attempt to characterize CA function in breathing. We report that clozapine-N-oxide (CNO)-DREADD-mediated inhibition of Th-Cre -defined neurons results in blunted ventilatory responses under respiratory challenge. Under a hypercapnic challenge (5% CO 2 /21% O 2 /74% N 2 ), perturbation of Th-Cre neurons results in reduced f R , [Formula: see text] and [Formula: see text] Under a hypoxic challenge (10% O 2 /90% N 2 ), we saw reduced f R , [Formula: see text] and [Formula: see text], in addition to instability in both interbreath interval and tidal volume, resulting in a Cheyne-Stokes-like respiratory pattern. These findings demonstrate the necessity of Th-Cre -defined neurons for the hypercapnic and hypoxic ventilatory responses and breathing stability during hypoxia. However, given the expanded non-CA expression domains of the Tg(Th-Cre)FI172Gsat mouse line found in the brainstem, full phenotypic effect cannot be assigned solely to CA neurons. Nonetheless, this work identifies a key respiratory population that may lead to further insights into the circuitry that maintains respiratory stability in the face of homeostatic challenges. © 2017. Published by The Company of Biologists Ltd.

  1. Spontaneous recombinase activity of Cre-ERT2 in vivo.

    Kristianto, Jasmin; Johnson, Michael G; Zastrow, Ryley K; Radcliff, Abigail B; Blank, Robert D

    2017-06-01

    Inducible Cre-ERT recombinase technology is widely used for gene targeting studies. The second generation of inducible Cre-ERT recombinase, hemizygous B6.129S-Tg(UBC-cre/ERT2)1Ejb/J (hereafter abbreviated as Cre-ERT2), a fusion of a mutated estrogen receptor and Cre recombinase, was engineered to be more efficient and specific than the original Cre-ERT. The putative mechanism of selective Cre-mediated recombination is Cre sequestration in the cytoplasm in the basal state with translocation to the nucleus only in the presence of tamoxifen. We utilized both a reporter mouse (B6.129 (Cg)-Gt(ROSA)26Sor tm4(ACTB-tdTomato,-EGFP)Luo /J) and endothelin converting enzyme-1 floxed transgenic mouse line to evaluate Cre-ERT2 activity. We observed spontaneous Cre activity in both settings. Unintended Cre activity is a confounding factor that has a potentially large impact on data interpretation. Thus, it is important to consider background Cre activity in experimental design.

  2. CRE answer to the European Commission public consultation on the new electricity market design

    Ladoucette, Philippe de

    2015-01-01

    On July 15, 2015, the European Commission launched a public consultation on the new Electricity Market Design. All National Regulatory Authorities (NRAs), and CRE in particular, contributed to the joint ACER-CEER response to the consultation. CRE supports this joint response, and further develops some topics in this document, building on its particular experience in the implementation of the internal energy market: implementation of the network codes, in particular those regarding the markets, development of demand-side flexibility, development of interconnections, and alignment of fragmented balancing markets

  3. Molecular switch of Cre/loxP for radiation modulated gene therapy on hepatoma

    Hsieh, Y.-J. [Institute of Radiological Sciences, National Yang-Ming University, Taiwan (China); Chen, Fu-Du [Institute of Radiological Sciences, National Yang-Ming University, Taiwan (China); Institute of Radiological Sciences, Central Taiwan University of Science and Technology, Taiwan (China); Wang, F.H. [National Yang-Ming University Medical School, Taiwan (China); Ke, C.C. [National PET/Cyclotron Center, Taipei Veterans General Hospital, Taiwan (China); Wang, H.-E. [Institute of Radiological Sciences, National Yang-Ming University, Taiwan (China); Liu, R.-S. [Institute of Radiological Sciences, National Yang-Ming University, Taiwan (China) and National Yang-Ming University Medical School, Taiwan (China) and National PET/Cyclotron Center, Taipei Veterans General Hospital, Taiwan (China)]. E-mail: maimai5010@yahoo.com.tw

    2007-02-01

    For the purpose of enhancement of AFP promoter for the use of radiation modulated gene therapy for hepatocellular carcinoma (HCC), we combined hepatitis B virus (HBV) enhancer II with AFP promoter which shows the selectivity to the target cells to control the Cre/loxP system. Different gene constructs, pE4luc, pE4Tk, EIIAPA-Cre, E4CMV-STOP-Tk and chimeric promoters combined with HBV enhancer were constructed and transfected into HepG2, HeLa and NIH-3T3 cell lines. Cell experiments revealed that E4 enhancer responses to radiation best after 60 h irradiation at a dose range of 5-7 Gy in HepG2 stable clone. The EIIAPA promoter provided high specificity to hepatoma and activated the Cre downstream and removed the stop cassette only in hepatoma cells. After removal of the stop cassette, the E4 response to radiation could encode more Tk protein and kill more tumor cells. In summary, the chimeric EIIAPA promoter can stringently control the expression of Cre recombinase only in HCC. The radiation effect of the EIIAPA-Cre and E4CMV-STOP-Tk system shows promising results in terms of cell survival of HCC.

  4. Molecular switch of Cre/loxP for radiation modulated gene therapy on hepatoma

    Hsieh, Y.-J.; Chen, Fu-Du; Wang, F.H.; Ke, C.C.; Wang, H.-E.; Liu, R.-S.

    2007-01-01

    For the purpose of enhancement of AFP promoter for the use of radiation modulated gene therapy for hepatocellular carcinoma (HCC), we combined hepatitis B virus (HBV) enhancer II with AFP promoter which shows the selectivity to the target cells to control the Cre/loxP system. Different gene constructs, pE4luc, pE4Tk, EIIAPA-Cre, E4CMV-STOP-Tk and chimeric promoters combined with HBV enhancer were constructed and transfected into HepG2, HeLa and NIH-3T3 cell lines. Cell experiments revealed that E4 enhancer responses to radiation best after 60 h irradiation at a dose range of 5-7 Gy in HepG2 stable clone. The EIIAPA promoter provided high specificity to hepatoma and activated the Cre downstream and removed the stop cassette only in hepatoma cells. After removal of the stop cassette, the E4 response to radiation could encode more Tk protein and kill more tumor cells. In summary, the chimeric EIIAPA promoter can stringently control the expression of Cre recombinase only in HCC. The radiation effect of the EIIAPA-Cre and E4CMV-STOP-Tk system shows promising results in terms of cell survival of HCC

  5. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  6. A new Cre driver mouse line, Tcf21/Pod1-Cre, targets metanephric mesenchyme.

    Yoshiro Maezawa

    Full Text Available Conditional gene targeting in mice has provided great insight into the role of gene function in kidney development and disease. Although a number of Cre-driver mouse strains already exist for the kidney, development of additional strains with unique expression patterns is needed. Here we report the generation and validation of a Tcf21/Pod1-Cre driver strain that expresses Cre recombinase throughout the condensing and stromal mesenchyme of developing kidneys and in their derivatives including epithelial components of the nephron and interstitial cells. To test the efficiency of this line, we crossed it to mice transgenic for either loss or gain of function β-catenin conditional alleles. Mice with deletion of β-catenin from Tcf21-expressing cells are born with hypoplastic kidneys, hydroureters and hydronephrosis. By contrast, Tcf21-Cre driven gain of function for β-catenin in mice results in fused midline kidneys and hypoplastic kidneys. Finally, we report the first renal mesenchymal deletion of Patched1 (Ptch1, the receptor for sonic hedgehog (Shh, which results in renal cysts demonstrating a functional role of Shh signaling pathway in renal cystogensis. In summary, we report the generation and validation of a new Cre driver strain that provides robust excision in metanephric mesenchyme.

  7. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  8. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  9. Production of Cellulases by Rhizopus stolonifer from Glucose-Containing Media Based on the Regulation of Transcriptional Regulator CRE.

    Zhang, Yingyiing; Tang, Bin; Du, Guocheng

    2017-03-28

    Carbon catabolite repression is a crucial regulation mechanism in microorganisms, but its characteristic in Rhizopus is still unclear. We extracted a carbon regulation gene, cre , that encoded a carbon catabolite repressor protein (CRE) from Rhizopus stolonifer TP-02, and studied the regulation of CRE by real-time qPCR. CRE responded to glucose in a certain range, where it could significantly regulate part of the cellulase genes ( eg, bg, and cbh2 ) without cbh1 . In the comparison of the response of cre and four cellulase genes to carboxymethylcellulose sodium and a simple carbon source (lactose), the effect of CRE was only related to the concentration of reducing sugars. By regulating the reducing sugars to range from 0.4% to 0.6%, a glucose-containing medium with lactose as the inducer could effectively induce cellulases without the repression of CRE. This regulation method could potentially reduce the cost of enzymes produced in industries and provide a possible solution to achieve the large-scale synthesis of cellulases.

  10. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  11. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  12. A Study of Plazomicin Compared With Colistin in Patients With Infection Due to Carbapenem-Resistant Enterobacteriaceae (CRE)

    2016-10-03

    Bloodstream Infections (BSI) Due to CRE; Hospital-Acquired Bacterial Pneumonia (HABP) Due to CRE; Ventilator-Associated Bacterial Pneumonia (VABP) Due to CRE; Complicated Urinary Tract Infection (cUTI) Due to CRE; Acute Pyelonephritis (AP) Due to CRE

  13. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  14. Suppressing cAMP response element-binding protein transcription shortens the duration of status epilepticus and decreases the number of spontaneous seizures in the pilocarpine model of epilepsy.

    Zhu, Xinjian; Dubey, Deepti; Bermudez, Camilo; Porter, Brenda E

    2015-12-01

    Current epilepsy therapies directed at altering the function of neurotransmitter receptors or ion channels, or release of synaptic vesicles fail to prevent seizures in approximately 30% of patients. A better understanding of the molecular mechanism underlying epilepsy is needed to provide new therapeutic targets. The activity of cyclic AMP (cAMP) response element-binding protein (CREB), a major transcription factor promoting CRE-mediated transcription, increases following a prolonged seizure called status epilepticus. It is also increased in the seizure focus of patients with medically intractable focal epilepsy. Herein we explored the effect of acute suppression of CREB activity on status epilepticus and spontaneous seizures in a chronic epilepsy model. Pilocarpine chemoconvulsant was used to induce status epilepticus. To suppress CREB activity, a transgenic mouse line expressing an inducible dominant negative mutant of CREB (CREB(IR) ) with a serine to alanine 133 substitution was used. Status epilepticus and spontaneous seizures of transgenic and wild-type mice were analyzed using video-electroencephalography (EEG) to assess the effect of CREB suppression on seizures. Our findings indicate that activation of CREB(IR) shortens the duration of status epilepticus. The frequency of spontaneous seizures decreased in mice with chronic epilepsy during CREB(IR) induction; however, the duration of the spontaneous seizures was unchanged. Of interest, we found significantly reduced levels of phospho-CREB Ser133 upon activation of CREB(IR) , supporting prior work suggesting that binding to the CRE site is important for CREB phosphorylation. Our results suggest that CRE transcription supports seizure activity both during status epilepticus and in spontaneous seizures. Thus, blocking of CRE transcription is a novel target for the treatment of epilepsy. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  15. Supporting conditional mouse mutagenesis with a comprehensive cre characterization resource

    Heffner, Caleb S.; Herbert Pratt, C.; Babiuk, Randal P.; Sharma, Yashoda; Rockwood, Stephen F.; Donahue, Leah R.; Eppig, Janan T.; Murray, Stephen A.

    2012-01-01

    Full realization of the value of the loxP-flanked alleles generated by the International Knockout Mouse Consortium will require a large set of well-characterized cre-driver lines. However, many cre driver lines display excision activity beyond the intended tissue or cell type, and these data are frequently unavailable to the potential user. Here we describe a high-throughput pipeline to extend characterization of cre driver lines to document excision activity in a wide range of tissues at multiple time points and disseminate these data to the scientific community. Our results show that the majority of cre strains exhibit some degree of unreported recombinase activity. In addition, we observe frequent mosaicism, inconsistent activity and parent-of-origin effects. Together, these results highlight the importance of deep characterization of cre strains, and provide the scientific community with a critical resource for cre strain information. PMID:23169059

  16. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  17. Isoeffect lines using TDF and CRE concepts

    Supe, S.J.; Sasane, J.B.; Gupta, M.K.; Supe, D.S.

    1979-01-01

    In most of the radiotherapy centres the treatment planning is based on isodose lines. Isoeffect lines are also being drawn based on the concepts of TDFs and CREs. A study has been made of whether the isoeffect lines based on the concepts of TDFs, CRes and the physical isodose lines are identical in all the treatment situations. Isoeffects lines for a few treatment schedules involving treatment of carcinoma of the bladder, treatment of cancer of the uterine cervix by combined intracavitary and external beam therapies and intracavitary therapy alone have been obtained and compared. The effect of treatment mode on the isoeffect lines has also been studied. It was found that the isodose curves and the isoeffect lines using the TDF and CRE concepts were not identical in all situations. Therefore, the ultimate treatment plans based on these isoeffect lines will not be exactly the same. The dependence of the isoeffect lines with the variation of the exponents of time and number of fractions used in the empirical relationship for NSD have also been investigated. Clinical trials have been initiated in the case of cancer of the bladder and cervix uterus based on the isodose curves and isoeffect lines using CRE and TDF concepts. (author)

  18. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  19. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  20. Overlapping ETS and CRE Motifs (G/CCGGAAGTGACGTCA) Preferentially Bound by GABPα and CREB Proteins

    Chatterjee, Raghunath; Zhao, Jianfei; He, Ximiao; Shlyakhtenko, Andrey; Mann, Ishminder; Waterfall, Joshua J.; Meltzer, Paul; Sathyanarayana, B. K.; FitzGerald, Peter C.; Vinson, Charles

    2012-01-01

    Previously, we identified 8-bps long DNA sequences (8-mers) that localize in human proximal promoters and grouped them into known transcription factor binding sites (TFBS). We now examine split 8-mers consisting of two 4-mers separated by 1-bp to 30-bps (X4-N1-30-X4) to identify pairs of TFBS that localize in proximal promoters at a precise distance. These include two overlapping TFBS: the ETS⇔ETS motif (C/GCCGGAAGCGGAA) and the ETS⇔CRE motif (C/GCGGAAGTGACGTCAC). The nucleotides in bold are part of both TFBS. Molecular modeling shows that the ETS⇔CRE motif can be bound simultaneously by both the ETS and the B-ZIP domains without protein-protein clashes. The electrophoretic mobility shift assay (EMSA) shows that the ETS protein GABPα and the B-ZIP protein CREB preferentially bind to the ETS⇔CRE motif only when the two TFBS overlap precisely. In contrast, the ETS domain of ETV5 and CREB interfere with each other for binding the ETS⇔CRE. The 11-mer (CGGAAGTGACG), the conserved part of the ETS⇔CRE motif, occurs 226 times in the human genome and 83% are in known regulatory regions. In vivo GABPα and CREB ChIP-seq peaks identified the ETS⇔CRE as the most enriched motif occurring in promoters of genes involved in mRNA processing, cellular catabolic processes, and stress response, suggesting that a specific class of genes is regulated by this composite motif. PMID:23050235

  1. Male germline recombination of a conditional allele by the widely used Dermo1-cre (Twist2-cre) transgene.

    He, Yun; Sun, Xiumei; Wang, Li; Mishina, Yuji; Guan, Jun-Lin; Liu, Fei

    2017-09-01

    Conditional gene knockout using the Cre/loxP system is instrumental in advancing our understanding of the function of genes in a wide range of disciplines. It is becoming increasingly apparent in the literature that recombination mediated by some Cre transgenes can occur in unexpected tissues. Dermo1-Cre (Twist2-Cre) has been widely used to target skeletal lineage cells as well as other mesoderm-derived cells. Here we report that Dermo1-Cre exhibits spontaneous male germline recombination activity leading to a Cre-mediated recombination of a floxed Ptk2 (Protein tyrosine kinase 2, also known as Fak [Focal adhesion kinase]) allele but not a floxed Rb1cc1 (RB1 inducible coiled-coil 1, also known as Fip200 [FAK-family Interacting Protein of 200 kDa]) allele at high frequency. This ectopic germline activity of Dermo1-Cre occurred in all or none manner in a given litter. We demonstrated that the occurrence of germline recombination activity of Dermo1-Cre transgene can be avoided by using female mice as parental Dermo1-Cre carriers. © 2017 Wiley Periodicals, Inc.

  2. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  3. Conditional Gene Expression in the Mouse Inner Ear Using Cre-loxP

    Cox, Brandon C.; Liu, Zhiyong; Lagarde, Marcia M. Mellado; Zuo, Jian

    2012-01-01

    In recent years, there has been significant progress in the use of Cre-loxP technology for conditional gene expression in the inner ear. Here, we introduce the basic concepts of this powerful technology, emphasizing the differences between Cre and CreER. We describe the creation and Cre expression pattern of each Cre and CreER mouse line that has been reported to have expression in auditory and vestibular organs. We compare the Cre expression patterns between Atoh1-CreERTM and Atoh1-CreERT2 a...

  4. Corporate branding: an exploration of the influence of CRE

    Appel - Meulenbroek, H.A.J.A.; Havermans, D.W.Q.; Janssen, I.I.; Kempen, van A.J.M.

    2010-01-01

    Purpose – The purpose of this paper is to understand how corporate real estate (CRE) can add value to corporate branding and how corporate branding strategies for CRE can be determined. Design/methodology/approach – The paper presents a theoretical background for corporate branding and real estate

  5. Cre recombinase expression can result in phenotypic aberrations in plants

    Coppoolse, E.; Vroomen, de M.J.; Roelofs, D.; Smit, J.; Gennip, van F.; Hersmus, B.J.M.; Nijkamp, H.J.J.; Haaren, van M.J.

    2003-01-01

    The cre recombinase gene was stably introduced and expressed in tomato, petunia and Nicotiana tabacum. Some plants expressing the cre gene driven by a CaMV 35S promoter displayed growth retardation and a distinct pattern of chlorosis in their leaves. Although no direct relation can be proven between

  6. Cre recombinase expression can result in phenotypic aberrations in plants

    Coppoolse, Eric R; de Vroomen, Marianne J; Roelofs, Dick; Smit, Jaap; van Gennip, Femke; Hersmus, Bart J M; Nijkamp, H John J; van Haaren, Mark J J

    The cre recombinase gene was stably introduced and expressed in tomato, petunia and Nicotiana tabacum. Some plants expressing the cre gene driven by a CaMV 35S promoter displayed growth retardation and a distinct pattern of chlorosis in their leaves. Although no direct relation can be proven between

  7. Generation of Oxtr cDNA(HA)-Ires-Cre Mice for Gene Expression in an Oxytocin Receptor Specific Manner.

    Hidema, Shizu; Fukuda, Tomokazu; Hiraoka, Yuichi; Mizukami, Hiroaki; Hayashi, Ryotaro; Otsuka, Ayano; Suzuki, Shingo; Miyazaki, Shinji; Nishimori, Katsuhiko

    2016-05-01

    The neurohypophysial hormone oxytocin (OXT) and its receptor (OXTR) have critical roles in the regulation of pro-social behaviors, including social recognition, pair bonding, parental behavior, and stress-related responses. Supporting this hypothesis, a portion of patients suffering from autism spectrum disorder have mutations, such as single nucleotide polymorphisms, or epigenetic modifications in their OXTR gene. We previously reported that OXTR-deficient mice exhibit pervasive social deficits, indicating the critical role of OXTR in social behaviors. In the present study, we generated Oxtr cDNA(HA)-Ires-Cre knock-in mice, expressing both OXTR and Cre recombinase under the control of the endogenous Oxtr promoter. Knock-in cassette of Oxtr cDNA(HA)-Ires-Cre consisted of Oxtr cDNA tagged with the hemagglutinin epitope at the 3' end (Oxtr cDNA(HA)), internal ribosomal entry site (Ires), and Cre. Cre was expressed in the uterus, mammary gland, kidney, and brain of Oxtr cDNA(HA)-Ires-Cre knock-in mice. Furthermore, the distribution of Cre in the brain was similar to that observed in Oxtr-Venus fluorescent protein expressing mice (Oxtr-Venus), another animal model previously generated by our group. Social behavior of Oxtr cDNA(HA)-Ires-Cre knock-in mice was similar to that of wild-type animals. We demonstrated that this construct is expressed in OXTR-expressing neurons specifically after an infection with the recombinant adeno-associated virus carrying the flip-excision switch vector. Using this system, we showed the transport of the wheat-germ agglutinin tracing molecule from the OXTR-expressing neurons to the innervated neurons in knock-in mice. This study might contribute to the monosynaptic analysis of neuronal circuits and to the optogenetic analysis of neurons expressing OXTR. © 2015 Wiley Periodicals, Inc.

  8. High-fidelity Glucagon-CreER mouse line generated by CRISPR-Cas9 assisted gene targeting

    Amanda M. Ackermann

    2017-03-01

    Full Text Available Objective: α-cells are the second most prominent cell type in pancreatic islets and are responsible for producing glucagon to increase plasma glucose levels in times of fasting. α-cell dysfunction and inappropriate glucagon secretion occur in both type 1 and type 2 diabetes. Thus, there is growing interest in studying both normal function and pathophysiology of α-cells. However, tools to target gene ablation or activation specifically of α-cells have been limited, compared to those available for β-cells. Previous Glucagon-Cre and Glucagon-CreER transgenic mouse lines have suffered from transgene silencing, and the only available Glucagon-CreER “knock-in” mouse line results in glucagon haploinsufficiency, which can confound the interpretation of gene deletion analyses. Therefore, we sought to develop a Glucagon-CreERT2 mouse line that would maintain normal glucagon expression and would be less susceptible to transgene silencing. Methods: We utilized CRISPR-Cas9 technology to insert an IRES-CreERT2 sequence into the 3′ UTR of the Glucagon (Gcg locus in mouse embryonic stem cells (ESCs. Targeted ESC clones were then injected into mouse blastocysts to obtain Gcg-CreERT2 mice. Recombination efficiency in GCG+ pancreatic α-cells and glucagon-like peptide 1 positive (GLP1+ enteroendocrine L-cells was measured in Gcg-CreERT2;Rosa26-LSL-YFP mice injected with tamoxifen during fetal development and adulthood. Results: Tamoxifen injection of Gcg-CreERT2;Rosa26-LSL-YFP mice induced high recombination efficiency of the Rosa26-LSL-YFP locus in perinatal and adult α-cells (88% and 95%, respectively, as well as in first-wave fetal α-cells (36% and adult enteroendocrine L-cells (33%. Mice homozygous for the Gcg-CreERT2 allele were phenotypically normal. Conclusions: We successfully derived a Gcg-CreERT2 mouse line that expresses CreERT2 in pancreatic α-cells and enteroendocrine L-cells without disrupting preproglucagon gene expression. These mice

  9. Phenotypically silent Cre recombination within the postnatal ventricular conduction system.

    Bhattacharyya, Samadrita; Bhakta, Minoti; Munshi, Nikhil Vilas

    2017-01-01

    The cardiac conduction system (CCS) is composed of specialized cardiomyocytes that initiate and maintain cardiac rhythm. Any perturbation to the normal sequence of electrical events within the heart can result in cardiac arrhythmias. To understand how cardiac rhythm is established at the molecular level, several genetically modified mouse lines expressing Cre recombinase within specific CCS compartments have been created. In general, Cre driver lines have been generated either by homologous recombination of Cre into an endogenous locus or Cre expression driven by a randomly inserted transgene. However, haploinsufficiency of the endogenous gene compromises the former approach, while position effects negatively impact the latter. To address these limitations, we generated a Cre driver line for the ventricular conduction system (VCS) that preserves endogenous gene expression by targeting the Contactin2 (Cntn2) 3' untranslated region (3'UTR). Here we show that Cntn23'UTR-IRES-Cre-EGFP/+ mice recombine floxed alleles within the VCS and that Cre expression faithfully recapitulates the spatial distribution of Cntn2 within the heart. We further demonstrate that Cre expression initiates after birth with preservation of native Cntn2 protein. Finally, we show that Cntn23'UTR-IRES-Cre-EGFP/+ mice maintain normal cardiac mechanical and electrical function. Taken together, our results establish a novel VCS-specific Cre driver line without the adverse consequences of haploinsufficiency or position effects. We expect that our new mouse line will add to the accumulating toolkit of CCS-specific mouse reagents and aid characterization of the cell-autonomous molecular circuitry that drives VCS maintenance and function.

  10. Effects of rolipram, a phosphodiesterase 4 inhibitor, in combination with imipramine on depressive behavior, CRE-binding activity and BDNF level in learned helplessness rats.

    Itoh, Tetsuji; Tokumura, Miwa; Abe, Kohji

    2004-09-13

    The brain cAMP regulating system and its downstream elements play a pivotal role in the therapeutic effects of antidepressants. We previously reported the increase in activities of phosphodiesterase 4, a major phosphodiesterase isozyme hydrolyzing cAMP, in the frontal cortex and hippocampus of learned helplessness rats, an animal model for depression. The present study was undertaken to examine the combination of effects of rolipram, a phosphodiesterase 4 inhibitor, with imipramine, a typical tricyclic antidepressant, on depressive behavior in learned helplessness rats. Concurrently, cAMP-response element (CRE)-binding activity and brain-derived neurotrophic factor (BDNF) levels related to the therapeutic effects of antidepressants were determined. Repeated administration of imipramine (1.25-10 mg/kg, i.p.) or rolipram (1.25 mg/kg, i.p.) reduced the number of escape failures in learned helplessness rats. Imipramine could not completely ameliorate the escape behavior to a level similar to that of non-stressed rats even at 10 mg/kg. However, repeated coadministration of rolipram with imipramine (1.25 and 2.5 mg/kg, respectively) almost completely eliminated the escape failures in learned helplessness rats. The reduction of CRE-binding activities and BDNF levels in the frontal cortex or hippocampus in learned helplessness rats were ameliorated by treatment with imipramine or rolipram alone. CRE-binding activities and/or BDNF levels of the frontal cortex and hippocampus were significantly increased by treatment with a combination of rolipram and imipramine compared to those in imipramine-treated rats. These results indicated that coadministration of phosphodiesterase type 4 inhibitors with antidepressants may be more effective for depression therapy and suggest that elevation of the cAMP signal transduction pathway is involved in the antidepressive effects.

  11. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  13. Building Cre Knockin Rat Lines Using CRISPR/Cas9.

    Ma, Yuanwu; Zhang, Lianfeng; Huang, Xingxu

    2017-01-01

    Conditional gene inactivation strategy helps researchers to study the gene functions that are critical in embryogenesis or in defined tissues of adulthood. The Cre/loxP system is widely used for conditional gene inactivation/activation in cells or organisms. Cre knockin animal lines are essential for gene expression or inactivation in a spatially and temporally restricted manner. However, to generate a Cre knockin line by traditional approach is laborious. Recently, the clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR/Cas9) has been proven as a simple and efficient genome-editing tool. We have used CRISPR/Cas9 system to generate rat strains that carry Cre genes in different targeted gene loci by direct delivery of gRNAs/Cas9/donors into fertilized eggs. Here, we described a stepwise procedure for the generation of Cre knockin rat, including target site selection, RNA preparation, the construction of the template donor, pronuclear injection, and the genotyping of precise Cre insertion in F 0 rats. Taken together, the establishment of Cre knockin line can be achieved within 6 weeks.

  14. Flavonoids and Auxin Transport Inhibitors Rescue Symbiotic Nodulation in the Medicago truncatula Cytokinin Perception Mutant cre1

    Ng, Jason Liang Pin; Hassan, Samira; Truong, Thy T.; Hocart, Charles H.; Laffont, Carole; Frugier, Florian; Mathesius, Ulrike

    2015-01-01

    Initiation of symbiotic nodules in legumes requires cytokinin signaling, but its mechanism of action is largely unknown. Here, we tested whether the failure to initiate nodules in the Medicago truncatula cytokinin perception mutant cre1 (cytokinin response1) is due to its altered ability to regulate auxin transport, auxin accumulation, and induction of flavonoids. We found that in the cre1 mutant, symbiotic rhizobia cannot locally alter acro- and basipetal auxin transport during nodule initiation and that these mutants show reduced auxin (indole-3-acetic acid) accumulation and auxin responses compared with the wild type. Quantification of flavonoids, which can act as endogenous auxin transport inhibitors, showed a deficiency in the induction of free naringenin, isoliquiritigenin, quercetin, and hesperetin in cre1 roots compared with wild-type roots 24 h after inoculation with rhizobia. Coinoculation of roots with rhizobia and the flavonoids naringenin, isoliquiritigenin, and kaempferol, or with the synthetic auxin transport inhibitor 2,3,5,-triiodobenzoic acid, rescued nodulation efficiency in cre1 mutants and allowed auxin transport control in response to rhizobia. Our results suggest that CRE1-dependent cytokinin signaling leads to nodule initiation through the regulation of flavonoid accumulation required for local alteration of polar auxin transport and subsequent auxin accumulation in cortical cells during the early stages of nodulation. PMID:26253705

  15. Commission for Energy regulation (CRE) - Activity report June 2007

    NONE

    2007-07-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2007 activity report of CRE. Content: A - Towards a single European energy market: Birth of a single European energy market (Origins of Europe of Energy, Emergence of a European energy policy); Main European Community guiding lines (European governance as regards energy, Guiding principles for the internal energy market); European Community activities (European Commission reports, Electricity and gas Regional Initiatives); Organisation and coordination of European regulators (Joint organisation of European regulators, CRE's relations with European Community institutions); CRE's European activities (Regional integration of gas markets, Regional integration of electricity markets, Operation of the European interconnected electricity grid and security of supply, CRE's other European activities); B - CRE action at national level: Grids/networks and infrastructures (General information, Electricity grids, Regulation of gas networks and infrastructures); Markets (Changes in the regulatory and legislative contexts of electricity and natural gas markets, Electricity markets

  16. Commission for Energy regulation (CRE) - Activity report June 2007

    2007-01-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2007 activity report of CRE. Content: A - Towards a single European energy market: Birth of a single European energy market (Origins of Europe of Energy, Emergence of a European energy policy); Main European Community guiding lines (European governance as regards energy, Guiding principles for the internal energy market); European Community activities (European Commission reports, Electricity and gas Regional Initiatives); Organisation and coordination of European regulators (Joint organisation of European regulators, CRE's relations with European Community institutions); CRE's European activities (Regional integration of gas markets, Regional integration of electricity markets, Operation of the European interconnected electricity grid and security of supply, CRE's other European activities); B - CRE action at national level: Grids/networks and infrastructures (General information, Electricity grids, Regulation of gas networks and infrastructures); Markets (Changes in the regulatory and legislative contexts of electricity and natural gas markets, Electricity markets, Natural gas

  17. Dwarfism in homozygous Agc1CreERT mice is associated with decreased expression of aggrecan.

    Rashid, Harunur; Chen, Haiyan; Hassan, Quamarul; Javed, Amjad

    2017-10-01

    Aggrecan (Acan), a large proteoglycan is abundantly expressed in cartilage tissue. Disruption of Acan gene causes dwarfism and perinatal lethality of homozygous mice. Because of sustained expression of Acan in the growth plate and articular cartilage, Agc Cre model has been developed for the regulated ablation of target gene in chondrocytes. In this model, the IRES-CreERT-Neo-pgk transgene is knocked-in the 3'UTR of the Acan gene. We consistently noticed variable weight and size among the Agc Cre littermates, prompting us to examine the cause of this phenotype. Wild-type, Cre-heterozygous (Agc +/Cre ), and Cre-homozygous (Agc Cre/Cre ) littermates were indistinguishable at birth. However, by 1-month, Agc Cre/Cre mice showed a significant reduction in body weight (18-27%) and body length (19-22%). Low body weight and dwarfism was sustained through adulthood and occurred in both genders. Compared with wild-type and Agc +/Cre littermates, long bones and vertebrae were shorter in Agc Cre/Cre mice. Histological analysis of Agc Cre/Cre mice revealed a significant reduction in the length of the growth plate and the thickness of articular cartilage. The amount of proteoglycan deposited in the cartilage of Agc Cre/Cre mice was nearly half of the WT littermates. Analysis of gene expression indicates impaired differentiation of chondrocyte in hyaline cartilage of Agc Cre/Cre mice. Notably, both Acan mRNA and protein was reduced by 50% in Agc Cre/Cre mice. A strong correlation was noted between the level of Acan mRNA and the body length. Importantly, Agc +/Cre mice showed no overt skeletal phenotype. Thus to avoid misinterpretation of data, only the Agc +/Cre mice should be used for conditional deletion of a target gene in the cartilage tissue. © 2017 Wiley Periodicals, Inc.

  18. Cre-Mediated Stress Affects Sirtuin Expression Levels, Peroxisome Biogenesis and Metabolism, Antioxidant and Proinflammatory Signaling Pathways

    Xiao, Yu; Karnati, Srikanth; Qian, Guofeng; Nenicu, Anca; Fan, Wei; Tchatalbachev, Svetlin; Höland, Anita; Hossain, Hamid; Guillou, Florian; Lüers, Georg H.; Baumgart-Vogt, Eveline

    2012-01-01

    Cre-mediated excision of loxP sites is widely used in mice to manipulate gene function in a tissue-specific manner. To analyze phenotypic alterations related to Cre-expression, we have used AMH-Cre-transgenic mice as a model system. Different Cre expression levels were obtained by investigation of C57BL/6J wild type as well as heterozygous and homozygous AMH-Cre-mice. Our results indicate that Cre-expression itself in Sertoli cells already has led to oxidative stress and lipid peroxidation (4-HNE lysine adducts), inducing PPARα/γ, peroxisome proliferation and alterations of peroxisome biogenesis (PEX5, PEX13 and PEX14) as well as metabolic proteins (ABCD1, ABCD3, MFP1, thiolase B, catalase). In addition to the strong catalase increase, a NRF2- and FOXO3-mediated antioxidative response (HMOX1 of the endoplasmic reticulum and mitochondrial SOD2) and a NF-κB activation were noted. TGFβ1 and proinflammatory cytokines like IL1, IL6 and TNFα were upregulated and stress-related signaling pathways were induced. Sertoli cell mRNA-microarray analysis revealed an increase of TNFR2-signaling components. 53BP1 recruitment and expression levels for DNA repair genes as well as for p53 were elevated and the ones for related sirtuin deacetylases affected (SIRT 1, 3-7) in Sertoli cells. Under chronic Cre-mediated DNA damage conditions a strong downregulation of Sirt1 was observed, suggesting that the decrease of this important coordinator between DNA repair and metabolic signaling might induce the repression release of major transcription factors regulating metabolic and cytokine-mediated stress pathways. Indeed, caspase-3 was activated and increased germ cell apoptosis was observed, suggesting paracrine effects. In conclusion, the observed wide stress-induced effects and metabolic alterations suggest that it is essential to use the correct control animals (Cre/Wt) with matched Cre expression levels to differentiate between Cre-mediated and specific gene-knock out

  19. Cre-mediated stress affects sirtuin expression levels, peroxisome biogenesis and metabolism, antioxidant and proinflammatory signaling pathways.

    Yu Xiao

    Full Text Available Cre-mediated excision of loxP sites is widely used in mice to manipulate gene function in a tissue-specific manner. To analyze phenotypic alterations related to Cre-expression, we have used AMH-Cre-transgenic mice as a model system. Different Cre expression levels were obtained by investigation of C57BL/6J wild type as well as heterozygous and homozygous AMH-Cre-mice. Our results indicate that Cre-expression itself in Sertoli cells already has led to oxidative stress and lipid peroxidation (4-HNE lysine adducts, inducing PPARα/γ, peroxisome proliferation and alterations of peroxisome biogenesis (PEX5, PEX13 and PEX14 as well as metabolic proteins (ABCD1, ABCD3, MFP1, thiolase B, catalase. In addition to the strong catalase increase, a NRF2- and FOXO3-mediated antioxidative response (HMOX1 of the endoplasmic reticulum and mitochondrial SOD2 and a NF-κB activation were noted. TGFβ1 and proinflammatory cytokines like IL1, IL6 and TNFα were upregulated and stress-related signaling pathways were induced. Sertoli cell mRNA-microarray analysis revealed an increase of TNFR2-signaling components. 53BP1 recruitment and expression levels for DNA repair genes as well as for p53 were elevated and the ones for related sirtuin deacetylases affected (SIRT 1, 3-7 in Sertoli cells. Under chronic Cre-mediated DNA damage conditions a strong downregulation of Sirt1 was observed, suggesting that the decrease of this important coordinator between DNA repair and metabolic signaling might induce the repression release of major transcription factors regulating metabolic and cytokine-mediated stress pathways. Indeed, caspase-3 was activated and increased germ cell apoptosis was observed, suggesting paracrine effects. In conclusion, the observed wide stress-induced effects and metabolic alterations suggest that it is essential to use the correct control animals (Cre/Wt with matched Cre expression levels to differentiate between Cre-mediated and specific gene-knock out

  20. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  1. Increased production of biomass-degrading enzymes by double deletion of creA and creB genes involved in carbon catabolite repression in Aspergillus oryzae.

    Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2018-02-01

    In a previous study, we reported that a double gene deletion mutant for CreA and CreB, which constitute the regulatory machinery involved in carbon catabolite repression, exhibited improved production of α-amylase compared with the wild-type strain and single creA or creB deletion mutants in Aspergillus oryzae. Because A. oryzae can also produce biomass-degrading enzymes, such as xylolytic and cellulolytic enzymes, we examined the production levels of those enzymes in deletion mutants in this study. Xylanase and β-glucosidase activities in the wild-type were hardly detected in submerged culture containing xylose as the carbon source, whereas those enzyme activities were significantly increased in the single creA deletion (ΔcreA) and double creA and creB deletion (ΔcreAΔcreB) mutants. In particular, the ΔcreAΔcreB mutant exhibited >100-fold higher xylanase and β-glucosidase activities than the wild-type. Moreover, in solid-state culture, the β-glucosidase activity of the double deletion mutant was >7-fold higher than in the wild-type. These results suggested that deletion of both creA and creB genes could also efficiently improve the production levels of biomass-degrading enzymes in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Commission for Energy regulation (CRE) - Activity report June 2005; Commission de regulation de l'energie (CRE) - Rapport d'activite juin 2005

    NONE

    2005-07-01

    texts specify the competitive framework); Opening of the gas markets (Opening of the markets in European Union countries, Opening of the French gas market); CRE: regulator of the French gas market (Major obstacles to efficient operation of the French gas market were raised during 2004 and early 2005, Changes in natural gas regulated sales tariffs, Regulated infrastructure tariffs and utilisation conditions, Gaz de France and Total commitments made to the European Commission, Opening of the non-household market on 1 July 2004 and work of the 2004 Gas Working Group (GTG 2004), Audits of the un-bundled accounts of integrated gas operators, CRE's opinions on the regulatory texts, Codes of good conduct for network operators); The work programme (Independence of network operators, Feedback, Preparation of total opening on 1 July 2007, Preparation of the new tariffs for use of regulated gas infrastructures, Comparison of offers of access to storage facilities in Europe, Distribution system operators' investment criteria, Works in the European context); C - Regulation of the electricity market: actors and electricity markets; access to public power networks; the public electric utility in the regulated market; D - The working of CRE: How CRE exercises its jurisdiction (A working method based on responsiveness, consultation and transparency, Disputes solved help to guarantee the right of access to networks for consumers, suppliers and producers, Control and sanction powers); Tools (Professionalism and a multi-disciplinary approach, Some resources remain insufficient to meet the deadline for total opening of the energy markets on 1 July 2007, Independence and budgetary structure); European and international activity (Relations with European Union institutions, Relations with other regulators, Other international relations); E - Glossary, Acronyms, Units and conversions, Index of insets, tables and figures, Council of European Energy Regulators (CEER)

  3. Commission for Energy regulation (CRE) - Activity report June 2005; Commission de regulation de l'energie (CRE) - Rapport d'activite juin 2005

    NONE

    2005-07-01

    European texts specify the competitive framework); Opening of the gas markets (Opening of the markets in European Union countries, Opening of the French gas market); CRE: regulator of the French gas market (Major obstacles to efficient operation of the French gas market were raised during 2004 and early 2005, Changes in natural gas regulated sales tariffs, Regulated infrastructure tariffs and utilisation conditions, Gaz de France and Total commitments made to the European Commission, Opening of the non-household market on 1 July 2004 and work of the 2004 Gas Working Group (GTG 2004), Audits of the un-bundled accounts of integrated gas operators, CRE's opinions on the regulatory texts, Codes of good conduct for network operators); The work programme (Independence of network operators, Feedback, Preparation of total opening on 1 July 2007, Preparation of the new tariffs for use of regulated gas infrastructures, Comparison of offers of access to storage facilities in Europe, Distribution system operators' investment criteria, Works in the European context); C - Regulation of the electricity market: actors and electricity markets; access to public power networks; the public electric utility in the regulated market; D - The working of CRE: How CRE exercises its jurisdiction (A working method based on responsiveness, consultation and transparency, Disputes solved help to guarantee the right of access to networks for consumers, suppliers and producers, Control and sanction powers); Tools (Professionalism and a multi-disciplinary approach, Some resources remain insufficient to meet the deadline for total opening of the energy markets on 1 July 2007, Independence and budgetary structure); European and international activity (Relations with European Union institutions, Relations with other regulators, Other international relations); E - Glossary, Acronyms, Units and conversions, Index of insets, tables and figures, Council of European Energy Regulators (CEER)

  4. Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

    Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

    2008-01-01

    Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

  5. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  6. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  7. Expression and Functions of CreD, an Inner Membrane Protein in Stenotrophomonas maltophilia

    Huang, Hsin-Hui; Lin, Yi-Tsung; Chen, Wei-Ching; Huang, Yi-Wei; Chen, Shiang-Jiuun; Yang, Tsuey-Ching

    2015-01-01

    CreBC is a highly conserved two-component regulatory system (TCS) in several gram-negative bacteria, including Escherichia coli, Aeromonas spp., Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. CreD is a conserved gene that encodes a predicted inner-membrane protein and is located near the creBC loci. Activation of CreBC increases creD expression; therefore, creD expression is generally used as a measure of CreBC activation in E. coli, Aeromonas spp., and P. aeruginosa systems. In th...

  8. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  9. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  10. Age- and Gene-Dosage–Dependent Cre-Induced Abnormalities in the Retinal Pigment Epithelium

    He, Lizhi; Marioutina, Mariya; Dunaief, Joshua L.; Marneros, Alexander G.

    2015-01-01

    To conditionally inactivate genes in the retinal pigment epithelium (RPE) transgenic mouse strains have been developed, in which Cre recombinase (Cre) expression is driven by an RPE-specific gene promoter. The RPE is a quiescent epithelium, and continuous expression of Cre could affect its function. Here, we tested the hypothesis that continuous postnatal Cre expression in the RPE may lead to cellular abnormalities, which may depend on both age and Cre gene dosage. We therefore examined the eyes of homozygous and heterozygous VMD2-Cre mice at various ages. In VMD2-Cre heterozygous mice variable progressive age-dependent RPE abnormalities were noticed, including attenuation of phalloidin and cytoplasmic active β-catenin staining, reduced cell size, and loss of the typical honeycomb pattern of RPE morphology in those RPE cells that stained for Cre. These morphological RPE abnormalities were not noticed in Cre-negative RPE cells in VMD2-Cre or age-matched control mice. In addition, an abnormal number and morphology of cell nuclei were noticed in a subset of Cre-expressing RPE cells in aged heterozygous VMD2-Cre mice, whereas more severe nuclear abnormalities were observed already in young homozygous VMD2-Cre mice. Thus, continuous postnatal expression of Cre causes abnormalities in the RPE in an age- and Cre gene dosage-dependent manner, which needs to be considered in the interpretation of gene targeting studies in the RPE. PMID:24854863

  11. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in neurons

    Saunders, Arpiar; Johnson, Caroline A.; Sabatini, Bernardo L.

    2012-01-01

    Understanding the organization of the nervous system requires methods for dissecting the contributions of each component cell type to circuit function. One widely used approach combines genetic targeting of Cre recombinase to specific cell populations with infection of recombinant adeno-associated viruses (rAAVs) whose transgene expression is activated by Cre (“Cre-On”). Distinguishing how the Cre-expressing neurons differ functionally from neighboring Cre-negative neurons requires rAAVs that are inactivated by Cre (“Cre-Off”) and can be used in tandem with Cre-On viruses. Here we introduce two rAAV vectors that are inactivated by Cre and carry different fluorophore and optogenetic constructs. We demonstrate single and dual rAAV systems to achieve Cre-On and Cre-Off expression in spatially-intermingled cell populations of the striatum. Using these systems, we uncovered cryptic genomic interactions that occur between multiple Cre-sensitive rAAVs or between Cre-sensitive rAAVs and somatic Cre-conditional alleles and devised methods to avoid these interactions. Our data highlight both important experimental caveats associated with Cre-dependent rAAV use as well as opportunities for the development of improved rAAVs for gene delivery. PMID:22866029

  12. Tissue Specific Expression of Cre in Rat Tyrosine Hydroxylase and Dopamine Active Transporter-Positive Neurons.

    Liu, Zhenyi; Brown, Andrew; Fisher, Dan; Wu, Yumei; Warren, Joe; Cui, Xiaoxia

    2016-01-01

    The rat is a preferred model system over the mouse for neurological studies, and cell type-specific Cre expression in the rat enables precise ablation of gene function in neurons of interest, which is especially valuable for neurodegenerative disease modeling and optogenetics. Yet, few such Cre rats are available. Here we report the characterization of two Cre rats, tyrosine hydroxylase (TH)-Cre and dopamine active transporter (DAT or Slc6a3)-Cre, by using a combination of immunohistochemistry (IHC) and mRNA fluorescence in situ hybridization (FISH) as well as a fluorescent reporter for Cre activity. We detected Cre expression in expected neurons in both Cre lines. Interestingly, we also found that in Th-Cre rats, but not DAT-Cre rats, Cre is expressed in female germ cells, allowing germline excision of the floxed allele and hence the generation of whole-body knockout rats. In summary, our data demonstrate that targeted integration of Cre cassette lead to faithful recapitulation of expression pattern of the endogenous promoter, and mRNA FISH, in addition to IHC, is an effective method for the analysis of the spatiotemporal gene expression patterns in the rat brain, alleviating the dependence on high quality antibodies that are often not available against rat proteins. The Th-Cre and the DAT-Cre rat lines express Cre in selective subsets of dopaminergic neurons and should be particularly useful for researches on Parkinson's disease.

  13. Commission for Energy regulation (CRE) - Activity report june 2008

    2008-01-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2008 activity report of CRE. Content: A - How CRE works: CRE regulatory authority and organisation: Powers, Organisation; Budget resources; Personnel; B - The Standing Committee for Dispute Settlement and Sanctions (CoRDiS) activity: Admissibility, Authority; C - Building a single European energy market: Overview; Organisation and coordination of the main European regulators (Work carried out collectively by European regulators, Regulator organisation and development, CRE's relations with European Community institutions, Development of CEER activities outside the European Union); CRE's European activities (The contribution of European regulators to the Third Energy Package, Integration of gas markets, Integration of electricity markets, Operation of the European interconnected electricity grid and security of supply, Opening up markets to benefit consumers); European Community activities (The European Commission's proposals for the internal energy market: the Third Energy Package, The European Commission's proposals for fighting climate change: the Climate Package, Infringement

  14. Commission for Energy regulation (CRE) - Activity report june 2006

    2006-01-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2006 activity report of CRE. Content: A - Opening of the electricity and natural gas markets to household consumers on 1 July 2007: CRE at the service of eligible customers (Information for eligible customers, Improved knowledge of non-household customers); Monitoring of the non-discrimination, transparency and independence of system operators (Drafting and distribution of codes of good conduct for system operators, The necessary improvement of system operator independence); Preparing the practical methods of opening: GTE 2007 and GTG 2007 (The necessary simplification of relations between operators and customers, Achieving a greater level of consumer information and protection, The clearly defined stages of the 'customer pathway', Profiling and settlement mechanisms: turning experience feedback from 2004 to good account); Persisting uncertainties and hurdles (The need for a suitable regulatory and legislative platform, Hurdles to the opening of the household market); B - Regulation of the natural gas market: The gas market in the European context (Increasing weight of imports in gas

  15. Commission for Energy regulation (CRE) - Activity report june 2006

    NONE

    2006-07-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2006 activity report of CRE. Content: A - Opening of the electricity and natural gas markets to household consumers on 1 July 2007: CRE at the service of eligible customers (Information for eligible customers, Improved knowledge of non-household customers); Monitoring of the non-discrimination, transparency and independence of system operators (Drafting and distribution of codes of good conduct for system operators, The necessary improvement of system operator independence); Preparing the practical methods of opening: GTE 2007 and GTG 2007 (The necessary simplification of relations between operators and customers, Achieving a greater level of consumer information and protection, The clearly defined stages of the 'customer pathway', Profiling and settlement mechanisms: turning experience feedback from 2004 to good account); Persisting uncertainties and hurdles (The need for a suitable regulatory and legislative platform, Hurdles to the opening of the household market); B - Regulation of the natural gas market: The gas market in the European context (Increasing weight of

  16. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  17. Commission for Energy regulation (CRE) - Activity report June 2004

    2004-01-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2004 activity report of CRE. Content: A - Opening of the gas and electricity markets for professional customers on 1 July 2004; B - Regulation of the gas market: Gas markets and players (The European environment, The French gas market); Regulation of the gas market (Implementing regulation, Works planned for the coming year; C - Regulation of the electricity market: The electricity markets and players (The European electricity markets, The French electricity market, Monitoring the electricity market); Regulation of the French electricity market (Access to public grid, Cross-border exchanges, Un-bundled accounting principles); The public electricity service in the regulated market (Content of the public service, Public service charges, Electricity production public service financing, Electricity sales tariffs) D - The working of CRE: How CRE exercises its jurisdiction, Tools; E - Appendices: Glossary, Units and conversions, Council of European Energy Regulators, Index of tables and figures

  18. Commission for Energy regulation (CRE) - Activity report June 2004

    NONE

    2004-07-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2004 activity report of CRE. Content: A - Opening of the gas and electricity markets for professional customers on 1 July 2004; B - Regulation of the gas market: Gas markets and players (The European environment, The French gas market); Regulation of the gas market (Implementing regulation, Works planned for the coming year; C - Regulation of the electricity market: The electricity markets and players (The European electricity markets, The French electricity market, Monitoring the electricity market); Regulation of the French electricity market (Access to public grid, Cross-border exchanges, Un-bundled accounting principles); The public electricity service in the regulated market (Content of the public service, Public service charges, Electricity production public service financing, Electricity sales tariffs) D - The working of CRE: How CRE exercises its jurisdiction, Tools; E - Appendices: Glossary, Units and conversions, Council of European Energy Regulators, Index of tables and figures.

  19. Infection control implications of heterogeneous resistance mechanisms in carbapenem-resistant Enterobacteriaceae (CRE).

    Goodman, K E; Simner, P J; Tamma, P D; Milstone, A M

    2016-01-01

    The Centers for Disease Control and Prevention (CDC) defines carbapenem-resistant Enterobacteriaceae (CRE) based upon a phenotypic demonstration of carbapenem resistance. However, considerable heterogeneity exists within this definitional umbrella. CRE may mechanistically differ by whether they do or do not produce carbapenemases. Moreover, patients can acquire CRE through multiple pathways: endogenously through antibiotic selective pressure on intestinal microbiota, exogenously through horizontal transmission or through a combination of these factors. Some evidence suggests that non-carbapenemase-producing CRE may be more frequently acquired by antibiotic exposure and carbapenemase-producing CRE via horizontal transmission, but definitive data are lacking. This review examines types of CRE resistance mechanisms, antibiotic exposure and horizontal transmission pathways of CRE acquisition, and the implications of these heterogeneities to the development of evidence-based CRE healthcare epidemiology policies. In our Expert Commentary & Five-Year View, we outline specific nosocomial CRE knowledge gaps and potential methodological approaches for their resolution.

  20. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  1. Cre Activated and Inactivated Recombinant Adeno-Associated Viral Vectors for Neuronal Anatomical Tracing or Activity Manipulation.

    Saunders, Arpiar; Sabatini, Bernardo L

    2015-07-01

    Recombinant adeno-associated viruses (rAAVs) transcriptionally activated by Cre recombinase (Cre-On) are powerful tools for determining the anatomy and function of genetically defined neuronal types in transgenic Cre driver mice. Here we describe how rAAVs transcriptionally inactivated by Cre (Cre-Off) can be used in conjunction with Cre-On rAAVs or genomic Cre-reporter alleles to study brain circuits. Intracranial injection of Cre-On/Cre-Off rAAVs into spatially intermingled Cre(+) and Cre(-) neurons allows these populations to be differentially labeled or manipulated within individual animals. This comparison helps define the unique properties of Cre(+) neurons, highlighting the specialized role they play in their constituent brain circuits. This protocol touches on the conceptual and experimental background of Cre-Off rAAV systems, including caveats and methods of validation. Copyright © 2015 John Wiley & Sons, Inc.

  2. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  3. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  4. CRISPR/Cas9-mediated targeting of the Rosa26 locus produces Cre reporter rat strains for monitoring Cre-loxP-mediated lineage tracing.

    Ma, Yuanwu; Yu, Lei; Pan, Shuo; Gao, Shan; Chen, Wei; Zhang, Xu; Dong, Wei; Li, Jing; Zhou, Rui; Huang, Lan; Han, Yunlin; Bai, Lin; Zhang, Li; Zhang, Lianfeng

    2017-10-01

    The rat is an important laboratory animal for physiological, toxicological and pharmacological studies. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) is a simple and efficient tool to generate precise genetic modifications in rats, which will promote the accumulation of genetic resources and enable more precise studies of gene function. To monitor Cre-loxP-mediated excision in vivo, we generated a Cre reporter rat strain (Rosa26-imCherry) by knockin of a Cre reporter cassette at the Rosa26 locus using CRISPR/Cas9. Rosa26-imCherry rats exhibited inducible expression of the mCherry cassette (imCherry) using the Cre-loxP system, whereas normal rats exhibited ubiquitous expression of eGFP but not mCherry in the whole body. Injection of adeno-associated virus serotype 9-Cre into the hippocampus and skeletal muscle resulted in mCherry expression in virus-infected cells. Cre-loxP-mediated mCherry expression was then evaluated by crossing Rosa26-imCherry rats with transgenic rats ubiquitously expressing CAG-Cre, heart-specific α-MHC-Cre transgenic rats and liver-specific Alb-Cre knockin rats. Finally, using the established system the expression pattern of Cre driven by two endogenous gene promoters (Wfs1-Cre knockin rat, FabP2-Cre knockin rat) was traced. In summary, we demonstrated excision of the loxP-flanked allele in Rosa26-imCherry rats via activation of mCherry expression in the presence of Cre recombinase. This newly established Rosa26-imCherry rat strain represents a useful tool to facilitate Cre-expression pattern determination and tracing experiments. © 2017 Federation of European Biochemical Societies.

  5. Quantitative measures of CRE and its link with organizational performance

    Appel - Meulenbroek, H.A.J.A.

    2007-01-01

    For CREM (Corporate Real Estate Management) to be able to deliver added value to its client organisation, it has to know 1) which CRE aspects influence its employees, processes, machinery, visitors, etc, 2) how these aspects influence performance and 3) how to measure and manage them. Analysis of

  6. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  7. A photoactivatable Cre-loxP recombination system for optogenetic genome engineering.

    Kawano, Fuun; Okazaki, Risako; Yazawa, Masayuki; Sato, Moritoshi

    2016-12-01

    Genome engineering techniques represented by the Cre-loxP recombination system have been used extensively for biomedical research. However, powerful and useful techniques for genome engineering that have high spatiotemporal precision remain elusive. Here we develop a highly efficient photoactivatable Cre recombinase (PA-Cre) to optogenetically control genome engineering in vivo. PA-Cre is based on the reassembly of split Cre fragments by light-inducible dimerization of the Magnet system. PA-Cre enables sharp induction (up to 320-fold) of DNA recombination and is efficiently activated even by low-intensity illumination (∼0.04 W m -2 ) or short periods of pulsed illumination (∼30 s). We demonstrate that PA-Cre allows for efficient DNA recombination in an internal organ of living mice through noninvasive external illumination using a LED light source. The present PA-Cre provides a powerful tool to greatly facilitate optogenetic genome engineering in vivo.

  8. CDC Vital Signs: Making Health Care Safer -- Stop Infections from Lethal CRE Germs Now

    ... to patients with CRE; and improving use of gloves and gowns. Result: The percentage of patients who got CRE at the facility dropped from 44% to 0. Top of Page What Can Be Done Federal Government ...

  9. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori

    2005-01-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism

  10. Four regulatory elements in the human c-fos promoter mediate transactivation by HTLV-1 Tax protein.

    Alexandre, C; Verrier, B

    1991-04-01

    Expression of the human c-fos proto-oncogene is activated in trans by the Tax protein encoded by human T-cell leukemia virus type-1 (HTLV-1). Indeed, we show here that a HeLa clone stably transfected by Tax expresses Fos at a high level. We also show that multiple elements of the human c-fos promoter, i.e. the v-sis conditioned medium inducible element (SIE), the dyad symmetry element (DSE) necessary for growth factor induction, the octanucleotide direct repeat element (DR), and the cyclic AMP response element (CRE) centred at -60, can all mediate Tax transactivation. In the DSE, the 10bp central core that binds the serum response factor (SRF) is, by itself, sufficient to mediate Tax transactivation. Moreover, a CRE-binding protein is involved in Tax activation through the CRE-60 element. Since Fos is a transregulator of cellular genes, our results suggest that the oncoprotein plays a crucial role in T-cell transformation by HTLV-1 in conjunction with other Tax-inducible genes.

  11. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  12. A new location to split Cre recombinase for protein fragment complementation.

    Rajaee, Maryam; Ow, David W

    2017-11-01

    We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Preserved dopaminergic homeostasis and dopamine-related behaviour in hemizygous TH-Cre mice

    Thomsen, Annika Højrup Runegaard; Jensen, Kathrine L; Fitzpatrick, Ciarán M

    2017-01-01

    assessment of the dopaminergic system in hemizygous tyrosine hydroxylase (TH)-Cre mice in comparison to wild-type (WT) controls. Our data show that TH-Cre mice display preserved dopaminergic homeostasis with unaltered levels of TH and dopamine as well as unaffected dopamine turnover in striatum. TH-Cre mice...

  14. The effect of conditional inactivation of beta 1 integrins using twist 2 Cre, Osterix Cre and osteocalcin Cre lines on skeletal phenotype.

    Shekaran, Asha; Shoemaker, James T; Kavanaugh, Taylor E; Lin, Angela S; LaPlaca, Michelle C; Fan, Yuhong; Guldberg, Robert E; García, Andrés J

    2014-11-01

    Skeletal development and growth are complex processes regulated by multiple microenvironmental cues, including integrin-ECM interactions. The β1 sub-family of integrins is the largest integrin sub-family and constitutes the main integrin binding partners of collagen I, the major ECM component of bone. As complete β1 integrin knockout results in embryonic lethality, studies of β1 integrin function in vivo rely on tissue-specific gene deletions. While multiple in vitro studies indicate that β1 integrins are crucial regulators of osteogenesis and mineralization, in vivo osteoblast-specific perturbations of β1 integrins have resulted in mild and sometimes contradictory skeletal phenotypes. To further investigate the role of β1 integrins on skeletal phenotype, we used the Twist2-Cre, Osterix-Cre and osteocalcin-Cre lines to generate conditional β1 integrin deletions, where Cre is expressed primarily in mesenchymal condensation, pre-osteoblast, and mature osteoblast lineage cells respectively within these lines. Mice with Twist2-specific β1 integrin disruption were smaller, had impaired skeletal development, especially in the craniofacial and vertebral tissues at E19.5, and did not survive beyond birth. Osterix-specific β1 integrin deficiency resulted in viable mice which were normal at birth but displayed early defects in calvarial ossification, incisor eruption and growth as well as femoral bone mineral density, structure, and mechanical properties. Although these defects persisted into adulthood, they became milder with age. Finally, a lack of β1 integrins in mature osteoblasts and osteocytes resulted in minor alterations to femur structure but had no effect on mineral density, biomechanics or fracture healing. Taken together, our data indicate that β1 integrin expression in early mesenchymal condensations play an important role in skeletal ossification, while β1 integrin-ECM interactions in pre-osteoblast, odontoblast- and hypertrophic chondryocyte

  15. Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

    Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

    2017-09-20

    Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

  16. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  17. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  19. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  20. Nrl-Cre transgenic mouse mediates loxP recombination in developing rod photoreceptors.

    Brightman, Diana S; Razafsky, David; Potter, Chloe; Hodzic, Didier; Chen, Shiming

    2016-03-01

    The developing mouse retina is a tractable model for studying neurogenesis and differentiation. Although transgenic Cre mouse lines exist to mediate conditional genetic manipulations in developing mouse retinas, none of them act specifically in early developing rods. For conditional genetic manipulations of developing retinas, a Nrl-Cre mouse line in which the Nrl promoter drives expression of Cre in rod precursors was created. The results showed that Nrl-Cre expression was specific to the retina where it drives rod-specific recombination with a temporal pattern similar to endogenous Nrl expression during retinal development. This Nrl-Cre transgene does not negatively impact retinal structure and function. Taken together, the data suggested that the Nrl-Cre mouse line was a valuable tool to drive Cre-mediated recombination specifically in developing rods. © 2016 Wiley Periodicals, Inc.

  1. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  2. Regulation of glycogen metabolism by the CRE-1, RCO-1 and RCM-1 proteins in Neurospora crassa. The role of CRE-1 as the central transcriptional regulator.

    Cupertino, Fernanda Barbosa; Virgilio, Stela; Freitas, Fernanda Zanolli; Candido, Thiago de Souza; Bertolini, Maria Célia

    2015-04-01

    The transcription factor CreA/Mig1/CRE-1 is a repressor protein that regulates the use of alternative carbon sources via a mechanism known as Carbon Catabolite Repression (CCR). In Saccharomyces cerevisiae, Mig1 recruits the complex Ssn6-Tup1, the Neurospora crassa RCM-1 and RCO-1 orthologous proteins, respectively, to bind to promoters of glucose-repressible genes. We have been studying the regulation of glycogen metabolism in N. crassa and the identification of the RCO-1 corepressor as a regulator led us to investigate the regulatory role of CRE-1 in this process. Glycogen content is misregulated in the rco-1(KO), rcm-1(RIP) and cre-1(KO) strains, and the glycogen synthase phosphorylation is decreased in all strains, showing that CRE-1, RCO-1 and RCM-1 proteins are involved in glycogen accumulation and in the regulation of GSN activity by phosphorylation. We also confirmed the regulatory role of CRE-1 in CCR and its nuclear localization under repressing condition in N. crassa. The expression of all glycogenic genes is misregulated in the cre-1(KO) strain, suggesting that CRE-1 also controls glycogen metabolism by regulating gene expression. The existence of a high number of the Aspergillus nidulans CreA motif (5'-SYGGRG-3') in the glycogenic gene promoters led us to analyze the binding of CRE-1 to some DNA motifs both in vitro by DNA gel shift and in vivo by ChIP-qPCR analysis. CRE-1 bound in vivo to all motifs analyzed demonstrating that it down-regulates glycogen metabolism by controlling gene expression and GSN phosphorylation. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Generation and analysis of an improved Foxg1-IRES-Cre driver mouse line.

    Kawaguchi, Daichi; Sahara, Setsuko; Zembrzycki, Andreas; O'Leary, Dennis D M

    2016-04-01

    Foxg1 expression is highly restricted to the telencephalon and other head structures in the early embryo. This expression pattern has been exploited to generate conditional knockout mice, based on a widely used Foxg1-Cre knock-in line (Foxg1(tm1(cre)Skm)), in which the Foxg1 coding region was replaced by the Cre gene. The utility of this line, however, is severely hampered for two reasons: (1) Foxg1-Cre mice display ectopic and unpredictable Cre activity, and (2) Foxg1 haploinsufficiency can produce neurodevelopmental phenotypes. To overcome these issues, we have generated a new Foxg1-IRES-Cre knock-in mouse line, in which an IRES-Cre cassette was inserted in the 3'UTR of Foxg1 locus, thus preserving the endogenous Foxg1 coding region and un-translated gene regulatory sequences in the 3'UTR, including recently discovered microRNA target sites. We further demonstrate that the new Foxg1-IRES-Cre line displays consistent Cre activity patterns that recapitulated the endogenous Foxg1 expression at embryonic and postnatal stages without causing defects in cortical development. We conclude that the new Foxg1-IRES-Cre mouse line is a unique and advanced tool for studying genes involved in the development of the telencephalon and other Foxg1-expressing regions starting from early embryonic stages. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Generation of CRISPR/Cas9-mediated bicistronic knock-in ins1-cre driver mice.

    Hasegawa, Yoshikazu; Hoshino, Yoshikazu; Ibrahim, Abdelaziz E; Kato, Kanako; Daitoku, Yoko; Tanimoto, Yoko; Ikeda, Yoshihisa; Oishi, Hisashi; Takahashi, Satoru; Yoshiki, Atsushi; Yagami, Ken-Ichi; Iseki, Hiroyoshi; Mizuno, Seiya; Sugiyama, Fumihiro

    2016-07-29

    In the present study, we generated novel cre driver mice for gene manipulation in pancreatic β cells. Using the CRISPR/Cas9 system, stop codon sequences of Ins1 were targeted for insertion of cre, including 2A sequences. A founder of C57BL/6J-Ins1(em1 (cre) Utr) strain was produced from an oocyte injected with pX330 containing the sequences encoding gRNA and Cas9 and a DNA donor plasmid carrying 2A-cre. (R26GRR x C57BL/6J-Ins1(em1 (cre) Utr)) F1 mice were histologically characterized for cre-loxP recombination in the embryonic and adult stages; cre-loxP recombination was observed in all pancreatic islets examined in which almost all insulin-positive cells showed tdsRed fluorescence, suggesting β cell-specific recombination. Furthermore, there were no significant differences in results of glucose tolerance test among genotypes (homo/hetero/wild). Taken together, these observations indicated that C57BL/6J-Ins1(em1 (cre) Utr) is useful for studies of glucose metabolism and the strategy of bicistronic cre knock-in using the CRISPR/Cas9 system could be useful for production of cre driver mice.

  5. Risk Factors for Carbapenemase-Producing Carbapenem-Resistant Enterobacteriaceae (CP-CRE) Acquisition Among Contacts of Newly Diagnosed CP-CRE Patients.

    Schwartz-Neiderman, Anat; Braun, Tali; Fallach, Noga; Schwartz, David; Carmeli, Yehuda; Schechner, Vered

    2016-10-01

    OBJECTIVE Carbapenemase-producing carbapenem-resistant Enterobacteriaceae (CP-CRE) are extremely drug-resistant pathogens. Screening of contacts of newly identified CP-CRE patients is an important step to limit further transmission. We aimed to determine the risk factors for CP-CRE acquisition among patients exposed to a CP-CRE index patient. METHODS A matched case-control study was performed in a tertiary care hospital in Israel. The study population was comprised of patients who underwent rectal screening for CP-CRE following close contact with a newly identified CP-CRE index patient. Cases were defined as positive tests for CP-CRE. For each case patient, 2 matched controls were randomly selected from the pool of contacts who tested negative for CP-CRE following exposure to the same index case. Bivariate and multivariate analyses were conducted using conditional logistic regression. RESULTS In total, 53 positive contacts were identified in 40 unique investigations (896 tests performed on 735 contacts) between October 6, 2008, and June 7, 2012. bla KPC was the only carbapenemase identified. In multivariate analysis, risk factors for CP-CRE acquisition among contacts were (1) contact with an index patient for ≥3 days (odds ratio [OR], 9.8; 95% confidence interval [CI], 2.0-48.9), (2) mechanical ventilation (OR, 4.1; 95% CI, 1.4-11.9), and (3) carriage or infection with another multidrug-resistant organism (MDRO; OR, 2.6; 95% CI, 1.0-7.1). Among patients who received antibiotics, cephalosporins were associated with a lower risk of acquisition. CONCLUSIONS Patient characteristics (ventilation and carriage of another MDRO) as well as duration of contact are risk factors for CP-CRE acquisition among contacts. The role of cephalosporins requires further study. Infect Control Hosp Epidemiol 2016;1-7.

  6. Multicenter Clinical and Molecular Epidemiological Analysis of Bacteremia Due to Carbapenem-Resistant Enterobacteriaceae (CRE) in the CRE Epicenter of the United States

    Chen, Liang; Patel, Gopi; Gomez-Simmonds, Angela; Weston, Gregory; Kim, Angela C.; Seo, Susan K.; Rosenthal, Marnie E.; Sperber, Steven J.; Jenkins, Stephen G.; Hamula, Camille L.; Uhlemann, Anne-Catrin; Levi, Michael H.; Fries, Bettina C.; Juretschko, Stefan; Rojtman, Albert D.; Hong, Tao; Mathema, Barun; Jacobs, Michael R.; Walsh, Thomas J.; Bonomo, Robert A.; Kreiswirth, Barry N.

    2017-01-01

    ABSTRACT Although the New York/New Jersey (NY/NJ) area is an epicenter for carbapenem-resistant Enterobacteriaceae (CRE), there are few multicenter studies of CRE from this region. We characterized patients with CRE bacteremia in 2013 at eight NY/NJ medical centers and determined the prevalence of carbapenem resistance among Enterobacteriaceae bloodstream isolates and CRE resistance mechanisms, genetic backgrounds, capsular types (cps), and antimicrobial susceptibilities. Of 121 patients with CRE bacteremia, 50% had cancer or had undergone transplantation. The prevalences of carbapenem resistance among Klebsiella pneumoniae, Enterobacter spp., and Escherichia coli bacteremias were 9.7%, 2.2%, and 0.1%, respectively. Ninety percent of CRE were K. pneumoniae and 92% produced K. pneumoniae carbapenemase (KPC-3, 48%; KPC-2, 44%). Two CRE produced NDM-1 and OXA-48 carbapenemases. Sequence type 258 (ST258) predominated among KPC-producing K. pneumoniae (KPC-Kp). The wzi154 allele, corresponding to cps-2, was present in 93% of KPC-3-Kp, whereas KPC-2-Kp had greater cps diversity. Ninety-nine percent of CRE were ceftazidime-avibactam (CAZ-AVI)-susceptible, although 42% of KPC-3-Kp had an CAZ-AVI MIC of ≥4/4 μg/ml. There was a median of 47 h from bacteremia onset until active antimicrobial therapy, 38% of patients had septic shock, and 49% died within 30 days. KPC-3-Kp bacteremia (adjusted odds ratio [aOR], 2.58; P = 0.045), cancer (aOR, 3.61, P = 0.01), and bacteremia onset in the intensive care unit (aOR, 3.79; P = 0.03) were independently associated with mortality. Active empirical therapy and combination therapy were not associated with survival. Despite a decade of experience with CRE, patients with CRE bacteremia have protracted delays in appropriate therapies and high mortality rates, highlighting the need for rapid diagnostics and evaluation of new therapeutics. PMID:28167547

  7. Generation of ERα-floxed and knockout mice using the Cre/LoxP system

    Antonson, P.; Omoto, Y.; Humire, P.; Gustafsson, J.-Å.

    2012-01-01

    Highlights: ► ERα floxed and knockout mice were generated. ► Disruption of the ERα gene results in sterility in both male and female mice. ► ERα −/− mice have ovaries with hemorrhagic follicles and hypoplastic uterus. ► Female ERα −/− mice develop obesity. -- Abstract: Estrogen receptor alpha (ERα) is a nuclear receptor that regulates a range of physiological processes in response to estrogens. In order to study its biological role, we generated a floxed ERα mouse line that can be used to knock out ERα in selected tissues by using the Cre/LoxP system. In this study, we established a new ERα knockout mouse line by crossing the floxed ERα mice with Cre deleter mice. Here we show that genetic disruption of the ERα gene in all tissues results in sterility in both male and female mice. Histological examination of uterus and ovaries revealed a dramatically atrophic uterus and hemorrhagic cysts in the ovary. These results suggest that infertility in female mice is the result of functional defects of the reproductive tract. Moreover, female knockout mice are hyperglycemic, develop obesity and at the age of 4 months the body weight of these mice was more than 20% higher compared to wild type littermates and this difference increased over time. Our results demonstrate that ERα is necessary for reproductive tract development and has important functions as a regulator of metabolism in females.

  8. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  9. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  10. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  11. Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice

    Gustafsson, E; Brakebusch, C; Hietanen, K

    2001-01-01

    Tissue-specific gene inactivation using the Cre-loxP system has become an important tool to unravel functions of genes when the conventional null mutation is lethal. We report here the generation of a transgenic mouse line expressing Cre recombinase in endothelial cells. In order to avoid...... the production and screening of multiple transgenic lines we used embryonic stem cell and embryoid body technology to identify recombinant embryonic stem cell clones with high, endothelial-specific Cre activity. One embryonic stem cell clone that showed high Cre activity in endothelial cells was used to generate...... germline chimeras. The in vivo efficiency and specificity of the transgenic Cre was analysed by intercrossing the tie-1-Cre line with the ROSA26R reporter mice. At initial stages of vascular formation (E8-9), LacZ staining was detected in almost all cells of the forming vasculature. Between E10 and birth...

  12. Variation of CRE with exponents of time and number of fractions

    Supe, S.J.; Rao, S.M.; Sawant, S.G.; Bisht, J.S.

    1976-01-01

    The concept of NSD has been modified into TDF's by Orton and Ellis and CRE's by Kirk et al. It was aimed to study the variability of these new concepts on the exponents of time and number of fractions. It was found that TDF has larger variation with the exponents compared to that of CRE. The use of CRE and NSD for solving the treatment scheduling problems or for intercomparison of various regimes has been simplified by providing readymade estimation of CRE for various doses/fraction with increasing number of fractions. As there is increasing evidence for the change of exponents J and H, nomograms are presented to determine the CRE for various values of J and H. The variation of decay correction factors with the exponent H is also evaluated and is presented. This will help various radiotherapists to use CRE and the decay correction factors consistent with their clinical findings. (orig.) [de

  13. A Nestin-cre transgenic mouse is insufficient for recombination in early embryonic neural progenitors

    Huixuan Liang

    2012-09-01

    Nestin-cre transgenic mice have been widely used to direct recombination to neural stem cells (NSCs and intermediate neural progenitor cells (NPCs. Here we report that a readily utilized, and the only commercially available, Nestin-cre line is insufficient for directing recombination in early embryonic NSCs and NPCs. Analysis of recombination efficiency in multiple cre-dependent reporters and a genetic mosaic line revealed consistent temporal and spatial patterns of recombination in NSCs and NPCs. For comparison we utilized a knock-in Emx1cre line and found robust recombination in NSCs and NPCs in ventricular and subventricular zones of the cerebral cortices as early as embryonic day 12.5. In addition we found that the rate of Nestin-cre driven recombination only reaches sufficiently high levels in NSCs and NPCs during late embryonic and early postnatal periods. These findings are important when commercially available cre lines are considered for directing recombination to embryonic NSCs and NPCs.

  14. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  15. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  16. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  17. Tamoxifen-independent recombination in the RIP-CreER mouse.

    Yanmei Liu

    Full Text Available BACKGROUND: The inducible Cre-lox system is a valuable tool to study gene function in a spatial and time restricted fashion in mouse models. This strategy relies on the limited background activity of the modified Cre recombinase (CreER in the absence of its inducer, the competitive estrogen receptor ligand, tamoxifen. The RIP-CreER mouse (Tg (Ins2-cre/Esr1 1Dam is among the few available β-cell specific CreER mouse lines and thus it has been often used to manipulate gene expression in the insulin-producing cells of the endocrine pancreas. PRINCIPAL FINDINGS: Here, we report the detection of tamoxifen-independent Cre activity as early as 2 months of age in RIP-CreER mice crossed with three distinct reporter strains. SIGNIFICANCE: Evidence of Cre-mediated recombination of floxed alleles even in the absence of tamoxifen administration should warrant cautious use of this mouse for the study of pancreatic β-cells.

  18. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  19. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  20. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  1. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  2. Pou4f2 knock-in Cre mouse: A multifaceted genetic tool for vision researchers.

    Simmons, Aaron B; Bloomsburg, Samuel J; Billingslea, Samuel A; Merrill, Morgan M; Li, Shuai; Thomas, Marshall W; Fuerst, Peter G

    2016-01-01

    A transgenic mouse that expresses Cre recombinase under control of the Pou4f2-promoter (also referred to as Brn-3b and Brn-3.2) was characterized. Pou4f2 expression has been reported in a subset of retinal ganglion cells (RGCs) in the retina, in the midbrain, and in the germline. In this study, we characterize the expression pattern of this Cre-recombinase line and report its utility in targeted deletion, temporal deletion, RGC depletion, and germline targeting, which can be regulated by the sex of the Cre-carrying mouse. Pou4f2(Cre) was mapped by using a combination of PCR and sequencing of PCR products to better understand the construct and to locate where it was inserted within the Pou4f2 locus. Cre expression patterns were examined by crossing Pou4f2(Cre/+) mice to Cre reporter mice. Immunohistochemistry was used to further define the pattern of Cre expression and Cre-mediated recombination within the retina, brain, and other tissues. An internal ribosome entry site (IRES)-Cre cassette was inserted into the Pou4f2 gene disrupting normal gene function, as verified by the depletion of RGCs in mice homozygous for the insert. Pou4f2(Cre) expression was observed in the retina, brain, peripheral neurons, and male germ cells. Germline recombination was observed when the sire carried the Cre and the target for recombination. In all other breeding schemes, recombination was observed within subsets of cells within the retina, brain, intestines, heart, and gonads. In the retina, Cre efficiently targets recombination in neurons within the RGC layer (RGL), the inner nuclear layer (INL), and a small percentage of photoreceptors, activity that has not been previously reported. Unlike most other Cre lines active in the inner retina, recombination in Müller and other glia was not observed in mice carrying Pou4f2(Cre) . Within the visual centers of the brain, Cre targets recombination in about 15% of cells within the superchiasmatic nucleus, lateral geniculate nucleus, and

  3. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  4. Prolonged Cre expression driven by the α-myosin heavy chain promoter can be cardiotoxic.

    Pugach, Emily K; Richmond, Phillip A; Azofeifa, Joseph G; Dowell, Robin D; Leinwand, Leslie A

    2015-09-01

    Studying the importance of genetic factors in a desired cell type or tissue necessitates the use of precise genetic tools. With the introduction of bacteriophage Cre recombinase/loxP mediated DNA editing and promoter-specific Cre expression, it is feasible to generate conditional knockout mice in which particular genes are disrupted in a cell type-specific manner in vivo. In cardiac myocytes, this is often achieved through α-myosin heavy chain promoter (αMyHC)-driven Cre expression in conjunction with a loxP-site flanked gene of interest. Recent studies in other cell types demonstrate toxicity of Cre expression through induction of DNA damage. However, it is unclear to what extent the traditionally used αMyHC-Cre line [1] may exhibit cardiotoxicity. Further, the genotype of αMyHC-Cre(+/-) is not often included as a control group in cardiac myocyte-specific knockout studies. Here we present evidence that these αMyHC-Cre(+/-) mice show molecular signs of cardiac toxicity by 3months of age and exhibit decreased cardiac function by 6months of age compared to wild-type littermates. Hearts from αMyHC-Cre(+/-) mice also display evidence of fibrosis, inflammation, and DNA damage. Interestingly, some of the early functional changes observed in αMyHC-Cre(+/-) mice are sexually dimorphic. Given the high level of Cre recombinase expression resulting from expression from the αMyHC promoter, we asked if degenerate loxP-like sites naturally exist in the mouse genome and if so, whether they are affected by Cre in the absence of canonical loxP-sites. Using a novel bioinformatics search tool, we identified 619 loxP-like sites with 4 or less mismatches to the canonical loxP-site. 227 sites overlapped with annotated genes and 55 of these genes were expressed in cardiac muscle. Expression of ~26% of the 27 genes tested was disrupted in αMyHC-Cre(+/-) mice indicating potential targeting by Cre. Taken together, these results highlight both the importance of using αMyHC-Cre mice

  5. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  6. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  7. Cre-expressing neurons in visual cortex of Ntsr1-Cre GN220 mice are corticothalamic and are depolarized by acetylcholine.

    Sundberg, Sofie Charlotte; Lindström, Sarah Helen; Sanchez, Gonzalo Manuel; Granseth, Björn

    2018-01-01

    The Ntsr1-Cre GN220 mouse expresses Cre-recombinase in corticothalamic (CT) neurons in neocortical layer 6. It is not known if the other major types of pyramidal neurons in this layer also express this enzyme. By electrophysiological recordings in slices and histological analysis of the uptake of retrogradely transported beads we show that Cre-positive neurons are CT and not corticocortical or corticoclaustral types. Furthermore, we show that Ntsr1-Cre-positive cells are immuno-positive for the nuclear transcription factor Forkhead box protein P2 (FoxP2). We conclude that Cre-expression is limited to a specific type of pyramidal neuron: CT. However, it appears as not all CT neurons are Cre-expressing; there are indications that the penetrance of the gene is about 90%. We demonstrate the utility of assigning a specific identity to individual neurons by determining that the CT neurons are potently modulated by acetylcholine acting on both nicotinic and muscarinic acetylcholine receptors. These results corroborate the suggested function of these neurons in regulating the gain of thalamocortical transfer of sensory information depending on attentional demand and state of arousal. © 2017 Wiley Periodicals, Inc.

  8. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  9. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  10. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  11. Screening strategy to generate cell specific recombination: a case report with the RIP-Cre mice.

    Spinelli, Valeria; Martin, Céline; Dorchies, Emilie; Vallez, Emmanuelle; Dehondt, Hélène; Trabelsi, Mohamed-Sami; Tailleux, Anne; Caron, Sandrine; Staels, Bart

    2015-10-01

    Conditional gene knockout technology is a powerful tool to study the function of a gene in a specific tissue, organ or cell lineage. The most commonly used procedure applies the Cre-LoxP strategy, where the choice of the Cre driver promoter is critical to determine the efficiency and specificity of the system. However, a considered choice of an appropriate promoter does not always protect against the risk of unwanted recombination and the consequent deletion of the gene in other tissues than the desired one(s), due to phenomena of non-specific activation of the Cre transgene. Furthermore, the causes of these phenomena are not completely understood and this can potentially affect every strain of Cre-mice. In our study on the deletion of a same gene in two different tissues, we show that the incidence rate of non-specific recombination in unwanted tissues depends on the Cre driver strain, ranging from 100%, rendering it useless (aP2-Cre strain), to ~5%, which is still compatible with their use (RIP-Cre strain). The use of a simple PCR strategy conceived to detect this occurrence is indispensable when producing a tissue-specific knockout mouse. Therefore, when choosing the Cre-driver promoter, researchers not only have to be careful about its tissue-specificity and timing of activation, but should also include a systematical screening in order to exclude mice in which atypical recombination has occurred and to limit the unnecessary use of laboratory animals in uninterpretable experiments.

  12. Redesign of the monomer–monomer interface of Cre recombinase yields an obligate heterotetrameric complex

    Zhang, Chi; Myers, Connie A.; Qi, Zongtai; Mitra, Robi D.; Corbo, Joseph C.; Havranek, James J.

    2015-01-01

    Cre recombinase catalyzes the cleavage and religation of DNA at loxP sites. The enzyme is a homotetramer in its functional state, and the symmetry of the protein complex enforces a pseudo-palindromic symmetry upon the loxP sequence. The Cre-lox system is a powerful tool for many researchers. However, broader application of the system is limited by the fixed sequence preferences of Cre, which are determined by both the direct DNA contacts and the homotetrameric arrangement of the Cre monomers. As a first step toward achieving recombination at arbitrary asymmetric target sites, we have broken the symmetry of the Cre tetramer assembly. Using a combination of computational and rational protein design, we have engineered an alternative interface between Cre monomers that is functional yet incompatible with the wild-type interface. Wild-type and engineered interface halves can be mixed to create two distinct Cre mutants, neither of which are functional in isolation, but which can form an active heterotetramer when combined. When these distinct mutants possess different DNA specificities, control over complex assembly directly discourages recombination at unwanted half-site combinations, enhancing the specificity of asymmetric site recombination. The engineered Cre mutants exhibit this assembly pattern in a variety of contexts, including mammalian cells. PMID:26365240

  13. Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.

    Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua

    2018-04-01

    Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.

  14. Redesign of the monomer-monomer interface of Cre recombinase yields an obligate heterotetrameric complex.

    Zhang, Chi; Myers, Connie A; Qi, Zongtai; Mitra, Robi D; Corbo, Joseph C; Havranek, James J

    2015-10-15

    Cre recombinase catalyzes the cleavage and religation of DNA at loxP sites. The enzyme is a homotetramer in its functional state, and the symmetry of the protein complex enforces a pseudo-palindromic symmetry upon the loxP sequence. The Cre-lox system is a powerful tool for many researchers. However, broader application of the system is limited by the fixed sequence preferences of Cre, which are determined by both the direct DNA contacts and the homotetrameric arrangement of the Cre monomers. As a first step toward achieving recombination at arbitrary asymmetric target sites, we have broken the symmetry of the Cre tetramer assembly. Using a combination of computational and rational protein design, we have engineered an alternative interface between Cre monomers that is functional yet incompatible with the wild-type interface. Wild-type and engineered interface halves can be mixed to create two distinct Cre mutants, neither of which are functional in isolation, but which can form an active heterotetramer when combined. When these distinct mutants possess different DNA specificities, control over complex assembly directly discourages recombination at unwanted half-site combinations, enhancing the specificity of asymmetric site recombination. The engineered Cre mutants exhibit this assembly pattern in a variety of contexts, including mammalian cells. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Contemporary zebrafish transgenesis with Tol2 and application for Cre/lox recombination experiments.

    Felker, A; Mosimann, C

    2016-01-01

    Spatiotemporal transgene regulation by transgenic DNA recombinases is a central tool for reverse genetics in multicellular organisms, with excellent applications for misexpression and lineage tracing experiments. One of the most widespread technologies for this purpose is Cre recombinase-controlled lox site recombination that is attracting increasing interest in the zebrafish field. Tol2-mediated zebrafish transgenesis provides a stable platform to integrate lox cassette transgenes, while the amenability of the zebrafish embryo to drug treatments makes the model an ideal candidate for tamoxifen-inducible CreERT2 experiments. In addition, advanced transgenesis technologies such as phiC31 or CRISPR-Cas9-based knock-ins are even further promoting zebrafish transgenesis for Cre/lox applications. In this chapter, we will first introduce the basics of Cre/lox methodology, CreERT2 regulation by tamoxifen, as well as the utility of Tol2 and other contemporary transgenesis techniques for Cre/lox experiments. We will then outline in detail practical experimental steps for efficient transgenesis toward the creation of single-insertion transgenes and will introduce protocols for 4-hydroxytamoxifen-mediated CreERT2 induction to perform spatiotemporal lox transgene regulation experiments in zebrafish embryos. Last, we will discuss advanced experimental applications of Cre/lox beyond traditional lineage tracing approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Cytokeratin 19 promoter directs the expression of Cre recombinase in various epithelia of transgenic mice.

    Zhao, Gui-Feng; Zhao, Shuang; Liu, Jia-Jie; Wu, Ji-Cheng; He, Hao-Yu; Ding, Xiao-Qing; Yu, Xue-Wen; Huang, Ke-Qiang; Li, Zhi-Jie; Zheng, Hua-Chuan

    2017-03-14

    Cytokeratin 19 (K19) is expressed in various differentiated cells, including gastric, intestinal and bronchial epithelial cells, and liver duct cells. Here, we generated a transgenic mouse line, K19-Cre, in which the expression of Cre recombinase was controlled by the promoter of K19. To test the tissue distribution and excision activity of Cre recombinase, K19-Cre transgenic mice were bred with Rosa26 reporter strain and a mouse strain that carries PTEN conditional alleles (PTENLoxp/Loxp). At mRNA level, Cre was strongly expressed in the stomach, lung and intestine, while in stomach, lung, and liver at protein level. The immunoreactivity to Cre was strongly observed the cytoplasm of gastric, bronchial and intestinal epithelial cells. Cre activity was detectable in gastric, bronchial and intestinal epithelial cells, according to LacZ staining. In K19-Cre/PTEN Loxp/Loxp mice, PTEN was abrogated in stomach, intestine, lung, liver and breast, the former two of which were verified by in situ PCR. There appeared breast cancer with PTEN loss. These data suggest that K19 promoter may be a useful tool to study the pathophysiological functions of cytokeratin 19-positive cells, especially gastrointestinal epithelial cells. Cell specificity of neoplasia is not completely attributable to the cell-specific expression of oncogenes and cell-specific loss of tumor suppressor genes.

  17. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  18. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  19. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  20. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  1. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  2. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  3. Functionally Complete Excision of Conditional Alleles in the Mouse Suprachiasmatic Nucleus by Vgat-ires-Cre.

    Weaver, David R; van der Vinne, Vincent; Giannaris, E Lela; Vajtay, Thomas J; Holloway, Kristopher L; Anaclet, Christelle

    2018-04-01

    Mice with targeted gene disruption have provided important information about the molecular mechanisms of circadian clock function. A full understanding of the roles of circadian-relevant genes requires manipulation of their expression in a tissue-specific manner, ideally including manipulation with high efficiency within the suprachiasmatic nuclei (SCN). To date, conditional manipulation of genes within the SCN has been difficult. In a previously developed mouse line, Cre recombinase was inserted into the vesicular GABA transporter (Vgat) locus. Since virtually all SCN neurons are GABAergic, this Vgat-Cre line seemed likely to have high efficiency at disrupting conditional alleles in SCN. To test this premise, the efficacy of Vgat-Cre in excising conditional (fl, for flanked by LoxP) alleles in the SCN was examined. Vgat-Cre-mediated excision of conditional alleles of Clock or Bmal1 led to loss of immunostaining for products of the targeted genes in the SCN. Vgat-Cre + ; Clock fl/fl ; Npas2 m/m mice and Vgat-Cre + ; Bmal1 fl/fl mice became arrhythmic immediately upon exposure to constant darkness, as expected based on the phenotype of mice in which these genes are disrupted throughout the body. The phenotype of mice with other combinations of Vgat-Cre + , conditional Clock, and mutant Npas2 alleles also resembled the corresponding whole-body knockout mice. These data indicate that the Vgat-Cre line is useful for Cre-mediated recombination within the SCN, making it useful for Cre-enabled technologies including gene disruption, gene replacement, and opto- and chemogenetic manipulation of the SCN circadian clock.

  4. Pdgfrb-Cre targets lymphatic endothelial cells of both venous and non-venous origins.

    Ulvmar, Maria H; Martinez-Corral, Ines; Stanczuk, Lukas; Mäkinen, Taija

    2016-06-01

    The Pdgfrb-Cre line has been used as a tool to specifically target pericytes and vascular smooth muscle cells. Recent studies showed additional targeting of cardiac and mesenteric lymphatic endothelial cells (LECs) by the Pdgfrb-Cre transgene. In the heart, this was suggested to provide evidence for a previously unknown nonvenous source of LECs originating from yolk sac (YS) hemogenic endothelium (HemEC). Here we show that Pdgfrb-Cre does not, however, target YS HemEC or YS-derived erythro-myeloid progenitors (EMPs). Instead, a high proportion of ECs in embryonic blood vessels of multiple organs, as well as venous-derived LECs were targeted. Assessment of temporal Cre activity using the R26-mTmG double reporter suggested recent occurrence of Pdgfrb-Cre recombination in both blood and lymphatic ECs. It thus cannot be excluded that Pdgfrb-Cre mediated targeting of LECs is due to de novo expression of the Pdgfrb-Cre transgene or their previously established venous endothelial origin. Importantly, Pdgfrb-Cre targeting of LECs does not provide evidence for YS HemEC origin of the lymphatic vasculature. Our results highlight the need for careful interpretation of lineage tracing using constitutive Cre lines that cannot discriminate active from historical expression. The early vascular targeting by the Pdgfrb-Cre also warrants consideration for its use in studies of mural cells. genesis 54:350-358, 2016. © 2016 The Authors. Genesis Published by Wiley Periodicals, Inc. © 2016 The Authors. Genesis Published by Wiley Periodicals, Inc.

  5. Activation Kinetics and Off-Target Effects of Thymus-Initiated Cre Transgenes

    Shi, Jianjun; Petrie, Howard T.

    2012-01-01

    The bacteriophage enzyme Cre is a site-specific recombinase widely used to delete loxP-flanked DNA sequences in lineage-specific fashion. Several mouse lines that direct Cre expression to lymphoid progenitors in the thymus have been established, but a side-by-side comparison of when they first become active, and/or their relative efficiency at various developmental stages, has been lacking. In this study, we evaluated these in four common Cre transgenic strains with thymus-initiated promoters (Lck, Cd2, or Cd4). We found that while all of them eventually labeled nearly all thymocytes, their kinetics were dramatically different, and other than Cd4[Cre], did not faithfully recapitulate the expression pattern of the corresponding endogenous gene. Perhaps even more importantly, while thymuses from some strains compared favorably to thymuses from control (Cre-negative) mice, we found that Cre expression could also result in off-target effects, including moderate to severe decreases in thymic cellularity. These effects occurred in the absence of loxP-flanked DNA target genes, and were dose and copy number dependent. Loss of cellularity was attributable to a specific decrease in CD4+8+ immature cells, and corresponds to an increased rate of programmed cell death. In addition to a comprehensive analysis of activation kinetics in thymus-initiated Cre transgenes, our data show that Cre is toxic to CD4+8+ cells in a dose-dependent fashion, and emphasize that the choice of thymus-initiated Cre strain is critically important for minimizing off-target effects of Cre. PMID:23049709

  6. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  7. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  8. Multicenter Clinical and Molecular Epidemiological Analysis of Bacteremia Due to Carbapenem-Resistant Enterobacteriaceae (CRE) in the CRE Epicenter of the United States.

    Satlin, Michael J; Chen, Liang; Patel, Gopi; Gomez-Simmonds, Angela; Weston, Gregory; Kim, Angela C; Seo, Susan K; Rosenthal, Marnie E; Sperber, Steven J; Jenkins, Stephen G; Hamula, Camille L; Uhlemann, Anne-Catrin; Levi, Michael H; Fries, Bettina C; Tang, Yi-Wei; Juretschko, Stefan; Rojtman, Albert D; Hong, Tao; Mathema, Barun; Jacobs, Michael R; Walsh, Thomas J; Bonomo, Robert A; Kreiswirth, Barry N

    2017-04-01

    Although the New York/New Jersey (NY/NJ) area is an epicenter for carbapenem-resistant Enterobacteriaceae (CRE), there are few multicenter studies of CRE from this region. We characterized patients with CRE bacteremia in 2013 at eight NY/NJ medical centers and determined the prevalence of carbapenem resistance among Enterobacteriaceae bloodstream isolates and CRE resistance mechanisms, genetic backgrounds, capsular types ( cps ), and antimicrobial susceptibilities. Of 121 patients with CRE bacteremia, 50% had cancer or had undergone transplantation. The prevalences of carbapenem resistance among Klebsiella pneumoniae , Enterobacter spp., and Escherichia coli bacteremias were 9.7%, 2.2%, and 0.1%, respectively. Ninety percent of CRE were K. pneumoniae and 92% produced K. pneumoniae carbapenemase (KPC-3, 48%; KPC-2, 44%). Two CRE produced NDM-1 and OXA-48 carbapenemases. Sequence type 258 (ST258) predominated among KPC-producing K. pneumoniae (KPC- Kp ). The wzi154 allele, corresponding to cps-2 , was present in 93% of KPC-3- Kp , whereas KPC-2- Kp had greater cps diversity. Ninety-nine percent of CRE were ceftazidime-avibactam (CAZ-AVI)-susceptible, although 42% of KPC-3- Kp had an CAZ-AVI MIC of ≥4/4 μg/ml. There was a median of 47 h from bacteremia onset until active antimicrobial therapy, 38% of patients had septic shock, and 49% died within 30 days. KPC-3- Kp bacteremia (adjusted odds ratio [aOR], 2.58; P = 0.045), cancer (aOR, 3.61, P = 0.01), and bacteremia onset in the intensive care unit (aOR, 3.79; P = 0.03) were independently associated with mortality. Active empirical therapy and combination therapy were not associated with survival. Despite a decade of experience with CRE, patients with CRE bacteremia have protracted delays in appropriate therapies and high mortality rates, highlighting the need for rapid diagnostics and evaluation of new therapeutics. Copyright © 2017 American Society for Microbiology.

  9. Generation of ER{alpha}-floxed and knockout mice using the Cre/LoxP system

    Antonson, P., E-mail: per.antonson@ki.se [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Omoto, Y.; Humire, P. [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Gustafsson, J.-A. [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Center for Nuclear Receptors and Cell Signaling, Department of Biology and Biochemistry, University of Houston, Houston, TX 77204 (United States)

    2012-08-10

    Highlights: Black-Right-Pointing-Pointer ER{alpha} floxed and knockout mice were generated. Black-Right-Pointing-Pointer Disruption of the ER{alpha} gene results in sterility in both male and female mice. Black-Right-Pointing-Pointer ER{alpha}{sup -/-} mice have ovaries with hemorrhagic follicles and hypoplastic uterus. Black-Right-Pointing-Pointer Female ER{alpha}{sup -/-} mice develop obesity. -- Abstract: Estrogen receptor alpha (ER{alpha}) is a nuclear receptor that regulates a range of physiological processes in response to estrogens. In order to study its biological role, we generated a floxed ER{alpha} mouse line that can be used to knock out ER{alpha} in selected tissues by using the Cre/LoxP system. In this study, we established a new ER{alpha} knockout mouse line by crossing the floxed ER{alpha} mice with Cre deleter mice. Here we show that genetic disruption of the ER{alpha} gene in all tissues results in sterility in both male and female mice. Histological examination of uterus and ovaries revealed a dramatically atrophic uterus and hemorrhagic cysts in the ovary. These results suggest that infertility in female mice is the result of functional defects of the reproductive tract. Moreover, female knockout mice are hyperglycemic, develop obesity and at the age of 4 months the body weight of these mice was more than 20% higher compared to wild type littermates and this difference increased over time. Our results demonstrate that ER{alpha} is necessary for reproductive tract development and has important functions as a regulator of metabolism in females.

  10. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  12. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  13. Delivery of the Cre recombinase by a self-deleting lentiviral vector: efficient gene targeting in vivo

    Pfeifer, A.; Brandon, E. P.; Kootstra, N.; Gage, F. H.; Verma, I. M.

    2001-01-01

    The Cre recombinase (Cre) from bacteriophage P1 is an important tool for genetic engineering in mammalian cells. We constructed lentiviral vectors that efficiently deliver Cre in vitro and in vivo. Surprisingly, we found a significant reduction in proliferation and an accumulation in the G(2)/M

  14. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  15. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  16. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  17. Cardiac-specific activation of Cre expression at late fetal development

    Opherk, Jan P.; Yampolsky, Peter; Hardt, Stefan E.; Schoels, Wolfgang; Katus, Hugo A.; Koenen, Michael; Zehelein, Joerg

    2007-01-01

    In a first step towards dissecting molecular mechanisms that contribute to the development of cardiac diseases, we have generated transgenic mice that express a Cre-GFP fusion protein under the transcriptional control of a 4.3 kb murine cardiac Troponin I gene (cTnI) promoter. Cre-GFP expression, similar in three transgenic lines, is described in one line. In mouse embryos, transgenic for the Cre-GFP and ROSA lacZ reporter allele, first Cre-mediated recombination appeared at 16.5 dpc selectively at the heart. Like the endogenous cTnI gene, transgenic Cre expression showed a slow rise through fetal development that increased neonatally. Bitransgenic hearts, stained at 30 days of age, showed intense signals in ventricular and atrial myocytes while no recombination occurred in other tissues. The delayed onset of Cre activity in cTnI-Cre mice could provide a useful genetic tool to evaluate the function of loxP targeted cardiac genes without interference of recombination during early heart development

  18. Spinal Hb9::Cre-derived excitatory interneurons contribute to rhythm generation in the mouse.

    Caldeira, Vanessa; Dougherty, Kimberly J; Borgius, Lotta; Kiehn, Ole

    2017-01-27

    Rhythm generating neurons are thought to be ipsilaterally-projecting excitatory neurons in the thoracolumbar mammalian spinal cord. Recently, a subset of Shox2 interneurons (Shox2 non-V2a INs) was found to fulfill these criteria and make up a fraction of the rhythm-generating population. Here we use Hb9::Cre mice to genetically manipulate Hb9::Cre-derived excitatory interneurons (INs) in order to determine the role of these INs in rhythm generation. We demonstrate that this line captures a consistent population of spinal INs which is mixed with respect to neurotransmitter phenotype and progenitor domain, but does not overlap with the Shox2 non-V2a population. We also show that Hb9::Cre-derived INs include the comparatively small medial population of INs which continues to express Hb9 postnatally. When excitatory neurotransmission is selectively blocked by deleting Vglut2 from Hb9::Cre-derived INs, there is no difference in left-right and/or flexor-extensor phasing between these cords and controls, suggesting that excitatory Hb9::Cre-derived INs do not affect pattern generation. In contrast, the frequencies of locomotor activity are significantly lower in cords from Hb9::Cre-Vglut2 Δ/Δ mice than in cords from controls. Collectively, our findings indicate that excitatory Hb9::Cre-derived INs constitute a distinct population of neurons that participates in the rhythm generating kernel for spinal locomotion.

  19. Commission for Energy regulation (CRE) - Activity report june 2008; Commission de regulation de l'energie (CRE) - Rapport d'activite juin 2008

    NONE

    2008-07-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2008 activity report of CRE. Content: A - How CRE works: CRE regulatory authority and organisation: Powers, Organisation; Budget resources; Personnel; B - The Standing Committee for Dispute Settlement and Sanctions (CoRDiS) activity: Admissibility, Authority; C - Building a single European energy market: Overview; Organisation and coordination of the main European regulators (Work carried out collectively by European regulators, Regulator organisation and development, CRE's relations with European Community institutions, Development of CEER activities outside the European Union); CRE's European activities (The contribution of European regulators to the Third Energy Package, Integration of gas markets, Integration of electricity markets, Operation of the European interconnected electricity grid and security of supply, Opening up markets to benefit consumers); European Community activities (The European Commission's proposals for the internal energy market: the Third Energy Package, The European Commission's proposals for fighting climate change: the Climate Package, Infringement

  20. Commission for Energy regulation (CRE) - Activity report june 2008; Commission de regulation de l'energie (CRE) - Rapport d'activite juin 2008

    NONE

    2008-07-01

    CRE is the French commission for energy regulation. CRE's remit is to assist in ensuring the proper operation of the electricity and natural gas markets for the benefit of the end-user. In particular, CRE ensures that the conditions of access to electricity and natural gas transmission and distribution systems do not hinder the development of competition. It monitors, for the electricity and natural gas sectors, all transactions made between suppliers, traders and producers, all transactions made on the organised markets and cross-border trading. It ensures that suppliers, traders and producers propose offers that are consistent with their financial and technical constraints. It monitors the implementation of and compliance with regulations giving consumers the right to choose their supplier in a competitive market, and allowing new suppliers to enter the market. This document is the 2008 activity report of CRE. Content: A - How CRE works: CRE regulatory authority and organisation: Powers, Organisation; Budget resources; Personnel; B - The Standing Committee for Dispute Settlement and Sanctions (CoRDiS) activity: Admissibility, Authority; C - Building a single European energy market: Overview; Organisation and coordination of the main European regulators (Work carried out collectively by European regulators, Regulator organisation and development, CRE's relations with European Community institutions, Development of CEER activities outside the European Union); CRE's European activities (The contribution of European regulators to the Third Energy Package, Integration of gas markets, Integration of electricity markets, Operation of the European interconnected electricity grid and security of supply, Opening up markets to benefit consumers); European Community activities (The European Commission's proposals for the internal energy market: the Third Energy Package, The European Commission's proposals for fighting climate change: the Climate

  1. Novel migrating mouse neural crest cell assay system utilizing P0-Cre/EGFP fluorescent time-lapse imaging

    Kawakami Minoru

    2011-11-01

    Full Text Available Abstract Background Neural crest cells (NCCs are embryonic, multipotent stem cells. Their long-range and precision-guided migration is one of their most striking characteristics. We previously reported that P0-Cre/CAG-CAT-lacZ double-transgenic mice showed significant lacZ expression in tissues derived from NCCs. Results In this study, by embedding a P0-Cre/CAG-CAT-EGFP embryo at E9.5 in collagen gel inside a culture glass slide, we were able to keep the embryo developing ex vivo for more than 24 hours; this development was with enough NCC fluorescent signal intensity to enable single-cell resolution analysis, with the accompanying NCC migration potential intact and with the appropriate NCC response to the extracellular signal maintained. By implantation of beads with absorbed platelet-derived growth factor-AA (PDGF-AA, we demonstrated that PDGF-AA acts as an NCC-attractant in embryos. We also performed assays with NCCs isolated from P0-Cre/CAG-CAT-EGFP embryos on culture plates. The neuromediator 5-hydroxytryptamine (5-HT has been known to regulate NCC migration. We newly demonstrated that dopamine, in addition to 5-HT, stimulated NCC migration in vitro. Two NCC populations, with different axial levels of origins, showed unique distribution patterns regarding migration velocity and different dose-response patterns to both 5-HT and dopamine. Conclusions Although avian species predominated over the other species in the NCC study, our novel system should enable us to use mice to assay many different aspects of NCCs in embryos or on culture plates, such as migration, division, differentiation, and apoptosis.

  2. Upregulation of CREM/ICER suppresses wound endothelial CRE-HIF-1α-VEGF-dependent signaling and impairs angiogenesis in type 2 diabetes

    Milad S. Bitar

    2015-01-01

    Full Text Available Impaired angiogenesis and endothelial dysfunction in type 2 diabetes constitute dominant risk factors for non-healing wounds and most forms of cardiovascular disease. We propose that diabetes shifts the ‘angiogenic balance’ in favor of an excessive anti-angiogenic phenotype. Herein, we report that diabetes impairs in vivo sponge angiogenic capacity by decreasing VEGF expression and fibrovascular invasion, and reciprocally enhances the formation of angiostatic molecules, such as thrombospondins, NFκB and FasL. Defective in vivo angiogenesis prompted cellular studies in cultured endothelial cells derived from subcutaneous sponge implants (SIECs of control and Goto-Kakizaki rats. Ensuing data from diabetic SIECs demonstrated a marked upregulation in cAMP-PKA-CREB signaling, possibly stemming from increased expression of adenylyl cyclase isoforms 3 and 8, and decreased expression of PDE3. Mechanistically, we found that oxidative stress and PKA activation in diabetes enhanced CREM/ICER expression. This reduces IRS2 cellular content by inhibiting cAMP response element (CRE transcriptional activity. Consequently, a decrease in the activity of Akt-mTOR ensued with a concomitant reduction in the total and nuclear protein levels of HIF-1α. Limiting HIF-1α availability for the specific hypoxia response elements in diabetic SIECs elicited a marked reduction in VEGF expression, both at the mRNA and protein levels. These molecular abnormalities were illustrated functionally by a defect in various pro-angiogenic properties, including cell proliferation, migration and tube formation. A genetic-based strategy in diabetic SIECs using siRNAs against CREM/ICER significantly augmented the PKA-dependent VEGF expression. To this end, the current data identify the importance of CREM/ICER as a negative regulator of endothelial function and establish a link between CREM/ICER overexpression and impaired angiogenesis during the course of diabetes. Moreover, it could

  3. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  4. The impact of Mexico's CRE regulation on Pemex marketing

    Martinez, A.

    1997-01-01

    The past, present and future of the natural gas industry in Mexico was reviewed. As far as the past is concerned, Pemex-Gas was a state monopoly, not subject to an independent regulatory authority. It was primarily concerned with providing natural gas to domestic consumers, it engaged in minimal marketing activities, and it was highly centralized. In the country as a whole, there was a notable indifference to regulation, and an almost total absence of a regulatory culture. Natural gas was seen as a minor byproduct of petroleum, not as an engine of economic growth. Reforms introduced in May 1995 attempt to institute revolutionary changes by creating a federal regulatory commission, (Comision Reguladora de Energia, CRE for short), and strongly encouraging private sector involvement in the storage, transmission and distribution of natural gas, while reserving exclusive jurisdiction for exploration and production to the State. Provisions of the new natural gas legislation were explained, including the impact on transportation, distribution and retail sales by the State Gas company, Pemex-Gas, and its assigned leading role in bringing about the legislated changes. A fully functioning open access system is expected to be in place by November 1997

  5. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  6. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  7. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  8. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  10. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  11. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  12. Usability as the Key Factor to the Design of a Web Server for the CReF Protein Structure Predictor: The wCReF

    Vanessa Stangherlin Machado Paixão-Cortes

    2018-01-01

    Full Text Available Protein structure prediction servers use various computational methods to predict the three-dimensional structure of proteins from their amino acid sequence. Predicted models are used to infer protein function and guide experimental efforts. This can contribute to solving the problem of predicting tertiary protein structures, one of the main unsolved problems in bioinformatics. The challenge is to understand the relationship between the amino acid sequence of a protein and its three-dimensional structure, which is related to the function of these macromolecules. This article is an extended version of the article wCReF: The Web Server for the Central Residue Fragment-based Method (CReF Protein Structure Predictor, published in the 14th International Conference on Information Technology: New Generations. In the first version, we presented the wCReF, a protein structure prediction server for the central residue fragment-based method. The wCReF interface was developed with a focus on usability and user interaction. With this tool, users can enter the amino acid sequence of their target protein and obtain its approximate 3D structure without the need to install all the multitude of necessary tools. In this extended version, we present the design process of the prediction server in detail, which includes: (A identification of user needs: aiming at understanding the features of a protein structure prediction server, the end user profiles and the commonly-performed tasks; (B server usability inspection: in order to define wCReF’s requirements and features, we have used heuristic evaluation guided by experts in both the human-computer interaction and bioinformatics domain areas, applied to the protein structure prediction servers I-TASSER, QUARK and Robetta; as a result, changes were found in all heuristics resulting in 89 usability problems; (C software requirements document and prototype: assessment results guiding the key features that wCReF must

  13. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  14. Cre Recombinase: You Can't Live with It, and You Can't Live Without It.

    Le, Yun-Zheng; Zhu, Meili; Anderson, Robert E

    2016-01-01

    The development of conditional gene targeting has greatly advanced our knowledge of human retinal diseases, but issues have arisen related to the use of some Cre-expressing mouse lines. In this article, we discuss potential problems associated with transgenic Cre expression-induced degeneration and alteration of rod photoreceptors and retinal pigment epithelium (RPE). Our strategy for circumventing RPE degeneration by induced transient Cre expression uses a single intravitreal doxycycline injection in a tetracycline-inducible RPE-specific Cre mouse line, which results in productive Cre-mediated recombination efficiently in the RPE. As constitutive expression of Cre in the RPE alters RPE biology, this inducible Cre/lox system provides an opportunity for conditional gene targeting in the RPE, a tissue that is closely related to photoreceptor degeneration, age-related macular degeneration, and diabetic retinopathy.

  15. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice.

    Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A; Stumpf, Sina K; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine

    2016-01-01

    Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.

  16. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  17. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  18. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  19. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  20. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  1. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  2. Sexually dimorphic distribution of Prokr2 neurons revealed by the Prokr2-Cre mouse model.

    Mohsen, Zaid; Sim, Hosung; Garcia-Galiano, David; Han, Xingfa; Bellefontaine, Nicole; Saunders, Thomas L; Elias, Carol F

    2017-12-01

    Prokineticin receptor 2 (PROKR2) is predominantly expressed in the mammalian central nervous system. Loss-of-function mutations of PROKR2 in humans are associated with Kallmann syndrome due to the disruption of gonadotropin releasing hormone neuronal migration and deficient olfactory bulb morphogenesis. PROKR2 has been also implicated in the neuroendocrine control of GnRH neurons post-migration and other physiological systems. However, the brain circuitry and mechanisms associated with these actions have been difficult to investigate mainly due to the widespread distribution of Prokr2-expressing cells, and the lack of animal models and molecular tools. Here, we describe the generation, validation and characterization of a new mouse model that expresses Cre recombinase driven by the Prokr2 promoter, using CRISPR-Cas9 technology. Cre expression was visualized using reporter genes, tdTomato and GFP, in males and females. Expression of Cre-induced reporter genes was found in brain sites previously described to express Prokr2, e.g., the paraventricular and the suprachiasmatic nuclei, and the area postrema. The Prokr2-Cre mouse model was further validated by colocalization of Cre-induced GFP and Prokr2 mRNA. No disruption of Prokr2 expression, GnRH neuronal migration or fertility was observed. Comparative analysis of Prokr2-Cre expression in male and female brains revealed a sexually dimorphic distribution confirmed by in situ hybridization. In females, higher Cre activity was found in the medial preoptic area, ventromedial nucleus of the hypothalamus, arcuate nucleus, medial amygdala and lateral parabrachial nucleus. In males, Cre was higher in the amygdalo-hippocampal area. The sexually dimorphic pattern of Prokr2 expression indicates differential roles in reproductive function and, potentially, in other physiological systems.

  3. Regulation of Cre recombinase by ligand-induced complementation of inactive fragments.

    Jullien, Nicolas; Sampieri, François; Enjalbert, Alain; Herman, Jean-Paul

    2003-11-01

    Cre recombinase is extensively used to engineer the genome of experimental animals. However, its usefulness is still limited by the lack of an efficient temporal control over its activity. To overcome this, we have developed DiCre, a regulatable fragment complementation system for Cre. The enzyme was split into two moieties that were fused to FKBP12 (FK506-binding protein) and FRB (binding domain of the FKBP12-rapamycin-associated protein), respectively. These can be efficiently heterodimerized by rapamycin. Several variants, based on splitting Cre at different sites and using different linker peptides, were tested in an indicator cell line. The fusion proteins, taken separately, had no recombinase activity. Stable transformants, co-expressing complementing fragments based on splitting Cre between Asn59 and Asn60, displayed low background activity affecting 0.05-0.4% of the cells. Rapamycin induced a rapid recombination, reaching 100% by 48-72 h, with an EC50 of 0.02 nM. Thus, ligand-induced dimerization can efficiently regulate Cre, and should be useful to achieve a tight temporal control of its activity, such as in the case of the creation of conditional knock-out animals.

  4. Activation of hypothalamic RIP-Cre neurons promotes beiging of WAT via sympathetic nervous system.

    Wang, Baile; Li, Ang; Li, Xiaomu; Ho, Philip Wl; Wu, Donghai; Wang, Xiaoqi; Liu, Zhuohao; Wu, Kelvin Kl; Yau, Sonata Sy; Xu, Aimin; Cheng, Kenneth Ky

    2018-04-01

    Activation of brown adipose tissue (BAT) and beige fat by cold increases energy expenditure. Although their activation is known to be differentially regulated in part by hypothalamus, the underlying neural pathways and populations remain poorly characterized. Here, we show that activation of rat-insulin-promoter-Cre (RIP-Cre) neurons in ventromedial hypothalamus (VMH) preferentially promotes recruitment of beige fat via a selective control of sympathetic nervous system (SNS) outflow to subcutaneous white adipose tissue (sWAT), but has no effect on BAT Genetic ablation of APPL2 in RIP-Cre neurons diminishes beiging in sWAT without affecting BAT, leading to cold intolerance and obesity in mice. Such defects are reversed by activation of RIP-Cre neurons, inactivation of VMH AMPK, or treatment with a β3-adrenergic receptor agonist. Hypothalamic APPL2 enhances neuronal activation in VMH RIP-Cre neurons and raphe pallidus, thereby eliciting SNS outflow to sWAT and subsequent beiging. These data suggest that beige fat can be selectively activated by VMH RIP-Cre neurons, in which the APPL2-AMPK signaling axis is crucial for this defending mechanism to cold and obesity. © 2018 The Authors.

  5. Cre-loxP-Mediated Recombination: General Principles and Experimental Considerations.

    McLellan, Micheal A; Rosenthal, Nadia A; Pinto, Alexander R

    2017-03-02

    The cre-loxP-mediated recombination system (the "cre-loxP system") is an integral experimental tool for mammalian genetics and cell biology. Use of the system has greatly expanded our ability to precisely interrogate gene function in the mouse, providing both spatial and temporal control of gene expression. This has been largely due to the simplicity of its use and its adaptability to address diverse biological questions. While the use of the cre-loxP system is becoming increasingly widespread, in particular because of growing availability of conditional mouse mutants, many considerations need to be taken into account when utilizing the cre-loxP system. This review provides an overview of the cre-loxP system and its various permutations. It addresses the limitations of cre-loxP technology and related considerations for experimental design, and it discusses alternative strategies for site-specific genetic recombination and integration. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  6. Marker Removal in Transgenic Plants Using Cre Recombinase Delivered with Potato Virus X.

    Kopertekh, Lilya; Schiemann, Joachim

    2017-01-01

    In this chapter we present an alternative method to develop marker-free transgenic plants. It makes use of the Cre/loxP recombination system from bacteriophage P1 and consists of two essential components. The first component is the transgenic plant containing a loxP-flanked marker gene. The second component is a cre transient expression vector based on potato virus X. The great benefit of this transient delivery method consists in the avoidance of stable integration of the cre recombinase gene into the plant genome. Upon infection of the loxP-target plant with PVX-Cre, the virus spreads systemically through the plant and causes the recombinase-mediated excision of the marker gene. Marker-free transgenic loci can be transmitted to the progeny by plant regeneration from PVX-Cre systemically infected leaves or self-pollination of virus-infected plants. The protocol covers generation of loxP-target transgenic plants, PVX-mediated delivery of Cre recombinase protein, phenotypic and molecular analysis of recombination events, and transmission of marker-free transgenic loci to the next generation. The transient expression system described in this chapter can be adapted for marker gene removal in other plant species that are amenable for virus infection.

  7. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  8. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  9. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  10. Construction of Marker-Free Transgenic Strains of Chlamydomonas reinhardtii Using a Cre/loxP-Mediated Recombinase System.

    Kasai, Yuki; Harayama, Shigeaki

    2016-01-01

    The Escherichia coli bacteriophage P1 encodes a site-specific recombinase called Cre and two 34-bp target sites of Cre recombinase called loxP. The Cre/loxP system has been used to achieve targeted insertion and precise deletion in many animal and plant genomes. The Cre/loxP system has particularly been used for the removal of selectable marker genes to create marker-free transgenic organisms. For the first time, we applied the Cre/loxP-mediated site-specific recombination system to Chlamydomonas reinhardtii to construct marker-free transgenic strains. Specifically, C. reinhardtii strains cc4350 and cc124 carrying an aphVIII expression cassette flanked by two direct repeats of loxP were constructed. Separately, a synthetic Cre recombinase gene (CrCRE), the codons of which were optimized for expression in C. reinhardtii, was synthesized, and a CrCRE expression cassette was introduced into strain cc4350 carrying a single copy of the loxP-flanked aphVIII expression cassette. Among 46 transformants carrying the CrCRE expression cassette stably, the excision of aphVIII by CrCre recombinase was observed only in one transformant. We then constructed an expression cassette of an in-frame fusion of ble to CrCRE via a short linker peptide. The product of ble (Ble) is a bleomycin-binding protein that confers resistance to bleomycin-related antibiotics such as Zeocin and localizes in the nucleus. Therefore, the ble-(linker)-CrCRE fusion protein is expected to localize in the nucleus. When the ble-(linker)-CrCRE expression cassette was integrated into the genome of strain cc4350 carrying a single copy of the loxP-flanked aphVIII expression cassette, CrCre recombinase-mediated excision of the aphVIII expression cassette was observed at a frequency higher than that in stable transformants of the CrCRE expression cassette. Similarly, from strain cc124 carrying a single loxP-flanked aphVIII expression cassette, the aphVIII expression cassette was successfully excised after

  11. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  12. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  13. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  14. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  15. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  17. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  18. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  19. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  20. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  1. Potential economic burden of carbapenem-resistant Enterobacteriaceae (CRE) in the United States.

    Bartsch, S M; McKinnell, J A; Mueller, L E; Miller, L G; Gohil, S K; Huang, S S; Lee, B Y

    2017-01-01

    The Centers for Disease Control and Prevention considers carbapenem-resistant Enterobacteriaceae (CRE) an urgent public health threat; however, its economic burden is unknown. We developed a CRE clinical and economics outcomes model to determine the cost of CRE infection from the hospital, third-party payer, and societal, perspectives and to evaluate the health and economic burden of CRE to the USA. Depending on the infection type, the median cost of a single CRE infection can range from $22 484 to $66 031 for hospitals, $10 440 to $31 621 for third-party payers, and $37 778 to $83 512 for society. An infection incidence of 2.93 per 100 000 population in the USA (9418 infections) would cost hospitals $275 million (95% CR $217-334 million), third-party payers $147 million (95% CR $129-172 million), and society $553 million (95% CR $303-1593 million) with a 25% attributable mortality, and would result in the loss of 8841 (95% CR 5805-12 420) quality-adjusted life years. An incidence of 15 per 100 000 (48 213 infections) would cost hospitals $1.4 billion (95% CR $1.1-1.7 billion), third-party payers $0.8 billion (95% CR $0.6-0.8 billion), and society $2.8 billion (95% CR $1.6-8.2 billion), and result in the loss of 45 261 quality-adjusted life years. The cost of CRE is higher than the annual cost of many chronic diseases and of many acute diseases. Costs rise proportionally with the incidence of CRE, increasing by 2.0 times, 3.4 times, and 5.1 times for incidence rates of 6, 10, and 15 per 100 000 persons. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. Anomalous baroreflex functionality inherent in floxed and Cre-Lox mice: an overlooked physiological phenotype.

    Tsai, Ching-Yi; Poon, Yan-Yuen; Chen, Chang-Han; Chan, Samuel H H

    2017-10-01

    The last two decades have seen the emergence of Cre-Lox recombination as one of the most powerful and versatile technologies for cell-specific genetic engineering of mammalian cells. Understandably, the primary concerns in the practice of Cre-Lox recombination are whether the predicted genome has been correctly modified and the targeted phenotypes expressed. Rarely are the physiological conditions of the animals routinely examined because the general assumption is that they are normal. Based on corroborative results from radiotelemetric recording, power spectral analysis, and magnetic resonance imaging/diffusion tensor imaging in brain-derived neurotrophic factor-floxed mice, the present study revealed that this assumption requires amendment. We found that despite comparable blood pressure and heart rate with C57BL/6 or Cre mice under the conscious state, floxed and Cre-Lox mice exhibited diminished baroreflex-mediated sympathetic vasomotor tone and cardiac vagal baroreflex. We further found that the capacity and plasticity of baroreflex of these two strains of mice under isoflurane anesthesia were retarded, as reflected by reduced connectivity between the nucleus tractus solitarii and rostral ventrolateral medulla or nucleus ambiguus. The identification of anomalous baroreflex functionality inherent in floxed and Cre-Lox mice points to the importance of incorporating physiological phenotypes into studies that engage gene manipulations such as Cre-Lox recombination. NEW & NOTEWORTHY We established that anomalous baroreflex functionality is inherent in floxed and Cre-Lox mice. These two mouse strains exhibited diminished baroreflex-mediated sympathetic vasomotor tone and cardiac vagal baroreflex under the conscious state, retarded capacity and plasticity of baroreflex under isoflurane anesthesia, and reduced connectivity between key nuclei in the baroreflex neural circuits. Copyright © 2017 the American Physiological Society.

  3. Broader expression of the mouse platelet factor 4-cre transgene beyond the megakaryocyte lineage.

    Pertuy, F; Aguilar, A; Strassel, C; Eckly, A; Freund, J-N; Duluc, I; Gachet, C; Lanza, F; Léon, C

    2015-01-01

    Transgenic mice expressing cre recombinase under the control of the platelet factor 4 (Pf4) promoter, in the context of a 100-kb bacterial artificial chromosome, have become a valuable tool with which to study genetic modifications in the platelet lineage. However, the specificity of cre expression has recently been questioned, and the time of its onset during megakaryopoiesis remains unknown. To characterize the expression of this transgene, we used double-fluorescent cre reporter mice. In the bone marrow, Pf4-cre-mediated recombination had occurred in all CD42-positive megakaryocytes as early as stage I of maturation, and in rare CD42-negative cells. In circulating blood, all platelets had recombined, along with only a minor fraction of CD45-positive cells. However, we found that all tissues contained recombined cells of monocyte/macrophage origin. When recombined, these cells might potentially modify the function of the tissues under particular conditions, especially inflammatory conditions, which further increase recombination in immune cells. Unexpectedly, a subset of epithelial cells from the distal colon showed signs of recombination resulting from endogenous Pf4-cre expression. This is probably the basis of the unexplained colon tumors developed by Apc(flox/flox) ;Pf4-cre mice, generated in a separate study on the role of Apc in platelet formation. Altogether, our results indicate early recombination with full penetrance in megakaryopoiesis, and confirm the value of Pf4-cre mice for the genetic engineering of megakaryocytes and platelets. However, care must be taken when investigating the role of platelets in processes outside hemostasis, especially when immune cells might be involved. © 2014 International Society on Thrombosis and Haemostasis.

  4. Heme oxygenase-1 expression protects the heart from acute injury caused by inducible Cre recombinase.

    Hull, Travis D; Bolisetty, Subhashini; DeAlmeida, Angela C; Litovsky, Silvio H; Prabhu, Sumanth D; Agarwal, Anupam; George, James F

    2013-08-01

    The protective effect of heme oxygenase-1 (HO-1) expression in cardiovascular disease has been previously demonstrated using transgenic animal models in which HO-1 is constitutively overexpressed in the heart. However, the temporal requirements for protection by HO-1 induction relative to injury have not been investigated, but are essential to employ HO-1 as a therapeutic strategy in human cardiovascular disease states. Therefore, we generated mice with cardiac-specific, tamoxifen (TAM)-inducible overexpression of a human HO-1 (hHO-1) transgene (myosin heavy chain (MHC)-HO-1 mice) by breeding mice with cardiac-specific expression of a TAM-inducible Cre recombinase (MHC-Cre mice), with mice containing an hHO-1 transgene preceded by a floxed-stop signal. MHC-HO-1 mice overexpress HO-1 mRNA and the enzymatically active protein following TAM administration (40 mg/kg body weight on 2 consecutive days). In MHC-Cre controls, TAM administration leads to severe, acute cardiac toxicity, cardiomyocyte necrosis, and 80% mortality by day 3. This cardiac toxicity is accompanied by a significant increase in inflammatory cells in the heart that are predominantly neutrophils. In MHC-HO-1 mice, HO-1 overexpression ameliorates the depression of cardiac function and high mortality rate observed in MHC-Cre mice following TAM administration and attenuates cardiomyocyte necrosis and neutrophil infiltration. These results highlight that HO-1 induction is sufficient to prevent the depression of cardiac function observed in mice with TAM-inducible Cre recombinase expression by protecting the heart from necrosis and neutrophil infiltration. These findings are important because MHC-Cre mice are widely used in cardiovascular research despite the limitations imposed by Cre-induced cardiac toxicity, and also because inflammation is an important pathological component of many human cardiovascular diseases.

  5. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  6. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  7. Cell-specific cre recombinase expression allows selective ablation of glutamate receptors from mouse horizontal cells.

    Sebastian Ströh

    Full Text Available In the mouse retina, horizontal cells form an electrically coupled network and provide feedback signals to photoreceptors and feedforward signals to bipolar cells. Thereby, horizontal cells contribute to gain control at the first visual synapse and to the antagonistic organization of bipolar and ganglion cell receptive fields. However, the nature of horizontal cell output remains a matter of debate, just as the exact contribution of horizontal cells to center-surround antagonism. To facilitate studying horizontal cell function, we developed a knockin mouse line which allows ablating genes exclusively in horizontal cells. This knockin line expresses a Cre recombinase under the promoter of connexin57 (Cx57, a gap junction protein only expressed in horizontal cells. Consistently, in Cx57+/Cre mice, Cre recombinase is expressed in almost all horizontal cells (>99% and no other retinal neurons. To test Cre activity, we crossbred Cx57+/Cre mice with a mouse line in which exon 11 of the coding sequence for the ionotropic glutamate receptor subunit GluA4 was flanked by two loxP sites (GluA4fl/fl. In GluA4fl/fl:Cx57+/Cre mice, GluA4 immunoreactivity was significantly reduced (∼ 50% in the outer retina where horizontal cells receive photoreceptor inputs, confirming the functionality of the Cre/loxP system. Whole-cell patch-clamp recordings from isolated horizontal cell somata showed a reduction of glutamate-induced inward currents by ∼ 75%, suggesting that the GluA4 subunit plays a major role in mediating photoreceptor inputs. The persistent current in GluA4-deficient cells is mostly driven by AMPA and to a very small extent by kainate receptors as revealed by application of the AMPA receptor antagonist GYKI52466 and concanavalin A, a potentiator of kainate receptor-mediated currents. In summary, the Cx57+/Cre mouse line provides a versatile tool for studying horizontal cell function. GluA4fl/fl:Cx57+/Cre mice, in which horizontal cells receive less

  8. CGRPα within the Trpv1-Cre population contributes to visceral nociception.

    Spencer, Nick J; Magnúsdóttir, Elín I; Jakobsson, Jon E T; Kestell, Garreth; Chen, Bao Nan; Morris, David; Brookes, Simon J; Lagerström, Malin C

    2018-02-01

    The role of calcitonin gene-related peptide (CGRP) in visceral and somatic nociception is incompletely understood. CGRPα is highly expressed in sensory neurons of dorsal root ganglia and particularly in neurons that also express the transient receptor potential cation channel subfamily V member 1 (Trpv1). Therefore, we investigated changes in visceral and somatic nociception following deletion of CGRPα from the Trpv1-Cre population using the Cre/lox system. In control mice, acetic acid injection (0.6%, ip) caused significant immobility (time stationary), an established indicator of visceral pain. In CGRPα-mCherry lx/lx ;Trpv1-Cre mice, the duration of immobility was significantly less than controls, and the distance CGRPα-mCherry lx/lx ;Trpv1-Cre mice traveled over 20 min following acetic acid was significantly greater than controls. However, following acetic acid injection, there was no difference between genotypes in the writhing reflex, number of abdominal licks, or forepaw wipes of the cheek. CGRPα-mCherry lx/lx ;Trpv1-Cre mice developed more pronounced inflammation-induced heat hypersensitivity above baseline values compared with controls. However, analyses of noxious acute heat or cold transmission revealed no difference between genotypes. Also, odor avoidance test, odor preference test, and buried food test for olfaction revealed no differences between genotypes. Our findings suggest that CGRPα-mediated transmission within the Trpv1-Cre population plays a significant role in visceral nociceptive pathways underlying voluntary movement. Monitoring changes in movement over time is a sensitive parameter to identify differences in visceral nociception, compared with writhing reflexes, abdominal licks, or forepaw wipes of the cheek that were unaffected by deletion of CGRPα- from Trpv1-Cre population and likely utilize different mechanisms. NEW & NOTEWORTHY The neuropeptide calcitonin gene-related peptide (CGRP) is highly colocalized with transient receptor

  9. Cell-Specific Cre Recombinase Expression Allows Selective Ablation of Glutamate Receptors from Mouse Horizontal Cells

    Janssen-Bienhold, Ulrike; Schultz, Konrad; Cimiotti, Kerstin; Weiler, Reto; Willecke, Klaus; Dedek, Karin

    2013-01-01

    In the mouse retina, horizontal cells form an electrically coupled network and provide feedback signals to photoreceptors and feedforward signals to bipolar cells. Thereby, horizontal cells contribute to gain control at the first visual synapse and to the antagonistic organization of bipolar and ganglion cell receptive fields. However, the nature of horizontal cell output remains a matter of debate, just as the exact contribution of horizontal cells to center-surround antagonism. To facilitate studying horizontal cell function, we developed a knockin mouse line which allows ablating genes exclusively in horizontal cells. This knockin line expresses a Cre recombinase under the promoter of connexin57 (Cx57), a gap junction protein only expressed in horizontal cells. Consistently, in Cx57+/Cre mice, Cre recombinase is expressed in almost all horizontal cells (>99%) and no other retinal neurons. To test Cre activity, we crossbred Cx57+/Cre mice with a mouse line in which exon 11 of the coding sequence for the ionotropic glutamate receptor subunit GluA4 was flanked by two loxP sites (GluA4fl/fl). In GluA4fl/fl:Cx57+/Cre mice, GluA4 immunoreactivity was significantly reduced (∼50%) in the outer retina where horizontal cells receive photoreceptor inputs, confirming the functionality of the Cre/loxP system. Whole-cell patch-clamp recordings from isolated horizontal cell somata showed a reduction of glutamate-induced inward currents by ∼75%, suggesting that the GluA4 subunit plays a major role in mediating photoreceptor inputs. The persistent current in GluA4-deficient cells is mostly driven by AMPA and to a very small extent by kainate receptors as revealed by application of the AMPA receptor antagonist GYKI52466 and concanavalin A, a potentiator of kainate receptor-mediated currents. In summary, the Cx57+/Cre mouse line provides a versatile tool for studying horizontal cell function. GluA4fl/fl:Cx57+/Cre mice, in which horizontal cells receive less excitatory input

  10. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  11. Cell Type-Specific Manipulation with GFP-Dependent Cre Recombinase

    Tang, Jonathan C Y; Rudolph, Stephanie; Dhande, Onkar S; Abraira, Victoria E; Choi, Seungwon; Lapan, Sylvain; Drew, Iain R; Drokhlyansky, Eugene; Huberman, Andrew D; Regehr, Wade G; Cepko, Constance L

    2016-01-01

    Summary There are many transgenic GFP reporter lines that allow visualization of specific populations of cells. Using such lines for functional studies requires a method that transforms GFP into a molecule that enables genetic manipulation. Here we report the creation of a method that exploits GFP for gene manipulation, Cre Recombinase Dependent on GFP (CRE-DOG), a split component system that uses GFP and its derivatives to directly induce Cre/loxP recombination. Using plasmid electroporation and AAV viral vectors, we delivered CRE-DOG to multiple GFP mouse lines, leading to effective recombination selectively in GFP-labeled cells. Further, CRE-DOG enabled optogenetic control of these neurons. Beyond providing a new set of tools for manipulation of gene expression selectively in GFP+ cells, we demonstrate that GFP can be used to reconstitute the activity of a protein not known to have a modular structure, suggesting that this strategy might be applicable to a wide range of proteins. PMID:26258682

  12. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  13. Cre Fused with RVG Peptide Mediates Targeted Genome Editing in Mouse Brain Cells In Vivo.

    Zou, Zhiyuan; Sun, Zhaolin; Li, Pan; Feng, Tao; Wu, Sen

    2016-12-14

    Cell penetrating peptides (CPPs) are short peptides that can pass through cell membranes. CPPs can facilitate the cellular entry of proteins, macromolecules, nanoparticles and drugs. RVG peptide (RVG hereinafter) is a 29-amino-acid CPP derived from a rabies virus glycoprotein that can cross the blood-brain barrier (BBB) and enter brain cells. However, whether RVG can be used for genome editing in the brain has not been reported. In this work, we combined RVG with Cre recombinase for bacterial expression. The purified RVG-Cre protein cut plasmids in vitro and traversed cell membranes in cultured Neuro2a cells. By tail vein-injecting RVG-Cre into Cre reporter mouse lines mTmG and Rosa26 lacZ , we demonstrated that RVG-Cre could target brain cells and achieve targeted somatic genome editing in adult mice. This direct delivery of the gene-editing enzyme protein into mouse brains with RVG is much safer than plasmid- or viral-based methods, holding promise for further applications in the treatment of various brain diseases.

  14. A BAC-based transgenic mouse specifically expresses an inducible Cre in the urothelium.

    Tian Huai Shen

    Full Text Available Cre-loxp mediated conditional knockout strategy has played critical roles for revealing functions of many genes essential for development, as well as the causal relationships between gene mutations and diseases in the postnatal adult mice. One key factor of this strategy is the availability of mice with tissue- or cell type-specific Cre expression. However, the success of the traditional molecular cloning approach to generate mice with tissue specific Cre expression often depends on luck. Here we provide a better alternative by using bacterial artificial chromosome (BAC-based recombineering to insert iCreERT2 cDNA at the ATG start of the Upk2 gene. The BAC-based transgenic mice express the inducible Cre specifically in the urothelium as demonstrated by mRNA expression and staining for LacZ expression after crossing with a Rosa26 reporter mouse. Taking into consideration the size of the gene of interest and neighboring genes included in a BAC, this method should be widely applicable for generation of mice with tissue specific gene expression or deletions in a more specific manner than previously reported.

  15. Deletion of creB in Aspergillus oryzae increases secreted hydrolytic enzyme activity.

    Hunter, A J; Morris, T A; Jin, B; Saint, C P; Kelly, J M

    2013-09-01

    Aspergillus oryzae has been used in the food and beverage industry for centuries, and industrial strains have been produced by multiple rounds of selection. Targeted gene deletion technology is particularly useful for strain improvement in such strains, particularly when they do not have a well-characterized meiotic cycle. Phenotypes of an Aspergillus nidulans strain null for the CreB deubiquitinating enzyme include effects on growth and repression, including increased activity levels of various enzymes. We show that Aspergillus oryzae contains a functional homologue of the CreB deubiquitinating enzyme and that a null strain shows increased activity levels of industrially important secreted enzymes, including cellulases, xylanases, amylases, and proteases, as well as alleviated inhibition of spore germination on glucose medium. Reverse transcription-quantitative PCR (RT-qPCR) analysis showed that the increased levels of enzyme activity in both Aspergillus nidulans and Aspergillus oryzae are mirrored at the transcript level, indicating transcriptional regulation. We report that Aspergillus oryzae DAR3699, originally isolated from soy fermentation, has a similar phenotype to that of a creB deletion mutant of the RIB40 strain, and it contains a mutation in the creB gene. Collectively, the results for Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, and Penicillium decumbens show that deletion of creB may be broadly useful in diverse fungi for increasing production of a variety of enzymes.

  16. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  17. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  18. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  19. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  20. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  1. Establishment of a tamoxifen-inducible Cre-driver mouse strain for widespread and temporal genetic modification in adult mice.

    Ichise, Hirotake; Hori, Akiko; Shiozawa, Seiji; Kondo, Saki; Kanegae, Yumi; Saito, Izumu; Ichise, Taeko; Yoshida, Nobuaki

    2016-07-29

    Temporal genetic modification of mice using the ligand-inducible Cre/loxP system is an important technique that allows the bypass of embryonic lethal phenotypes and access to adult phenotypes. In this study, we generated a tamoxifen-inducible Cre-driver mouse strain for the purpose of widespread and temporal Cre recombination. The new line, named CM32, expresses the GFPneo-fusion gene in a wide variety of tissues before FLP recombination and tamoxifen-inducible Cre after FLP recombination. Using FLP-recombined CM32 mice (CM32Δ mice) and Cre reporter mouse lines, we evaluated the efficiency of Cre recombination with and without tamoxifen administration to adult mice, and found tamoxifen-dependent induction of Cre recombination in a variety of adult tissues. In addition, we demonstrated that conditional activation of an oncogene could be achieved in adults using CM32Δ mice. CM32Δ;T26 mice, which harbored a Cre recombination-driven, SV40 large T antigen-expressing transgene, were viable and fertile. No overt phenotype was found in the mice up to 3 months after birth. Although they displayed pineoblastomas (pinealoblastomas) and/or thymic enlargement due to background Cre recombination by 6 months after birth, they developed epidermal hyperplasia when administered tamoxifen. Collectively, our results suggest that the CM32Δ transgenic mouse line can be applied to the assessment of adult phenotypes in mice with loxP-flanked transgenes.

  2. Targeting of Mesenchymal Stromal Cells by Cre-Recombinase Transgenes Commonly Used to Target Osteoblast Lineage Cells.

    Zhang, Jingzhu; Link, Daniel C

    2016-11-01

    The targeting specificity of tissue-specific Cre-recombinase transgenes is a key to interpreting phenotypes associated with their use. The Ocn-Cre and Dmp1-Cre transgenes are widely used to target osteoblasts and osteocytes, respectively. Here, we used high-resolution microscopy of bone sections and flow cytometry to carefully define the targeting specificity of these transgenes. These transgenes were crossed with Cxcl12 gfp mice to identify Cxcl12-abundant reticular (CAR) cells, which are a perivascular mesenchymal stromal population implicated in hematopoietic stem/progenitor cell maintenance. We show that in addition to osteoblasts, Ocn-Cre targets a majority of CAR cells and arteriolar pericytes. Surprisingly, Dmp1-Cre also targets a subset of CAR cells, in which expression of osteoblast-lineage genes is enriched. Finally, we introduce a new tissue-specific Cre-recombinase, Tagln-Cre, which efficiently targets osteoblasts, a majority of CAR cells, and both venous sinusoidal and arteriolar pericytes. These data show that Ocn-Cre and Dmp1-Cre target broader stromal cell populations than previously appreciated and may aid in the design of future studies. Moreover, these data highlight the heterogeneity of mesenchymal stromal cells in the bone marrow and provide tools to interrogate this heterogeneity. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.

  3. Silencing inhibits Cre-mediated recombination of the Z/AP and Z/EG reporters in adult cells.

    Long, Michael A; Rossi, Fabio M V

    2009-01-01

    The Cre-loxP system has been used to enable tissue specific activation, inactivation and mutation of many genes in vivo and has thereby greatly facilitated the genetic dissection of several cellular and developmental processes. In such studies, Cre-reporter strains, which carry a Cre-activated marker gene, are frequently utilized to validate the expression profile of Cre transgenes, to act as a surrogate marker for excision of a second allele, and to irreversibly label cells for lineage tracing experiments. We have studied three commonly used Cre-reporter strains, Z/AP, Z/EG and R26R-EYFP and have demonstrated that although each reporter can be reliably activated by Cre during early development, exposure to Cre in adult hematopoietic cells results in a much lower frequency of marker-positive cells in the Z/AP or Z/EG strains than in the R26R-EYFP strain. In marker negative cells derived from the Z/AP and Z/EG strains, the transgenic promoter is methylated and Cre-mediated recombination of the locus is inhibited. These results show that the efficiency of Cre-mediated recombination is not only dependent on the genomic context of a given loxP-flanked sequence, but also on stochastic epigenetic mechanisms underlying transgene variegation. Furthermore, our data highlights the potential shortcomings of utilizing the Z/AP and Z/EG reporters as surrogate markers of excision or in lineage tracing experiments.

  4. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  5. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  6. BIOCHEMICAL AND PHYLOGENETIC STUDIES OF CreD OF Corynebacterium glutamicum

    Muhammad Tausif Chaudhry

    2015-06-01

    Full Text Available CreD characterized as Mg2+-dependent phosphohydrolase with conserved HD domain was involved in 4-cresol metabolism in Corynebacterium glutamicum. Native molecular mass of 54 kDa suggested that the biological unit is a dimer. No deoxynucleotide triphosphate triphosphohydrolase (dNTPase activity was detected for CreD. The apparent Km and Vmax values for 4-nitrophenyl phosphate were 0.35 mM and 16.23 M min-1 mg-1, respectively, while calculated values for kcat and kcat/Km were 0.4 s-1 and 1.14103 M-1 s-1, respectively. Among thiol group inhibitors, iodoacetic acid significantly inhibited phosphohydrolase activity. Sequence identity and phylogenetic analysis suggested universal existence of CreD homologues. Involvement of HD-domain hydrolase in aromatic degradation has not been reported before.

  7. Spinal Hb9::Cre-derived excitatory interneurons contribute to rhythm generation in the mouse

    Caldeira, Vanessa; Dougherty, Kimberly J.; Borgius, Lotta

    2017-01-01

    Rhythm generating neurons are thought to be ipsilaterally-projecting excitatory neurons in the thoracolumbar mammalian spinal cord. Recently, a subset of Shox2 interneurons (Shox2 non-V2a INs) was found to fulfill these criteria and make up a fraction of the rhythm-generating population. Here we...... than in cords from controls. Collectively, our findings indicate that excitatory Hb9::Cre-derived INs constitute a distinct population of neurons that participates in the rhythm generating kernel for spinal locomotion....... use Hb9::Cre mice to genetically manipulate Hb9::Cre-derived excitatory interneurons (INs) in order to determine the role of these INs in rhythm generation. We demonstrate that this line captures a consistent population of spinal INs which is mixed with respect to neurotransmitter phenotype...

  8. A novel Cre recombinase imaging system for tracking lymphotropic virus infection in vivo.

    Bernadette M Dutia

    2009-08-01

    Full Text Available Detection, isolation, and identification of individual virus infected cells during long term infection are critical to advance our understanding of mechanisms of pathogenesis for latent/persistent viruses. However, current approaches to study these viruses in vivo have been hampered by low sensitivity and effects of cell-type on expression of viral encoded reporter genes. We have designed a novel Cre recombinase (Cre-based murine system to overcome these problems, and thereby enable tracking and isolation of individual in vivo infected cells.Murine gammaherpesvirus 68 (MHV-68 was used as a prototypic persistent model virus. A Cre expressing recombinant virus was constructed and characterised. The virus is attenuated both in lytic virus replication, producing ten-fold lower lung virus titres than wild type virus, and in the establishment of latency. However, despite this limitation, when the sEGFP7 mouse line containing a Cre-activated enhanced green fluorescent protein (EGFP was infected with the Cre expressing virus, sites of latent and persistent virus infection could be identified within B cells and macrophages of the lymphoid system on the basis of EGFP expression. Importantly, the use of the sEGFP7 mouse line which expresses high levels of EGFP allowed individual virus positive cells to be purified by FACSorting. Virus gene expression could be detected in these cells. Low numbers of EGFP positive cells could also be detected in the bone marrow.The use of this novel Cre-based virus/mouse system allowed identification of individual latently infected cells in vivo and may be useful for the study and long-term monitoring of other latent/persistent virus infections.

  9. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  10. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  11. Nonlocal symmetry and explicit solutions from the CRE method of the Boussinesq equation

    Zhao, Zhonglong; Han, Bo

    2018-04-01

    In this paper, we analyze the integrability of the Boussinesq equation by using the truncated Painlevé expansion and the CRE method. Based on the truncated Painlevé expansion, the nonlocal symmetry and Bäcklund transformation of this equation are obtained. A prolonged system is introduced to localize the nonlocal symmetry to the local Lie point symmetry. It is proved that the Boussinesq equation is CRE solvable. The two-solitary-wave fusion solutions, single soliton solutions and soliton-cnoidal wave solutions are presented by means of the Bäcklund transformations.

  12. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  13. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  15. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  16. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  17. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  18. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  19. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  20. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  1. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  2. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  3. Proglucagon Promoter Cre-Mediated AMPK Deletion in Mice Increases Circulating GLP-1 Levels and Oral Glucose Tolerance.

    Sophie R Sayers

    Full Text Available Enteroendocrine L-cells synthesise and release the gut hormone glucagon-like peptide-1 (GLP-1 in response to food transit. Deletion of the tumour suppressor kinase LKB1 from proglucagon-expressing cells leads to the generation of intestinal polyps but no change in circulating GLP-1 levels. Here, we explore the role of the downstream kinase AMP-activated protein kinase (AMPK in these cells.Loss of AMPK from proglucagon-expressing cells was achieved using a preproglucagon promoter-driven Cre (iGluCre to catalyse recombination of floxed alleles of AMPKα1 and α2. Oral and intraperitoneal glucose tolerance were measured using standard protocols. L-cell mass was measured by immunocytochemistry. Hormone and peptide levels were measured by electrochemical-based luminescence detection or radioimmunoassay.Recombination with iGluCre led to efficient deletion of AMPK from intestinal L- and pancreatic alpha-cells. In contrast to mice rendered null for LKB1 using the same strategy, mice deleted for AMPK displayed an increase (WT: 0.05 ± 0.01, KO: 0.09±0.02%, p<0.01 in L-cell mass and elevated plasma fasting (WT: 5.62 ± 0.800 pg/ml, KO: 14.5 ± 1.870, p<0.01 and fed (WT: 15.7 ± 1.48pg/ml, KO: 22.0 ± 6.62, p<0.01 GLP-1 levels. Oral, but not intraperitoneal, glucose tolerance was significantly improved by AMPK deletion, whilst insulin and glucagon levels were unchanged despite an increase in alpha to beta cell ratio (WT: 0.23 ± 0.02, KO: 0.33 ± 0.03, p<0.01.AMPK restricts L-cell growth and GLP-1 secretion to suppress glucose tolerance. Targeted inhibition of AMPK in L-cells may thus provide a new therapeutic strategy in some forms of type 2 diabetes.

  4. Size does matter: Cre-mediated somatic deletion efficiency depends on the distance between the target lox-sites

    Coppoolse, E.R.; Vroomen, de M.J.; Gennip, van F.; Hersmus, B.J.M.; Haaren, van M.J.

    2005-01-01

    Cre/lox recombination in vivo has become an important tool to induce chromosomal rearrangements like deletions. Using a combination of Ds transposition and Cre/lox recombination in two independent experiments on chromosomes 6 and 7 of tomato, two sets of somatic deletions up to a size of 200 kb were

  5. Disruption of Trichoderma reesei cre2, encoding an ubiquitin C-terminal hydrolase, results in increased cellulase activity

    2011-01-01

    Background The filamentous fungus Trichoderma reesei (Hypocrea jecorina) is an important source of cellulases for use in the textile and alternative fuel industries. To fully understand the regulation of cellulase production in T. reesei, the role of a gene known to be involved in carbon regulation in Aspergillus nidulans, but unstudied in T. reesei, was investigated. Results The T. reesei orthologue of the A. nidulans creB gene, designated cre2, was identified and shown to be functional through heterologous complementation of a creB mutation in A. nidulans. A T. reesei strain was constructed using gene disruption techniques that contained a disrupted cre2 gene. This strain, JKTR2-6, exhibited phenotypes similar to the A. nidulans creB mutant strain both in carbon catabolite repressing, and in carbon catabolite derepressing conditions. Importantly, the disruption also led to elevated cellulase levels. Conclusions These results demonstrate that cre2 is involved in cellulase expression. Since the disruption of cre2 increases the amount of cellulase activity, without severe morphological affects, targeting creB orthologues for disruption in other industrially useful filamentous fungi, such as Aspergillus oryzae, Trichoderma harzianum or Aspergillus niger may also lead to elevated hydrolytic enzyme activity in these species. PMID:22070776

  6. Disruption of Trichoderma reesei cre2, encoding an ubiquitin C-terminal hydrolase, results in increased cellulase activity

    Denton Jai A

    2011-11-01

    Full Text Available Abstract Background The filamentous fungus Trichoderma reesei (Hypocrea jecorina is an important source of cellulases for use in the textile and alternative fuel industries. To fully understand the regulation of cellulase production in T. reesei, the role of a gene known to be involved in carbon regulation in Aspergillus nidulans, but unstudied in T. reesei, was investigated. Results The T. reesei orthologue of the A. nidulans creB gene, designated cre2, was identified and shown to be functional through heterologous complementation of a creB mutation in A. nidulans. A T. reesei strain was constructed using gene disruption techniques that contained a disrupted cre2 gene. This strain, JKTR2-6, exhibited phenotypes similar to the A. nidulans creB mutant strain both in carbon catabolite repressing, and in carbon catabolite derepressing conditions. Importantly, the disruption also led to elevated cellulase levels. Conclusions These results demonstrate that cre2 is involved in cellulase expression. Since the disruption of cre2 increases the amount of cellulase activity, without severe morphological affects, targeting creB orthologues for disruption in other industrially useful filamentous fungi, such as Aspergillus oryzae, Trichoderma harzianum or Aspergillus niger may also lead to elevated hydrolytic enzyme activity in these species.

  7. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  8. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  9. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  10. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  11. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  12. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  13. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  14. Altered Baseline and Nicotine-Mediated Behavioral and Cholinergic Profiles in ChAT-Cre Mouse Lines.

    Chen, Edison; Lallai, Valeria; Sherafat, Yasmine; Grimes, Nickolas P; Pushkin, Anna N; Fowler, J P; Fowler, Christie D

    2018-02-28

    The recent development of transgenic rodent lines expressing cre recombinase in a cell-specific manner, along with advances in engineered viral vectors, has permitted in-depth investigations into circuit function. However, emerging evidence has begun to suggest that genetic modifications may introduce unexpected caveats. In the current studies, we sought to extensively characterize male and female mice from both the ChAT (BAC) -Cre mouse line, created with the bacterial artificial chromosome (BAC) method, and ChAT (IRES) -Cre mouse line, generated with the internal ribosome entry site (IRES) method. ChAT (BAC) -Cre transgenic and wild-type mice did not differ in general locomotor behavior, anxiety measures, drug-induced cataplexy, nicotine-mediated hypolocomotion, or operant food training. However, ChAT (BAC) -Cre transgenic mice did exhibit significant deficits in intravenous nicotine self-administration, which paralleled an increase in vesicular acetylcholine transporter and choline acetyltransferase (ChAT) hippocampal expression. For the ChAT (IRES) -Cre line, transgenic mice exhibited deficits in baseline locomotor, nicotine-mediated hypolocomotion, and operant food training compared with wild-type and hemizygous littermates. No differences among ChAT (IRES) -Cre wild-type, hemizygous, and transgenic littermates were found in anxiety measures, drug-induced cataplexy, and nicotine self-administration. Given that increased cre expression was present in the ChAT (IRES) -Cre transgenic mice, as well as a decrease in ChAT expression in the hippocampus, altered neuronal function may underlie behavioral phenotypes. In contrast, ChAT (IRES) -Cre hemizygous mice were more similar to wild-type mice in both protein expression and the majority of behavioral assessments. As such, interpretation of data derived from ChAT-Cre rodents must consider potential limitations dependent on the line and/or genotype used in research investigations. SIGNIFICANCE STATEMENT Altered

  15. Critical Religious Education (CRE) in Practice: Evaluating the Reception of an Introductory Scheme of Work

    Goodman, Angela

    2018-01-01

    Critical Religious Education (CRE) is a contemporary pedagogy of religious education developed by Andrew Wright and various colleagues over the past two decades. There has been widespread academic discourse about the pedagogy in theory but increasingly commentators have called for examples of it in practice. Over the past seven years a writing…

  16. The FEM simulation of continuous rotary extrusion (CRE) of aluminum alloy AA3003

    Rajendran, Nijenthan; Valberg, Henry; Misiolek, Wojciech Z.

    2017-10-01

    Continuous Rotary Extrusion (CRE) process is also known in literature under Conform TM name and it is mainly used for the continuous extrusion of Aluminum and Copper alloys. CRE use a feedstock in the form of rod, powders and chips, which are fed into the groove of the rotating wheel. As the wheel rotates the feedstock moves along with it due to friction with the wheel. Once the feedstock reaches the abutment the material deforms plastically and it is extruded through the die. CRE has lot to offer when compared to other more conventional extrusion processes such as low energy input, no limit in billet length as it is a continuous process as well as improved material physical properties due to plastic deformation under constant parameters. In this work a FEM model has been developed using Deform TM 3D, to study the metal flow and state variables of AA3003 CRE extrusion. The effect of extrusion wheel velocity has been investigated. The results show that increase in wheel velocity will heat up the feedstock metal due to high shear deformation and higher friction, which significantly changes metal flow conditions at the die exit.

  17. The cre-inducer doxycycline lowers cytokine and chemokine transcript levels in the gut of mice

    Hansen, Axel Kornerup; Malm, Sara Astrup; Metzdorff, Stine B.

    2017-01-01

    The antibiotic doxycycline is used as an inducer of recombinase (cre)-based conditional gene knockout in mice, which is a common tool to show the effect of disrupted gene functions only in one period of a research animal’s life. However, other types of such antibiotics have been shown to have...

  18. The effect of CreA in glucose and xylose catabolism in Aspergillus nidulans

    Prathumpai, Wai; Mcintyre, Mhairi; Nielsen, Jens

    2004-01-01

    The catabolism of glucose and xylose was studied in a wild type and creA deleted (carbon catabolite de-repressed) strain of Aspergillus nidulans. Both strains were cultivated in bioreactors with either glucose or xylose as the sole carbon source, or in the presence of both sugars. In the cultivat......The catabolism of glucose and xylose was studied in a wild type and creA deleted (carbon catabolite de-repressed) strain of Aspergillus nidulans. Both strains were cultivated in bioreactors with either glucose or xylose as the sole carbon source, or in the presence of both sugars...... on the sugar mixture, glucose repression of xylose utilisation was observed; with xylose utilisation occurring only after glucose was depleted. This phenomenon was not seen in the creA deleted strain, where glucose and xylose were catabolised simultaneously. Measurement of key metabolites and the activities...... of key enzymes in the xylose utilisation pathway revealed that xylose metabolism was occurring in the creA deleted strain, even at high glucose concentrations. Conversely, in the wild type strain, activities of the key enzymes for xylose metabolism increased only when the effects of glucose repression...

  19. Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation

    Harris, Julie A.; Hirokawa, Karla E.; Sorensen, Staci A.; Gu, Hong; Mills, Maya; Ng, Lydia L.; Bohn, Phillip; Mortrud, Marty; Ouellette, Benjamin; Kidney, Jolene; Smith, Kimberly A.; Dang, Chinh; Sunkin, Susan; Bernard, Amy; Oh, Seung Wook; Madisen, Linda; Zeng, Hongkui

    2014-01-01

    Significant advances in circuit-level analyses of the brain require tools that allow for labeling, modulation of gene expression, and monitoring and manipulation of cellular activity in specific cell types and/or anatomical regions. Large-scale projects and individual laboratories have produced hundreds of gene-specific promoter-driven Cre mouse lines invaluable for enabling genetic access to subpopulations of cells in the brain. However, the potential utility of each line may not be fully realized without systematic whole brain characterization of transgene expression patterns. We established a high-throughput in situ hybridization (ISH), imaging and data processing pipeline to describe whole brain gene expression patterns in Cre driver mice. Currently, anatomical data from over 100 Cre driver lines are publicly available via the Allen Institute's Transgenic Characterization database, which can be used to assist researchers in choosing the appropriate Cre drivers for functional, molecular, or connectional studies of different regions and/or cell types in the brain. PMID:25071457

  20. STIM1fl/fl Ksp-Cre Mouse has Impaired Renal Water Balance

    Liudmila Cebotaru

    2016-06-01

    Full Text Available Background/AIM: STIM1 is as an essential component in store operated Ca2+ entry. However give the paucity of information on the role of STIM1 in kidney, the aim was to study the function of STIM1 in the medulla of the kidney. Methods: we crossed a Ksp-cre mouse with another mouse containing two loxP sites flanking Exon 6 of STIM1. The Ksp-cre mouse is based upon the Ksp-cadherin gene promoter which expresses cre recombinase in developing nephrons, collecting ducts (SD and thick ascending limbs (TAL of the loop of Henle. Results: The offspring of these mice are viable without gross morphological changes, however, we noticed that the STIM1 Ksp-cre knockout mice produced more urine compared to control. To examine this more carefully, we fed mice low (LP and high protein (HP diets respectively. When mice were fed HP diet STIM1 ko mice had significantly increased urinary volume and lower specific gravity compared to wt mice. In STIM1 ko mice fed HP diet urine creatinine and urea were significantly lower compared to wt mice fed HP diet, however the fractional excretion was the same. Conclusion: These data support the idea that STIM1 ko mice have impaired urinary concentrating ability when challenged with HP diet is most likely caused by impaired Ca2+-dependent signal transduction through the vasopressin receptor cascade.

  1. Induced Pluripotent Stem Cells Generated from P0-Cre;Z/EG Transgenic Mice.

    Ogawa, Yasuhiro; Eto, Akira; Miyake, Chisato; Tsuchida, Nana; Miyake, Haruka; Takaku, Yasuhiro; Hagiwara, Hiroaki; Oishi, Kazuhiko

    2015-01-01

    Neural crest (NC) cells are a migratory, multipotent cell population that arises at the neural plate border, and migrate from the dorsal neural tube to their target tissues, where they differentiate into various cell types. Abnormal development of NC cells can result in severe congenital birth defects. Because only a limited number of cells can be obtained from an embryo, mechanistic studies are difficult to perform with directly isolated NC cells. Protein zero (P0) is expressed by migrating NC cells during the early embryonic period. In the P0-Cre;Z/EG transgenic mouse, transient activation of the P0 promoter induces Cre-mediated recombination, indelibly tagging NC-derived cells with enhanced green fluorescent protein (EGFP). Induced pluripotent stem cell (iPSC) technology offers new opportunities for both mechanistic studies and development of stem cell-based therapies. Here, we report the generation of iPSCs from the P0-Cre;Z/EG mouse. P0-Cre;Z/EG mouse-derived iPSCs (P/G-iPSCs) exhibited pluripotent stem cell properties. In lineage-directed differentiation studies, P/G-iPSCs were efficiently differentiated along the neural lineage while expressing EGFP. These results suggest that P/G-iPSCs are useful to study NC development and NC-associated diseases.

  2. Identification of a minimal functional linker in human topoisomerase I by domain swapping with Cre recombinase

    Hougaard, Rikke Frøhlich; Juul, Sissel; Vinther, Maria

    2008-01-01

    . In this study we replace 86 amino acids including the linker domain of the cellular type IB topoisomerase, human topoisomerase I, with four, six, or eight amino acids from the corresponding short loop region in Cre recombinase. In vitro characterization of the resulting chimeras, denoted Cropos, reveals...

  3. Anatomical characterization of cre driver mice for neural circuit mapping and manipulation

    Julie Ann Harris

    2014-07-01

    Full Text Available Significant advances in circuit-level analyses of the brain require tools that allow for labeling, modulation of gene expression, and monitoring and manipulation of cellular activity in specific cell types and/or anatomical regions. Large-scale projects and individual laboratories have produced hundreds of gene-specific promoter-driven Cre mouse lines invaluable for enabling genetic access to subpopulations of cells in the brain. However, the potential utility of each line may not be fully realized without systematic whole brain characterization of transgene expression patterns. We established a high-throughput in situ hybridization, imaging and data processing pipeline to describe whole brain gene expression patterns in Cre driver mice. Currently, anatomical data from over 100 Cre driver lines are publicly available via the Allen Institute’s Transgenic Characterization database, which can be used to assist researchers in choosing the appropriate Cre drivers for functional, molecular, or connectional studies of different regions and/or cell types in the brain.

  4. Atrial cardiomyocyte-specific expression of Cre recombinase driven by an Nppa gene fragment

    de Lange, Frederik J.; Moorman, Antoon F. M.; Christoffels, Vincent M.

    2003-01-01

    To study the development of the atria, we produced a transgenic mouse line that expresses Cre under the regulatory control of a 7 kbp fragment of the Natriuretic peptide precursor type A gene (Nppa), from -3 kbp to +4 kbp relative to the transcription start site. Crossing this line with the R26R and

  5. Cre-Lox Neurogenetics: 20 Years of Versatile Applications in Brain Research and Counting….

    Tsien, Joe Z

    2016-01-01

    Defining and manipulating specific neurons in the brain has garnered enormous interest in recent years, because such an approach is now widely recognized as crucial for deepening our understanding of how the brain works. When I started exploring the Cre-loxP recombination for brain research in the early 1990s, it was written off as a dead-end project by a young fool. Yet over the past 20 years, Cre-lox recombination-mediated neurogenetics has emerged as one of the most powerful and versatile technology platforms for cell-specific gene knockouts, transgenic overexpression, Brainbow imaging, neural pathway tracing with retrovirus and CLARITY, chemical genetics, and optogenetics. Its popularity and greater utility in neuroscience research is also largely thanks to the NIH's bold Blueprint for Neuroscience Research Initiative to launch several Cre-driver resource projects, as well as individual laboratories and private research organizations. With newly-discovered, genetically-encoded molecules that are capable of responding to sonar and magnetic stimulation, for sonogenetics or magnetogenetics, respectively, or detecting rapid voltage changes in neurons, Cre-lox neurogenetics will continue to aid brain research for years to come.

  6. Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research.

    Tetteh, Paul W; Kretzschmar, Kai; Begthel, Harry; van den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; van Es, Johan H; Offerhaus, G Johan A; Clevers, Hans

    2016-10-18

    Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic anhydrase I (Car1) is a gene expressed uniquely in colonic epithelial cells. We generated a colon-specific inducible Car1 CreER knock-in (KI) mouse with broad Cre activity in epithelial cells of the proximal colon and cecum. Deletion of the tumor suppressor gene Apc using the Car1 CreER KI caused tumor formation in the cecum but did not yield adenomas in the proximal colon. Mutation of both Apc and Kras yielded microadenomas in both the cecum and the proximal colon, which progressed to macroadenomas with significant morbidity. Aggressive carcinomas with some invasion into lymph nodes developed upon combined induction of oncogenic mutations of Apc, Kras, p53, and Smad4 Importantly, no adenomas were observed in the small intestine. Additionally, we observed tumors from differentiated Car1-expressing cells with Apc/Kras mutations, suggesting that a top-down model of intestinal tumorigenesis can occur with multiple mutations. Our results establish the Car1 CreER KI as a valuable mouse model to study colon-specific tumorigenesis and metastasis as well as cancer-cell-of-origin questions.

  7. Induced Pluripotent Stem Cells Generated from P0-Cre;Z/EG Transgenic Mice.

    Yasuhiro Ogawa

    Full Text Available Neural crest (NC cells are a migratory, multipotent cell population that arises at the neural plate border, and migrate from the dorsal neural tube to their target tissues, where they differentiate into various cell types. Abnormal development of NC cells can result in severe congenital birth defects. Because only a limited number of cells can be obtained from an embryo, mechanistic studies are difficult to perform with directly isolated NC cells. Protein zero (P0 is expressed by migrating NC cells during the early embryonic period. In the P0-Cre;Z/EG transgenic mouse, transient activation of the P0 promoter induces Cre-mediated recombination, indelibly tagging NC-derived cells with enhanced green fluorescent protein (EGFP. Induced pluripotent stem cell (iPSC technology offers new opportunities for both mechanistic studies and development of stem cell-based therapies. Here, we report the generation of iPSCs from the P0-Cre;Z/EG mouse. P0-Cre;Z/EG mouse-derived iPSCs (P/G-iPSCs exhibited pluripotent stem cell properties. In lineage-directed differentiation studies, P/G-iPSCs were efficiently differentiated along the neural lineage while expressing EGFP. These results suggest that P/G-iPSCs are useful to study NC development and NC-associated diseases.

  8. CRE communication on the work of the GTE 2007 and GTG 2007

    NONE

    2006-09-15

    The work conducted in the first half of 2006 by the Electricity Working Group (GTE) and Gas Working Group (GTG) consultation bodies set up by the Commission de regulation de l'energie (CRE), has specified the practical conditions for market operation defined in CRE communication of 10 January 2006. The CRE decision of 26 May 2005, has led to the creation of a consumer committee within the GTE and GTG allowing the expectations of gas and electricity consumers to be given greater consideration. During the first half of 2006, this consumer committee defined consumers needs in terms of information and protection, and set recommendations, whose application is one of the priorities over the coming months. The consumer committee has become a plenary committee for gas and electricity consumers, with the same stature as the GTE and GTG plenary committees. Following a round table with the players on 14 September 2006, CRE presents the decisions made and guidelines adopted for the coming months in this communication. (author)

  9. CRE communication on the work of the GTE 2007 and GTG 2007

    2006-09-01

    The work conducted in the first half of 2006 by the Electricity Working Group (GTE) and Gas Working Group (GTG) consultation bodies set up by the Commission de regulation de l'energie (CRE), has specified the practical conditions for market operation defined in CRE communication of 10 January 2006. The CRE decision of 26 May 2005, has led to the creation of a consumer committee within the GTE and GTG allowing the expectations of gas and electricity consumers to be given greater consideration. During the first half of 2006, this consumer committee defined consumers needs in terms of information and protection, and set recommendations, whose application is one of the priorities over the coming months. The consumer committee has become a plenary committee for gas and electricity consumers, with the same stature as the GTE and GTG plenary committees. Following a round table with the players on 14 September 2006, CRE presents the decisions made and guidelines adopted for the coming months in this communication. (author)

  10. Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

    Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

    2014-12-01

    The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  12. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  13. Targeted deletion of RANKL in M cell inducer cells by the Col6a1-Cre driver.

    Nagashima, Kazuki; Sawa, Shinichiro; Nitta, Takeshi; Prados, Alejandro; Koliaraki, Vasiliki; Kollias, George; Nakashima, Tomoki; Takayanagi, Hiroshi

    2017-11-04

    The gut-associated lymphoid tissues (GALTs), including Peyer's patches (PPs), cryptopatches (CPs) and isolated lymphoid follicles (ILFs), establish a host-microbe symbiosis by the promotion of immune reactions against gut microbes. Microfold cell inducer (MCi) cells in GALTs are the recently identified mesenchymal cells that express the cytokine RANKL and initiate bacteria-specific immunoglobulin A (IgA) production via induction of microfold (M) cell differentiation. In the previous study, the Twist2-Cre driver was utilized for gene deletion in mesenchymal cells including MCi cells. In order to investigate MCi cells more extensively, it will be necessary to develop experimental tools in addition to the Twist2-Cre driver mice and characterize such drivers in specificity and efficiency. Here we show that M cell differentiation and IgA production are impaired in the targeted deletion of RANKL by the Col6a1-Cre driver. We compared Col6a1-Cre with Twist2-Cre in terms of the specificity for mesenchymal cells in GALTs. Col6a1-Cre CAG-CAT-EGFP mice exhibited EGFP expression in podoplanin + CD31 - cells including MCi cells, while Twist2-Cre mice were shown to target endothelial cells and podoplanin + CD31 - cells. Tnfsf11 fl/Δ Col6a1-Cre mice exhibited the absence of M cells and severe IgA reduction together with an alteration in gut microbial composition. Moreover, we analyzed germ free mice to test whether changes in the microbiota are the cause of M cell deficiency. M cell differentiation was normal in the CPs/ILFs of germ free mice, indicating that MCi cells induce M cells independently of microbial colonization. This study demonstrates that Col6a1-Cre driver mice are as useful as Twist2-Cre driver mice for functional analyses of GALT-resident mesenchymal cells, including MCi cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Reappraisal of VAChT-Cre: Preference in slow motor neurons innervating type I or IIa muscle fibers.

    Misawa, Hidemi; Inomata, Daijiro; Kikuchi, Miseri; Maruyama, Sae; Moriwaki, Yasuhiro; Okuda, Takashi; Nukina, Nobuyuki; Yamanaka, Tomoyuki

    2016-11-01

    VAChT-Cre.Fast and VAChT-Cre.Slow mice selectively express Cre recombinase in approximately one half of postnatal somatic motor neurons. The mouse lines have been used in various studies with selective genetic modifications in adult motor neurons. In the present study, we crossed VAChT-Cre lines with a reporter line, CAG-Syp/tdTomato, in which synaptophysin-tdTomato fusion proteins are efficiently sorted to axon terminals, making it possible to label both cell bodies and axon terminals of motor neurons. In the mice, Syp/tdTomato fluorescence preferentially co-localized with osteopontin, a recently discovered motor neuron marker for slow-twitch fatigue-resistant (S) and fast-twitch fatigue-resistant (FR) types. The fluorescence did not preferentially co-localize with matrix metalloproteinase-9, a marker for fast-twitch fatigable (FF) motor neurons. In the neuromuscular junctions, Syp/tdTomato fluorescence was detected mainly in motor nerve terminals that innervate type I or IIa muscle fibers. These results suggest that the VAChT-Cre lines are Cre-drivers that have selectivity in S and FR motor neurons. In order to avoid confusion, we have changed the mouse line names from VAChT-Cre.Fast and VAChT-Cre.Slow to VAChT-Cre.Early and VAChT-Cre.Late, respectively. The mouse lines will be useful tools to study slow-type motor neurons, in relation to physiology and pathology. © 2016 Wiley Periodicals, Inc.

  15. Defective bone repair in mast cell-deficient Cpa3Cre/+ mice.

    Jose Luis Ramirez-GarciaLuna

    Full Text Available In the adult skeleton, cells of the immune system interact with those of the skeleton during all phases of bone repair to influence the outcome. Mast cells are immune cells best known for their pathologic role in allergy, and may be involved in chronic inflammatory and fibrotic disorders. Potential roles for mast cells in tissue homeostasis, vascularization and repair remain enigmatic. Previous studies in combined mast cell- and Kit-deficient KitW-sh/W-sh mice (KitW-sh implicated mast cells in bone repair but KitW-sh mice suffer from additional Kit-dependent hematopoietic and non- hematopoietic deficiencies that could have confounded the outcome. The goal of the current study was to compare bone repair in normal wild type (WT and Cpa3Cre/+ mice, which lack mast cells in the absence of any other hematopoietic or non- hematopoietic deficiencies. Repair of a femoral window defect was characterized using micro CT imaging and histological analyses from the early inflammatory phase, through soft and hard callus formation, and finally the remodeling phase. The data indicate 1 mast cells appear in healing bone of WT mice but not Cpa3Cre/+ mice, beginning 14 days after surgery; 2 re-vascularization of repair tissue and deposition of mineralized bone was delayed and dis-organised in Cpa3Cre/+ mice compared with WT mice; 3 the defects in Cpa3Cre/+ mice were associated with little change in anabolic activity and biphasic alterations in osteoclast and macrophage activity. The outcome at 56 days postoperative was complete bridging of the defect in most WT mice and fibrous mal-union in most Cpa3Cre/+ mice. The results indicate that mast cells promote bone healing, possibly by recruiting vascular endothelial cells during the inflammatory phase and coordinating anabolic and catabolic activity during tissue remodeling. Taken together the data indicate that mast cells have a positive impact on bone repair.

  16. Defective bone repair in mast cell-deficient Cpa3Cre/+ mice.

    Ramirez-GarciaLuna, Jose Luis; Chan, Daniel; Samberg, Robert; Abou-Rjeili, Mira; Wong, Timothy H; Li, Ailian; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Henderson, Janet E; Martineau, Paul A

    2017-01-01

    In the adult skeleton, cells of the immune system interact with those of the skeleton during all phases of bone repair to influence the outcome. Mast cells are immune cells best known for their pathologic role in allergy, and may be involved in chronic inflammatory and fibrotic disorders. Potential roles for mast cells in tissue homeostasis, vascularization and repair remain enigmatic. Previous studies in combined mast cell- and Kit-deficient KitW-sh/W-sh mice (KitW-sh) implicated mast cells in bone repair but KitW-sh mice suffer from additional Kit-dependent hematopoietic and non- hematopoietic deficiencies that could have confounded the outcome. The goal of the current study was to compare bone repair in normal wild type (WT) and Cpa3Cre/+ mice, which lack mast cells in the absence of any other hematopoietic or non- hematopoietic deficiencies. Repair of a femoral window defect was characterized using micro CT imaging and histological analyses from the early inflammatory phase, through soft and hard callus formation, and finally the remodeling phase. The data indicate 1) mast cells appear in healing bone of WT mice but not Cpa3Cre/+ mice, beginning 14 days after surgery; 2) re-vascularization of repair tissue and deposition of mineralized bone was delayed and dis-organised in Cpa3Cre/+ mice compared with WT mice; 3) the defects in Cpa3Cre/+ mice were associated with little change in anabolic activity and biphasic alterations in osteoclast and macrophage activity. The outcome at 56 days postoperative was complete bridging of the defect in most WT mice and fibrous mal-union in most Cpa3Cre/+ mice. The results indicate that mast cells promote bone healing, possibly by recruiting vascular endothelial cells during the inflammatory phase and coordinating anabolic and catabolic activity during tissue remodeling. Taken together the data indicate that mast cells have a positive impact on bone repair.

  17. Transgenic mice for a tamoxifen-induced, conditional expression of the Cre recombinase in osteoclasts.

    Maria Arantzazu Sanchez-Fernandez

    Full Text Available BACKGROUND: Studies on osteoclasts, the bone resorbing cells, have remained limited due to the lack of transgenic mice allowing the conditional knockout of genes in osteoclasts at any time during development or adulthood. METHODOLOGY/PRINCIPAL FINDING: We report here on the generation of transgenic mice which specifically express a tamoxifen-inducible Cre recombinase in osteoclasts. These mice, generated on C57BL/6 and FVB background, express a fusion Cre recombinase-ERT2 protein whose expression is driven by the promoter of cathepsin K (CtsK, a gene highly expressed in osteoclasts. We tested the cellular specificity of Cre activity in CtsKCreERT2 strains by breeding with Rosa26LacZ reporter mice. PCR and histological analyses of the CtsKCreERT2LacZ positive adult mice and E17.5 embryos show that Cre activity is restricted largely to bone tissue. In vitro, primary osteoclasts derived from the bone marrow of CtsKCreERT2+/-LacZ+/- adult mice show a Cre-dependent β-galactosidase activity after tamoxifen stimulation. CONCLUSIONS/SIGNIFICANCE: We have generated transgenic lines that enable the tamoxifen-induced, conditional deletion of loxP-flanked genes in osteoclasts, thus circumventing embryonic and postnatal gene lethality and avoiding gene deletion in other cell types. Such CtsKCreERT2 mice provide a convenient tool to study in vivo the different facets of osteoclast function in bone physiology during different developmental stages and adulthood of mice.

  18. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  19. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  20. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  1. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  2. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  3. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  4. Cre-/IoxP-Mediated Recombination between the SIL and SCL Genes Leads to a Block in T-Cell Development at the CD4-CD8- to CD4+CD8+ Transition

    Yue Cheng

    2007-04-01

    Full Text Available In the most common form of stem cell leukemia (SCL gene rearrangement, an interstitial deletion of 82 kb brings SCL under the control of regulatory elements that normally govern expression of the ubiquitously expressed SCL interrupting locus (SIL gene, which is located directly upstream of SCL. To investigate the effect of this fusion in a mouse model, a bacterial artificial chromosome (BAC clone containing both human SIL and SCL genes was isolated, and IoxP sites were inserted into intron 1 of both the SIL and SCL genes, corresponding to the sites at which recombination occurs in human T-cell acute lymphocytic leukemia patients. This BAC clone was used to generate transgenic SILIoxloxSCL mice. These transgenic mice were subsequently bred to Lck-Cre mice that express the Cre recombinase specifically in the thymus. The BAC transgene was recombined between the two IoxP sites in over 50% of the thymocytes from SILIoxloxSCL/Cre double-transgenic mice, bringing the SCL gene under the direct control of SIL regulatory elements. Aberrant SCL gene expression in the thymus was verified by reverse transcription- polymerase chain reaction. Using FACS analysis, we found that mice carrying both SILIoxloxSCL and Cre transgenes have increased CD4-/CD8- thymocytes compared with transgenenegative mice. In the spleen, these transgenic mice show a marked reduction in the number of mature CD4+ or CD8+ cells. These results demonstrate that conditional activation of SCL under control of SIL regulatory elements can impair normal T-cell development.

  5. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  6. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  7. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  8. Generation of a KOR-Cre knockin mouse strain to study cells involved in kappa opioid signaling.

    Cai, Xiaoyun; Huang, Huizhen; Kuzirian, Marissa S; Snyder, Lindsey M; Matsushita, Megumi; Lee, Michael C; Ferguson, Carolyn; Homanics, Gregg E; Barth, Alison L; Ross, Sarah E

    2016-01-01

    The kappa opioid receptor (KOR) has numerous important roles in the nervous system including the modulation of mood, reward, pain, and itch. In addition, KOR is expressed in many non-neuronal tissues. However, the specific cell types that express KOR are poorly characterized. Here, we report the development of a KOR-Cre knockin allele, which provides genetic access to cells that express KOR. In this mouse, Cre recombinase (Cre) replaces the initial coding sequence of the Opkr1 gene (encoding the kappa opioid receptor). We demonstrate that the KOR-Cre allele mediates recombination by embryonic day 14.5 (E14.5). Within the brain, KOR-Cre shows expression in numerous areas including the cerebral cortex, nucleus accumbens and striatum. In addition, this allele is expressed in epithelium and throughout many regions of the body including the heart, lung, and liver. Finally, we reveal that KOR-Cre mediates recombination of a subset of bipolar and amacrine cells in the retina. Thus, the KOR-Cre mouse line is a valuable new tool for conditional gene manipulation to enable the study of KOR. © 2015 Wiley Periodicals, Inc.

  9. Cold inducible promoter driven Cre-lox system proved to be highly efficient for marker gene excision in transgenic barley.

    Éva, Csaba; Téglás, Flóra; Zelenyánszki, Helga; Tamás, Cecília; Juhász, Angéla; Mészáros, Klára; Tamás, László

    2018-01-10

    A Cre-lox based auto-excision strategy has been adapted for barley, capable of cre and selectable marker gene (SMG) removal. The cold inducible wheat promoter called wcs120 was utilised for driving Cre expression. The binary vector was carrying the transgene (uidA) and a so called 'recombination cassette' flanked by the lox sequences. This part included both the recombinase gene and the SMG (bar) under the control of a constitutive promoter. T 0 , T 1 and T 2 transgenic plants were subjected to low temperature (at 4°C, 10°C and 12°C) at different developmental stages to induce recombination. The presence of uidA, cre, and bar genes and recombination footprints were studied by PCR and DNA sequencing, while cre transcription was followed by qRT-PCR. These analyses indicated that, cold treatment of the germinating seeds (4°C for 3days) followed by plant growing at higher temperature (24°C) has been the most efficient (90-100%), and this treatment lead to heritable changes in the genome. Thermal separation of Cre accumulation (at low temperature) from Cre enzyme activity (at higher temperature) could have prevented the premature excision of its own encoding gene, and lead to high expression level thereby increasing recombination frequency. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Cell-penetrating peptide-driven Cre recombination in porcine primary cells and generation of marker-free pigs.

    Kang, Qianqian; Sun, Zhaolin; Zou, Zhiyuan; Wang, Ming; Li, Qiuyan; Hu, Xiaoxiang; Li, Ning

    2018-01-01

    Cell-penetrating peptides (CPPs) have been increasingly used to deliver various molecules, both in vitro and in vivo. However, there are no reports of CPPs being used in porcine fetal fibroblasts (PFFs). The increased use of transgenic pigs for basic research and biomedical applications depends on the availability of technologies for efficient genetic-modification of PFFs. Here, we report that three CPPs (CPP5, TAT, and R9) can efficiently deliver active Cre recombinase protein into PFFs via an energy-dependent endocytosis pathway. The three CPP-Cre proteins can enter PFFs and subsequently perform recombination with different efficiencies. The recombination efficacy of CPP5-Cre was found to be nearly 90%. The rate-limiting step for CPP-Cre-mediated recombination was the step of endosome escape. HA2 and chloroquine were found to improve the recombination efficiency of TAT-Cre. Furthermore, we successfully obtained marker-free transgenic pigs using TAT-Cre and CPP5-Cre. We provide a framework for the development of CPP-based farm animal transgenic technologies that would be beneficial to agriculture and biomedicine.

  11. Bypass of lethality with mosaic mice generated by Cre-loxP-mediated recombination.

    Betz, U A; Vosshenrich, C A; Rajewsky, K; Müller, W

    1996-10-01

    The analysis of gene function based on the generation of mutant mice by homologous recombination in embryonic stem cells is limited if gene disruption results in embryonic lethality. Mosaic mice, which contain a certain proportion of mutant cells in all organs, allow lethality to be circumvented and the potential of mutant cells to contribute to different cell lineages to be analyzed. To generate mosaic animals, we used the bacteriophage P1-derived Cre-loxP recombination system, which allows gene alteration by Cre-mediated deletion of loxP-flanked gene segments. We generated nestin-cre transgenic mouse lines, which expressed the Cre recombinase under the control of the rat nestin promoter and its second intron enhancer. In crosses to animals carrying a loxP-flanked target gene, partial deletion of the loxP-flanked allele occurred before day 10.5 post coitum and was detectable in all adult organs examined, including germ-line cells. Using this approach, we generated mosaic mice containing cells deficient in the gamma-chain of the interleukin-2 receptor (IL-2R gamma); in these animals, the IL-2R gamma-deficient cells were underrepresented in the thymus and spleen. Because mice deficient in DNA polymerase beta die perinatally, we studied the effects of DNA polymerase beta deficiency in mosaic animals. We found that some of the mosaic polymerase beta-deficient animals were viable, but were often reduced in size and weight. The fraction of DNA polymerase beta-deficient cells in mosaic embryos decreased during embryonic development, presumably because wild-type cells had a competitive advantage. The nestin-cre transgenic mice can be used to generate mosaic animals in which target genes are mutated by Cre-mediated recombination of loxP-flanked target genes. By using mosaic animals, embryonic lethality can be bypassed and cell lineages for whose development a given target gene is critical can be identified. In the case of DNA polymerase beta, deficient cells are already

  12. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  13. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  14. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  15. The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the Rosa(Notch) Allele.

    Zanotti, Stefano; Canalis, Ernesto

    2016-05-01

    Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch)) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. © 2015 Wiley Periodicals, Inc.

  16. Silencing inhibits Cre-mediated recombination of the Z/AP and Z/EG reporters in adult cells.

    Michael A Long

    Full Text Available BACKGROUND: The Cre-loxP system has been used to enable tissue specific activation, inactivation and mutation of many genes in vivo and has thereby greatly facilitated the genetic dissection of several cellular and developmental processes. In such studies, Cre-reporter strains, which carry a Cre-activated marker gene, are frequently utilized to validate the expression profile of Cre transgenes, to act as a surrogate marker for excision of a second allele, and to irreversibly label cells for lineage tracing experiments. PRINCIPAL FINDINGS: We have studied three commonly used Cre-reporter strains, Z/AP, Z/EG and R26R-EYFP and have demonstrated that although each reporter can be reliably activated by Cre during early development, exposure to Cre in adult hematopoietic cells results in a much lower frequency of marker-positive cells in the Z/AP or Z/EG strains than in the R26R-EYFP strain. In marker negative cells derived from the Z/AP and Z/EG strains, the transgenic promoter is methylated and Cre-mediated recombination of the locus is inhibited. CONCLUSIONS: These results show that the efficiency of Cre-mediated recombination is not only dependent on the genomic context of a given loxP-flanked sequence, but also on stochastic epigenetic mechanisms underlying transgene variegation. Furthermore, our data highlights the potential shortcomings of utilizing the Z/AP and Z/EG reporters as surrogate markers of excision or in lineage tracing experiments.

  17. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  18. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  19. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  20. Agreement of quadratic and CRE models in predicting the late effects of continuous low dose-rate radiotherapy; and reply

    O'Donoghue, J.A.

    1986-01-01

    These letters discuss the problems associated with the fact that the normal tissue isoeffect formulae based on the Ellis equation (1969) do not correctly account for the late-occurring effects of fractionated radiotherapy, and with the extension of the linear quadratic model to include continuous low dose-rate radiotherapy with constant or decaying sources by R.G. Dale (1985). J.A. O'Donoghue points out that the 'late effects' and CRE curves correspond closely, whilst the 'acute effects; and CRE curves are in obvious disagreement. For continuous low-dose-rate radiotherapy, the CRE and late effects quadratic model are in agreement. Useful bibliography. (U.K.)

  1. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  2. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  3. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  4. Simultaneous and Sequential Integration by Cre/loxP Site-Specific Recombination in Saccharomyces cerevisiae.

    Choi, Ho-Jung; Kim, Yeon-Hee

    2018-05-28

    A Cre/ loxP -δ-integration system was developed to allow sequential and simultaneous integration of a multiple gene expression cassette in Saccharomyces cerevisiae . To allow repeated integrations, the reusable Candida glabrata MARKER ( CgMARKER ) carrying loxP sequences was used, and the integrated CgMARKER was efficiently removed by inducing Cre recombinase. The XYLP and XYLB genes encoding endoxylanase and β-xylosidase, respectively, were used as model genes for xylan metabolism in this system, and the copy number of these genes was increased to 15.8 and 16.9 copies/cell, respectively, by repeated integration. This integration system is a promising approach for the easy construction of yeast strains with enhanced metabolic pathways through multicopy gene expression.

  5. CRE deliberation concerning balancing regime developments for the natural gas transmission network in France

    2006-06-01

    GRTgaz has presented a project of progressive changeover to a new market-based balancing system, according to the following principles: quantities of gas required to ensure transmission network balancing are purchased from or sold on the daily and intra-day market by transmission system operators (TSOs); a daily gas balancing price reflecting actual costs borne by every TSO is defined according to these purchases and sales; every day, each shipper residual position after use of the available flexibility and tolerance, is cleared off by transactions at the daily balancing gas price, under terms encouraging shippers to minimise their imbalance. In order to incorporate current development of the French market, which still has low liquidity, GRTgaz proposes to progressively develop the volume of its market transactions. Within this context, from 4 May to 6 June 2006, CRE organised a public consultation concerning balancing regime developments, a summary of which is presented. The last part concerns the CRE decisions. (A.L.B.)

  6. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Being a Learner Using Social Media in School: The Case of Space2cre8

    Vasbø, Kristin Beate; Silseth, Kenneth; Erstad, Ola

    2014-01-01

    The aim of this article is to gain knowledge about what it means to be a learner using social media in an educational setting. The article presents an ethnographic study of students in a multiethnic community in Oslo who participate in a social networking site called Space2cre8 (S28). In this article, we set out to explore the kind of space for…

  8. Ins1 Cre knock-in mice for beta cell-specific gene recombination

    Thorens Bernard; Tarussio David; Maestro Miguel Angel; Maestro Miguel Angel; Rovira Meritxell; Rovira Meritxell; Heikkilä Eija; Ferrer Jorge; Ferrer Jorge; Ferrer Jorge

    2013-01-01

    Aims/hypothesis Pancreatic beta cells play a central role in the control of glucose homeostasis by secreting insulin to stimulate glucose uptake by peripheral tissues. Understanding the molecular mechanisms that control beta cell function and plasticity has critical implications for the pathophysiology and therapy of major forms of diabetes. Selective gene inactivation in pancreatic beta cells, using the Cre-lox system, is a powerful approach to assess the role of particular genes in beta cel...

  9. Tracing notochord-derived cells using a Noto-cre mouse: implications for intervertebral disc development.

    McCann, Matthew R; Tamplin, Owen J; Rossant, Janet; Séguin, Cheryle A

    2012-01-01

    Back pain related to intervertebral disc degeneration is the most common musculoskeletal problem, with a lifetime prevalence of 82%. The lack of effective treatment for this widespread problem is directly related to our limited understanding of disc development, maintenance and degeneration. The aim of this study was to determine the developmental origins of nucleus pulposus cells within the intervertebral disc using a novel notochord-specific Cre mouse. To trace the fate of notochordal cells within the intervertebral disc, we derived a notochord-specific Cre mouse line by targeting the homeobox gene Noto. Expression of this gene is restricted to the node and the posterior notochord during gastrulation [embryonic day 7.5 (E7.5)-E12.5]. The Noto-cre mice were crossed with a conditional lacZ reporter for visualization of notochord fate in whole-mount embryos. We performed lineage-tracing experiments to examine the contribution of the notochord to spinal development from E12.5 through to skeletally mature mice (9 months). Fate mapping studies demonstrated that, following elongation and formation of the primitive axial skeleton, the notochord gives rise to the nucleus pulposus in fully formed intervertebral discs. Cellular localization of β-galactosidase (encoded by lacZ) and cytokeratin-8 demonstrated that both notochordal cells and chondrocyte-like nucleus pulposus cells are derived from the embryonic notochord. These studies establish conclusively that notochordal cells act as embryonic precursors to all cells found within the nucleus pulposus of the mature intervertebral disc. This suggests that notochordal cells might serve as tissue-specific progenitor cells within the disc and establishes the Noto-cre mouse as a unique tool to interrogate the contribution of notochordal cells to both intervertebral disc development and disc degeneration.

  10. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  11. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  12. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  13. Unexpected Cartilage Phenotype in CD4-Cre-Conditional SOS-Deficient Mice.

    Guittard, Geoffrey; Gallardo, Devorah L; Li, Wenmei; Melis, Nicolas; Lui, Julian C; Kortum, Robert L; Shakarishvili, Nicholas G; Huh, Sunmee; Baron, Jeffrey; Weigert, Roberto; Kramer, Joshua A; Samelson, Lawrence E; Sommers, Connie L

    2017-01-01

    RAS signaling is central to many cellular processes and SOS proteins promote RAS activation. To investigate the role of SOS proteins in T cell biology, we crossed Sos1 f/f Sos2 -/- mice to CD4-Cre transgenic mice. We previously reported an effect of these mutations on T cell signaling and T cell migration. Unexpectedly, we observed nodules on the joints of greater than 90% of these mutant mice at 5 months of age, especially on the carpal joints. As the mice aged further, some also displayed joint stiffness, hind limb paralysis, and lameness. Histological analysis indicated that the abnormal growth in joints originated from dysplastic chondrocytes. Second harmonic generation imaging of the carpal nodules revealed that nodules were encased by rich collagen fibrous networks. Nodules formed in mice also deficient in RAG2, indicating that conventional T cells, which undergo rearrangement of the T cell antigen receptor, are not required for this phenotype. CD4-Cre expression in a subset of cells, either immune lineage cells (e.g., non-conventional T cells) or non-immune lineage cells (e.g., chondrocytes) likely mediates the dramatic phenotype observed in this study. Disruptions of genes in the RAS signaling pathway are especially likely to cause this phenotype. These results also serve as a cautionary tale to those intending to use CD4-Cre transgenic mice to specifically delete genes in conventional T cells.

  14. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  15. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  16. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  17. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  18. Unintended targeting of Dmp1-Cre reveals a critical role for Bmpr1a signaling in the gastrointestinal mesenchyme of adult mice.

    Lim, Joohyun; Burclaff, Joseph; He, Guangxu; Mills, Jason C; Long, Fanxin

    2017-01-01

    Cre/loxP technology has been widely used to study cell type-specific functions of genes. Proper interpretation of such data critically depends on a clear understanding of the tissue specificity of Cre expression. The Dmp1-Cre mouse, expressing Cre from a 14-kb DNA fragment of the mouse Dmp1 gene, has become a common tool for studying gene function in osteocytes, but the presumed cell specificity is yet to be fully established. By using the Ai9 reporter line that expresses a red fluorescent protein upon Cre recombination, we find that in 2-month-old mice, Dmp1-Cre targets not only osteocytes within the bone matrix but also osteoblasts on the bone surface and preosteoblasts at the metaphyseal chondro-osseous junction. In the bone marrow, Cre activity is evident in certain stromal cells adjacent to the blood vessels, but not in adipocytes. Outside the skeleton, Dmp1-Cre marks not only the skeletal muscle fibers, certain cells in the cerebellum and the hindbrain but also gastric and intestinal mesenchymal cells that express Pdgfra . Confirming the utility of Dmp1-Cre in the gastrointestinal mesenchyme, deletion of Bmpr1a with Dmp1-Cre causes numerous large polyps along the gastrointestinal tract, consistent with prior work involving inhibition of BMP signaling. Thus, caution needs to be exercised when using Dmp1-Cre because it targets not only the osteoblast lineage at an earlier stage than previously appreciated, but also a number of non-skeletal cell types.

  19. Cre recombinase expression or topical tamoxifen treatment do not affect retinal structure and function, neuronal vulnerability or glial reactivity in the mouse eye.

    Boneva, S K; Groß, T R; Schlecht, A; Schmitt, S I; Sippl, C; Jägle, H; Volz, C; Neueder, A; Tamm, E R; Braunger, B M

    2016-06-14

    Mice with a constitutive or tamoxifen-induced Cre recombinase (Cre) expression are frequently used research tools to allow the conditional deletion of target genes via the Cre-loxP system. Here we analyzed for the first time in a comprehensive and comparative way, whether retinal Cre expression or topical tamoxifen treatment itself would cause structural or functional changes, including changes in the expression profiles of molecular markers, glial reactivity and photoreceptor vulnerability. To this end, we characterized the transgenic α-Cre, Lmop-Cre and the tamoxifen-inducible CAGG-CreER™ mouse lines, all having robust Cre expression in the neuronal retina. In addition, we characterized the effects of topical tamoxifen treatment itself in wildtype mice. We performed morphometric analyses, immunohistochemical staining, in vivo ERG and angiography analyses and realtime RT-PCR analyses. Furthermore, the influence of Cre recombinase or topical tamoxifen exposure on neuronal vulnerability was studied by using light damage as a model for photoreceptor degeneration. Taken together, neither the expression of Cre, nor topical tamoxifen treatment caused detectable changes in retinal structure and function, the expression profiles of investigated molecular markers, glial reactivity and photoreceptor vulnerability. We conclude that the Cre-loxP system and its induction through tamoxifen is a safe and reliable method to delete desired target genes in the neural retina. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  20. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  1. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice [version 1; referees: 2 approved

    Jan Winchenbach

    2016-12-01

    Full Text Available Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.

  2. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  3. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  4. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

    Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

    2016-07-01

    Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre

  6. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  7. Fabp4-Cre-mediated Sirt6 deletion impairs adipose tissue function and metabolic homeostasis in mice.

    Xiong, Xiwen; Zhang, Cuicui; Zhang, Yang; Fan, Rui; Qian, Xinlai; Dong, X Charlie

    2017-06-01

    SIRT6 is a member of sirtuin family of deacetylases involved in diverse processes including genome stability, metabolic homeostasis and anti-inflammation. However, its function in the adipose tissue is not well understood. To examine the metabolic function of SIRT6 in the adipose tissue, we generated two mouse models that are deficient in Sirt6 using the Cre-lox approach. Two commonly used Cre lines that are driven by either the mouse Fabp4 or Adipoq gene promoter were chosen for this study. The Sirt6- knockout mice generated by the Fabp4-Cre line ( Sirt6 f/f : Fabp4-Cre) had a significant increase in both body weight and fat mass and exhibited glucose intolerance and insulin resistance as compared with the control wild-type mice. At the molecular levels, the Sirt6 f/f :Fabp4-Cre-knockout mice had increased expression of inflammatory genes including F4/80, TNFα, IL-6 and MCP-1 in both white and brown adipose tissues. Moreover, the knockout mice showed decreased expression of the adiponectin gene in the white adipose tissue and UCP1 in the brown adipose tissue, respectively. In contrast, the Sirt6 knockout mice generated by the Adipoq-Cre line ( Sirt6 f/f :Adipoq-Cre) only had modest insulin resistance. In conclusion, our data suggest that the function of SIRT6 in the Fabp4-Cre-expressing cells in addition to mature adipocytes plays a critical role in body weight maintenance and metabolic homeostasis. © 2017 Society for Endocrinology.

  8. Conditional and inducible transgene expression in endothelial and hematopoietic cells using Cre/loxP and tetracycline-off systems.

    Liu, Ju; Deutsch, Urban; Fung, Iris; Lobe, Corrinne G

    2014-11-01

    In the present study, the tetracycline-off and Cre/ loxP systems were combined to gain temporal and spatial control of transgene expression. Mice were generated that carried three transgenes: Tie2-tTA, tet-O-Cre and either the ZEG or ZAP reporter. Tie2-tTA directs expression of tetracycline-controlled transactivator (tTA) in endothelial and hematopoietic cells under the control of the Tie2 promoter. Tet-O-Cre produces Cre recombinase from a minimal promoter containing the tet-operator (tetO). ZEG or ZAP contains a strong promoter and a loxP -flanked stop sequence, followed by an enhanced green fluorescence protein (EGFP) or human placental alkaline phosphatase (hPLAP) reporter. In the presence of tetracycline, the tTA transactivator produced by Tie-2-tTA is disabled and Cre is not expressed. In the absence of tetracycline, the tTA binds tet-O-Cre to drive the expression of Cre, which recombines the loxP sites of the ZEG or ZAP transgene and results in reporter gene expression. In the present study, the expression of the ZEG or ZAP reporter genes in embryos and adult animals with and without tetracycline treatment was examined. In the presence of tetracycline, no reporter gene expression was observed. When tetracycline was withdrawn, Cre excision was activated and the reporter genes were detected in endothelial and hematopoietic cells. These results demonstrate that this system may be used to bypass embryonic lethality and access adult phenotypes.

  9. Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-Out System

    Czarneski, Jennifer

    2000-01-01

    .... Mice that carried the Mtv-17 Cre fusion vector would then be mated to mice that had the p53 locus flanked by loxP sites, resulting in the tissue-specific loss of p53 in the mammary gland only. The prediction is that these animals would only develop mammary and not other tumors. We believed that the cre-transgenic mice would also prove useful for other investigators in the mammary gland development and tumorigenesis field.

  10. Cre/lox-based multiple markerless gene disruption in the genome of the extreme thermophile Thermus thermophilus.

    Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro

    2018-02-01

    Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.

  11. Efficient delivery of Cre-recombinase to neurons in vivo and stable transduction of neurons using adeno-associated and lentiviral vectors

    Sablitzky Fred

    2004-01-01

    Full Text Available Abstract Background Inactivating genes in vivo is an important technique for establishing their function in the adult nervous system. Unfortunately, conventional knockout mice may suffer from several limitations including embryonic or perinatal lethality and the compensatory regulation of other genes. One approach to producing conditional activation or inactivation of genes involves the use of Cre recombinase to remove loxP-flanked segments of DNA. We have studied the effects of delivering Cre to the hippocampus and neocortex of adult mice by injecting replication-deficient adeno-associated virus (AAV and lentiviral (LV vectors into discrete regions of the forebrain. Results Recombinant AAV-Cre, AAV-GFP (green fluorescent protein and LV-Cre-EGFP (enhanced GFP were made with the transgene controlled by the cytomegalovirus promoter. Infecting 293T cells in vitro with AAV-Cre and LV-Cre-EGFP resulted in transduction of most cells as shown by GFP fluorescence and Cre immunoreactivity. Injections of submicrolitre quantities of LV-Cre-EGFP and mixtures of AAV-Cre with AAV-GFP into the neocortex and hippocampus of adult Rosa26 reporter mice resulted in strong Cre and GFP expression in the dentate gyrus and moderate to strong labelling in specific regions of the hippocampus and in the neocortex, mainly in neurons. The pattern of expression of Cre and GFP obtained with AAV and LV vectors was very similar. X-gal staining showed that Cre-mediated recombination had occurred in neurons in the same regions of the brain, starting at 3 days post-injection. No obvious toxic effects of Cre expression were detected even after four weeks post-injection. Conclusion AAV and LV vectors are capable of delivering Cre to neurons in discrete regions of the adult mouse brain and producing recombination.

  12. An Lck-cre transgene accelerates autoantibody production and lupus development in (NZB × NZW)F1 mice.

    Nelson, R K; Gould, K A

    2016-02-01

    Lupus is an autoimmune disease characterized by the development of antinuclear autoantibodies and immune complex-mediated tissue damage. T cells in lupus patients appear to undergo apoptosis at an increased rate, and this enhanced T cell apoptosis has been postulated to contribute to lupus pathogenesis by increasing autoantigen load. However, there is no direct evidence to support this hypothesis. In this study, we show that an Lck-cre transgene, which increases T cell apoptosis as a result of T cell-specific expression of cre recombinase, accelerates the development of autoantibodies and nephritis in lupus-prone (NZB × NZW)F1 mice. Although the enhanced T cell apoptosis in Lck-cre transgenic mice resulted in an overall decrease in the relative abundance of splenic CD4(+) and CD8(+) T cells, the proportion of activated CD4(+) T cells was increased and no significant change was observed in the relative abundance of suppressive T cells. We postulate that the Lck-cre transgene promoted lupus by enhancing T cell apoptosis, which, in conjunction with the impaired clearance of apoptotic cells in lupus-prone mice, increased the nuclear antigen load and accelerated the development of anti-nuclear autoantibodies. Furthermore, our results also underscore the importance of including cre-only controls in studies using the cre-lox system. © The Author(s) 2015.

  13. Cre/lox-assisted non-invasive in vivo tracking of specific cell populations by positron emission tomography.

    Thunemann, Martin; Schörg, Barbara F; Feil, Susanne; Lin, Yun; Voelkl, Jakob; Golla, Matthias; Vachaviolos, Angelos; Kohlhofer, Ursula; Quintanilla-Martinez, Leticia; Olbrich, Marcus; Ehrlichmann, Walter; Reischl, Gerald; Griessinger, Christoph M; Langer, Harald F; Gawaz, Meinrad; Lang, Florian; Schäfers, Michael; Kneilling, Manfred; Pichler, Bernd J; Feil, Robert

    2017-09-05

    Many pathophysiological processes are associated with proliferation, migration or death of distinct cell populations. Monitoring specific cell types and their progeny in a non-invasive, longitudinal and quantitative manner is still challenging. Here we show a novel cell-tracking system that combines Cre/lox-assisted cell fate mapping with a thymidine kinase (sr39tk) reporter gene for cell detection by positron emission tomography (PET). We generate Rosa26-mT/sr39tk PET reporter mice and induce sr39tk expression in platelets, T lymphocytes or cardiomyocytes. As proof of concept, we demonstrate that our mouse model permits longitudinal PET imaging and quantification of T-cell homing during inflammation and cardiomyocyte viability after myocardial infarction. Moreover, Rosa26-mT/sr39tk mice are useful for whole-body characterization of transgenic Cre mice and to detect previously unknown Cre activity. We anticipate that the Cre-switchable PET reporter mice will be broadly applicable for non-invasive long-term tracking of selected cell populations in vivo.Non-invasive cell tracking is a powerful method to visualize cells in vivo under physiological and pathophysiological conditions. Here Thunemann et al. generate a mouse model for in vivo tracking and quantification of specific cell types by combining a PET reporter gene with Cre-dependent activation that can be exploited for any cell population for which a Cre mouse line is available.

  14. An Lck-cre transgene accelerates autoantibody production and lupus development in (NZB × NZW)F1 mice

    Nelson, Richard K.; Gould, Karen A.

    2015-01-01

    Lupus is an autoimmune disease characterized by the development of antinuclear autoantibodies and immune complex-mediated tissue damage. T cells in lupus patients appear to undergo apoptosis at an increased rate, and this enhanced T cell apoptosis has been postulated to contribute to lupus pathogenesis by increasing autoantigen load. However, there is no direct evidence to support this hypothesis. In this study, we show that an Lck-cre transgene, which increases T cell apoptosis as a result of T cell specific expression of cre recombinase, accelerates the development of autoantibodies and nephritis in lupus-prone (NZB×NZW)F1 mice. Although the enhanced T cell apoptosis in Lck-cre transgenic mice resulted in an overall decrease in the relative abundance of splenic CD4+ and CD8+ T cells, the proportion of activated CD4+ T cells was increased and no significant change was observed in the relative abundance of suppressive T cells. We postulate that the Lck-cre transgene promoted lupus by enhancing T cells apoptosis, which, in conjunction with the impaired clearance of apoptotic cells in lupus-prone mice, increased the nuclear antigen load and accelerated the development of anti-nuclear autoantibodies. Furthermore, our results also underscore the importance of including cre-only controls in studies using the cre-lox system. PMID:26385218

  15. Site-specific modification of genome with cell-permeable Cre fusion protein in preimplantation mouse embryo

    Kim, Kyoungmi; Kim, Hwain; Lee, Daekee

    2009-01-01

    Site-specific recombination (SSR) by Cre recombinase and its target sequence, loxP, is a valuable tool in genetic analysis of gene function. Recently, several studies reported successful application of Cre fusion protein containing protein transduction peptide for inducing gene modification in various mammalian cells including ES cell as well as in the whole animal. In this study, we show that a short incubation of preimplantation mouse embryos with purified cell-permeable Cre fusion protein results in efficient SSR. X-Gal staining of preimplantation embryos, heterozygous for Gtrosa26 tm1Sor , revealed that treatment of 1-cell or 2-cell embryos with 3 μM of Cre fusion protein for 2 h leads to Cre-mediated excision in 70-85% of embryos. We have examined the effect of the concentration of the Cre fusion protein and the duration of the treatment on embryonic development, established a condition for full term development and survival to adulthood, and demonstrated the germ line transmission of excised Gtrosa26 allele. Potential applications and advantages of the highly efficient technique described here are discussed.

  16. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  18. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  19. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  20. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  1. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  2. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  3. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  4. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  5. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  6. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  7. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  8. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  9. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  10. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  11. lck-Driven Cre Expression Alters T Cell Development in the Thymus and the Frequencies and Functions of Peripheral T Cell Subsets.

    Carow, Berit; Gao, Yu; Coquet, Jonathan; Reilly, Marie; Rottenberg, Martin E

    2016-09-15

    Conditional gene targeting using the bacteriophage-derived Cre recombinase is widely applied for functional gene studies in mice. Mice transgenic for Cre under the control of the lck gene promoter are used to study the role of loxP-targeted genes in T cell development and function. In this article, we show a striking 65% reduction in cellularity, preferential development of γδ versus αβ T cells, and increased expression of IL-7R in the thymus of mice expressing Cre under the proximal lck promoter (lck-cre(+) mice). The transition from CD4/CD8 double-negative to double-positive cells was blocked, and lck-cre(+) double-positive cells were more prone to apoptosis and showed higher levels of Cre expression. Importantly, numbers of naive T cells were reduced in spleens and lymph nodes of lck-cre(+) mice. In contrast, frequencies of γδ T cells, CD44(+)CD62L(-) effector T cells, and Foxp3(+) regulatory T cells were elevated, as was the frequency of IFN-γ-secreting CD4(+) and CD8(+) T cells. A literature survey of 332 articles that used lck-cre(+) mice for deletion of floxed genes indicated that results are statistically influenced by the control used (lck-cre(+) or lck-cre(-)), more frequently resembling the lck-cre(+) phenotype described in this article if lck-cre(-) controls were used. Altogether, care should be taken when interpreting published results and to properly control targeted gene deletions using the lck-cre(+) strain. Copyright © 2016 by The American Association of Immunologists, Inc.

  12. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  13. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  14. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  15. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  16. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  17. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  18. Cre/lox Studies Identify Resident Macrophages as the Major Source of Circulating Coagulation Factor XIII-A.

    Beckers, Cora M L; Simpson, Kingsley R; Griffin, Kathryn J; Brown, Jane M; Cheah, Lih T; Smith, Kerrie A; Vacher, Jean; Cordell, Paul A; Kearney, Mark T; Grant, Peter J; Pease, Richard J

    2017-08-01

    To establish the cellular source of plasma factor (F)XIII-A. A novel mouse floxed for the F13a1 gene, FXIII-A flox/flox (Flox), was crossed with myeloid- and platelet-cre-expressing mice, and cellular FXIII-A mRNA expression and plasma and platelet FXIII-A levels were measured. The platelet factor 4-cre.Flox cross abolished platelet FXIII-A and reduced plasma FXIII-A to 23±3% ( P cre on plasma FXIII-A was exerted outside of the megakaryocyte lineage because plasma FXIII-A was not reduced in the Mpl -/- mouse, despite marked thrombocytopenia. In support of this, platelet factor 4-cre depleted FXIII-A mRNA in brain, aorta, and heart of floxed mice, where FXIII-A pos cells were identified as macrophages as they costained with CD163. In the integrin αM-cre.Flox and the double copy lysozyme 2-cre.cre.Flox crosses, plasma FXIII-A was reduced to, respectively, 75±5% ( P =0.003) and 30±7% ( P <0.001), with no change in FXIII-A content per platelet, further consistent with a macrophage origin of plasma FXIII-A. The change in plasma FXIII-A levels across the various mouse genotypes mirrored the change in FXIII-A mRNA expression in aorta. Bone marrow transplantation of FXIII-A +/+ bone marrow into FXIII-A -/- mice both restored plasma FXIII-A to normal levels and replaced aortic and cardiac FXIII-A mRNA, while its transplantation into FXIII-A +/+ mice did not increase plasma FXIII-A levels, suggesting that a limited population of niches exists that support FXIII-A-releasing cells. This work suggests that resident macrophages maintain plasma FXIII-A and exclude the platelet lineage as a major contributor. © 2017 The Authors.

  19. The electricity bill may rise by 30% between now and 2017, according to the CRE

    Anon.

    2013-01-01

    The CRE (French Regulatory Commission for Electricity) expects a rise of 30% in the electricity price for households in the next five years in France, the rise would only be of 16% for enterprises. The study shows that one third of this rise is due to the contribution to the public service of electricity whose main purpose is to finance the development of renewable energies. The rise will also cover the investments that have to be made in the power grid and in the means of production of electricity. (A.C.)

  20. A T-cell specific transcriptional enhancer element 3' of Cα in the human T-cell receptor α locus

    Ho, Icheng; Yang, Lihsuan; Morle, G.; Leiden, J.M.

    1989-01-01

    A transcriptional enhancer element has been identified 4.5 kilobases 3' of C α (constant region α chain) in the human T-cell receptor (TCR) α-chain locus. This enhancer is active on both a TCR V α (variable region α chain) promoter and the minimal simian virus 40 promoter in TCR α/β Jurkat and EL4 cells but is inactive on a V α promoter TCR γ/δ PEER and Molt-13 cells, clone 13 B cells, and HeLa fibroblasts. The enhancer has been localized to a 116-base-pair BstXI/Dra I restriction enzyme fragment, which lacks immunoglobulin octamer and κB enhancer motifs but does contain a consensus cAMP-response element (CRE). DNase I footprint analyses demonstrated that the minimal enhancer contains two binding sites for Jurkat nuclear proteins. One of these sites corresponds to the CRE, while the other does not correspond to a known transcriptional enhancer motif. These data support a model in which TCR α gene transcription is regulated by a unique set of cis-acting sequences and trans-acting factors, which are differentially active in cells of the TCR α/β lineage. In addition, the TCR α enhancer may play a role in activating oncogene expression in T-lymphoblastoid tumors that have previously been shown to display chromosomal translocations into the human TCR α locus

  1. Carbapenem-resistant Enterobacteriaceae colonization (CRE) and subsequent risk of infection and 90-day mortality in critically ill patients, an observational study.

    McConville, Thomas Howe; Sullivan, Sean Berger; Gomez-Simmonds, Angela; Whittier, Susan; Uhlemann, Anne-Catrin

    2017-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) have emerged as an urgent public health threat. Intestinal colonization with CRE has been identified as a risk factor for the development of systemic CRE infection, but has not been compared to colonization with third and/or fourth generation cephalosporin-resistant (Ceph-R) Enterobacteriaceae. Moreover, the risk conferred by colonization on adverse outcomes is less clear, particularly in critically ill patients admitted to the intensive care unit (ICU). We carried out a cohort study of consecutive adult patients screened for rectal colonization with CRE or Ceph-R upon ICU entry between April and July 2013. We identified clinical variables and assessed the relationship between CRE or Ceph-R colonization and subsequent systemic CRE infection within 30 days (primary outcome) and all-cause mortality within 90 days (secondary outcome). Among 338 ICU patients, 94 (28%) were colonized with either Ceph-R or CRE. 26 patients developed CRE infection within 30 days of swab collection; 47% (N = 17/36) of CRE-colonized and 3% (N = 2/58) of Ceph-R colonized patients. 36% (N = 13/36) of CRE-colonized patients died within 90 days compared to 31% (N = 18/58) of Ceph-R-colonized and 15% (N = 37/244) of non-colonized patients. In a multivariable analysis, CRE colonization independently predicted development of a systemic CRE infection at 30 days (aOR 10.8, 95% CI2.8-41.9, p = 0.0006); Ceph-R colonization did not (aOR 0.5, 95% CI0.1-3.3, p = 0.5). CRE colonization was associated with increased 90-day mortality in a univariable analysis (p-value 0.001), in a multivariable model, previous hospitalization and medical ICU admission were independent predictors of 90-day mortality whereas CRE colonization approached significance (aOR 2.3, 95% CI1.0-5.3, p = 0.056). Our study highlights the increased risk of CRE infection and mortality in patients with CRE colonization at the time of ICU admission. Future studies are needed to assess how CRE

  2. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  3. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  4. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  5. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  6. Cloning-free genome engineering in Sinorhizobium meliloti advances applications of Cre/loxP site-specific recombination.

    Döhlemann, Johannes; Brennecke, Meike; Becker, Anke

    2016-09-10

    The soil-dwelling α-proteobacterium Sinorhizobium meliloti serves as model for studies of symbiotic nitrogen fixation, a highly important process in sustainable agriculture. Here, we report advancements of the genetic toolbox accelerating genome editing in S. meliloti. The hsdMSR operon encodes a type-I restriction-modification (R-M) system. Transformation of S. meliloti is counteracted by the restriction endonuclease HsdR degrading DNA which lacks the appropriate methylation pattern. We provide a stable S. meliloti hsdR deletion mutant showing enhanced transformation with Escherichia coli-derived plasmid DNA and demonstrate that using an E. coli plasmid donor, expressing S. meliloti methyl transferase genes, is an alternative strategy of increasing the transformation efficiency of S. meliloti. Furthermore, we devise a novel cloning-free genome editing (CFGE) method for S. meliloti, Agrobacterium tumefaciens and Xanthomonas campestris, and demonstrate the applicability of this method for intricate applications of the Cre/lox recombination system in S. meliloti. An enhanced Cre/lox system, allowing for serial deletions of large genomic regions, was established. An assay of lox spacer mutants identified a set of lox sites mediating specific recombination. The availability of several non-promiscuous Cre recognition sites enables simultaneous specific Cre/lox recombination events. CFGE combined with Cre/lox recombination is put forward as powerful approach for targeted genome editing, involving serial steps of manipulation to expedite the genetic accessibility of S. meliloti as chassis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. R/L, a double reporter mouse line that expresses luciferase gene upon Cre-mediated excision, followed by inactivation of mRFP expression.

    Jia, Junshuang; Lin, Xiaolin; Lin, Xia; Lin, Taoyan; Chen, Bangzhu; Hao, Weichao; Cheng, Yushuang; Liu, Yu; Dian, Meijuan; Yao, Kaitai; Xiao, Dong; Gu, Weiwang

    2016-10-01

    The Cre/loxP system has become an important tool for the conditional gene knockout and conditional gene expression in genetically engineered mice. The applications of this system depend on transgenic reporter mouse lines that provide Cre recombinase activity with a defined cell type-, tissue-, or developmental stage-specificity. To develop a sensitive assay for monitoring Cre-mediated DNA excisions in mice, we generated Cre-mediated excision reporter mice, designated R/L mice (R/L: mRFP(monomeric red fluorescent protein)/luciferase), express mRFP throughout embryonic development and adult stages, while Cre-mediated excision deletes a loxP-flanked mRFP reporter gene and STOP sequence, thereby activating the expression of the second reporter gene luciferase, as assayed by in vivo and ex vivo bioluminescence imaging. After germ line deletion of the floxed mRFP and STOP sequence in R/L mice by EIIa-Cre mice, the resulting luciferase transgenic mice in which the loxP-mRFP-STOP-loxP cassette is excised from all cells express luciferase in all tissues and organs examined. The expression of luciferase transgene was activated in liver of RL/Alb-Cre double transgenic mice and in brain of RL/Nestin-Cre double transgenic mice when R/L reporter mice were mated with Alb-Cre mice and Nestin-Cre mice, respectively. Our findings reveal that the double reporter R/L mouse line is able to indicate the occurrence of Cre-mediated excision from early embryonic to adult lineages. Taken together, these findings demonstrate that the R/L mice serve as a sensitive reporter for Cre-mediated DNA excision both in living animals and in organs, tissues, and cells following necropsy.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  9. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  10. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  11. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  12. Sensitivity of TDF and CRE to variations in exponents of N and T

    Orton, C.G.

    1976-01-01

    A typical example is given of the calculation by two methods of the value of the radiation dose given in 20 treatments at 5 fractions per week to be equivalent to 6000 rad given in 30 treatments also at 5 fractions per week. The solutions obtained were identical and demonstrated that, in normal clinical practice, whatever values are chosen for the exponents of N and T in the basic NSD equation, the CRE (Kirk, J., Gray, W.M., and Watson, E.R., 1971, Clinical Radiology, vol. 22, 145) and TDF (Orton, C.G., and Ellis, F., 1973, Br. J. Radiol., vol. 46, 529) methods are exactly equivalent. The variations in the values calculated by the TDF method of the dose/fraction in the same example for differing values of the exponents of N and T were typically less than +- 3%, and even for more drastic changes a variation of less than 5% resulted. The TDF and CRE methods are not therefore very sensitive to changes in these exponents. It is emphasized that since CREs are not linearly additive, application of the TDF method greatly reduces the probability of arithmetical error, particularly for more complex treatment regimes. The TDF method should however be applied with great caution if the time, dose or fractionation differ significantly from that used in conventional radiotherapeutic practice, since the theory was based on clinical evidence obtained by retrospective analysis of typical radiotherapy data. (U.K.)

  13. Sensitivity of TDF and CRE to variations in exponents of N and T

    Orton, C G [Rhode Island Hospital, Providence (USA). Dept. of Radiation Oncology

    1976-10-01

    A typical example is given of the calculation by two methods of the value of the radiation dose given in 20 treatments at 5 fractions per week to be equivalent to 6000 rad given in 30 treatments also at 5 fractions per week. The solutions obtained were identical and demonstrated that, in normal clinical practice, whatever values are chosen for the exponents of N and T in the basic NSD equation, the CRE (Kirk, J., Gray, W.M., and Watson, E.R., 1971, Clinical Radiology, vol. 22, 145) and TDF (Orton, C.G., and Ellis, F., 1973, Br. J. Radiol., vol. 46, 529) methods are exactly equivalent. The variations in the values calculated by the TDF method of the dose/fraction in the same example for differing values of the exponents of N and T were typically less than +- 3%, and even for more drastic changes a variation of less than 5% resulted. The TDF and CRE methods are not therefore very sensitive to changes in these exponents. It is emphasized that since CREs are not linearly additive, application of the TDF method greatly reduces the probability of arithmetical error, particularly for more complex treatment regimes. The TDF method should however be applied with great caution if the time, dose or fractionation differ significantly from that used in conventional radiotherapeutic practice, since the theory was based on clinical evidence obtained by retrospective analysis of typical radiotherapy data.

  14. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  15. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  16. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  17. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  18. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  19. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  20. Development of CRTEIL and CETRIZ, Cre-loxP-Based Systems, Which Allow Change of Expression of Red to Green or Green to Red Fluorescence upon Transfection with a Cre-Expression Vector

    Masato Ohtsuka

    2009-01-01

    Full Text Available We developed Cre-loxP-based systems, termed CRTEIL and CETRIZ, which allow gene switching in a noninvasive manner. Single transfection with pCRTEIL resulted in predominant expression of red fluorescence. Cotransfection with pCRTEIL and Cre-expression plasmid (pCAG/NCre caused switching from red to green fluorescence. Similarly, cotransfection with pCETRIZ and pCAG/NCre resulted in change of green to red fluorescence. These noninvasive systems will be useful in cell lineage analysis, since descendants of cells exhibiting newly activated gene expression can be continuously monitored in noninvasive fashion.

  1. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  2. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  3. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  4. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  5. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  6. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  7. Transient Cnp expression by early progenitors causes Cre-Lox-based reporter lines to map profoundly different fates.

    Tognatta, Reshmi; Sun, Wenjing; Goebbels, Sandra; Nave, Klaus-Armin; Nishiyama, Akiko; Schoch, Susanne; Dimou, Leda; Dietrich, Dirk

    2017-02-01

    NG2 expressing oligodendroglial precursor cells are ubiquitous in the central nervous system and the only cell type cycling throughout life. Previous fate mapping studies have remained inconsistent regarding the question whether NG2 cells are capable of generating certain types of neurons. Here, we use CNP-Cre mice to map the fate of a sub-population of NG2 cells assumed to be close to differentiation. When crossing these mice with the ROSA26/YFP Cre-reporter line we discovered large numbers of reporter-expressing pyramidal neurons in the piriform and dorsal cortex. In contrast, when using Z/EG reporter mice to track the fate of Cnp-expressing NG2 cells only oligodendroglial cells were found reporter positive. Using BrdU-based birth dating protocols and inducible NG2CreER:ROSA26/YFP mice we show that YFP positive neurons are generated from radial glial cells and that these radial glial cells display temporary and low level activity of certain oligodendroglial genes sufficient to recombine the Cre-inducible reporter gene in ROSA26/YFP but not in Z/EG mice. Taken together, we did not obtain evidence for generation of neurons from NG2 cells. Our results suggest that with an appropriate reporter system Cnp activity can be used to define a proliferative subpopulation of NG2 cells committed to generate oligodendrocytes. However, the strikingly different results obtained from ROSA26/YFP versus Z/EG mice demonstrate that the choice of Cre-reporter line can be of crucial importance for fate mapping studies and other applications of the Cre-lox technology. GLIA 2017;65:342-359. © 2016 Wiley Periodicals, Inc.

  8. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  9. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  10. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  11. Hemizygous Le-Cre Transgenic Mice Have Severe Eye Abnormalities on Some Genetic Backgrounds in the Absence of LoxP Sites

    Dorà, Natalie J.; Collinson, J. Martin; Hill, Robert E.; West, John D.

    2014-01-01

    Eye phenotypes were investigated in Le-CreTg/−; Pax6fl/+ mice, which were expected to show tissue-specific reduction of Pax6 in surface ectoderm derivatives. To provide a better comparison with our previous studies of Pax6+/− eye phenotypes, hemizygous Le-CreTg/− and heterozygous Pax6fl/+mice were crossed onto the CBA/Ca genetic background. After the Le-Cre transgene had been backcrossed to CBA/Ca for seven generations, significant eye abnormalities occurred in some hemizygous Le-CreTg/−; Pax6+/+ controls (without a floxed Pax6fl allele) as well as experimental Le-CreTg/−; Pax6fl/+ mice. However, no abnormalities were seen in Le-Cre−/−; Pax6fl/+ or Le-Cre−/−; Pax6+/+ controls (without the Le-Cre transgene). The severity and frequency of the eye abnormalities in Le-CreTg/−; Pax6+/+ control mice diminished after backcrossing Le-CreTg/− mice to the original FVB/N strain for two generations, showing that the effect was reversible. This genetic background effect suggests that the eye abnormalities are a consequence of an interaction between the Le-Cre transgene and alleles of unknown modifier genes present in certain genetic backgrounds. The abnormalities were also ameliorated by introducing additional Pax6 gene copies on a CBA/Ca background, suggesting involvement of Pax6 depletion in Le-CreTg/−; Pax6+/+ mice rather than direct action of Cre recombinase on cryptic pseudo-loxP sites. One possibility is that expression of Cre recombinase from the Pax6-Le regulatory sequences in the Le-Cre transgene depletes cofactors required for endogenous Pax6 gene expression. Our observation that eye abnormalities can occur in hemizygous Le-CreTg/−; Pax6+/+ mice, in the absence of a floxed allele, demonstrates the importance of including all the relevant genetic controls in Cre-loxP experiments. PMID:25272013

  12. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  13. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  14. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  15. Exploiting CReP for Knowledge Retrieval and Use in Complex Domains

    Manenti, Lorenza; Sartori, Fabio

    Case Based Reasoning (CBR) is a Knowledge Management approach that consists in the development of decision support systems where problem are solved by analogy with similar problem solved in the past. In this way, the system supports users in finding solutions without starting from scratch. CBR has become a very important research topic in Artificial Intelligence, with the definition of methodologies and architectural patterns for supporting developers in the design and implementation of case-based systems. The paper presents one of this frameworks, namely CReP, an on-going research project of the Artificial Intelligence Laboratory (L.Int.Ar.) of University of Milan-Bicocca, focusing on the integration between CBR paradigm and metadata approach to obtain domain-independent case structure and retrieval algorithm definition.

  16. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  17. What is the role of the consultant responsible for postgraduate education in the clinical department?

    Malling, B; Scherpbier, A J J A; Ringsted, C

    2007-01-01

    interviewees expressed a wish for a strong leader at the same time they did not consider the position of the CRE influential. CONCLUSION: Along with improved information about the role of the CRE, formal education, proper job-descriptions and clear leadership in the organisation concerning specialist training......BACKGROUND: The organisation of specialist training is complex and involves many clinical departments. The position of consultants responsible for education (CRE) in specialist training at department level is poorly defined in the literature. AIMS: The aim of the study was to explore expectations...... of stakeholders concerning the role and position of a CRE in specialist training. METHOD: The role and position of the CRE was explored using focus group and semi-structured individual interviews. RESULTS: Knowledge of tasks and responsibilities was limited in all stakeholders except among CREs. The expectations...

  18. A self-excising Cre recombinase allows efficient recombination of multiple ectopic heterospecific lox sites in transgenic tobacco

    Mlynarova, L.; Nap, J.P.H.

    2003-01-01

    To study the impact of different DNA configurations on the stability of transgene expression, a variant of the cre gene was developed. This variant allows for the highly efficient in planta removal of its own loxP-flanked coding sequence as well as other DNAs flanked by ectopic heterospecific lox

  19. Cre-mediated cell ablation contests mast cell contribution in models of antibody- and T cell-mediated autoimmunity.

    Feyerabend, Thorsten B; Weiser, Anne; Tietz, Annette; Stassen, Michael; Harris, Nicola; Kopf, Manfred; Radermacher, Peter; Möller, Peter; Benoist, Christophe; Mathis, Diane; Fehling, Hans Jörg; Rodewald, Hans-Reimer

    2011-11-23

    Immunological functions of mast cells remain poorly understood. Studies in Kit mutant mice suggest key roles for mast cells in certain antibody- and T cell-mediated autoimmune diseases. However, Kit mutations affect multiple cell types of both immune and nonimmune origin. Here, we show that targeted insertion of Cre-recombinase into the mast cell carboxypeptidase A3 locus deleted mast cells in connective and mucosal tissues by a genotoxic Trp53-dependent mechanism. Cre-mediated mast cell eradication (Cre-Master) mice had, with the exception of a lack of mast cells and reduced basophils, a normal immune system. Cre-Master mice were refractory to IgE-mediated anaphylaxis, and this defect was rescued by mast cell reconstitution. This mast cell-deficient strain was fully susceptible to antibody-induced autoimmune arthritis and to experimental autoimmune encephalomyelitis. Differences comparing Kit mutant mast cell deficiency models to selectively mast cell-deficient mice call for a systematic re-evaluation of immunological functions of mast cells beyond allergy. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.

    Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa

    2008-10-01

    A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.

  1. Spatial and temporal lineage analysis of a Pitx3-driven Cre-recombinase knock-in mouse model.

    Marten P Smidt

    Full Text Available Development and function of mesodiencephalic dopaminergic (mdDA neurons has received a lot of scientific interest since these neurons are critically involved in neurological diseases as Parkinson and psychiatric diseases as schizophrenia, depression and attention deficit hyperactivity disorder (ADHD. The understanding of the molecular processes that lead to normal development and function of mdDA neurons has provided insight in the pathology and provided critical information on new treatment paradigms. In order to be able to study specific genetic ablation in mdDA neurons a new tools was developed that drives Cre-recombinase under the control of the Pitx3 locus. The Pitx3 gene is well known for its specific expression in mdDA neurons and is present at the onset of terminal differentiation. Analysis of newly generated Pitx3-Cre knock-in mice shows that Cre expression, measured through the activation of eYfp by removal of a "Stop" signal (LoxP-Stop-LoxP-eYfp reporter mouse, is present at the onset of terminal differentiation and mimics closely the native Pitx3 expression domain. In conclusion, we present here a new Cre-driver mouse model to be used in the restricted ablation of interesting genes in mdDA neurons in order to improve our understanding of the underlying molecular programming.

  2. A non-specific effect associated with conditional transgene expression based on Cre-loxP strategy in mice.

    Linghua Qiu

    Full Text Available Transgenes flanked by loxP sites have been widely used to generate transgenic mice where the transgene expression can be controlled spatially and temporally by Cre recombinase. Data from this approach has led to important conclusions in cancer, neurodevelopment and neurodegeneration. Using this approach to conditionally express micro RNAs (miRNAs in mice, we found that Cre-mediated recombination in neural progenitor cells caused microcephaly in five of our ten independent transgenic lines. This effect was not associated with the types or the quantity of miRNAs being expressed, nor was it associated with specific target knockdown. Rather, it was correlated with the presence of multiple tandem transgene copies and inverted (head-to-head or tail-to-tail transgene repeats. The presence of these inverted repeats caused a high level of cell death in the ventricular zone of the embryonic brain, where Cre was expressed. Therefore, results from this Cre-loxP approach to generate inducible transgenic alleles must be interpreted with caution and conclusions drawn in previous reports may need reexamination.

  3. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  4. Down-regulation of Irf8 by Lyz2-cre/loxP accelerates osteoclast differentiation in vitro.

    Saito, Emi; Suzuki, Dai; Kurotaki, Daisuke; Mochizuki, Ayako; Manome, Yoko; Suzawa, Tetsuo; Toyoshima, Yoichi; Ichikawa, Takahiro; Funatsu, Takahiro; Inoue, Tomio; Takami, Masamichi; Tamura, Tomohiko; Inagaki, Katsunori; Kamijo, Ryutaro

    2017-06-01

    Interferon regulatory factor 8 (Irf8) is a transcription factor that negatively regulates osteoclast differentiation and Irf8 global knockout (Irf8 -/- ) mice have been shown to have reduced bone volume resulting from increased osteoclast numbers. However, detailed analysis of the functions of Irf8 in osteoclast precursors with a monocyte/macrophage linage is difficult, because the population and properties of hematopoietic cells in Irf8 -/- mice are severely altered. Therefore, to clearly elucidate the functions of Irf8 during osteoclastogenesis, we established myeloid cell-specific Irf8 conditional knockout (Irf8 fl/fl ;Lyz2 cre/+ ) mice. We found that trabecular bone volume in the Irf8 fl/fl ;Lyz2 cre/+ mice was not significantly affected, while exposure to M-CSF and RANKL significantly increased TRAP activity in vitro in osteoclasts that underwent osteoclastogenesis from bone marrow-derived macrophages (BMMs) induced from bone marrow cells (BMCs) of those mice by addition of M-CSF. Our results also showed that expression of Irf8 mRNA and protein in BMMs obtained from Irf8 fl/fl ;Lyz2 cre/+ mice and cultured with M-CSF was reduced. These findings predicted that Lyz2/Lyz2-cre expression is induced when BMCs differentiate into BMMs in cultures with M-CSF. In osteoclast differentiation cultures, Lyz2 was gradually increased by M-CSF during the first 3 days of culture, then rapidly decreased by the addition of RANKL with M-CSF during the next 3 days. Furthermore, BMCs differentiated into osteoclasts while maintaining a low level of Lyz2 expression when cultured simultaneously with both M-CSF and RANKL from the initiation of culture. These findings suggest that Lyz2-cre expression is induced along with differentiation to BMMs by BMCs obtained from Irf8 fl/fl ;Lyz2 cre/+ mice and cultured with M-CSF. In addition, Irf8 was down-regulated by activation of the cre/loxP recombination system in BMMs and osteoclastogenesis was accelerated. Based on our results, we propose

  5. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  7. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  8. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  9. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  10. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  11. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  12. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  13. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  15. Use of Cre/loxP recombination to swap cell binding motifs on the adenoviral capsid protein IX

    Poulin, Kathy L.; Tong, Grace; Vorobyova, Olga; Pool, Madeline; Kothary, Rashmi; Parks, Robin J.

    2011-01-01

    We used Cre/loxP recombination to swap targeting ligands present on the adenoviral capsid protein IX (pIX). A loxP-flanked sequence encoding poly-lysine (pK-binds heparan sulfate proteoglycans) was engineered onto the 3'-terminus of pIX, and the resulting fusion protein allowed for routine virus propagation. Growth of this virus on Cre-expressing cells removed the pK coding sequence, generating virus that could only infect through alternative ligands, such as a tyrosine kinase receptor A (TrkA)-binding motif engineered into the capsid fibre protein for enhanced infection of neuronal cells. We used a similar approach to swap the pK motif on pIX for a sequence encoding a single-domain antibody directed towards CD66c for targeted infection of cancer cells; Cre-mediated removal of the pK-coding sequence simultaneously placed the single-domain antibody coding sequence in frame with pIX. Thus, we have developed a simple method to propagate virus lacking native viral tropism but containing cell-specific binding ligands. - Highlights: → We describe a method to grow virus lacking native tropism but containing novel cell-binding ligands. → Cre/loxP recombination was used to modify the adenovirus genome. → A targeting ligand present on capsid protein IX was removed or replaced using recombination. → Cre-loxP was also used to 'swap' the identity of the targeting ligand present on pIX.

  16. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  17. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  18. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  19. Construction of a viral T2A-peptide based knock-in mouse model for enhanced Cre recombinase activity and fluorescent labeling of podocytes.

    Koehler, Sybille; Brähler, Sebastian; Braun, Fabian; Hagmann, Henning; Rinschen, Markus M; Späth, Martin R; Höhne, Martin; Wunderlich, F Thomas; Schermer, Bernhard; Benzing, Thomas; Brinkkoetter, Paul T

    2017-06-01

    Podocyte injury is a key event in glomerular disease leading to proteinuria and opening the path toward glomerular scarring. As a consequence, glomerular research strives to discover molecular mechanisms and signaling pathways affecting podocyte health. The hNphs2.Cre mouse model has been a valuable tool to manipulate podocyte-specific genes and to label podocytes for lineage tracing and purification. Here we designed a novel podocyte-specific tricistronic Cre mouse model combining codon improved Cre expression and fluorescent cell labeling with mTomato under the control of the endogenous Nphs2 promoter using viral T2A-peptides. Independent expression of endogenous podocin, codon improved Cre, and mTomato was confirmed by immunofluorescence, fluorescent activated cell sorting and protein analyses. Nphs2 pod.T2A.ciCre.T2A.mTomato/wild-type mice developed normally and did not show any signs of glomerular disease or off-target effects under basal conditions and in states of disease. Nphs2 pod.T2A.ciCre.T2A.mTomato/wild-type -mediated gene recombination was superior to conventional hNphs2.Cre mice-mediated gene recombination. Last, we compared Cre efficiency in a disease model by mating Nphs2 pod.T2A.ciCre.T2A.mTomato/wild-type and hNphs2.Cre mice to Phb2 fl/fl mice. The podocyte-specific Phb2 knockout by Nphs2 pod.T2A.ciCre.T2A.mTomato/wild-type mice resulted in an aggravated glomerular injury as compared to a podocyte-specific Phb2 gene deletion triggered by hNphs2.Cre. Thus, we generated the first tricistronic podocyte mouse model combining enhanced Cre recombinase efficiency and fluorescent labeling in podocytes without the need for additional matings with conventional reporter mouse lines. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  20. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  1. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  2. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  3. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  4. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  6. Dermal Delivery of Constructs Encoding Cre Recombinase to Induce Skin Tumors in PtenLoxP/LoxP;BrafCA/+ Mice

    Marcel A. Deken

    2016-12-01

    Full Text Available Current genetically-engineered mouse melanoma models are often based on Tyr::CreERT2-controlled MAPK pathway activation by the BRAFV600E mutation and PI3K pathway activation by loss of PTEN. The major drawback of these models is the occurrence of spontaneous tumors caused by leakiness of the Tyr::CreERT2 system, hampering long-term experiments. To address this problem, we investigated several approaches to optimally provide local delivery of Cre recombinase, including injection of lentiviral particles, DNA tattoo administration and particle-mediated gene transfer, to induce melanomas in PtenLoxP/LoxP;BrafCA/+ mice lacking the Tyr::CreERT2 allele. We found that dermal delivery of the Cre recombinase gene under the control of a non-specific CAG promoter induced the formation of melanomas, but also keratoacanthoma and squamous cell carcinomas. Delivery of Cre recombinase DNA under the control of melanocyte-specific promoters in PtenLoxP/LoxP;BrafCA/+ mice resulted in sole melanoma induction. The growth rate and histological features of the induced tumors were similar to 4-hydroxytamoxifen-induced tumors in Tyr::CreERT2;PtenLoxP/LoxP;BrafCA/+ mice, while the onset of spontaneous tumors was prevented completely. These novel induction methods will allow long-term experiments in mouse models of skin malignancies.

  7. Cre recombinase activity is inhibited in vivo but not ex vivo by a mutation in the asymmetric spacer region of the distal loxP site.

    Arguello, Tania; Moraes, Carlos T

    2015-11-01

    The cre/loxP recombination system is a valuable tool used to generate tissue specific genomic rearrangements in mouse models. The deletion of a region of interest flanked by two loxP sites is accomplished by the recombinase (cre) enzyme, which binds to the inverted repeat segments of two loxP sites and recognition of a conserved TA sequence in the asymmetric central spacer region "ATAACTTCGTATA -NNNTANNN-TATACGAAGTTAT. In vivo, we found that a single T to C mutation at position 4 of the central spacer region in the distal (3') loxP site, completely inhibited the recombination reaction in two conditional mouse models. These mice were generated using a mitochondrial methionyl-tRNA formyltransferase (Mtfmt) gene targeted construct and cre transgene under the control of tissue-specific promoters: calcium/calmodulin-dependent kinase II alpha (Camk2a-cre) and myosin light polypeptide 1 (Myl1-cre). Surprisingly, transient transfection of a plasmid expressing cre in dermal fibroblasts derived from the same mutant floxed Mtfmt((loxP/loxP)) mice line, successfully deleted the region of interest. This study demonstrates the sequence specificity required in vivo, the possibility of bypassing this limitation by expressing high levels of cre recombinase ex vivo and raises concerns related to the quality control of large scale production of gene targeted constructs and mice. genesis 53:695-700, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  8. Consultation organised by CRE and CREG on the France-Belgium interconnection; Consultation organisee par la CRE et la CREG relative a la gestion de l'interconnexion France-Belgique

    NONE

    2002-07-01

    In June 2002, RTE and ELIA put forward a proposal to CRE and CR