WorldWideScience

Sample records for response element tre

  1. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    Thomas Spaller

    Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  2. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  3. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  4. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  5. Tre strejker i det offentlige

    Stamhus, Jørgen; Scheuer, Steen; Chrstensen, Ellen Susanne

    2010-01-01

    Fra april til juni 2008 gik tre grupper af offentligt ansatte (sosu-assistenter, sygeplejersker m.fl. og børnehavepædagoger) i strejke for at opnå forbedrede relative løngevinster. Kunne dette betale sig? På grundlag af en investeringskalkule påvises det, at kun en velforberedt og relativt kort s...

  6. Implementering af tre misbrugsbehandlinger for udsatte unge

    Weatherall, Cecilie Dohlmann; Termansen, Tina

    2015-01-01

    SFI- Det Nationale Forskningscenter for Velfærd skal evaluere ”Projekt misbrugsbehandling for udsatte unge”, som løber fra 2011 til 2014. De tre behandlingsmodeller, som indgår i Socialstyrelsens (SOS) ”Projekt misbrugsbehandling for udsatte unge”, er MST-SA (Multi Systemic Therapy Substance Abuse...... både i Danmark og internationalt. Dog er der et stigende fokus på, at det er et centralt element for at opnå gode evalueringer (Fixen m.fl., 2005; Fixen m.fl., 2009; Durlak & DuPre, 2008), idet implementeringen af en indsats kan have stor betydning for den effekt, der observeres. Ifølge Durlak og Du...

  7. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  8. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  9. Tre ting mangler i Nykredit-debatten

    Østrup, Finn

    2016-01-01

    Det har mudret debatten om Nykredits bidragssatser, at flere synspunkter er decideret forkerte. Og samtidig mangler vi at diskutere tre vigtige pointer.......Det har mudret debatten om Nykredits bidragssatser, at flere synspunkter er decideret forkerte. Og samtidig mangler vi at diskutere tre vigtige pointer....

  10. Conditional RNA interference achieved by Oct-1 POU/rtTA fusion protein activator and a modified TRE-mouse U6 promoter

    Fei Zhaoliang; Chen Zheng; Wang Zhugang; Fei Jian

    2007-01-01

    RNA interference (RNAi) is a powerful technique and is widely used to down-regulate expression of specific genes in cultured cells and in vivo. In this paper, we report our development of a new tetracycline-inducible RNAi expression using a modified TRE-mouse U6 promoter in which the distal sequence element (DSE) was replaced by the tetracycline-responsive element (TRE). The modified TRE-mouse U6 promoter can be activated by a Tet-on version tetracycline-regulated artificial activator rTetOct which was constructed by fusing the rtTA DNA binding domain with the Oct-1 POU activation domain. This rTetOct/TRE-U6 system was successfully applied to conditionally and reversibly down-regulate the expression of endogenous p53 gene in MCF7 cells, and the expression of β-defensin gene (mBin1b) either transiently expressed in COS7 cells or stably expressed in CHO cells

  11. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  12. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  13. Théâtre de Carouge

    Staff Association

    2014-01-01

    Venez rire et profitez c'est bientôt les fêtes ! Même Au Théâtre de Carouge-Atelier de Genève ! Profitez de votre tarif pour découvrir la pièce la plus drôle de tous les temps ! venez rire autour de : Silence en coulisses (Noises off) de Michael Frayn et mise en scène de Raoul Pastor Du vendredi 5 au mercredi 31 décembre 2014 ! Certaines dates sont déjà complète ! With English surtitles on December 16th, 17th, 18th, 19th, 20th and 21st Du théâtre dans le théâtre, un chef d'œuvre d'horlogerie dont la mécanique comique nous offre une pièce délirante, une parabole sur le théâtre où l'on tourne en dérision acteurs et metteur en scène. En trois actes, l'auteur nous dépeint l...

  14. Tre teorier om den moralske udvikling

    Bo, Inger Glavind; Andreasen, Brian Kjær

    I artiklen gennemgås tre forskellige men teorihistorisk relaterede perspektiver på forståelsen af moralsk udvikling: Piaget, Kohlberg og Gilligan. I den efterfølgende diskussion af disse teoretikeres respektive positioner påpeges såvel forskelle som ligheder i deres betoning af moralens karakter...

  15. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  16. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  17. Théâtre Les 50

    Théâtre Les 50

    2010-01-01

    Vendredi 1 et samedi 2 octobre 2010 à 20h00 Théâtre en langue anglaise.   WAITING FOR GODOT From Samuel Beckett A Theatre Someone production    Cast Estragon Gary Bird, Vladimir Alan Leather, Lucky Andrew Brookes, Pozzo Joe Pirri, A boy Gabriel Bird Crew Director Sue Humphreys, Producer Dave Humphreys, Technical Steve Pavis   Waiting for Godot is an absurdist play by Samuel Beckett, in which two characters, Vladimir and Estragon, wait for someone named Godot. Godot's absence, as well as numerous other aspects of the play, have led to many different interpretations since the play's premiere. The play is considered by some critics to be one of the most prominent works of the "Theatre of the Absurd".   Théâtre Les 50 à Saint Jean de Gonville Vendredi 1 octobre 2010 à 20h Samedi 2 octobre 2010 à 20h Tarif plein : 18 € Tarif abonné, ense...

  18. Théâtre de Carouge

    Théâtre de Carouge

    2012-01-01

     Du venderdi 24 février au dimanche 18 mars Salle François-Simon – Création FIGARO !  D’après Beaumarchais Mise en scène de Jean Liermier Jean Liermier dit souvent qu’il ne fait pas de différence entre le théâtre et la vie. Que sa vie est théâtre. Rien d’étonnant alors à ce qu’il remonte le cours de son propre fleuve et prenne comme point de départ de Figaro ! la dernière scène de son Jeu de l’amour et du hasard. Un processus rappelant que pour lui, « la représentation n’est jamais une conclusion ». Nous avons le plaisir de vous faire profiter d’un tarif spécial, pour les membres de l’Association du personnel du CERN + 1 accompagnant, de CHF 35.- (par personne) au lieu de CHF 40.-. Plus d&...

  19. Théâtre Carouge

    Théâtre Carouge

    2012-01-01

    Du ve. 24 février au di. 18 mars 2012 Salle François-Simon – Création   FIGARO !   D’après BEAUMARCHAIS Mise en scène de JEAN LIERMIER   Jean Liermier dit souvent qu’il ne fait pas de différence entre le théâtre et la vie. Que sa vie est théâtre. Rien d’étonnant alors à ce qu’il remonte le cours de son propre fleuve et prenne comme point de départ de Figaro ! la dernière scène de son Jeu de l’amour et du hasard. Un processus rappelant que pour lui, « la représentation n’est jamais une conclusion ». Les membres de l’AP et un accompagnant de leur choix peuvent bénéficier du tarif spécial de CHF 35.– (par personne) au lieu de CHF 40.–.

  20. Théâtre les 50

    Théâtre les 50

    2011-01-01

    Le Théâtre Les 50 de Saint Jean de Gonville propose : ARAGON CHANTÉ ET PARLÉ : Ferré, Ferrat, Brassens LOUIS ARAGON, écrivain et poète français ... Cofondateur de la revue Libération en 1919, avec André Breton et Philippe Soupault, Aragon publia l'un des meilleurs romans surréalistes, Le Paysan de Paris (1926). Lié à la Résistance durant toute l'occupation, Aragon participa après la guerre aux activités du Parti communiste français. Son œuvre poétique fut marquée par son amour pour sa compagne, Elsa Triolet. À partir de la fin des années 1950, nombre de ses poèmes ont été mis en musique et chantés notamment par Jean Ferrat et Léo Ferré, contribuant à faire connaître son œ...

  1. Supervision og de tre k´er

    Schilling, Benedicte; Jacobsen, Claus Haugaard; Nielsen, Jan

    2010-01-01

    Kontrol, kontrakt og kontekst er supervisionens tre k'er. Men hvad er supervision i det hele taget for en størrelse, der spillerså central en rolle for den psykologfaglige profession?......Kontrol, kontrakt og kontekst er supervisionens tre k'er. Men hvad er supervision i det hele taget for en størrelse, der spillerså central en rolle for den psykologfaglige profession?...

  2. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  3. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  4. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  5.  Spis treści

    Mieczysław Dobija

    2014-04-01

    Ze współpracy z zagranicą .................................................................................. 145 Susana Callao, José I. Jarne, Dawid Wróblewski – Debates and studies on earnings management: a geographical perspective – Dyskusja na temat zarządzania zyskiem: perspektywa geograficzna ........... 145 4 Spis treści Darius Vaicekauskas, Jonas Mackevičius – Developing a framework for audit quality management in the audit firms –Ramy zarządzania jakością audytu w firmach audytorskich ........................ 171 Konferencje naukowe w dziedzinie rachunkowości i finansów organizowane w 2014 roku przez szkoły wyższe w Polsce ................................................... 195 Informacja dla autorów ....................................................................................... 199 Instructions for authors ....................................................................................... 207

  6. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  7. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  8. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  9. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  10. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  12. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  13. Tre gordiske knuder eller bare bump på vejen

    Hansen, Nana Wesley; Mailand, Mikkel

    I notatet analyseres forventningerne til OK2018, der særligt byder på tre udfordringer. Det gælder uenighed om privatlønsværn og løngab, samarbejdsproblemer på statens område (herunder spørgsmålet om den betalte frokostpause) og spørgsmålet om lærernes arbejdstid. Notatet understreger den særlige...

  14. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  15. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  16. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  17. Confessions of a TRE Junkie: What's Next? Who Cares?

    Hjelm, E. J.

    2011-12-01

    Whether self-selected or chosen through a competitive process, teachers who seek out research experiences are at or near the top of their profession and often well trained in science. We incorporate our research experiences into our classrooms. We tinker and refine. We become TRE experts in our own right. How do we continue to grow and share this expertise? TRE veterans are an untapped resource. I provide a first hand, teacher account of the years after the TRE. My first was the 2005 ERESE Teacher Research Experience in Plate Tectonics at SIO. I brought an M.S. in Geology, field and middle school teaching experience, a passion for teaching geoscience, and a desire to inspire the next generation of geoscientists. I left committed to finding authentic ways for my students to conduct inquiry-based geoscience. Geoscience is taught in middle school. That's where the pipeline begins. One "real" geoscience experience in those middle years can inspire the best and the brightest to pursue geoscience careers. At SIO I embraced the idea that meaningful science involves asking and answering your own questions. My sixth grade students use NOAA OceanExplorer websites to explore subduction zones and seafloor vents. They ask and then answer their own questions. Each student communicates her results in a classroom scientific meeting. In 2006, I presented my students' work at AGU Fall Meeting. Next, I believed my students would benefit from contact with a scientist at their scientific meeting, so in 2007 we co-hosted, with Dartmouth College, a MARGINS Distinguished Lecturer. I was using NOAA websites, so in 2008 I was a NOAA Teacher at Sea in AK. My TAS experience resulted in a MARGINS minilesson that enables students to use GeoMapApp to explore and compare volcanic and glacial features on Aleutian islands and surrounding seafloor http://serc.carleton.edu/margins/minilessons/32005.html. In 2009, with an interest in visualizations and volcanoes, and a letter of support from a PI, I

  18. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  19. Alexandre Hardy, Théâtre complet, Tome I

    Pavesio, Monica

    2016-01-01

    Il primo volume del teatro completo di Alexandre Hardy, pubblicato nella collezione della Bibliothèque du théâtre français diretta da Charles Mazouer, presenta le edizioni critiche delle pièces contenute nel primo volume del drammaturgo, stampato per la prima volta a Parigi nel 1624. Si tratta del primo risultato di un lavoro più vasto che prevede, nei prossimi anni, la pubblicazione dell’intero corpus delle opere teatrali del grande drammaturgo del primo Seicento, grazie al lavoro di un’équi...

  20. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  1. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  2. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  3. Conditional reverse tet-transactivator mouse strains for the efficient induction of TRE-regulated transgenes in mice.

    Lukas E Dow

    Full Text Available Tetracycline or doxycycline (dox-regulated control of genetic elements allows inducible, reversible and tissue specific regulation of gene expression in mice. This approach provides a means to investigate protein function in specific cell lineages and at defined periods of development and disease. Efficient and stable regulation of cDNAs or non-coding elements (e.g. shRNAs downstream of the tetracycline-regulated element (TRE requires the robust expression of a tet-transactivator protein, commonly the reverse tet-transactivator, rtTA. Most rtTA strains rely on tissue specific promoters that often do not provide sufficient rtTA levels for optimal inducible expression. Here we describe the generation of two mouse strains that enable Cre-dependent, robust expression of rtTA3, providing tissue-restricted and consistent induction of TRE-controlled transgenes. We show that these transgenic strains can be effectively combined with established mouse models of disease, including both Cre/LoxP-based approaches and non Cre-dependent disease models. The integration of these new tools with established mouse models promises the development of more flexible genetic systems to uncover the mechanisms of development and disease pathogenesis.

  4. En, to, tre - tjek på branding

    Hermansen, Judy

    2010-01-01

    Da brandet i såvel juridisk som marketingmæssig forstand er et tegn, er det oplagt at vende sig mod semiotikken i forsøget på at udvikle en model, der kan integrere de forskellige komponenter, som brand-tegnet består af. Forfatterne undersøger dimensionerne ’identitet’, ’marketing’ og ’respons’ ved...... hjælp af Peirce's tredelte tegnbegreb og udvikler en model, der illustrerer brandets anatomi i form af tre ”søjler”: 1) Identitetssøjlen, som er et mix af tegn og brands, 2) Marketingsøjlen, som er et mix af produkter og marketing aktiviteter og 3) Responssøjlen, som er et mix af forskellige markeder og...

  5. Evaluering af tre projekter i Socialstyrelsens Forældreprogram

    Scavenius Sonne-Schmidt, Christoffer; Andersen, Luna Kragh; Frøslev-Thomsen, Kathrine

    2018-01-01

    I Danmark oplever vi i disse år en stigning i antallet af børn og unge med ADHD diagnoser og ADHD-lignende vanskeligheder, hvilket har medført øget fokus på effektive indsatser til de berør-te familier, børn og unge. Dette notat har til formål at beskrive implementering af tre sådanne indsatser......, herunder unge med ADHD (PMTO) samt Mentor- og støttekontaktpersons-ordningen (M-SKP) rettet mod unge. KiK og PMTO er begge manualbaserede og velafprøvede indsatser, mens M-SKP bygger på det eksisterende mentor- og støttekontaktpersonsarbejde, der foretages i danske kommuner, men i sig selv er en ny indsats...

  6. Georges Lemaître Life, Science and Legacy

    Mitton, Simon

    2012-01-01

    The year 2011 marked the 80th anniversary of Georges Lemaître’s primeval atom model of the universe, forerunner of the modern day Big Bang theory. Prompted by this momentous anniversary the Royal Astronomical Society decided to publish a volume of essays on the life, work and faith of this great cosmologist, who was also a Roman Catholic priest. The papers presented in this book examine in detail the historical, cosmological, philosophical and theological issues surrounding the development of the Big Bang theory from its beginnings in the pioneering work of Lemaître through to the modern day. This book offers the best account in English of Lemaître’s life and work. It will be appreciated by professionals and graduate students interested in the history of cosmology.

  7. Densità informativa. Tre parametri linguistico-testuali

    Jansen, Hanne

    ) il rapporto fra informazione "vera e propria" e materiale linguistico adempiente invece a funzioni testuali ed interpersonali. Dopo una discussione dei presupposti teorici e metodologici (in particolare della stessa nozione di "informazione" e di quella altrettanto importante, di "unità di......In una prospettiva contrastiva e su una base eclettica, funzionale/cognititiva/testuale, lo studio si propone di definire la densità informativa di un testo in base a tre parametri: 1) il rapporto fra informazione esplicita e implicita; 2) la strutturazione concreta dell'unità di informazione; 3...... informazione"), è messo a prova il modello d'analisi proposto, confrontando i testi del corpus di Mr. Bean (testi paralleli italiani e danesi, scritti e parlati)...

  8. Georges Lemaître: Science and Religion

    Coyne, George V.

    In order to appreciate the contribution which Georges Lemaître made to the relationship between religion and science it is necessary to understand how the Catholic Church, of which he was a priest, passed in the course of three centuries, from a position of conflict with the sciences to one of compatible openness and dialogue. In doing this I hope to show that the natural sciences have played a significant role in helping to establish the kind of dialogue that is absolutely necessary for the enrichment of the multifaceted aspects of human culture. I will speak of the following four periods of history: (l) the rise of modern atheism in the seventeenth and eighteenth centuries; (2) anticlericalism in Europe in the nineteenth century; (3) the awakening within the Catholic Church to modern science in the first six decades of the twentieth century; (4) the Church's view today.

  9. 40 CFR Table 2 to Subpart D of... - TRE Parameters for NSPS Referencing Subpartsa

    2010-07-01

    ...? Net heating value(MJ/scm)b Vent stream flow rate (scm/min)c Values of terms for TRE equation: TRE=A... § 65.64(h). b MJ/scm = mega Joules per standard cubic meter. c scm/min = standard cubic meters per...

  10. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  11. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  12. The role of Tre6P and SnRK1 in maize early kernel development and events leading to stress-induced kernel abortion.

    Bledsoe, Samuel W; Henry, Clémence; Griffiths, Cara A; Paul, Matthew J; Feil, Regina; Lunn, John E; Stitt, Mark; Lagrimini, L Mark

    2017-04-12

    Drought stress during flowering is a major contributor to yield loss in maize. Genetic and biotechnological improvement in yield sustainability requires an understanding of the mechanisms underpinning yield loss. Sucrose starvation has been proposed as the cause for kernel abortion; however, potential targets for genetic improvement have not been identified. Field and greenhouse drought studies with maize are expensive and it can be difficult to reproduce results; therefore, an in vitro kernel culture method is presented as a proxy for drought stress occurring at the time of flowering in maize (3 days after pollination). This method is used to focus on the effects of drought on kernel metabolism, and the role of trehalose 6-phosphate (Tre6P) and the sucrose non-fermenting-1-related kinase (SnRK1) as potential regulators of this response. A precipitous drop in Tre6P is observed during the first two hours after removing the kernels from the plant, and the resulting changes in transcript abundance are indicative of an activation of SnRK1, and an immediate shift from anabolism to catabolism. Once Tre6P levels are depleted to below 1 nmol∙g -1 FW in the kernel, SnRK1 remained active throughout the 96 h experiment, regardless of the presence or absence of sucrose in the medium. Recovery on sucrose enriched medium results in the restoration of sucrose synthesis and glycolysis. Biosynthetic processes including the citric acid cycle and protein and starch synthesis are inhibited by excision, and do not recover even after the re-addition of sucrose. It is also observed that excision induces the transcription of the sugar transporters SUT1 and SWEET1, the sucrose hydrolyzing enzymes CELL WALL INVERTASE 2 (INCW2) and SUCROSE SYNTHASE 1 (SUSY1), the class II TREHALOSE PHOSPHATE SYNTHASES (TPS), TREHALASE (TRE), and TREHALOSE PHOSPHATE PHOSPHATASE (ZmTPPA.3), previously shown to enhance drought tolerance (Nuccio et al., Nat Biotechnol (October 2014):1-13, 2015). The impact

  13. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  14. "Life of Galileo" Théâtre de Carouge

    2008-01-01

    Special offer for CERN personnel CERN personnel and their spouses have until Tuesday, 18 March 2008 to buy tickets for « Vie de Galilée » ("Life of Galileo") at the Théâtre de Carouge at the special discount rate of 28 CHF (instead of 35 CHF). This play, by the German dramatist Bertolt Brecht, is directed by Manfred Karge and recounts the life of the father of modern physics in fifteen tableaux. The wily, impassioned teacher Galileo is about to substantiate Copernicus’ theory that the Earth is not a static object but revolves around the sun, a discovery that revolutionised mankind’s view of itself and the world. When hauled before the Inquisition, he recants. "Life of Galileo" is the first major dramatic work after the invention of the atom bomb to address the issues of freedom of thought and ethics in the context of scientific discoveries. Special performances on 3, 10, 15 and 22 April will be followed by organised debat...

  15. Tre voci per un Lexicon di Giuseppe Pontiggia

    Daniela Marcheschi

    2014-07-01

    Full Text Available Tre parole-chiave offrono lo spunto per un’immersione nel pensiero e nell’opera di Giuseppe Pontiggia. La prima: parola, riaffermata dallo scrittore in quanto atto civile e ‘corporeo’ mediante il quale l’uomo fa esperienza di se stesso entrando in contatto con i suoi simili e con il circostante, ricongiungendosi insieme alla sua più profonda e antica natura. Viene così restituita allo scrittore/critico la responsabilità di lottare contro l’attuale minaccia dello svuotamento linguistico, nel nome di una costruttiva utopia culturale. La seconda parola, musica, serve a illuminare i romanzi di Pontiggia – in specie La grande sera e L’arte della fuga – attraverso suggestive analogie con la musica classica e il jazz, predilette dallo scrittore. Ossimoro è l’ultima voce di questo Lexicon: figura retorica, ma soprattutto figura conoscitiva che permette allo scrittore di scoprire la propria verità e il proprio linguaggio e al lettore di abbracciare una visione non lineare e problematica del mondo, capace di ampliare le prospettive e rinnovare lo sguardo.

  16. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  18. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  19. Tre1, a G protein-coupled receptor, directs transepithelial migration of Drosophila germ cells.

    Prabhat S Kunwar

    2003-12-01

    Full Text Available In most organisms, germ cells are formed distant from the somatic part of the gonad and thus have to migrate along and through a variety of tissues to reach the gonad. Transepithelial migration through the posterior midgut (PMG is the first active step during Drosophila germ cell migration. Here we report the identification of a novel G protein-coupled receptor (GPCR, Tre1, that is essential for this migration step. Maternal tre1 RNA is localized to germ cells, and tre1 is required cell autonomously in germ cells. In tre1 mutant embryos, most germ cells do not exit the PMG. The few germ cells that do leave the midgut early migrate normally to the gonad, suggesting that this gene is specifically required for transepithelial migration and that mutant germ cells are still able to recognize other guidance cues. Additionally, inhibiting small Rho GTPases in germ cells affects transepithelial migration, suggesting that Tre1 signals through Rho1. We propose that Tre1 acts in a manner similar to chemokine receptors required during transepithelial migration of leukocytes, implying an evolutionarily conserved mechanism of transepithelial migration. Recently, the chemokine receptor CXCR4 was shown to direct migration in vertebrate germ cells. Thus, germ cells may more generally use GPCR signaling to navigate the embryo toward their target.

  20. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  1. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  2. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  3. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  4. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  5. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  6. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  7. Georges Lemaître: The Priest Who Invented the Big Bang

    Lambert, Dominique

    This contribution gives a concise survey of Georges Lemaître works and life, shedding some light on less-known aspects. Lemaître is a Belgian catholic priest who gave for the first time in 1927 the explanation of the Hubble law and who proposed in 1931 the "Primeval Atom Hypothesis", considered as the first step towards the Big Bang cosmology. But the scientific work of Lemaître goes far beyond Physical Cosmology. Indeed, he contributed also to the theory of Cosmis Rays, to the Spinor theory, to Analytical mechanics (regularization of 3- Bodies problem), to Numerical Analysis (Fast Fourier Transform), to Computer Science (he introduced and programmed the first computer of Louvain),… Lemaître took part to the "Science and Faith" debate. He defended a position that has some analogy with the NOMA principle, making a sharp distinction between what he called the "two paths to Truth" (a scientific one and a theological one). In particular, he never made a confusion between the theological concept of "creation" and the scientific notion of "natural beginning" (initial singularity). Lemaître was deeply rooted in his faith and sacerdotal vocation. Remaining a secular priest, he belonged to a community of priests called "The Friends of Jesus", characterized by a deep spirituality and special vows (for example the vow of poverty). He had also an apostolic activity amongst Chinese students.

  8. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  9. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  10. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  11. Aa. Vv., Alain Resnais et le théâtre

    Brangé, Mireille

    2016-01-01

    Le présent numéro propose onze études sur les rapports du cinéaste Alain Resnais (né en 1922) avec le théâtre, sa passion première, dont la présence, loin d’être l’objet d’un glissement de plus en plus visible dans son œuvre depuis Mélo en 1985, y a toujours été présent, comme le signale Jean-Louis Libois dans Théâtre, cinéma, l’autre scène (pp. 17-23). Le réalisateur préfère le terme de «spectacle» pour parler de leur coprésence dans ses films et Vincent Amiel permet dans Comme au théâtre! N...

  12. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  13. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  14. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  15. Fromleik i Black Supper, Piss Christ og Crucifixion, tre fotografi av Andres Serrano

    Vinje, Lilly

    2006-01-01

    Oppgåva skal omhandla tre utvalgte foto av fotografen Andres Serrano, ein amerikanar født i 1950. Enkeltbileta det er snakk om er Black Supper (1990), Piss Christ og Crucifixion (begge 1987). Dei er laga ved at kitschfigurar er nedsenka i gjennomsiktige behaldarar fyllte av kroppsvæsker og vatn; vatn i Black Supper, urin i Piss Christ og blod i Crucifixion. Henholdsvis framstiller dei Nattverden, Jesus på krossen og Krossfestinga (tre figurar). Serrano befinn seg med desse innanfor religiøs k...

  16. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  17. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  18. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  19. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  20. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  1. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  2. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  3. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  5. Kompetenceopbygning i tre succesfulde danske fødevarevirksomheder

    Jensen, Bjarne; Harmsen, Hanne

    2000-01-01

    that the companies are good at compared to their competitors. These competences are called distinctive competences. 2. In total, the participating five food companies pointed at 11 different distinctive competences of which the competences product development, customer relations and quality management are the three....... Furthermore, in those cases where more than one food company has pointed at a particular competence as a distinctive competence, it is evident that the companies have structured the competence very differently. This also indicates that there is "room" for building up a particular competence in different ways...... and still - or rather therefore - be successful with the competence. 4. The study reveals that competence structures are complex entities that are made up of six different competence elements that are interrelated and interdependent. The six competence elements are 1) activities, 2) management and control...

  6. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  7. Evaluering af Københavns kommunes tre Agenda 21 centre og sattellitter

    Agger, Annika; Hoffmann, Birgitte; Jensen, Jesper Ole

    Evaluering af Københavns kommunes tre første Agenda 21 centre på Indre Nørrebro, Bispebjerg, Sundbyøster samt sattellitterne på Østerbro og Ydre Nørrebro. Evalueringen fokuserer på centrenes forankring i lokale organisationer og netværk, samt forventningsafklaring mellem de mange involverede...

  8. SoTRE's Speak Up: Students Share the Benefits of Teacher Researcher Experiences

    Eubanks, E.; Allen, S.; Farmer, S.; Jones, K.

    2016-12-01

    Being Students of Teacher Researcher Experiences (SoTRE) gives students special advantages that most students do not get. Teachers Elizabeth Eubanks and Steve Allen share their knowledge gained via partnerships with Teacher Researcher Experiences (TRE's) such as the National Oceanographic and Atmospheric Administration Teacher at Sea program (NOAA- TAS), Polar TREC (Teachers and Researchers & Exploring & Collaboration), National Science Foundation (NSF) funded researchers, (EARTH) Education and Research: Testing Hypothesis, the RJ Dunlap Marine Conservation Program, C-DEBI (Center for Dark Energy Biosphere Investigations and (STARS) Sending Teachers Aboard Research Ships, The Maury Project and Mate. Students gain special privileges such as understanding unique research ideas, tracking tagged sharks, following daily journals written on location, taking part in cross-continental experiments, tracking real time data, exploring current research via posters or visiting universities. Furthermore, contacts made by a TRE give students an added set of resources. When doing experiments for class or advancing their education or career goals Eubanks and Allen help students connect with scientists. Many students have felt so strongly about the TRE relationship that they have presented at several local and international science conferences. Their message is to encourage scientists to partner with teachers. The benefits of participation in such conferences have included abstract writing and submission, travel, poster creation, oral presentation, networking and personal research presentation, all tools that they will carry with them for a lifetime.

  9. Fra Bach til Beatles på tre måneder!

    Bonde, Anders

    2006-01-01

    Fra Bach til Beatles på tre måneder! Didaktiske overvejelser og erfaringer på baggrund af nyt et-semesters oversigtskursus Anders Bonde Fra og med september 2005 har man på musikuddannelsen ved Aalborg Universitet, som led i implementeringen af en ny tofaglig bachelorstruktur, udviklet et nyt...

  10. Lemaître, the Big Bang and the Quantum Universe

    Heller, Michael

    Lemaître's work on the geometric nature of singularities and his speculations concerning the applications of quantum physics to cosmology are confronted with later achievements in these fields. His works on the global structure of the de Sitter solution and the appearance of "non-regular" points in the Schwarzschild solution led to the conclusion that the "vanishing of the radius of the universe" is a generic property of cosmological models. This conclusion was strengthened when Lemaître proved that, against Einstein's intuition, space anisotropy (in Bianchi I models) does not remove the singularity. This is why Lemaître regarded the initial singularity as a "geometric support" of his Primeval Atom hypothesis. This hypothesis was not yet a quantum gravity idea (in the present sense of this expression), but it was certainly an application of quantum physics to the early stages of cosmic evolution. The beginning itself is aspatial and atemporal, and both space and time emerge only when the simplicity of the Primeval Atom gives place to physical multiplicity. How do the problems with which Lemaître struggled appear in the light of the present state of cosmological research?

  11. Kategoriseringsmodeller, typer af kriterier og gyldighedsområder - de tre niveauer i tekstgenrerforskningen

    Frandsen, Finn

    1995-01-01

    Artiklen forsøger at vise, hvordan de metodologiske problemstillinger i studiet af tekstgenrer kan fordeles på tre forskellige forskningsniveauer, som bør holdes ude fra hinanden, uanset hvilke tekstgenrer man studerer: a) valg af kategoriseringsmodel, b) valg af typer af kriterier og c) kriterie...

  12. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  13. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  14. Excision of HIV-1 proviral DNA by recombinant cell permeable tre-recombinase.

    Lakshmikanth Mariyanna

    Full Text Available Over the previous years, comprehensive studies on antiretroviral drugs resulted in the successful introduction of highly active antiretroviral therapy (HAART into clinical practice for treatment of HIV/AIDS. However, there is still need for new therapeutic approaches, since HAART cannot eradicate HIV-1 from the infected organism and, unfortunately, can be associated with long-term toxicity and the development of drug resistance. In contrast, novel gene therapy strategies may have the potential to reverse the infection by eradicating HIV-1. For example, expression of long terminal repeat (LTR-specific recombinase (Tre-recombinase has been shown to result in chromosomal excision of proviral DNA and, in consequence, in the eradication of HIV-1 from infected cell cultures. However, the delivery of Tre-recombinase currently depends on the genetic manipulation of target cells, a process that is complicating such therapeutic approaches and, thus, might be undesirable in a clinical setting. In this report we demonstrate that E.coli expressed Tre-recombinases, tagged either with the protein transduction domain (PTD from the HIV-1 Tat trans-activator or the translocation motif (TLM of the Hepatitis B virus PreS2 protein, were able to translocate efficiently into cells and showed significant recombination activity on HIV-1 LTR sequences. Tre activity was observed using episomal and stable integrated reporter constructs in transfected HeLa cells. Furthermore, the TLM-tagged enzyme was able to excise the full-length proviral DNA from chromosomal integration sites of HIV-1-infected HeLa and CEM-SS cells. The presented data confirm Tre-recombinase activity on integrated HIV-1 and provide the basis for the non-genetic transient application of engineered recombinases, which may be a valuable component of future HIV eradication strategies.

  15. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  16. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  17. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  18. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  19. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  20. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  2. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  3. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  4. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  5. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  6. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  7. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  8. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  9. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  10. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  11. QUANTUM @ Théâtre Forum Meyrin | 30-31 October

    2015-01-01

    The Gilles Jobin Company has the pleasure of welcoming you to QUANTUM @ Théâtre Forum Meyrin.   QUANTUM @ Théâtre Forum Meyrin Friday, 30 October - 8.30 p.m.  Saturday, 31 October - 7.00 p.m. SPECIAL PRICE FOR CERN PERSONNEL: 15 CHF upon presentation of your CERN card (regular price: 25 CHF/20 CHF). QUANTUM is a "creative collision" between 2012 Arts@CERN resident artists Gilles Jobin, choreographer, and Julius Von Bismarck, visual artist. Von Bismarck's lumino-kinetic installation lights up the stage while Carla Scaletti's music score uses real LHC "sonified" data! Physicists Michael Doser and Nicholas Chanon participated in the creation as scientific advisors to the choreographer. Created at the CMS ex...

  12. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  13. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  14. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  15. Georges Lemaître and Fred Hoyle: Contrasting Characters in Science and Religion

    Holder, Rodney D.

    Georges Lemaître was a jocular Roman Catholic priest and Fred Hoyle a bluff Yorkshireman who despised organized religion. Both were giants of twentieth century cosmology but espoused diametrically opposed cosmological models. This paper explores the extent to which ideology, and particularly religion, played a part in the controversies over the big bang and steady-state theories. A particular problem for many cosmologists, including Hoyle, was posed by the idea that the universe had a temporal beginning: an eternal, unchanging universe seemed metaphysically preferable. And Hoyle was highly polemical about religion in his popular writings. In contrast, Lemaître saw no theological import from the big bang, and never entered a debate about its theological implications until, perhaps unexpectedly, he took issue with an address given by the Pope. Hoyle's seminal work on stellar nucleosynthesis led him to speak of a `superintellect monkeying with physics' though this was never identified with the God of classical theism. The work of both Lemaître and Hoyle resonates with more recent debates concerning cosmology.

  16. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  17. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  18. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  19. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  20. 40 CFR 63.117 - Process vent provisions-reporting and recordkeeping requirements for group and TRE determinations...

    2010-07-01

    ... provisions for Group 2 process vents with a TRE index value greater than 1.0 but less than or equal to 4.0 in... report the following when achieving and maintaining a TRE index value greater than 1.0 but less than 4.0... than 4.0 as specified in § 63.113(e) of this subpart, shall maintain records and submit as part of the...

  1. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  3. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  4. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  5. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  6. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  7. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  8. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  9. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  10. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  11. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  12. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  13. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  14. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  15. Polska prasa tabletowa – modele biznesowe dystrybucji treści

    Krzysztof Flasiński

    2012-02-01

    Full Text Available Autor przeanalizował aplikacje spełniające trzy warunki: przeznaczone na tablety marki iPad, dostępne w sklepie App Store oraz powiązane z polskojęzycznymi tytułami prasowymi. Artykuł przedstawia kompletną panoramę polskiej prasy tabletowej. Ujętych zostało 38 aplikacji dostępnych 30 września 2011 r. Po zbadaniu wszystkich programów utworzono „mapę modeli biznesowych dystrybucji treści”. Czynnikiem decydującym o umieszczeniu na niej aplikacji prasowych była forma dystrybucji treści (płatna/bezpłatna oraz  rodzaj udostępnianej treści (powiązana z wydaniem drukowanym/powiązana z wydaniem online. Z analizy wynika, że 11 redakcji udostępnia płatne wydanie print, 10 – bezpłatne wydanie online, 7 – bezpłatne wydanie print, 3 – bezpłatne wydanie online oraz płatne wydanie print, jedna – oba wydania bezpłatnie, i jedna – oba wydania płatnie. Wywód uzupełniają dodatkowe dane: chronologiczna lista aplikacji prasowych według daty ukazania, wykaz kosztów korzystania z poszczególnych aplikacji, aktywność wydawców prasowych w App Store w rozbiciu na miesiące oraz kwartały.

  16. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  17. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  18. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  19. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  1. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  2. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  3. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  4. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  5. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  6. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  7. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  8. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  9. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  10. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  11. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  12. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  13. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  14. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  15. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  16. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  17. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  18. Accroître l'inclusion financière pour les femmes et les jeunes ...

    Accroître l'inclusion financière pour les femmes et les jeunes vulnérables : Proyecto Capital. L'accès à des services financiers officiels peut aider les personnes les plus pauvres du monde à échapper à la pauvreté et à réduire leur vulnérabilité. Ce projet aidera à accroître la sécurité économique de femmes et de jeunes ...

  19. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  20. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  1. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  2. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  3. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  4. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  5. Bog i besmrtnost – drugo i treće najvažnije pitanje

    Djurić, Marko P.

    2013-01-01

    Autor u ovom članku sagledava pitanje o Bogu i pitanje o čovjekovoj besmrtnosti kao čovjekovo drugo i treće najvažnije pitanje. Pitanje o čovjekovoj sreći smatra prvim i najvažnijim. Prema njegovu shvaćanju sva tri pitanja međusobno se prožimlju, ne isključujući se. Bez vjere u objavljenog Boga i vjerovanja u vlastitu besmrtnost čovjek neće moći doživjeti najdublju i najpotpuniju sreću. Stoga se ovo izlaganje isključivo tiče eshatološkog vremena i budućnosti. Posljedica č...

  6. Effets des sels organiques de tributyletain sur l'huître adulte Crassostrea gigas

    Heral, Maurice; Alzieu, Claude; Caux, O.; Razet, Daniel; Garnier, Jacqueline

    1983-01-01

    La toxicité des composés organostanniques a été mise en évidence à l'égard de l'huître Crassostrea gigas tant aux stades larvaires (His & Robert, 1980) que chez l'adulte (Alzieu & al., 1980, 1981). Parallèlement ces mêmes auteurs ont montré l'accumulation d'étain dans les huîtres contaminées expérimentalement ainsi que le rôle que peut jouer le fluorure de TBT dans la perturbation de la croissance (Héral & al. 1981) et dans la malformation de la coquille des huîtres (Alzieu & al., 1981). Dans...

  7. 40 CFR Table 4 to Subpart G of... - Process Vents-Monitoring, Recordkeeping, and Reporting Requirements For Maintaining a TRE Index...

    2010-07-01

    ..., and Reporting Requirements For Maintaining a TRE Index Value >1.0 and. â¤4.0 4 Table 4 to Subpart G of... TRE Index Value >1.0 and. ≤4.0 Final recovery device Parameters to be monitored a Recordkeeping and... for Organic Hazardous Air Pollutants From the Synthetic Organic Chemical Manufacturing Industry for...

  8. Perturbed Newtonian description of the Lemaître model with non-negligible pressure

    Yamamoto, Kazuhiro [Department of Physical Sciences, Hiroshima University, Higashi-hiroshima, Kagamiyama 1-3-1, 739-8526 (Japan); Marra, Valerio [Departamento de Física, Universidade Federal do Espírito Santo, Av. F. Ferrari, 514, 29075-910, Vitória, ES (Brazil); Mukhanov, Viatcheslav [Theoretical Physics, Ludwig Maxmillians University, Theresienstr. 37, 80333 Munich (Germany); Sasaki, Misao, E-mail: kazuhiro@hiroshima-u.ac.jp, E-mail: valerio.marra@me.com, E-mail: Viatcheslav.Mukhanov@physik.lmu.de, E-mail: misao@yukawa.kyoto-u.ac.jp [Yukawa Institute for Theoretical Physics, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-Ku, Kyoto 606-8502 (Japan)

    2016-03-01

    We study the validity of the Newtonian description of cosmological perturbations using the Lemaître model, an exact spherically symmetric solution of Einstein's equation. This problem has been investigated in the past for the case of a dust fluid. Here, we extend the previous analysis to the more general case of a fluid with non-negligible pressure, and, for the numerical examples, we consider the case of radiation (P=ρ/3). We find that, even when the density contrast has a nonlinear amplitude, the Newtonian description of the cosmological perturbations using the gravitational potential ψ and the curvature potential φ is valid as long as we consider sub-horizon inhomogeneities. However, the relation ψ+φ=O(φ{sup 2})—which holds for the case of a dust fluid—is not valid for a relativistic fluid, and an effective anisotropic stress is generated. This demonstrates the usefulness of the Lemaître model which allows us to study in an exact nonlinear fashion the onset of anisotropic stress in fluids with non-negligible pressure. We show that this happens when the characteristic scale of the inhomogeneity is smaller than the sound horizon and that the deviation is caused by the nonlinear effect of the fluid's fast motion. We also find that ψ+φ= [O(φ{sup 2}),O(c{sub s}{sup 2φ} δ)] for an inhomogeneity with density contrast δ whose characteristic scale is smaller than the sound horizon, unless w is close to −1, where w and c{sub s} are the equation of state parameter and the sound speed of the fluid, respectively. On the other hand, we expect ψ+φ=O(φ{sup 2}) to hold for an inhomogeneity whose characteristic scale is larger than the sound horizon, unless the amplitude of the inhomogeneity is large and w is close to −1.

  9. Perturbed Newtonian description of the Lemaître model with non-negligible pressure

    Yamamoto, Kazuhiro; Marra, Valerio; Mukhanov, Viatcheslav; Sasaki, Misao

    2016-01-01

    We study the validity of the Newtonian description of cosmological perturbations using the Lemaître model, an exact spherically symmetric solution of Einstein's equation. This problem has been investigated in the past for the case of a dust fluid. Here, we extend the previous analysis to the more general case of a fluid with non-negligible pressure, and, for the numerical examples, we consider the case of radiation (P=ρ/3). We find that, even when the density contrast has a nonlinear amplitude, the Newtonian description of the cosmological perturbations using the gravitational potential ψ and the curvature potential φ is valid as long as we consider sub-horizon inhomogeneities. However, the relation ψ+φ=O(φ 2 )—which holds for the case of a dust fluid—is not valid for a relativistic fluid, and an effective anisotropic stress is generated. This demonstrates the usefulness of the Lemaître model which allows us to study in an exact nonlinear fashion the onset of anisotropic stress in fluids with non-negligible pressure. We show that this happens when the characteristic scale of the inhomogeneity is smaller than the sound horizon and that the deviation is caused by the nonlinear effect of the fluid's fast motion. We also find that ψ+φ= [O(φ 2 ),O(c s 2φ  δ)] for an inhomogeneity with density contrast δ whose characteristic scale is smaller than the sound horizon, unless w is close to −1, where w and c s are the equation of state parameter and the sound speed of the fluid, respectively. On the other hand, we expect ψ+φ=O(φ 2 ) to hold for an inhomogeneity whose characteristic scale is larger than the sound horizon, unless the amplitude of the inhomogeneity is large and w is close to −1

  10. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  11. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  12. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  13. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  14. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  15. Underviseres og studerendes erfaringer med undervisning og læring i tre formater: Blended Learning, Synkron, online deltagelse, Mooc

    christiansen, rene b; Bichel, Rikke Aarestrup; Frimand, Anja

    2015-01-01

    Denne rapport er en afdækning af erfaringer, som undervisere og studerende ved pædagoguddannelsen på University College Sjælland (afdelingerne i Roskilde og Slagelse) gjorde sig omkring et forløb på uddannelsen, som blev udbudt i tre formater: blended undervisning, synkron, online undervisning og...

  16. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  17. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  18. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  19. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  20. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  1. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  2. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  3. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  4. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  5. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  7. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  8. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  9. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  10. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  11. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  12. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  13. Le fascisme, c’est du théâtre. Macchina scenica e meccanica narrativa

    Emanuele Canzaniello

    2015-11-01

    Full Text Available «Le fascisme, c’est du théâtre», sostiene Jean Genet, e come tale i suoi legami con la natura e la prassi della messa in scena sono essenziali alla specificità del fenomeno. La resa spettacolare della nazionalizzazione delle masse è stata senz’altro tra i temi fondamentali della ricerca sui totalitarismi. Il mio proposito è qui quello di intarsiare alcuni nuclei consolidati della ricerca storica con le rese squisitamente letterarie di quello che fu poco più che un  decennio di immensi tableaux vivants, visioni di un nuovo ordine di massa. Un’opera d’arte collettiva, basata su una premessa  fondamentale: dare “figurabilità” ai detriti e alle rovine (rimosse? di alcuni miti delle origini propri della cultura romantica, e  consapevolmente avviare e mettere in luce un enorme processo più generale di disgregazione del logos e di tutta la civiltà europea nella sua prospettiva diremo cartesiana, geometrica e razionalista. Il mio discorso si fonda, anche se in breve, su un testo solo: la Gerbe des forces (1937 di A. de Châteaubriant, uno dei più singolari resoconti di pellegrinaggio politico verso il miraggio totalitario che si sia dato tre le due guerre mondiali. Soccorsi non secondari sono il saggio di Sontag Under the sign of Saturn (1980 e quello di Tame La Mystique du Fascisme dans l’oeuvre de Robert Brasillach (1986. According to Jean Genet: «Le fascisme, c’est du théâtre», and as such its relationship with the nature and praxis of staging are essential to the specificity of the phenomenon. The magnificent representation of mass nationalisation is beyond doubt one of the fundamental issues when investigating totalitarianisms. My aim here is to link some wellestablished nuclei of historical research to the literary outputs of what was little more than a decade of immense tableaux vivants, visions of a new mass order. A collective work of art, based on a fundamental premise: to give ‘figurality’ to the rubble

  14. La marâtre dans les contes merveilleux du Yémen

    Jean Lambert

    2010-07-01

    Full Text Available La figure de la marâtre est particulièrement répandue dans les contes merveilleux du Yémen. Comme en Europe, ce genre de la littérature orale remplit des fonctions d’éducation enfantine, mais il s’adresse aussi aux adultes. Au Yémen, la figure de la marâtre doit être remise dans son contexte socio-économique des familles recomposées dans une société encore rurale et patriarcale. Sans négliger le contexte de performance du conte au Yémen, ni l’intertextualité des différentes formes de contes (se rapprochant du mythe et de l’histoire de ruse, la présentation et l’analyse de cinq contes yéménites et de diverses variantes permettent d’explorer les thèmes fantasmatiques de la mère cruelle et de la monstruosité des autres membres de la famille nucléaire. D’un autre côté, inséparables du merveilleux, les agents magiques sont principalement des animaux qui symbolisent et idéalisent des degrés de parenté proche. Tout en déformant les enjeux de la vie réelle dans un sens moral, le conte yéménite révèle, par ses structures symboliques, l’existence de ce que l’on peut appeler le « complexe anthropologique » de la marâtre, et qui s’exprime aussi, au Yémen, sous d’autres formes littéraires orales qui restent encore à explorer.The literary figure of the stepmother is widely spread in the fairy tales in Yemen. Like in Europe, this genre fulfils educative functions for the children, but it is also addressed to adults. In Yemen, the figure of the stepmother must be put in perspective in the socio-economical context of recomposed families in a still rural and patriarchal society. Without neglecting the performance context of the narration, neither the intertextual weaving of different forms of “tales” (myths, tricksters tales, the presentation and the analysis of five Yemeni tales and their variants allows us to explore the fantasy themes of the cruel mother and other kinds of monstrous kinship

  15. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  16. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  17. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  19. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  1. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  2. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  3. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  4. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  5. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  6. Urojone-nic. Pojęcie zasady w Être, Monde, Imaginaire Stanislasa Bretona

    Marcin POLAK

    2012-12-01

    Full Text Available A philosophical study of the concept of the principle was conducted by Stanislas Breton inhis two books: Du principe and Être, Monde Imaginaire, the first of which was dominated byits analytical and abstract style, while the second was speculative and imaginary. This articleundertakes the task of reconstructing the idea of the principle contained in the latter position.In the first part of the article the author presents two currents of thought concerning theprinciple: the ontological, which is based on the category of logos, and the ontomythological,for which the leading category is mythos. After discussing the differences between these twofields of thought and their corresponding fields of being, the author undertakes an attempt atdescribing the absolute source of reality – imaginary-nothing. The attempt is accompanied bya presentation of the way in which the ineffable principle produces the Word, whose originalexpression is prattle. The article concludes with an analysis of fable as the original form of expressionof the imaginary-nothing, from which arise the two trunks of rationality mentionedabove: the ontological and the ontomythological.

  7. Ricci time in the Lemaître-Tolman model and the block universe

    Elmahalawy, Yasser; Hellaby, Charles; Ellis, George F. R.

    2015-10-01

    It is common to think of our universe according to the "block universe" concept, which says that spacetime consists of many "stacked" three-surfaces, labelled by some kind of proper time, . Standard ideas do not distinguish past and future, but Ellis' "evolving block universe" tries to make a fundamental distinction. One proposal for this proper time is the proper time measured along the timelike Ricci eigenlines, starting from the big bang. This work investigates the shape of the "Ricci time" surfaces relative to the the null surfaces. We use the Lemaître-Tolman metric as our inhomogeneous spacetime model, and we find the necessary and sufficient conditions for these constant surfaces, , to be spacelike or timelike. Furthermore, we look at the effect of strong gravity domains by determining the location of timelike S regions relative to apparent horizons. We find that constant Ricci time surfaces are always spacelike near the big bang, while at late times (near the crunch or the extreme far future), they are only timelike under special circumstances. At intermediate times, timelike S regions are common unless the variation of the bang time is restricted. The regions where these surfaces become timelike are often adjacent to apparent horizons, but always outside them, and in particular timelike S regions do not occur inside the horizons of black-hole-like models.

  8. Influence of a trout farm on macrozoobenthos communities of the Trešnjica river, Serbia

    Živić Ivana

    2009-01-01

    Full Text Available Trout farming poses an increasing threat to quality of the water of clean highland streams. Research of this problem has focused primarily on changes in physico-chemical composition of the water and structure of the river bottom, and less on the effects on living organisms. In the present work, we investigated influence of the farm with the highest trout production in Serbia, the 'Riboteks' Trout Farm on the Trešnjica River, on its macrozoobenthos communities. Our investigations showed that the 'Riboteks' Trout Farm wastewaters caused a clear and statistically significant change of moderate intensity in all measured parameters describing the composition and structure of macrozoobenthos communities. These changes were most pronounced in the part of the watercourse closest to the influx of waste water (locality III but remained statistically significant even 500 m downstream (locality IV and were lost only about 3.5 km away from the influx of the farm's wastewater (locality V. The most pronounced were changes in the participation in total abundance of the Baetidae, Chironomidae, and Plecoptera. Additionally, results of the present work confirmed that the mass of fish on the trout farm is a parameter that adequately defines the strength of its action, above all the intensity of its influence on structure of the macrozoobenthos community.

  9. Le théâtre quantique l'horloge des anges ici-bas

    Connes, Alain; Dixmier, Jacques

    2013-01-01

    Ce livre vous propose de pénétrer au coeur du théâtre quantique en vous offrant une voie d'accès rapide à l'univers magique de la mécanique quantique, découverte essentielle du XXe siècle qui défie notre intuition. Vous vous prendrez à rêver de ces photons capricieux, de leurs états intriqués, de ces expériences troublantes aux conclusions inattendues. Voici une fantaisie initiatique qui aborde de manière innovante le problème du temps, les paradoxes de la mécanique quantique et les interrogations sur la simulation des fonctions cérébrales, à travers une intrigue policière originale et les aventures d'une physicienne attachante, passionnée et prête à tout. Laissez-vous entraîner dans un monde enchanté où "l'aléa quantique est le tic-tac de l'horloge divine".

  10. Introduction. Théâtre et révolutions

    Bourdin, Philippe

    2012-01-01

    La réflexion his­­to­­rique, esthé­­tique, musicologique, théo­­rique et cri­­tique sur le théâtre de la Révo­­lu­­tion fran­­çaise a connu depuis le Bicen­­te­­naire une efflo­­res­­cence notoire. Plu­­ri­­dis­­cip­­li­­naire, asso­­ciant his­­to­­riens, his­­to­­riens de l’art, musi­­co­­logues et lit­­té­­raires, cette recherche a jeté ces der­­nières années des ponts solides de part et d’autre de l’Atlan­­tique, et déborde actuel­­le­­ment des fron­­tières fran­­çaises pour trou­­ver écho...

  11. TYPHLOREICHEIA DELLA SARDEGNA: DESCRIZIONE DI TRE NUOVI TAXA E DATI GEONEMICI INEDITI (COLEOPTERA, CARABIDAE

    Paolo Magrini

    2007-10-01

    Full Text Available Nella presente nota vengono descritti tre nuovi taxa di Typhloreicheia Holdhaus, 1924 del Sud della Sardegna e riportati nuovi dati geonemici relativi a Typhloreicheia degiovannii Magrini, 2003 e Typhloreicheia raymondi (Putzeys, 1869. T. petriolii n. sp. di Monte Idda (San Priamo, Muravera, Cagliari, appartenente al “gruppo occulta”, sensu Magrini & Bulirsch 2002, diversa da tutte le altre specie del gruppo per l’edeago meno incurvato ventralmente, l’apice meno inflesso, la lamella copulatrice più corta e ristretta apicalmente anziché dilatata. T. abbazzii n. sp. di Arbus (San Gavino Monreale, Medio Campidano, caratterizzata da un edeago con apice fortemente ricurvo ventralmente e lamella copulatrice costituita da grosse spine evanescenti posizionate lungo il margine inferiore dell’apice dell’edeago, caratteri che pongono la nuova specie in posizione isolata nell’ambito del genere. T. leoi pilosa n. ssp. del Parco di Monte Marganai, loc. Mamenga (Carbonia-Iglesias, appartenente al “gruppo angelae”, sensu Magrini 2003. La nuova razza si differenzia dalla forma tipica essenzialmente per la morfologia esterna: presenza di setole discali elitrali su tutte le interstrie (dalla due alla sette, solo nelle interstrie 3-5-7 nella forma tipica e per l’habitus nettamente più dilatato, specialmente a livello delle elitre, come indicano le misure riportate nel testo.

  12. Lemaître-Tolman-Bondi dust solutions in f (R) gravity

    Sussman, Roberto A.; Jaime, Luisa G.

    2017-12-01

    We derive a class of non-static inhomogeneous dust solutions in f(R) gravity described by the Lemaître-Tolman-Bondi (LTB) metric. The field equations are fully integrated for all parameter subcases and compared with analogous subcases of LTB dust solutions of GR. Since the solutions do not admit regular symmetry centres, we have two possibilities: (i) a spherical dust cloud with angle deficit acting as the source of a vacuum Schwarzschild-like solution associated with a global monopole, or (ii) fully regular dust wormholes without angle deficit, whose rest frames are homeomorphic to the Schwarzschild-Kruskal manifold or to a 3d torus. The compatibility between the LTB metric and generic f(R) ansatzes furnishes an ‘inverse procedure’ to generate LTB solutions whose sources are found from the f(R) geometry. While the resulting fluids may have an elusive physical interpretation, they can be used as exact non-perturbative toy models in theoretical and cosmological applications of f(R) theories.

  13. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  14. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  15. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  16. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  17. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  18. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  19. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  20. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  1. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  2. Global bifurcation of solutions of the mean curvature spacelike equation in certain Friedmann-Lemaître-Robertson-Walker spacetimes

    Dai, Guowei; Romero, Alfonso; Torres, Pedro J.

    2018-06-01

    We study the existence of spacelike graphs for the prescribed mean curvature equation in the Friedmann-Lemaître-Robertson-Walker (FLRW) spacetime. By using a conformal change of variable, this problem is translated into an equivalent problem in the Lorentz-Minkowski spacetime. Then, by using Rabinowitz's global bifurcation method, we obtain the existence and multiplicity of positive solutions for this equation with 0-Dirichlet boundary condition on a ball. Moreover, the global structure of the positive solution set is studied.

  3. Des agriculteurs éthiopiens réussissent à accroître le rendement et ...

    14 janv. 2013 ... Des chercheurs canadiens et éthiopiens testent, adaptent et font connaître des solutions pratiques pour la culture des légumineuses à graines dans des zones où sévit la pauvreté en Éthiopie. Le pois chiche, la lentille et le haricot, entre autres, peuvent combattre la malnutrition et mettre en disponibilité ...

  4. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  5. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  6. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  7. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  8. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  9. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  10. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene

    Lu Zhang

    2017-09-01

    Full Text Available The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE (dsTRE, even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF, and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs. Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP, and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens.

  11. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene.

    Zhang, Lu; Qiu, Ling-Yu; Yang, Hui-Li; Wang, Hui-Juan; Zhou, Min; Wang, Shi-Gui; Tang, Bin

    2017-01-01

    The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE) genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE ( dsTRE ), even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF , and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs . Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP , and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens .

  12. Linear motion feed through with thin wall rubber sealing element

    Mikhailov, V. P.; Deulin, E. A.

    2017-07-01

    The patented linear motion feedthrough is based on elastic thin rubber walls usage being reinforced with analeptic string fixed in the middle part of the walls. The pneumatic or hydro actuators create linear movement of stock. The length of this movement is two times more the rubber wall length. This flexible wall is a sealing element of feedthrough. The main advantage of device is negligible resistance force that is less then mentioned one in sealing bellows that leads to positioning error decreasing. Nevertheless, the thin wall rubber sealing element (TRE) of the feedthrough is the main unreliable element that was the reason of this element longevity research. The theory and experimental results help to create equation for TRE longevity calculation under vacuum or extra high pressure difference action. The equation was used for TRE longevity determination for hydraulic or vacuum equipment realization also as it helps for gas flow being leaking through the cracks in thin walls of rubber sealing element of linear motion feedthrough calculation.

  13. Phenomenological constraints on Lemaître-Tolman-Bondi cosmological inhomogeneities from solar system dynamics

    Iorio, Lorenzo

    2010-06-01

    We, first, analytically work out the long-term, i.e. averaged over one orbital revolution, perturbations on the orbit of a test particle moving in a local Fermi frame induced therein by the cosmological tidal effects of the inhomogeneous Lemaître-Tolman-Bondi (LTB) model. The LTB solution has recently attracted attention, among other things, as a possible explanation of the observed cosmic acceleration without resorting to dark energy. Then, we phenomenologically constrain both the parameters K1 doteq ddot frakR / frakR and K2 doteq ddot frakR' / frakR' of the LTB metric in the Fermi frame by using different kinds of solar system data. The corrections Δdot varpi to the standard Newtonian/Einsteinian precessions of the perihelia of the inner planets recently estimated with the EPM ephemerides, compared to our predictions for them, yield preliminarily K1 = (4±8) × 10-26 s-2, K2 = (3±7) × 10-23 s-2. The residuals of the Cassini-based Earth-Saturn range, compared with the numerically integrated LTB range signature, allow to preliminarily obtain K1 approx K2 approx 10-27 s-2. Actually, the LTB effects should be explicitly modeled in the ephemerides softwares, so that the entire planetary and spacecraft data sets should be accordingly re-processed. The LTB-induced distortions of the orbit of a typical object of the Oort cloud with respect to the commonly accepted Newtonian picture, based on the observations of the comet showers from that remote region of the solar system, point towards K1 approx K2lesssim10-30-10-32 s-2. Such figures have to be compared with those inferred from cosmological data which are of the order of K1 approx K2 = -4 × 10-36 s-2.

  14. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  15. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  16. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  17. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  19. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  20. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  1. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  2. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  3. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  4. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  5. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  6. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  7. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  8. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  9. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  10. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  11. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  12. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  13. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  14. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  15. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  16. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  17. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  18. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  19. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  20. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  1. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  2. Théâtre et Neuroscience: l’éveil d’un nouveau dialogue entre arts et science

    Dorys Faria

    2014-05-01

    Full Text Available Cet article a pour but de démontrer, à travers une perspective historique, que l’étude neurophysiologique et expressive des émotions surgit en tant que vecteur facilitateur du dialogue entre le théâtre et les sciences du vivant. Font également partie de ce travail l’exploration de certains concepts neuroscientifiques actuellement utilisés dans la recherche expérimentale sur les émotions humaines, ainsi que la réflexion sur les liens possibles entre la neuroscience des émotions et le travail de l’acteur

  3. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  4. Transfer Rate Edited experiment for the selective detection of Chemical Exchange via Saturation Transfer (TRE-CEST)

    Friedman, Joshua I.; Xia, Ding; Regatte, Ravinder R.; Jerschow, Alexej

    2015-07-01

    Chemical Exchange Saturation Transfer (CEST) magnetic resonance experiments have become valuable tools in magnetic resonance for the detection of low concentration solutes with far greater sensitivity than direct detection methods. Accurate measures of rates of chemical exchange provided by CEST are of particular interest to biomedical imaging communities where variations in chemical exchange can be related to subtle variations in biomarker concentration, temperature and pH within tissues using MRI. Despite their name, however, traditional CEST methods are not truly selective for chemical exchange and instead detect all forms of magnetization transfer including through-space NOE. This ambiguity crowds CEST spectra and greatly complicates subsequent data analysis. We have developed a Transfer Rate Edited CEST experiment (TRE-CEST) that uses two different types of solute labeling in order to selectively amplify signals of rapidly exchanging proton species while simultaneously suppressing 'slower' NOE-dominated magnetization transfer processes. This approach is demonstrated in the context of both NMR and MRI, where it is used to detect the labile amide protons of proteins undergoing chemical exchange (at rates ⩾ 30 s-1) while simultaneously eliminating signals originating from slower (∼5 s-1) NOE-mediated magnetization transfer processes. TRE-CEST greatly expands the utility of CEST experiments in complex systems, and in-vivo, in particular, where it is expected to improve the quantification of chemical exchange and magnetization transfer rates while enabling new forms of imaging contrast.

  5. Transfer Rate Edited experiment for the selective detection of Chemical Exchange via Saturation Transfer (TRE-CEST).

    Friedman, Joshua I; Xia, Ding; Regatte, Ravinder R; Jerschow, Alexej

    2015-07-01

    Chemical Exchange Saturation Transfer (CEST) magnetic resonance experiments have become valuable tools in magnetic resonance for the detection of low concentration solutes with far greater sensitivity than direct detection methods. Accurate measures of rates of chemical exchange provided by CEST are of particular interest to biomedical imaging communities where variations in chemical exchange can be related to subtle variations in biomarker concentration, temperature and pH within tissues using MRI. Despite their name, however, traditional CEST methods are not truly selective for chemical exchange and instead detect all forms of magnetization transfer including through-space NOE. This ambiguity crowds CEST spectra and greatly complicates subsequent data analysis. We have developed a Transfer Rate Edited CEST experiment (TRE-CEST) that uses two different types of solute labeling in order to selectively amplify signals of rapidly exchanging proton species while simultaneously suppressing 'slower' NOE-dominated magnetization transfer processes. This approach is demonstrated in the context of both NMR and MRI, where it is used to detect the labile amide protons of proteins undergoing chemical exchange (at rates⩾30s(-1)) while simultaneously eliminating signals originating from slower (∼5s(-1)) NOE-mediated magnetization transfer processes. TRE-CEST greatly expands the utility of CEST experiments in complex systems, and in-vivo, in particular, where it is expected to improve the quantification of chemical exchange and magnetization transfer rates while enabling new forms of imaging contrast. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  7. An update to the HIV-TRePS system: the development of new computational models that do not require a genotype to predict HIV treatment outcomes.

    Revell, Andrew D; Wang, Dechao; Wood, Robin; Morrow, Carl; Tempelman, Hugo; Hamers, Raph; Alvarez-Uria, Gerardo; Streinu-Cercel, Adrian; Ene, Luminita; Wensing, Annemarie; Reiss, Peter; van Sighem, Ard I; Nelson, Mark; Emery, Sean; Montaner, Julio S G; Lane, H Clifford; Larder, Brendan A

    2014-04-01

    The optimal individualized selection of antiretroviral drugs in resource-limited settings is challenging because of the limited availability of drugs and genotyping. Here we describe the development of the latest computational models to predict the response to combination antiretroviral therapy without a genotype, for potential use in such settings. Random forest models were trained to predict the probability of a virological response to therapy (HIV RNA/mL) following virological failure using the following data from 22,567 treatment-change episodes including 1090 from southern Africa: baseline viral load and CD4 cell count, treatment history, drugs in the new regimen, time to follow-up and follow-up viral load. The models were assessed during cross-validation and with an independent global test set of 1000 cases including 100 from southern Africa. The models' accuracy [area under the receiver-operating characteristic curve (AUC)] was evaluated and compared with genotyping using rules-based interpretation systems for those cases with genotypes available. The models achieved AUCs of 0.79-0.84 (mean 0.82) during cross-validation, 0.80 with the global test set and 0.78 with the southern African subset. The AUCs were significantly lower (0.56-0.57) for genotyping. The models predicted virological response to HIV therapy without a genotype as accurately as previous models that included a genotype. They were accurate for cases from southern Africa and significantly more accurate than genotyping. These models will be accessible via the online treatment support tool HIV-TRePS and have the potential to help optimize antiretroviral therapy in resource-limited settings where genotyping is not generally available.

  8. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  10. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  11. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  12. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  13. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  14. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  15. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  16. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  18. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  19. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  20. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  1. Manlighet i kris? Några anmärkningar om mansporträtt i tre populärlitterära romaner

    Szymoniak, Katarzyna

    2010-01-01

    I artikeln konfronteras Susan Faludis och Thomas Johanssons teori om manlighetskris med mansporträtt i tre svenska populärlitterära romaner. Teorin om manlighetskris uppstod i samband med feminism. Enligt forskarna visar sig manlighetskrisen i mäns oförmåga att ingå nära relationer, ensamhet och rädsla att inte leva upp till mansidealet. Tre svenska populärromaner Pappadagar i Råttans år av Daniel Möllberg (2007), Vi som aldrig sa hora av Ronnie Sandahl (2007) and Vi har redan sagt hej då av ...

  2. La m?taplasie osteoide de l'endom?tre apr?s une grossesse ? terme: ? propos d'un cas rare

    Jayi, Sofia; Bouguern, Hakima; Fatemi, Hind; Chaara, Hikmat; Laamarti, Afaf; Melhouf, Aabdelilah

    2013-01-01

    La m?taplasie ost?o?de de l'endom?tre (MOE) est une entit? rare correspondant ? la pr?sence de tissu osseux dans l'endom?tre, elle est le plus souvent diagnostiqu?e dans un contexte d'infertilit? secondaire faisant suite ? une grossesse interrompue. M?me si plusieurs facteurs de risque sont r?pertori?s, sa physiopathologie reste mal connue et sa traduction clinique est tr?s variable. Nous rapportons un cas de MOE apparu suite ? un curetage pour r?tention placentaire en post-partum. Le diagnos...

  3. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  5. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  6. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  7. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  9. Noise Training - ’Bruit – Connaître les risques liés au bruit‘

    HR Department

    2010-01-01

    Several sessions of the ‘Bruit – Connaître les risques liés au bruit’ course will be held in February 2010. This course is intended for the members of the personnel who are exposed to the noise on a regular basis or punctually, and, in priority to those persons who wear hearing protections. The objective of the training is to explain: That noise is a progressive evil, not painful but with irreversible effects That the only effective action to preserve his hearing is prevention through protection Programme of the course: Noise in the workplace: localization of noisy places; Analysis of a questionnaire: questions and answers; Noise: definitions and elementary notions; How the hearing works; The effects of noise on hearing; The audiogram; The individual hearing protection; How to gradually get used to hearing protection? Duration: 2h30 Language: English or French To subscribe, please create a training request on EDH...

  10. Bilderboken ur ett genusperspektiv : En bilderboksanalys av tre svenska böcker som utmanar stereotypa könsroller

    Malmqvist, Hanna

    2015-01-01

    Syftet med denna studie är att se hur några bilderböcker utmanar de stereotypa könsrollerna. Jag kommer att granska hur pojkar och flickor framställs ur ett genusperspektiv och även titta på hur text och bild kompletterar varandra, med hjälp av Nikolajevas (2000) analysmodell för bilderböcker. Jag har valt att analysera tre stycken böcker och två av dessa har pojkar som huvudkaraktärer och en har en flicka som huvudkaraktär. Med den medvetenhet man har idag kring genus så kan dessa böcker var...

  11. Sartre, en l’année de son centenaire : mauvais maître ou boussole éthique ?

    Annie Cohen-Solal

    2007-06-01

    Full Text Available En France, peu de centenaires ont fait l’objet, comme celui de Sartre en 2005, d’une aussi négative unanimité. Hormis Les Temps Modernes et Libération (dont il fut le fondateur, pratiquement toute la presse colporta les mêmes clichés, en le stigmatisant en mauvais maître, en penseur démodé ou encore en imposteur. Le magazine L’Histoire reprit de vieilles insinuations, sans fondement scientifique, sur les occupations du philosophe pendant l’occupation nazie. Le Nouvel Observateur poursuivit la salve, avec le titre accrocheur de « Faut‐il brûler Sartre ? »

  12. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  13. Performance ReviewStories by Alice Munro: “The Office” and “Dolly”Théâtre Adyar, Paris, May 5

    Bigot, Corinne

    2015-01-01

    Critique théâtrale, 5 mai 2015 Spectacle: Stories by Alice Munro “The Office” and “Dolly”: Théâtre Adyar, Paris 5 et 6 mai 2015 Theatre review, May 5th 2015 Show: Stories by Alice Munro: “The Office” and “Dolly”—May 5th & May 6th 2015

  14. Christophe Couderc, dir., Le théâtre Espagnol du Siècle d'Or en France. De la traduction au transfert culturel

    Christian Andrès

    2012-12-01

    Full Text Available Review of Christophe Couderc, Le théâtre Espagnol du Siècle d'Or en France. De la traduction au transfert culturel, Presses Universitaires de Paris Ouest, París, 2012, 299 pp. ISBN: 978-2-84016-102-8.

  15. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  16. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  17. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  18. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  19. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  20. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  1. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  2. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  3. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  4. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  5. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  6. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  7. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  8. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  9. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  10. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  11. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  12. La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

    Giuseppe Bonaccorso

    2014-06-01

    . The most important aspects of the eastern quadrant of the Roman periphery are described “from the inside”, accentuating the passages, spaces and elements of composition standing in the origin of form and structure of the neighborhoods in the vicinity of Great Circular Road. The article proposes that the key episodes in this process are the new churches by internationally famous architects, created as new focal points for peripheral neighborhoods whilst replacing libraries, squares and malls. Recent realizations are seen as intention to enforce, or, better, to construct, an identity factor for each of the neighborhoods in the dicussed sector of the city. Starting from the general discourse, the article focuses on one church and one neighborhood that might be considered as models to follow in the entire periphery around GCR: the jubilee church of God the Father of Mercy designed by Richard Meier in the neighborhood of Tor Tre Teste. The sequence of events related to the architectural competition for the church, the choice of proposal by Richard Meier, the complexity of construction as well as the technical, stylistic and symbolical analysis of the building are put in relation to the neighborhood, and finally read as an attempt to create centre of attention for the entire periphery.

  13. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  14. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  15. Radiographic element

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  16. Georges Lemaître et la théorie du big bang qu'y avait-t-il au commencement de l'univers ?

    Landa, Pauline

    2015-01-01

    Découvrez enfin tout ce qu'il faut savoir sur Georges Lemaître et ses inventions en moins d'une heure !L'origine de l'univers, voilà une problématique qui a tenu en haleine de très nombreux scientifiques. Alors que l'on pourrait croire que l'homme s'est posé cette question depuis la nuit des temps, il n'en est rien. C'est Georges Lemaître, un prêtre belge et grand astrophysicien, qui le premier cherche à dater l'univers et à tenter de découvrir ce qu'il y avait au commencement, alors même que l'ensemble de la communauté scientifique était persuadé qu'il avait toujours exis

  17. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  18. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  19. A novel device for measuring arterial stiffness using finger-toe pulse wave velocity: Validation study of the pOpmètre®.

    Alivon, Maureen; Vo-Duc Phuong, Thao; Vignon, Virginie; Bozec, Erwan; Khettab, Hakim; Hanon, Olivier; Briet, Marie; Halimi, Jean-Michel; Hallab, Magid; Plichart, Matthieu; Mohammedi, Kamel; Marre, Michel; Boutouyrie, Pierre; Laurent, Stéphane

    2015-04-01

    The finger-toe pathway could be a good alternative for assessing arterial stiffness conveniently. To evaluate the accuracy of the pOpmètre®--a new device that measures finger-toe pulse wave velocity (ft-PWV). The pOpmètre has two photodiode sensors, positioned on the finger and the toe. Pulse waves are recorded continuously for 20 seconds, and the difference in pulse wave transit time between toe and finger (ft-TT) is calculated. The travelled distance is estimated using subject height. Study 1 compared ft-PWV with carotid-femoral PWV (cf-PWV) obtained by the reference method (SphygmoCor®) in 86 subjects (mean age 53±20 years), including 69 patients with various pathologies and 17 healthy normotensives. Study 2 compared changes in ft-PWV and cf-PWV during a cold pressor test in 10 healthy subjects. Study 3 assessed repeatability in 45 patients. ft-PWV correlated significantly with cf-PWV (R2=0.43; P<0.0001). A better correlation was found in terms of transit time (R2=0.61; P<0.0001). The discrepancy between transit times was related to age. The cold pressor test induced parallel changes in cf-PWV and ft-PWV, with increased aortic stiffness that was reversible during recovery. Intra-session repeatability was very good, with a coefficient of variation of 4.52%. The pOpmètre® allows measurement of arterial stiffness in routine clinical practice. The greatest advantages of ft-PWV are simplicity, rapidity, feasibility, acceptability by patients and correct agreement with the reference technique. Further studies are needed to adjust for bias and to validate the pOpmètre in larger populations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  1. Standard elements; Elements standards

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  2. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  3. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  4. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  5. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  6. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  7. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  8. A (giant) void is not mandatory to explain away dark energy with a Lemaître-Tolman model

    Célérier, M.-N.; Bolejko, K.; Krasiński, A.

    2010-07-01

    Context. Lemaître-Tolman (L-T) toy models with a central observer have been used to study the effect of large scale inhomogeneities on the SN Ia dimming. Claims that a giant void is mandatory to explain away dark energy in this framework are currently dominating. Aims: Our aim is to show that L-T models exist that reproduce a few features of the ΛCDM model, but do not contain the giant cosmic void. Methods: We propose to use two sets of data - the angular diameter distance together with the redshift-space mass-density and the angular diameter distance together with the expansion rate - both defined on the past null cone as functions of the redshift. We assume that these functions are of the same form as in the ΛCDM model. Using the Mustapha-Hellaby-Ellis algorithm, we numerically transform these initial data into the usual two L-T arbitrary functions and solve the evolution equation to calculate the mass distribution in spacetime. Results: For both models, we find that the current density profile does not exhibit a giant void, but rather a giant hump. However, this hump is not directly observable, since it is in a spacelike relation to a present observer. Conclusions: The alleged existence of the giant void was a consequence of the L-T models used earlier because their generality was limited a priori by needless simplifying assumptions, like, for example, the bang-time function being constant. Instead, one can feed any mass distribution or expansion rate history on the past light cone as initial data to the L-T evolution equation. When a fully general L-T metric is used, the giant void is not implied.

  9. Disparaître dans la fiction. La traversée du miroir du Docteur Pasavento

    Charline Pluvinet

    2010-09-01

    Full Text Available Cet article s’attache à explorer dans Docteur Pasavento les modalités et les enjeux d’une réinvention fictionnelle de soi qui se déploie selon un dispositif complexe : le personnage éponyme, qui orchestre sa propre disparition pour se donner de nouvelles identités fictives, est lui-même une projection de l’écrivain. Se réalise dans le roman une alliance entre l’aspiration à disparaître et le désir de rendre indistinctes fiction et réalité, que nous proposons d’éclairer par la métaphore carrollienne de la traversée du miroir où ces mouvements se conjuguent. Il s’agira de rendre perceptible la dynamique fictionnelle qui anime l’écriture romanesque d’Enrique Vila-Matas. This article endeavours to explore the stakes and modalities of the fictional re-invention of the self that takes place in Docteur Pasavento.In the novel, this reinvention arranges itself in accordance to a complex scheme : by orchestrating his own disappearance in order to confer upon himself new fictitious identities, the eponymous character of the novel becomes a projection of the author himself. In the novel, the aspiration to disappear is thus unified with a desire to blur the boundaries between fiction and reality. I intend to shed light on this union by invoking the Carrollian metaphor of passing “through the looking-glass”. The intention of this article is to render evident the fictional dynamism that underpins the novelistic writings of Enrique Vila-Matas.

  10. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  11. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  12. Improviser en classe de Français Langue Étrangère : spontanéité et réflexion à travers le théâtre-forum

    Claire Del Olmo

    2015-02-01

    Full Text Available Depuis l’avènement des approches communicatives, les enseignants de Français Langue Étrangère (FLE mettent souvent en place des jeux de rôles. Cependant, leur pertinence a été remise en question. Aujourd’hui, les enseignants se tournent vers des formes de théâtre permettant aux apprenants une pratique improvisée de la langue cible. Dans cet article, nous nous proposons de mettre en avant dans quelle mesure l’improvisation inhérente au théâtre-forum favorise l’enseignement/apprentissage du FLE. Nous expliciterons, dans un premier temps, les caractéristiques du théâtre-forum. Puis, nous soulignerons les avantages de l’improvisation que comprend cette forme de théâtre quand il s’agit d’enseigner le FLE. Nous rapporterons une expérience menée auprès d’étudiants Erasmus. Nous proposerons une modélisation de la dynamique et des enjeux de l’improvisation liée au théâtre-forum dans le champ du FLE. Nous finirons par expliquer comment un enseignant peut mettre en place une séance de théâtre-forum. Notre but sera de fournir les outils nécessaires à sa mise en place.

  13. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  15. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  16. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  17. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  18. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  19. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  20. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  1. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  2. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  3. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  4. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  5. Galvanic element. Galvanisches Element

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  6. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  7. Tre uger 'over there'

    Brandt, Eva; Binder, Thomas

    2007-01-01

    Vi ser ofte mod USA når der skal findes inspiration for udviklingen af det hjemlige. IDEO er en af de mest interessante design konsulentvirksomheder, og Institute of Design på IIT i Chicago (ID) er den første amerikanske uddannelsesinstitution, der har påbegyndt forskeruddannelsen i design. Vi tog...

  8. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  9. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  10. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  11. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  12. [Increase of entomological indices during the pre-epidemic period of dengue in Ben Tre, South Vietnam].

    Nguyen, T P Q; Luu, L L; Vu, T Q H; Buisson, Y

    2011-10-01

    Dengue has emerged in Vietnam 50 years ago and since has become endemo-epidemic throughout the whole country. Each year, major epidemics of dengue fever (DF) and dengue hemorrhagic fever (DHF) hit South Vietnam during the rainy season, causing significant morbidity and mortality, especially among young children. The only preventive measure is vector control, but it is often implemented too late or indiscriminately. The aim of this study was to investigate, in the pre-epidemic stage, the existence of significant changes in vector indices, which will predict DF/DHF outbreaks. We conducted a descriptive transversal study, repeated once a month for four months (March to June) in the village of Locthuan (province Ben Tre) in the Mekong's delta. Adult mosquitoes were caught in 30 houses, and larvae were collected in water holding containers of 50 houses. The houses were randomly selected. Vector densities were calculated according to the indices recommended by WHO. Virological analysis was carried out on lots of female Aedes and larvae in order to determine viral infection rates. Catches of adult mosquitoes collected 496 specimens including 329 Aedes, 139 Culex and 28 Anopheles. Aedes aegypti was present in 63% of visited homes that is an average density of 1.8 mosquitoes per house. The increase in imaginal indices during the 4 months was not significant. The survey of breeding sites of Ae. aegypti identified 1292 water containers in which 71,569 larval specimens were collected. The values of house index, container index [CI] and Breteau index [BI] increased each month, the latter from 166 to 442. This increase was significant for CI and BI. Breeding sites were mostly intra-home, mainly consisting of large and small ceramic jars. Larval density of Ae. aegypti in the containers also increased significantly over the 4 months. It was correlated with the lack of cover and predators such as Mesocyclops spp., Micronecta spp. and larvivorous fishes. Cultivation of 15 pools of

  13. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  15. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. 2. Le théâtre en révolution. Jeux et enjeux juridiques et politiques 1789–1799

    Jahiel Ruffier-Méray

    2017-08-01

    Full Text Available Cette étude porte sur la manière dont le pouvoir politique a tenté d’instrumentaliser le théâtre et examine les différents moyens juridiques utilisés pour transformer l’art théâtral en outil de propagande durant la période révolutionnaire. Durant tout l’Ancien Régime, le système des spectacles privilégiés règne en maître. En plaçant certaines troupes en situation de monopole, l’État fait le choix d’une politique de régulation des salles. Quant à la surveillance des divertissements, elle est assurée à la fois par la police des spectacles et par la censure. En 1789, avec l’abolition des privilèges, les révolutionnaires remettent en cause tout ce système. Inévitablement, ils sont obligés de s’interroger sur les politiques à mener en matière théâtrale et de repenser les modalités de l’offre artistique. Le théâtre apparaît, dès lors, comme un enjeu majeur situé au cœur des préoccupations révolutionnaires. L’art dramatique concentre à lui seul, toutes les questions débattues avec passion à l’Assemblée.

  17. Hepatic stellate cells lack AP-1 responsiveness to electrophiles and phorbol 12-myristate-13-acetate

    Reichard, John F.; Petersen, Dennis R.

    2004-01-01

    Stellate cell profibrotic gene induction and transdifferentiation are central events in liver fibrosis. Oxidative stress has been implicated as an activator of the transcription factors Nrf2 and AP-1 through shared kinase signaling pathways that also purportedly contribute to stellate cell activation. The present study examined the role of oxidative stress in ARE- and TRE-regulated gene induction in isolated hepatic stellate cells. Using a portion of the human Nqo1 promoter consisting of an ARE imbedded TRE, it was demonstrated that while the ARE was responsible for mediating inducible gene expression in response to the electrophiles 4-HNE and tBHQ, the TRE was refractory to induction by either electrophiles or PMA. It was demonstrated that stellate cells possess nuclear TRE-binding proteins that were identified as JunB, JunD, Fra1, and Fra2, which were unaffected by either electrophiles or PMA treatment. This report demonstrates that, in contrast to the ARE, the TRE and its binding cognate AP-1 did not mediate independent gene induction in hepatic stellate cells. This observation is significant given the presumed importance attributed to AP-1 in mediating profibrogenic gene expression

  18. Partial oxidation of landfill leachate in supercritical water: Optimization by response surface methodology

    Gong, Yanmeng; Wang, Shuzhong; Xu, Haidong; Guo, Yang; Tang, Xingying

    2015-01-01

    Highlights: • Partial oxidation of landfill leachate in supercritical water was investigated. • The process was optimized by Box–Behnken design and response surface methodology. • GY H2 , TRE and CR could exhibit up to 14.32 mmol·gTOC −1 , 82.54% and 94.56%. • Small amounts of oxidant can decrease the generation of tar and char. - Abstract: To achieve the maximum H 2 yield (GY H2 ), TOC removal rate (TRE) and carbon recovery rate (CR), response surface methodology was applied to optimize the process parameters for supercritical water partial oxidation (SWPO) of landfill leachate in a batch reactor. Quadratic polynomial models for GY H2 , CR and TRE were established with Box–Behnken design. GY H2 , CR and TRE reached up to 14.32 mmol·gTOC −1 , 82.54% and 94.56% under optimum conditions, respectively. TRE was invariably above 91.87%. In contrast, TC removal rate (TR) only changed from 8.76% to 32.98%. Furthermore, carbonate and bicarbonate were the most abundant carbonaceous substances in product, whereas CO 2 and H 2 were the most abundant gaseous products. As a product of nitrogen-containing organics, NH 3 has an important effect on gas composition. The carbon balance cannot be reached duo to the formation of tar and char. CR increased with the increase of temperature and oxidation coefficient

  19. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  20. Après le postdramatique : narration et fiction entre écriture de plateau et théâtre néo-dramatique

    Anne Monfort

    2009-12-01

    Full Text Available Dans le théâtre contemporain, que ce soit en France ou en Allemagne, la notion de récit intervient dans la représentation traditionnelle théâtrale, introduisant une redéfinition de la fiction et de l’acteur.Im zeitgenössischen Theater, sei es in Frankreich oder in Deutschland, werden Erzählung und herkömmliche Bühnendarstellung in Korrelation gebracht, wobei der Begriff der Fiktion sowie die Rolle des Schauspielers als Handlungsträger neu definiert werden.

  1. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  2. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  3. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  4. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  5. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  6. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  7. Être dans la musique Getting into the Music. Aesthetic Experience and “Mind Tripping”

    Laurent Legrain

    2011-02-01

    Full Text Available “Être dans la musique”… cette expression maintes fois entendue dans le cadre d’interviews ou de discussions informelles menées avec des amateurs de jazz montre toute l’importance de ces moments musicaux particuliers dans les trajectoires des amateurs. Mais comment approcher analytiquement cet état fugace et, à la manière des amateurs, le placer au centre de nos préoccupations ? En dénouant le corset kantien qui enserre l’esthétique, de nombreux auteurs ont esquissé les contours d’une notion, celle de l’expérience esthétique, qui s’approche de ce que les amateurs évoquent par cette expression. Le plaisir, l’oubli de soi y sont vus comme des dimensions constitutives. Les concepts de déambulation et de logique dispositive chers au sociologue Emmanuel Belin peuvent nous aider, d’une part, à mieux cerner le dynamisme propre de cette forme d’expérience, et d’autre part, à mieux comprendre comment elle émerge d’un travail collectif sur l’environnement. Sur base de l’ethnographie d’un groupe d’amateurs se mettant en condition pour le concert du soir, cet article propose de rapprocher la notion d’expérience esthétique de celle de déambulation et de dégager la plus-value de ce rapprochement.“Getting into the music”… this expression, often heard in the context of interviews or abstract discussions held with jazz lovers, shows the major importance of these particular musical moments along the paths of jazz lovers. But how to approach this fugacious state analytically and, like jazz lovers, place it at the centre of our concerns ? In untying the Kantian corset bound around aesthetics, many authors have outlined the contours of a concept, that of aesthetic experience, approaching what jazz lovers evoke via this expression. Pleasure and forgetting oneself are seen as constitutive dimensions here. The concepts of “mind tripping” and “dispositive logic” dear to the sociologist Emmanuel

  8. Funcionalidad de Juegos de Estrategia Virtuales y del Software Cabri-géomètre II en el Aprendizaje de la Simetría en Secundaria

    Guadalupe Rodríguez

    2010-06-01

    Full Text Available Presentamos resultados de un estudio exploratorio cuyo propósito es indagar sobre el uso del Cabri-Géomètre II y de un juego matemático virtual de estrategia cuando se incluyen en clases ordinarias de matemáticas de estudiantes de 12-13 años en una escuela secundaria pública de México. Para este trabajo, el tema abordado fue la simetría. El análisis de datos permitió ver la funcionalidad de estos ambientes para transformar las nociones del alumno sobre el tema y para reconocer que se puede avanzar en el desarrollo de un pensamiento matemático distinto a través de ambientes de aprendizaje computacionales. We present the results of an exploratory study whose purpose was to explore the use by 12-13 years old students of Cabri-Géomètre II and a mathematical strategic virtual game in a Mexican state school. For this paper, the mathematical focus was on symmetry. The data analysis allowed us to observe the functionality of this learning environment to transform the students’ conceptions and to recognize that a different type of mathematical thinking can be developed with these computational learning environments.

  9. La métaplasie osteoide de l'endomètre après une grossesse à terme: à propos d'un cas rare

    Jayi, Sofia; Bouguern, Hakima; Fatemi, Hind; Chaara, Hikmat; Laamarti, Afaf; Melhouf, Aabdelilah

    2013-01-01

    La métaplasie ostéoïde de l'endomètre (MOE) est une entité rare correspondant à la présence de tissu osseux dans l'endomètre, elle est le plus souvent diagnostiquée dans un contexte d'infertilité secondaire faisant suite à une grossesse interrompue. Même si plusieurs facteurs de risque sont répertoriés, sa physiopathologie reste mal connue et sa traduction clinique est très variable. Nous rapportons un cas de MOE apparu suite à un curetage pour rétention placentaire en post-partum. Le diagnostic a été suspecté par l'hystéroscopie et confirmé par l’étude anatomopathologique. A notre connaissance c'est le premier cas décrit suite à un accouchement à terme. A travers notre cas et à la lumière d'une revue de la littérature nous insistons sur les caractéristiques épidémiologiques, physiopathologiques, cliniques et para cliniques de cette entité rare, dont la connaissance est primordiale pour un diagnostic sûr et par conséquent un traitement adapté permettant souvent de récupérer la fertilité de la patiente. PMID:23898363

  10. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  12. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  13. Transplutonium elements

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  14. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  15. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  16. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  17. Effects of tire inclination (turning traffic and dynamic loading on the pavement stress–strain responses using 3-D finite element modeling

    Xiaodi Hu

    2017-07-01

    Full Text Available In this study, ABAQUS finite element (FE modeling in three-dimensional (3-D loading mode was utilized to analytically investigate and quantify the effects of tire inclination and dynamic loading on the stress–strain responses of a pavement structure under varying loading and environmental conditions. The input variables for modeling consisted of actual laboratory and field data obtained from an in-service highway US 59 and included the in-situ pavement structure, material properties (i.e., modulus and shear strength, traffic, and climatic (i.e., temperature data. Computational modeling and sensitivity analyses were conducted through variation of the following two input variables with a focus on the top surfacing hot-mix asphalt (HMA layer: a tire inclination angle to simulate turning traffic, and, b dynamic loading to simulate accelerating, steady rolling, and decelerating (braking traffic. The generated maximum shear stress and vertical strain responses were then analyzed and correlated to the HMA material strength and the actual measured/observed field rutting performance data. The corresponding results indicated that inclined tires (simulating turning traffic and decelerating (braking vehicles induced the most severe shear stresses and vertical strains on the pavement structure in terms of magnitude (i.e., increased; exceeding the HMA material strength in some cases. Thus, for pavement design and structural analysis purposes, the following critical highway areas that may be subjected to extreme stresses and strains due to turning and stopping (braking traffic, particularly in high temperature environments, should be given more attention with respect to material strength characterization to mitigate potential shear/rutting failures: intersections, junctions; urban stop–go sections, and curves. Keywords: 3-D FE stress–strain modeling, Rutting, Shear deformation, Shear stress, Vertical strains

  18. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  19. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  20. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  1. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  2. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  4. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  5. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  6. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  7. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  8. Investigation on the Cyclic Response of Superelastic Shape Memory Alloy (SMA Slit Damper Devices Simulated by Quasi-Static Finite Element (FE Analyses

    Jong Wan Hu

    2014-02-01

    Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.

  9. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  10. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  11. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  12. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  13. Toxic Elements

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  14. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  15. Thermoregulatory responses to skin wetting during prolonged treadmill running.

    Bassett, D R; Nagle, F J; Mookerjee, S; Darr, K C; Ng, A V; Voss, S G; Napp, J P

    1987-02-01

    We examined the physiological responses to skin wetting during a 120-min level treadmill run to assess whether skin wetting would reduce the dehydration and the increase in core temperature associated with prolonged exercise. Testing was conducted in an environmental chamber (T = 29.5 degrees C, wind velocity = 3 m X sec-1) under two different humidity conditions (33 or 66% relative humidity). Ten male subjects performed two runs in each humidity condition; one served as a control run. The other included spraying the body with 50 ml of water (T = 29.5 degrees C) every 10 min. Spraying had no effect on rectal temperature (Tre), heart rate, oxygen consumption, perceived exertion, sweat loss, or percent change in plasma volume in both the humid and the dry conditions. Spraying produced a significant reduction in mean skin temperature (Tsk), which increased the (Tre - Tsk) gradient. At the same time, overall skin conductance (K) was decreased, presumably as a result of cutaneous vasoconstriction due to the low Tsk. Since heat transfer from the body's core to the skin is expressed by the equation: heat transfer = K X (Tre - Tsk) the spraying had no effect on heat transfer away from the core, and Tre remained unchanged.

  16. Autun (Saône-et-Loire. Étude archéologique du cloître canonial de Saint-Nazaire

    Walter Berry

    2004-12-01

    Full Text Available L’année 2003, qui marquait à la fois les 20 ans de recherches entreprises à l’initiative de Christian Sapin et la fin des investigations de terrain, fut très fructueuse. En effet, outre une étude complémentaire de la zone occidentale du cloître, riche en découvertes, la galerie orientale qui a particulièrement retenu notre attention, recelait des informations capitales pour comprendre de façon plus précise l’histoire du site. À l’est, justement, d’autres parties d’une vaste habitation de l’An...

  17. Marins, terriens et touristes sur la côte d’Albâtre: «renoncer, moi? jamais!»

    Barbara Evrard

    2009-10-01

    Full Text Available L’objectif de cet article est de montrer et de questionner la territorialisation de la Côte d’Albâtre à partir des expériences corporelles qui s’y déploient. Ce littoral, à première vue peu propice au développement des loisirs, sert pourtant de «terrain de jeu» à quelques pratiquants d’activités de nature. Nous cherchons à mieux comprendre dans quelle mesure les activités de nature participent de la production d’usages et d’images constitutifs de médiation(s territoriale(s et d’identité maritime spécifique à la Haute-Normandie et dans le même temps distincte de celle des non pratiquants.

  18. A 'college of astrology and medicine'? Charles V, Gervais Chrétien, and the scientific manuscripts of Maître Gervais's College.

    Boudet, Jean-Patrice

    2010-06-01

    Considered an institution mainly devoted to astrology and medicine by Simon de Phares and by some historians who believe that he was reliable, the college founded in 1371 by Charles V's first physician, Gervais Chrétien, was in fact primarily dedicated to theological students. It was not before 1377 that there were created there two bursaries for scholares regis, specialising in 'licit mathematical sciences', and two medical fellowships. Yet the influence of the activity of these fellows seems to have been rather moderate and-as far as we can learn from the material still extant, notably from manuscripts that belonged to Maître Gervais' College and to some of its members-this institution was devoted much more to theological studies than to medicine and the quadrivium.

  19. Compréhension des mécanismes de séchage dans les matériaux de construction : cas du plâtre

    SECK, Mamadou Diaga

    2015-01-01

    Les enjeux liés aux problématiques de développement durable encouragent de plus en plus d'industriels, dans le secteur du bâtiment, à se lancer dans une politique de réduction de la consommation énergétique de leurs procédés industriels. C'est dans ce cadre qu'est menée cette étude, où nous nous intéressons au cas particulier de la fabrication des plaques de plâtre, qui de par les qualités qu'elles présentent liées à leur caractère pratique et rapide à poser (temps pour le neuf que la rénovat...

  20. Caroline Surmann, Cinéma et théâtre chez Jean Cocteau. Intermédialité et esthétique

    Brangé, Mireille

    2016-01-01

    Dans une démarche artistique considérée comme essentiellement multimédiale et «déambulant entre les arts» (p. 12), la relation établie entre cinéma et théâtre par Cocteau est un terrain de choix pour envisager sa pratique intermédiale. L’A. précise ce concept travaillé d’abord en Allemagne et au Canada et le plus souvent seulement approché en France, et offre une introduction théorique appréciable (pp. 13-15; 47-67) en l’absence, à notre connaissance, de toute traduction française des textes ...

  1. Optimisation and validation of a remote monitoring system (Onco-TreC) for home-based management of oral anticancer therapies: an Italian multicentre feasibility study.

    Passardi, Alessandro; Rizzo, Mimma; Maines, Francesca; Tondini, Carlo; Zambelli, Alberto; Vespignani, Roberto; Andreis, Daniele; Massa, Ilaria; Dianti, Marco; Forti, Stefano; Piras, Enrico Maria; Eccher, Claudio

    2017-05-29

    Despite the growing number of oral agents available for cancer treatment, their efficacy may be reduced due to the lack of adherence, inappropriate adverse event self-management and arbitrary dose adjustment. The management of anticancer therapies could exponentially benefit from the introduction of mobile health technologies in a highly integrated electronic oncology system. We plan to customise and fine-tune an existing monitoring TreC platform used in different chronic diseases in the oncology setting. This project follows a multistep approach with two major purposes: 1. participatory design techniques driven by Health Literacy and Patient Reported Outcomes principles in order to adapt the system to the oncology setting involving patients and healthcare providers; 2. a prospective training-validation, interventional, non-pharmacological, multicentre study on a series of consecutive patients with cancer (20 and 60 patients in the training and validation steps, respectively) in order to assess system capability, usability and acceptability. The novel Onco-TreC 2.0 is expected to contribute to improving the adherence and safety of cancer care, promoting patient empowerment and patient-doctor communication. Ethical approval was obtained from the Independent Ethics Committees of the participating institutions (CEIIAV protocol Number 2549/2015; reference Number 1315-PU). Informed consent will be obtained from all study participants. Findings will be disseminated through peer-reviewed journals, conferences and event presentations. ClinicalTrials.gov (NCT02921724); (Pre-results). Other study ID Number: IRST100.18. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  2. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  3. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  4. Risøs treårsplan 2000-2002. Rullende 3-årsplan med hovedlinier for året 2000 og perspektiver for årene 2001 og 2002

    Forskningscenter Risø, Roskilde

    2000-01-01

    Denne treårsplan fastlægger rammerne for Forskningscenter Risøs virksomhed i perioden 2000 - 2002. Risø hører under Forskningsministeriet og driver naturvidenskabelig og teknisk-videnskabelig forskning med det formål at skabe nye udviklingsmuligheder forerhvervsliv og samfund rettet mod anvendels...

  5. Risøs treårsplan 1999-2001. Rullende 3-årsplan med hovedlinier for året 1999 og perspektiver for årene 2000 og 2001

    Forskningscenter Risø, Roskilde

    1999-01-01

    Denne treårsplan fastlægger rammerne for Forskningscenter Risøs virksomhed i perioden 1999-2001. Risø hører under Forskningsministeriet og driver naturvidenskabelig og teknisk-videnskabelig forskning med det formål at skabe nye udviklingsmuligheder forerhvervsliv og samfund rettet mod anvendelse ...

  6. Anne-Hélène Pitel, Le prosimètre dans l’oeuvre de fiction de Lope de Vega, de «La Arcadia» (1598 à «La Dorotea» (1632

    Javier Rubiera

    2013-05-01

    Full Text Available Review of Anne-Hélène Pitel, Le prosimètre dans l’oeuvre de fiction de Lope de Vega, de «La Arcadia» (1598 à «La Dorotea» (1632, Editorial Academia del Hispanismo, Vigo, 2011, 400 pp. ISBN: 978-84-96915-98-5.

  7. Fuel element

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  8. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  9. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  10. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  11. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, including glucose, on pancreatic development. We previously showed that glucose and its metabolism through the hexosamine biosynthesis pathway (HBP) promote pancreatic endocrine cell differentiation. Here, we analysed the role of the transcription factor carbohydrate-responsive element-binding protein (ChREBP) in this process. This transcription factor is activated by glucose, and has been recently described as a target of the HBP. We used an in vitro bioassay in which pancreatic endocrine and exocrine cells develop from rat embryonic pancreas in a way that mimics in vivo pancreatic development. Using this model, gain-of-function and loss-of-function experiments were undertaken. ChREBP was produced in the endocrine lineage during pancreatic development, its abundance increasing with differentiation. When rat embryonic pancreases were cultured in the presence of glucose or xylitol, the production of ChREBP targets was induced. Concomitantly, beta cell differentiation was enhanced. On the other hand, when embryonic pancreases were cultured with inhibitors decreasing ChREBP activity or an adenovirus producing a dominant-negative ChREBP, beta cell differentiation was reduced, indicating that ChREBP activity was necessary for proper beta cell differentiation. Interestingly, adenovirus producing a dominant-negative ChREBP also reduced the positive effect of N-acetylglucosamine, a substrate of the HBP acting on beta cell differentiation. Our work supports the idea that glucose, through the transcription factor ChREBP, controls beta cell differentiation from pancreatic progenitors.

  12. Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

    Matthew S Lalonde

    2011-05-01

    Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

  13. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  14. Numerical Simulation on Seismic Response of the Filled Joint under High Amplitude Stress Waves Using Finite-Discrete Element Method (FDEM

    Xiaolin Huang

    2016-12-01

    Full Text Available This paper numerically investigates the seismic response of the filled joint under high amplitude stress waves using the combined finite-discrete element method (FDEM. A thin layer of independent polygonal particles are used to simulate the joint fillings. Each particle is meshed using the Delaunay triangulation scheme and can be crushed when the load exceeds its strength. The propagation of the 1D longitude wave through a single filled joint is studied, considering the influences of the joint thickness and the characteristics of the incident wave, such as the amplitude and frequency. The results show that the filled particles under high amplitude stress waves mainly experience three deformation stages: (i initial compaction stage; (ii crushing stage; and (iii crushing and compaction stage. In the initial compaction stage and crushing and compaction stage, compaction dominates the mechanical behavior of the joint, and the particle area distribution curve varies little. In these stages, the transmission coefficient increases with the increase of the amplitude, i.e., peak particle velocity (PPV, of the incident wave. On the other hand, in the crushing stage, particle crushing plays the dominant role. The particle size distribution curve changes abruptly with the PPV due to the fragments created by the crushing process. This process consumes part of wave energy and reduces the stiffness of the filled joint. The transmission coefficient decreases with increasing PPV in this stage because of the increased amount of energy consumed by crushing. Moreover, with the increase of the frequency of the incident wave, the transmission coefficient decreases and fewer particles can be crushed. Under the same incident wave, the transmission coefficient decreases when the filled thickness increases and the filled particles become more difficult to be crushed.

  15. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  16. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  17. Utilization of a hybrid finite-element based registration method to quantify heterogeneous tumor response for adaptive treatment for lung cancer patients

    Sharifi, Hoda; Zhang, Hong; Bagher-Ebadian, Hassan; Lu, Wei; Ajlouni, Munther I.; Jin, Jian-Yue; (Spring Kong, Feng-Ming; Chetty, Indrin J.; Zhong, Hualiang

    2018-03-01

    Tumor response to radiation treatment (RT) can be evaluated from changes in metabolic activity between two positron emission tomography (PET) images. Activity changes at individual voxels in pre-treatment PET images (PET1), however, cannot be derived until their associated PET-CT (CT1) images are appropriately registered to during-treatment PET-CT (CT2) images. This study aimed to investigate the feasibility of using deformable image registration (DIR) techniques to quantify radiation-induced metabolic changes on PET images. Five patients with non-small-cell lung cancer (NSCLC) treated with adaptive radiotherapy were considered. PET-CTs were acquired two weeks before RT and 18 fractions after the start of RT. DIR was performed from CT1 to CT2 using B-Spline and diffeomorphic Demons algorithms. The resultant displacements in the tumor region were then corrected using a hybrid finite element method (FEM). Bitmap masks generated from gross tumor volumes (GTVs) in PET1 were deformed using the four different displacement vector fields (DVFs). The conservation of total lesion glycolysis (TLG) in GTVs was used as a criterion to evaluate the quality of these registrations. The deformed masks were united to form a large mask which was then partitioned into multiple layers from center to border. The averages of SUV changes over all the layers were 1.0  ±  1.3, 1.0  ±  1.2, 0.8  ±  1.3, 1.1  ±  1.5 for the B-Spline, B-Spline  +  FEM, Demons and Demons  +  FEM algorithms, respectively. TLG changes before and after mapping using B-Spline, Demons, hybrid-B-Spline, and hybrid-Demons registrations were 20.2%, 28.3%, 8.7%, and 2.2% on average, respectively. Compared to image intensity-based DIR algorithms, the hybrid FEM modeling technique is better in preserving TLG and could be useful for evaluation of tumor response for patients with regressing tumors.

  18. Plant HDAC inhibitor chrysin arrest cell growth and induce p21WAF1 by altering chromatin of STAT response element in A375 cells

    Pal-Bhadra, Manika; Bhadra, Utpal; Ramaiah, M Janaki; Reddy, T Lakshminarayan; Krishnan, Anita; Pushpavalli, SNCVL; Babu, K Suresh; Tiwari, Ashok K; Rao, J Madhusudana; Yadav, Jhillu S

    2012-01-01

    Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21 WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21 WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK

  19. Response

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  20. PELTIER ELEMENTS

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  1. Transposable elements in cancer.

    Burns, Kathleen H

    2017-07-01

    Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

  2. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  3. Roles of p300 and cyclic adenosine monophosphate response element binding protein in high glucose-induced hypoxia-inducible factor 1α inactivation under hypoxic conditions.

    Ding, Lingtao; Yang, Minlie; Zhao, Tianlan; Lv, Guozhong

    2017-05-01

    Given the high prevalence of diabetes and burn injuries worldwide, it is essential to dissect the underlying mechanism of delayed burn wound healing in diabetes patients, especially the high glucose-induced hypoxia-inducible factor 1 (HIF-1)-mediated transcription defects. Human umbilical vein endothelial cells were cultured with low or high concentrations of glucose. HIF-1α-induced vascular endothelial growth factor (VEGF) transcription was measured by luciferase assay. Immunofluorescence staining was carried out to visualize cyclic adenosine monophosphate response element binding protein (CREB) localization. Immunoprecipitation was carried out to characterize the association between HIF-1α/p300/CREB. To test whether p300, CREB or p300+CREB co-overexpression was sufficient to rescue the HIF-1-mediated transcription defect after high glucose exposure, p300, CREB or p300+CREB co-overexpression were engineered, and VEGF expression was quantified. Finally, in vitro angiogenesis assay was carried out to test whether the high glucose-induced angiogenesis defect is rescuable by p300 and CREB co-overexpression. Chronic high glucose treatment resulted in impaired HIF-1-induced VEGF transcription and CREB exclusion from the nucleus. P300 or CREB overexpression alone cannot rescue high glucose-induced HIF-1α transcription defects. In contrast, co-overexpression of p300 and CREB dramatically ameliorated high glucose-induced impairment of HIF-1-mediated VEGF transcription, as well as in vitro angiogenesis. Finally, we showed that co-overexpression of p300 and CREB rectifies the dissociation of HIF-1α-p300-CREB protein complex in chronic high glucose-treated cells. Both p300 and CREB are required for the function integrity of HIF-1α transcription machinery and subsequent angiogenesis, suggesting future studies to improve burn wound healing might be directed to optimization of the interaction between p300, CREB and HIF-1α. © 2016 The Authors. Journal of Diabetes

  4. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  5. A case report of spontaneous mutation (C33>U) in the iron-responsive element of L-ferritin causing hyperferritinemia-cataract syndrome.

    Cao, Wei

    2010-01-15

    The hereditary hyperferritinemia cataract syndrome (HHCS) is an autosomal dominant disorder characterized by juvenile-onset cataracts and elevated serum ferritin levels. It is caused by mutation in the iron response element (IRE) within the 5\\'UTR of L-ferritin gene. The mutation results in a loss of post-transcriptional negative feedback exerted by the interaction between iron regulatory proteins 1, 2 (IRP1 and IRP2) and IRE, which leads to uncontrolled expression of L-ferritin. In this paper, we describe the molecular pathogenesis of non-hereditary hyperferritinemia cataract syndrome (non-H-HCS) in a patient with typical HHCS ocular lens morphology and high ferritin levels without obvious family history. Initial sequencing of the full-length L-ferritin cloned from genomic DNA demonstrated a mutation (C33>T) in the IRE of the affected patient but not in her unaffected family members. The mutation (C\\/T heterozygote) was also detected in cDNA derived from her blood mononuclear cells. Structure-prediction-modeling indicates that this mutation would significantly alter the secondary structure of the IRE, resulting in a loss of the interaction between IRP and IRE. By using IRP1\\/IRP2-human IgG1 Fc fusion proteins, we established a novel in vitro report system (modified ELISA) to verify impaired IRE\\/IRP binding. Both the C33>U and A40G mutations (the first identified mutation for HHCS) showed a dramatically decreased binding to IRP1\\/IRP2 protein, compared to the normal IRE RNA. Surprisingly, a decrease in L-ferritin mRNA levels was observed in the affected patient compared to controls suggesting a mechanism of transcriptional negative feedback by high intracellular L-ferritin protein levels not described heretofore. Taken together, spontaneous mutation in the IRE of L-ferritin may cause non-H-HCS by the same mechanism as HHCS. In addition, under abnormal circumstances, the protein level of L-ferritin may be principally controlled by post

  6. Fuel element

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  7. Transactinide elements

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)

  8. Separation and Recycling for Rare Earth Elements by Homogeneous Liquid-Liquid Extraction (HoLLE Using a pH-Responsive Fluorine-Based Surfactant

    Shotaro Saito

    2015-08-01

    Full Text Available A selective separation and recycling system for metal ions was developed by homogeneous liquid-liquid extraction (HoLLE using a fluorosurfactant. Sixty-two different elemental ions (e.g., Ag, Al, As, Au, B, Ba, Be, Bi, Ca, Cd, Ce, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Gd, Ge, Hf, Hg, Ho, In, Ir, La, Lu, Mg, Mn, Mo, Nb, Nd, Ni, Os, P, Pb, Pd, Pr, Pt, Re, Rh, Ru, Sb, Sc, Se, Si, Sm, Sn, Sr, Ta, Tb, Te, Ti, Tl, Tm, V, W, Y, Yb, Zn, and Zr were examined. By changing pH from a neutral or alkaline solution (pH ≥ 6.5 to that of an acidic solution (pH < 4.0, gallium, zirconium, palladium, silver, platinum, and rare earth elements were extracted at >90% efficiency into a sedimented Zonyl FSA® (CF3(CF2n(CH22S(CH22COOH, n = 6–8 liquid phase. Moreover, all rare earth elements were obtained with superior extraction and stripping percentages. In the recycling of rare earth elements, the sedimented phase was maintained using a filter along with a mixed solution of THF and 1 M sodium hydroxide aqueous solution. The Zonyl FSA® was filtrated and the rare earth elements were recovered on the filter as a hydroxide. Furthermore, the filtrated Zonyl FSA was reusable by conditioning the subject pH.

  9. L'amélioration des services de garde d'enfants afin d'accroître les ...

    -à déterminer si l'amélioration de l'abordabilité et de la qualité des services de garde augmente la participation au marché du travail, le nombre d'heures travaillées et le revenu gagné; -à favoriser la sensibilisation et les échanges chez les dirigeants communautaires et les responsables des politiques concernant les défis ...

  10. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I

    Seiki, Motoharu; Inoue, Junichiro; Hidaka, Makoto; Yoshida, Mitsuaki

    1988-01-01

    The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40 tax and p27 rex and a cytoplasmic protein, p21 X-III . p40 tax activates transcription from the long terminal repeat (LTR), whereas p27 rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, the authors identify two cis-acting sequence elements needed for regulation by p27 rex : a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27 rex ; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests and unusual regulatory mechanism of RNA processing in the nucleus

  11. Effects of Mushroom and Herb Polysaccharides on Cellular and Humoral Immune Responses of Eimeria tenella-Infected Chickens

    Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Parmentier, H.K.; Li, W.K.; Yang, Z.Q.; Verstegen, M.W.A.

    2004-01-01

    We investigated the effects of polysaccharide extracts from 2 mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and an herb, Astragalus membranaceus (AstE), on cellular and humoral immune responses of Eimeria tenella-infected chickens. A total of 150 broiler chicks were assigned to 5

  12. Coccidiosis Immunization: Effects of Mushroom and Herb Polysaccharides on Immune Responses of Chickens Infected with Eimeria Tenella

    Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Suo, X.; Li, W.K.; Verstegen, M.W.A.

    2005-01-01

    An experiment was conducted to investigate the effects of polysaccharide extracts (E) of two mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and an herb, Astragalus membranaceus (AstE), on the immune responses of chickens infected with Eimeria tenella. A total of 180 broiler

  13. Boundary Element Analysis of the Steady-state Response of an Elastic Half-Space to a Moving Force on its Surface

    Andersen, Lars; Nielsen, Søren R. K.

    2003-01-01

    The paper deals with the boundary element method formulation of the steady-state wave propagation through elastic media due to a source moving with constant velocity. The Greens' function for the three-dimensional full-space is formulated in a local frame of reference following the source...... is approximated, but the error which is introduced in this way is insignificant. Numerical examples are given for a moving rectangular load on an elastic half-space. The result from a boundary element code based on the derived Green's function are compared with a semi-analytic solution....

  14. Influence of easily ionised elements on the delayed responses of the emission intensities of an analyte in a power modulated U-shaped argon stabilised DC arc plasma with an aerosol supply

    MIROSLAV KUZMANOVIC

    2005-09-01

    Full Text Available The current of a U-shaped argon stabilised DC arc was square modulated with a 40 Hz repetition frequency between 6 and 3 A. The delayed line intensity responses to the modulation of the arc current were investigated using calcium as a representative analyte. The intensities of both the atomic and ionic lines were monitored at different distances from the arc axis in the presence of various concentrations of the easily ionised element. Temporal evolutions were monitored on a millisecond time scale. It was found that the responses of the line intesity to the arc current change strongly depended on the observed radial position, especially in the vicinity of the arc axis. The obtained results showed a significant influence of even small amounts of the easily ionised element on the excitation and transport of the analyte and indicated a way of possibly improving the analytical capabilities of the excitation source.

  15. New elements

    Flerov, G.

    1976-01-01

    The history is briefly described of the investigation of superheavy elements at the Joint Institute for Nuclear Research at Dubna. The significance of the investigation is assessed from the point of view of the nuclear structure study and major problems encountered in experimental efforts are indicated. Current experimental methods aiming at the discovery or the production of superheavy nuclei with Z approximately 114 are listed. (I.W.)

  16. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  17. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  18. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  19. Varying response of the concentration and content of soybean seed mineral elements, carbohydrates, organic acids, amino acids, protein, and oil to phosphorus starvation and CO2 enrichment

    A detailed investigation of the concentration (g-1 seed weight) and content (g plant-1) of seed mineral elements and metabolic profile under phosphorus (P) starvation at ambient (aCO2) and elevated carbon dioxide (eCO2) in soybean is limited. Soybean plants were grown in a controlled environment at ...

  20. Neither Reb1p nor poly(dA*T) elements are responsible for the highly specific chromatin organization at the ILV1 promoter

    Moreira, José Manuel Alfonso; Hörz, Wolfram; Holmberg, Steen

    2001-01-01

    Analysis of the chromatin structure at the yeast ILV1 locus revealed highly positioned nucleosomes covering the entire locus except for a hypersensitive site in the promoter region. All previously identified cis-acting elements required for GCN4-independent ILV1 basal level transcription, includi...

  1. Bilans w warunkach utraty kontynuacji działalności– zasada ostrożności czy treść ekonomiczna

    Ewa Walińska

    2009-10-01

    Full Text Available Przedmiotem rozważań w niniejszym artykule są obecnie obowiązujące zasady sporządzania bilansu przedsiębiorstwa, które straciło zdolność do kontynuacji działalności z powodu postępowania upadłościowego. Bilans likwidacyjny rozpoczyna ostatni cykl życia przedsiębiorstwa – zakończenie jego działalności. W tym okresie zmieniają się cele działalności gospodarczej: jedynym celem staje się sprzedaż jego majątku. Brak zasady kontynuacji działalności przedsiębiorstwa upoważnia, zdaniem autorów, do odstępstw od pewnych zasad rachunkowości, głównie ostrożności, na rzecz zasady treści ekonomicznej. Takie odstępstwo realizuje zapisaną w prawie bilansowym koncepcję true and fair. W artykule postuluje się przyjęcie do wyceny majątku w bilansie likwidacyjnym wartości zbywczej niezależnie od tego, czy jest ona wyższa, czy niższa od jego wartości księgowej.

  2. Integracija digitalne radio-difuzne mreže mobilne televizije i ćelijske mreže treće generacije

    Milan Manojle Šunjevarić

    2013-02-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 U radu su prikazani rezultati istraživanja mogućnosti za integraciju radio-difuznih mreža za mobilnu televiziju i ćelijskih mreža treće generacije (3G. Analizirani su trendovi u pogledu razvoja usluge mobilne televizije, i dosadašnja istraživanja koja imaju za cilj traženje optimalnih načina za integraciju različitih tipova mreža. U radu su analizirane postojeće tehnologije za mobilnu televiziju, s posebnim osvrtom na DVB-H (Digital Video Broadcasting - Handheld tehnologiju. Analizirani su preduslovi, razlozi i mogućnosti za integraciju DVB-H i 3G mreže UMTS (Universal Mobile Telecommunications System, a zaključci ovih analiza su potkrepljeni rezultatima praktičnog rada. Na osnovu svih ovih istraživanja donesen je zaključak o opravdanosti realizacije hibridne DVB-H/UMTS mreže.

  3. Cosmology of a Friedmann-Lamaître-Robertson-Walker 3-brane, late-time cosmic acceleration, and the cosmic coincidence.

    Doolin, Ciaran; Neupane, Ishwaree P

    2013-04-05

    A late epoch cosmic acceleration may be naturally entangled with cosmic coincidence--the observation that at the onset of acceleration the vacuum energy density fraction nearly coincides with the matter density fraction. In this Letter we show that this is indeed the case with the cosmology of a Friedmann-Lamaître-Robertson-Walker (FLRW) 3-brane in a five-dimensional anti-de Sitter spacetime. We derive the four-dimensional effective action on a FLRW 3-brane, from which we obtain a mass-reduction formula, namely, M(P)(2) = ρ(b)/|Λ(5)|, where M(P) is the effective (normalized) Planck mass, Λ(5) is the five-dimensional cosmological constant, and ρ(b) is the sum of the 3-brane tension V and the matter density ρ. Although the range of variation in ρ(b) is strongly constrained, the big bang nucleosynthesis bound on the time variation of the effective Newton constant G(N) = (8πM(P)(2))(-1) is satisfied when the ratio V/ρ ≳ O(10(2)) on cosmological scales. The same bound leads to an effective equation of state close to -1 at late epochs in accordance with astrophysical and cosmological observations.

  4. SOLUȚIONAREA „CHESTIUNII ARMENEȘTI” DE CĂTRE GUBERNATORUL BASARABIEI S.D. URUSOV (1903-1904

    Valentin ARAPU

    2017-08-01

    Full Text Available Gubernatorul Basarabiei S.D. Urusov a soluționat „chestiunea armenească” pe cale amiabilă. Armenii basarabeni au acceptat să cedeze statului rus o parte din bani și proprietăți, păstrându-și intacte privilegiile și statutul de odinioară. În Basarabia, spre deosebire de alte gubernii în care au existat tensiuni în acest sens, grație unei politici abile și tolerante, promovate față de armeni de către S.D. Urusov, procesul de expropriere parțială a comunității armenești s-a desfășurat calm și fără excese.SETTLEMENT OF THE „ARMENIAN ISSUE” BY THE GOVERNOR OF BESSARABIA S.D. URUSOV (1903-1904The governor of Bessarabia S.D. Urusov settled the „Armenian issue” in an amicable way. Armenians from Bessarabiaagreed to cede to Russian state some money and properties, in order to keep intact the privileges and status they held. In Bessarabia, unlike other gubernias, where there were tensions in this regard, thanks to skilful and tolerant policy, promoted by S.D. Urusov, the process of partial expropriation of the Armenian community was held calmly and without excesses.

  5. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake.

    Shirokova, L S; Pokrovsky, O S; Moreva, O Yu; Chupakov, A V; Zabelina, S A; Klimov, S I; Shorina, N V; Vorobieva, T Ya

    2013-10-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa-0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30°C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70-80% to only 20-30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90-98% in most summers and winters to approximately 60-70% in August 2010. During this hot summer, measurable and significant (>30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved (organic matter by heterotrophic aerobic bacterioplankton and 3) photo-degradation of DOM and photo-chemical liberation of organic-bound TE. While the first process may have caused significant decreases in the total dissolved concentration of micronutrients (a factor of 2 to 5 for Cr, Mn, Fe, Ni, Cu, Zn and Cd and a factor of >100 for Co), the second and third factors could have brought

  6. Adaptations cinématographiques de pièces de théâtre à Lyon (1929-1939) : promotion mutuelle entre le théâtre des Célestins et les salles de cinéma

    Marignan, Marylin

    2018-01-01

    Cet article propose de réexaminer la notion d’adaptation et de reprise, dans les années trente, à Lyon, non plus seulement en termes de « concurrence » entre le théâtre et le cinéma mais également en termes d’« emprunt », de « complémentarité » et de « promotion mutuelle ». Durant cette période, la presse diffuse largement l’idée que le cinéma, en se tournant davantage vers le répertoire théâtral ainsi que vers les dramaturges et les acteurs de l’art dramatique, avait fait un tort considérabl...

  7. Probabilistic finite elements

    Belytschko, Ted; Wing, Kam Liu

    1987-01-01

    In the Probabilistic Finite Element Method (PFEM), finite element methods have been efficiently combined with second-order perturbation techniques to provide an effective method for informing the designer of the range of response which is likely in a given problem. The designer must provide as input the statistical character of the input variables, such as yield strength, load magnitude, and Young's modulus, by specifying their mean values and their variances. The output then consists of the mean response and the variance in the response. Thus the designer is given a much broader picture of the predicted performance than with simply a single response curve. These methods are applicable to a wide class of problems, provided that the scale of randomness is not too large and the probabilistic density functions possess decaying tails. By incorporating the computational techniques we have developed in the past 3 years for efficiency, the probabilistic finite element methods are capable of handling large systems with many sources of uncertainties. Sample results for an elastic-plastic ten-bar structure and an elastic-plastic plane continuum with a circular hole subject to cyclic loadings with the yield stress on the random field are given.

  8. Intravitreal Sirolimus for Noninfectious Uveitis: A Phase III Sirolimus Study Assessing Double-masKed Uveitis TReAtment (SAKURA).

    Nguyen, Quan Dong; Merrill, Pauline T; Clark, W Lloyd; Banker, Alay S; Fardeau, Christine; Franco, Pablo; LeHoang, Phuc; Ohno, Shigeaki; Rathinam, Sivakumar R; Thurau, Stephan; Abraham, Abu; Wilson, Laura; Yang, Yang; Shams, Naveed

    2016-11-01

    To evaluate the efficacy and safety of intravitreal sirolimus in the treatment of noninfectious uveitis (NIU) of the posterior segment (i.e., posterior, intermediate, or panuveitis). Phase III, randomized, double-masked, active-controlled, 6-month study with intravitreal sirolimus. Adults with active NIU of the posterior segment (intermediate, posterior, or panuveitis), defined as a vitreous haze (VH) score >1+. Subjects discontinued NIU medications before baseline, except for systemic corticosteroids, which were allowed only for those already receiving them at baseline and were rapidly tapered after baseline per protocol. Intravitreal sirolimus assigned 1:1:1 at doses of 44 (active control), 440, or 880 μg, administered on Days 1, 60, and 120. The primary efficacy outcome was the percentage of subjects with VH 0 response at Month 5 (study eye) without use of rescue therapy. Secondary outcomes at Month 5 were VH 0 or 0.5+ response rate, corticosteroid tapering success rate (i.e., tapering to a prednisone-equivalent dosage of ≤5 mg/day), and changes in best-corrected visual acuity (BCVA). Adverse events during the double-masked treatment period are presented. A total of 347 subjects were randomized. Higher proportions of subjects in the intravitreal sirolimus 440 μg (22.8%; P = 0.025) and 880 μg (16.4%; P = 0.182) groups met the primary end point than in the 44 μg group (10.3%). Likewise, higher proportions of subjects in the 440 μg (52.6%; P = 0.008) and 880 μg (43.1%; P = 0.228) groups achieved a VH score of 0 or 0.5+ than in the 44 μg group (35.0%). Mean BCVA was maintained throughout the study in each dose group, and the majority of subjects receiving corticosteroids at baseline successfully tapered off corticosteroids (44 μg [63.6%], 440 μg [76.9%], and 880 μg [66.7%]). Adverse events in the treatment and active control groups were similar in incidence, and all doses were well tolerated. Intravitreal sirolimus 440 μg demonstrated a significant

  9. JAC2D: A two-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    Biffle, J.H.; Blanford, M.L.

    1994-05-01

    JAC2D is a two-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equations. The method is implemented in a two-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. A four-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic/plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  10. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake

    Shirokova, L.S.; Pokrovsky, O.S.; Moreva, O.Yu.; Chupakov, A.V.; Zabelina, S.A.; Klimov, S.I.; Shorina, N.V.; Vorobieva, T.Ya.

    2013-01-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa–0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30 °C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70–80% to only 20–30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90–98% in most summers and winters to approximately 60–70% in August 2010. During this hot summer, measurable and significant (> 30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved ( 100 for Co), the second and third factors could have brought about the decrease of allochthonous DOC concentration as well as the concentration and proportion of organic and organo-mineral colloidal forms of non-essential low-soluble trace elements present in the form of organic colloids (Al, Y, Ti, Zr, Hf, Th, Pb, all REEs). It can be hypothesized that climate warming in

  11. JAC3D -- A three-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    Biffle, J.H.

    1993-02-01

    JAC3D is a three-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equation. The method is implemented in a three-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. An eight-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic-plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  12. Superheavy elements

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  13. Fuel element

    Hirose, Yasuo.

    1982-01-01

    Purpose: To increase the plenum space in a fuel element used for a liquid metal cooled reactor. Constitution: A fuel pellet is secured at one end with an end plug and at the other with a coil spring in a tubular container. A mechanism for fixing the coil spring composed of a tubular unit is mounted by friction with the inner surface of the tubular container. Accordingly, the recoiling force of the coil spring can be retained by fixing mechanism with a small volume, and since a large amount of plenum space can be obtained, the internal pressure rise in the cladding tube can be suppressed even if large quantities of fission products are discharged. (Kamimura, M.)

  14. Low-temperature-induced expression of rice ureidoglycolate amidohydrolase is mediated by a C-repeat/dehydration-responsive element that specifically interacts with rice C-repeat-binding factor 3

    Juan eLi

    2015-11-01

    Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.

  15. Partial oxidation of landfill leachate in supercritical water: Optimization by response surface methodology

    Gong, Yanmeng; Wang, Shuzhong; Xu, Haidong; Guo, Yang; Tang, Xingying

    2015-09-15

    Highlights: • Partial oxidation of landfill leachate in supercritical water was investigated. • The process was optimized by Box–Behnken design and response surface methodology. • GY{sub H2}, TRE and CR could exhibit up to 14.32 mmol·gTOC{sup −1}, 82.54% and 94.56%. • Small amounts of oxidant can decrease the generation of tar and char. - Abstract: To achieve the maximum H{sub 2} yield (GY{sub H2}), TOC removal rate (TRE) and carbon recovery rate (CR), response surface methodology was applied to optimize the process parameters for supercritical water partial oxidation (SWPO) of landfill leachate in a batch reactor. Quadratic polynomial models for GY{sub H2}, CR and TRE were established with Box–Behnken design. GY{sub H2}, CR and TRE reached up to 14.32 mmol·gTOC{sup −1}, 82.54% and 94.56% under optimum conditions, respectively. TRE was invariably above 91.87%. In contrast, TC removal rate (TR) only changed from 8.76% to 32.98%. Furthermore, carbonate and bicarbonate were the most abundant carbonaceous substances in product, whereas CO{sub 2} and H{sub 2} were the most abundant gaseous products. As a product of nitrogen-containing organics, NH{sub 3} has an important effect on gas composition. The carbon balance cannot be reached duo to the formation of tar and char. CR increased with the increase of temperature and oxidation coefficient.

  16. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  17. Trappin-2/elafin modulate innate immune responses of human endometrial epithelial cells to PolyI:C.

    Anna G Drannik

    Full Text Available BACKGROUND: Upon viral recognition, innate and adaptive antiviral immune responses are initiated by genital epithelial cells (ECs to eradicate or contain viral infection. Such responses, however, are often accompanied by inflammation that contributes to acquisition and progression of sexually transmitted infections (STIs. Hence, interventions/factors enhancing antiviral protection while reducing inflammation may prove beneficial in controlling the spread of STIs. Serine antiprotease trappin-2 (Tr and its cleaved form, elafin (E, are alarm antimicrobials secreted by multiple cells, including genital epithelia. METHODOLOGY AND PRINCIPAL FINDINGS: We investigated whether and how each Tr and E (Tr/E contribute to antiviral defenses against a synthetic mimic of viral dsRNA, polyinosine-polycytidylic acid (polyI:C and vesicular stomatitis virus. We show that delivery of a replication-deficient adenovector expressing Tr gene (Ad/Tr to human endometrial epithelial cells, HEC-1A, resulted in secretion of functional Tr, whereas both Tr/E were detected in response to polyI:C. Moreover, Tr/E were found to significantly reduce viral replication by either acting directly on virus or through enhancing polyI:C-driven antiviral protection. The latter was associated with reduced levels of pro-inflammatory factors IL-8, IL-6, TNFα, lowered expression of RIG-I, MDA5 and attenuated NF-κB activation. Interestingly, enhanced polyI:C-driven antiviral protection of HEC-Ad/Tr cells was partially mediated through IRF3 activation, but not associated with higher induction of IFNβ, suggesting multiple antiviral mechanisms of Tr/E and the involvement of alternative factors or pathways. CONCLUSIONS AND SIGNIFICANCE: This is the first evidence of both Tr/E altering viral binding/entry, innate recognition and mounting of antiviral and inflammatory responses in genital ECs that could have significant implications for homeostasis of the female genital tract.

  18. Réponses comportementales du brochet (Esox lucius L. à un extrait épidermique de carassin doré (Carassius auratus L. en olfactomètre

    SAGLIO Ph.

    1993-04-01

    Full Text Available Les effets de solutions brutes (EE et d'une fraction d'acides aminés libres reconstituée (FAA, issues d'un extrait épidermique de Carassin doré (Carassius auratus L., ont été analysés sur l'attraction et le comportement exploratoire du Brochet (Esox lucius L. en olfactomètre. Des effets significatifs ont été observés en réponse aux différentes solutions et doses testées (EE = 0,005 ; 0,05 ; 0,5 équivalent-carassin/l ; FAA = 0,5 équivalent-carassin/l. L'effet stimulant des solutions épidermiques brutes sur l'exploration varie en raison inverse de la concentration testée. L'activité de ces solutions sur l'attraction augmente avec la concentration. L'effet stimulant de la fraction d'acides aminés libres reconstituée sur l'exploration et sur l'attraction est apparu inférieur à celui observé en réponse à la solution brute. Ces résultats sont discutés à la lueur de données sur le rôle des sécrétions de la peau et des acides aminés dans la communication chimique chez les poissons.

  19. Influence of three-dimensional reconstruction method for building a model of the cervical spine on its biomechanical responses: A finite element analysis study

    Iman Zafarparandeh

    2016-03-01

    Full Text Available In some finite element analysis studies of models of sections of the spine, the three-dimensional solid model is built by assuming symmetry about the mid-sagittal plane of the section, whereas in other studies, the model is built from the exact geometry of the section. The influence of the method used to build the solid model on model parameters, in the case of the cervical spine, has not been reported in the literature. This issue is the subject of this study, with the section being C2–C7, the applied loadings being extension, flexion, left lateral bending, and right axial rotation (each of magnitude 1 Nm, and the model parameters determined being rotation, intradiskal pressure, and facet load at each of the segments. When all the parameter results were considered, it was found that, by and large, the influence of solid model construction method used (exact geometry vs assumption of symmetry about the mid-sagittal plane of the section was marginal. As construction of a symmetric finite element model requires less time and effort, construction of an asymmetric model may be justified in special cases only.

  20. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic Conditions at Different pH and Alkalinity

    Tyler S. Anderson

    2017-07-01

    Full Text Available Biomass and tissue elemental differences were quantified for lettuce grown in deep-water conventional hydroponic conditions at two pH and alkalinity conditions. Nutrient solutions were created using inorganic salts and either reverse osmosis (RO water or municipal water with high alkalinity. Three treatments were evaluated: (a nutrient solution created with reverse osmosis (RO water and maintained at pH 5.8 (H5; (b same as H5 but maintained at pH 7.0 (H7; and (c nutrient solution created using municipal water and maintained at pH 7.0, referred to as HA7. Averaged across three trials, the HA7 and H7 treatments produced 26% less shoot fresh weight (FW than the H5 treatment with an 18% reduction in dry weight (DW. The H5 treatment had the least biomass in root FW and DW. In tissue elemental analyses, both the pH 7.0 treatments showed lower concentrations than H5 in Cu, N, Mo, and Sr, and increased concentrations in Ba, Mg, Na, and Zn. There were no differences in Al, C, Ca, Fe, K, Mn, Ni, P, S, and Si concentrations among treatments (p = 0.05. The results from this experiment can be used to isolate the effects of pH and alkalinity in aquaponic conditions where pH and alkalinity will mimic HA7 conditions.

  1. Potential of Ranunculus acris L. for biomonitoring trace element contamination of riverbank soils: photosystem II activity and phenotypic responses for two soil series.

    Marchand, Lilian; Lamy, Pierre; Bert, Valerie; Quintela-Sabaris, Celestino; Mench, Michel

    2016-02-01

    Foliar ionome, photosystem II activity, and leaf growth parameters of Ranunculus acris L., a potential biomonitor of trace element (TE) contamination and phytoavailability, were assessed using two riverbank soil series. R. acris was cultivated on two potted soil series obtained by mixing a TE (Cd, Cu, Pb, and Zn)-contaminated technosol with either an uncontaminated sandy riverbank soil (A) or a silty clay one slightly contaminated by TE (B). Trace elements concentrations in the soil-pore water and the leaves, leaf dry weight (DW) yield, total leaf area (TLA), specific leaf area (SLA), and photosystem II activity were measured for both soil series after a 50-day growth period. As soil contamination increased, changes in soluble TE concentrations depended on soil texture. Increase in total soil TE did not affect the leaf DW yield, the TLA, the SLA, and the photosystem II activity of R. acris over the 50-day exposure. The foliar ionome did not reflect the total and soluble TE concentrations in both soil series. Foliar ionome of R. acris was only effective to biomonitor total and soluble soil Na concentrations in both soil series and total and soluble soil Mo concentrations in the soil series B.

  2. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  3. WE-AB-BRA-02: Development of Biomechanical Models to Describe Dose-Volume Response to Liver Stereotactic Body Radiation Therapy (SBRT) Patients

    McCulloch, M; Polan, D; Feng, M; Lawrence, T; Haken, R Ten; Brock, K

    2015-01-01

    Purpose: Previous studies have shown that radiotherapy treatment for liver metastases causes marked liver hypertrophy in areas receiving low dose and atrophy/fibrosis in areas receiving high dose. The purpose of this work is to develop and evaluate a biomechanical model-based dose-response model to describe these liver responses to SBRT. Methods: In this retrospective study, a biomechanical model-based deformable registration algorithm, Morfeus, was expanded to include dose-based boundary conditions. Liver and tumor volumes were contoured on the planning images and CT/MR images three months post-RT and converted to finite element models. A thermal expansion-based relationship correlating the delivered dose and volume response was generated from 22 patients previously treated. This coefficient, combined with the planned dose, was applied as an additional boundary condition to describe the volumetric response of the liver of an additional cohort of metastatic liver patients treated with SBRT. The accuracy of the model was evaluated based on overall volumetric liver comparisons and the target registration error (TRE) using the average deviations in positions of identified vascular bifurcations on each set of registered images, with a target accuracy of the 2.5mm isotropic dose grid (vector dimension 4.3mm). Results: The thermal expansion coefficient models the volumetric change of the liver to within 3%. The accuracy of Morfeus with dose-expansion boundary conditions a TRE of 5.7±2.8mm compared to 11.2±3.7mm using rigid registration and 8.9±0.28mm using Morfeus with only spatial boundary conditions. Conclusion: A biomechanical model has been developed to describe the volumetric and spatial response of the liver to SBRT. This work will enable the improvement of correlating functional imaging with delivered dose, the mapping of the delivered dose from one treatment onto the planning images for a subsequent treatment, and will further provide information to assist

  4. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  5. Transboundary geophysical mapping of geological elements and salinity distribution critical for the assessment of future sea water intrusion in response to sea level rise

    F. Jørgensen

    2012-07-01

    Full Text Available Geophysical techniques are increasingly being used as tools for characterising the subsurface, and they are generally required to develop subsurface models that properly delineate the distribution of aquifers and aquitards, salt/freshwater interfaces, and geological structures that affect groundwater flow. In a study area covering 730 km2 across the border between Germany and Denmark, a combination of an airborne electromagnetic survey (performed with the SkyTEM system, a high-resolution seismic survey and borehole logging has been used in an integrated mapping of important geological, physical and chemical features of the subsurface. The spacing between flight lines is 200–250 m which gives a total of about 3200 line km. About 38 km of seismic lines have been collected. Faults bordering a graben structure, buried tunnel valleys, glaciotectonic thrust complexes, marine clay units, and sand aquifers are all examples of geological structures mapped by the geophysical data that control groundwater flow and to some extent hydrochemistry. Additionally, the data provide an excellent picture of the salinity distribution in the area and thus provide important information on the salt/freshwater boundary and the chemical status of groundwater. Although the westernmost part of the study area along the North Sea coast is saturated with saline water and the TEM data therefore are strongly influenced by the increased electrical conductivity there, buried valleys and other geological elements are still revealed. The mapped salinity distribution indicates preferential flow paths through and along specific geological structures within the area. The effects of a future sea level rise on the groundwater system and groundwater chemistry are discussed with special emphasis on the importance of knowing the existence, distribution and geometry of the mapped geological elements, and their control on the groundwater salinity distribution is assessed.

  6. Predicting the flexure response of wood-plastic composites from uni-axial and shear data using a finite-element model

    Scott E. Hamel; John C. Hermanson; Steven M. Cramer

    2014-01-01

    Wood-plastic composites (WPCs), commonly used in residential decks and railings, exhibit mechanical behavior that is bimodal, anisotropic, and nonlinear viscoelastic. They exhibit different stress-strain responses to tension and compression, both of which are nonlinear. Their mechanical properties vary with respect to extrusion direction, their deformation under...

  7. TRE ~ANGUAGE LOTTERY: PROMISES, PROMISES ...

    dual children, about which expressions a certain child heard and registered and with what frequency at ... scientific theorizing, suggested the need for another model, allowing d simpler account of the phenotype or .... (1) generate base structures, which are mapped to abstract S-structures including trace by tranSformations,.

  8. Tre citazioni: Corazzini, Sbarbaro, Montale

    Giorgio Bàrberi Squarotti

    2010-12-01

    Full Text Available Twentieth-century Italian literature is deeply rooted in the tradition. This is demonstrated by numerous examples, such as the echo of Gabriele D’Annunzio’s tragedy La fiaccola sotto il moggio (The Torch under the Bushel in a famous poem by Sandro Corazzini. Other examples include the presence of Dante’s Paradiso (Paradise in Camillo Sbarbaro’s verses and the influence of a famous episode taken from I Promessi Sposi (The Betrothed on a poem by Eugenio Montale. Indeed, great Authors’ texts are constantly reformulated, modified, distorted, and even reversed. Every time, quotations illustrate how close but also how far that indispensable past is.

  9. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  10. Comparison of lime and fly ash as amendments to acidic coal mine refusej growth responses and trace-element uptake of two grasses

    Jasrow, J. D.; Zimmerman, C. A.; Dvorak, A. J.; Hinchman, R. R.

    1979-10-01

    Two commonly used revegetation species, Kentucky 31 tall fescue (Festuca arundinacea Schreb.) and Lincoln smooth brome (Bromus inermis Leyss.) were grown for 60 days in pots containing coarse coal mine refuse (referred to as gob, pH = 3.5) that was amended with lime or alkaline fly ash. Both species were also grown in pots containing a silt-loam surface soil as a control. Morphological growth parameters were measured over time; dry weights and shoot:root ratios were determined at harvest. Concentrations of Al, As, Cd, Co, Cr, Cu, Fe, Hg, Mn, Ni, Pb, Se, V, and Zn in the plant shoots were determined by atomic absorption spectrophotometry. Plant growth of both species was not as good on either lime- or fly ash-amended gob as it was on surface soil. Although plant height and length of the longest lead were not significantly different (p > 0.10) at the end of the experiment for plants grown on the two amended-gob substrates, parameters giving an indication of plant vigor (i.e., number of leaves and stems, width of the longest lead, and biomass) were significantly greater (p < 0.01) for plants grown on lime-amended gob than for those grown on fly ash-amended gob. Significant (p < 0.05) differences in the tissue concentrations of Cd, Co, Fe, Hg, Mn, Pb, V, and Zn were found among the plants grown on the three substrates. Except for Hg and Pb, these elements were higher in plants grown on at least one of the amended-gob substrates than in plants grown on surface soil. Significant substrate differences were not observed for Al, As, Cr, Cu, Ni, and Se. The tissue concentrations of some elements - notably Al, Cu, Fe, Mn, V, and Zn - were high enough in plants from one or more of the substrates to either approach or exceed concentrations that have been reported to be associated with toxic effects in some plant species.

  11. Changes in nutrient stoichiometry, elemental homeostasis and growth rate of aquatic litter-associated fungi in response to inorganic nutrient supply.

    Gulis, Vladislav; Kuehn, Kevin A; Schoettle, Louie N; Leach, Desiree; Benstead, Jonathan P; Rosemond, Amy D

    2017-12-01

    Aquatic fungi mediate important energy and nutrient transfers in freshwater ecosystems, a role potentially altered by widespread eutrophication. We studied the effects of dissolved nitrogen (N) and phosphorus (P) concentrations and ratios on fungal stoichiometry, elemental homeostasis, nutrient uptake and growth rate in two experiments that used (1) liquid media and a relatively recalcitrant carbon (C) source and (2) fungi grown on leaf litter in microcosms. Two monospecific fungal cultures and a multi-species assemblage were assessed in each experiment. Combining a radioactive tracer to estimate fungal production (C accrual) with N and P uptake measurements provided an ecologically relevant estimate of mean fungal C:N:P of 107:9:1 in litter-associated fungi, similar to the 92:9:1 obtained from liquid cultures. Aquatic fungi were found to be relatively homeostatic with respect to their C:N ratio (~11:1), but non-homeostatic with respect to C:P and N:P. Dissolved N greatly affected fungal growth rate and production, with little effect on C:nutrient stoichiometry. Conversely, dissolved P did not affect fungal growth and production but controlled biomass C:P and N:P, probably via luxury P uptake and storage. The ability of fungi to immobilize and store excess P may alter nutrient flow through aquatic food webs and affect ecosystem functioning.

  12. La première traduction slave de Molière et la naissance du théâtre slovène

    Boštjan Marko Turk

    2008-12-01

    Full Text Available Trois ans après sa première représentation à Versailles, Georges Dandin de Molière a fait l 'objet d'une traduction partielle en slovène réalisée par Franjo Krsto Frankopan. Cette traduction des trois premières scènes peut être objectivement considérée comme l'un des défis les plus ardus de l'histoire littéraire contemporaine. La recherche slovène et internationale l'a tantôt ignoré, tantôt considéré comme lettre morte. La raison en est que, dans ce fragment, Frankopan aurait utilisé le slovène comme langue servant à ridiculiser, comme l'ayaient fait les dramaturges italiens de la Renaissance avec les dialectes slaves. Or, rien n'est plus éloigné de la vérité. Le texte est intégralement écrit en slovène, langue de la mère de Frankopan. Du reste, comme le montre ne serait-ce que l'analyse bergsonienne du comique, Georges Dandin n'est pas un texte comique. Il convient, par contre, de voir le lien entre la traduction du fragment de la pièce de Molière et l'action de Frankopan contre la monarchie habsbourgeoise. Par l'intermédiaire de la diplomatie viennoise, ce dernier cherchait en effet des appuis à la cour du .roi Louis XIV dont l'auteur dramatique comique en titre était précisément Molière. En conclusion, il convient de souligner que le fragment traduit par Frankopan, en tant que premier texte dramatique en langue slovène, invite à remettre en question la datation des débuts du théâtre slovène proposée par les historiens de la littérature.

  13. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J

    2016-03-01

    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  14. Multiple element isotope probes, NanoSIMS, and the functional genomics of microbial carbon cycling in soils in response to chronic climatic change

    Hungate, Bruce; Pett-Ridge, Jennifer; Blazewicz, Steven; Blazewicz, Steven; Schwartz, Egbert; Dijkstra, Paul

    2018-03-24

    In this project, we developed an innovative and ground-breaking technique, quantitative stable isotope probing, a technique that uses density separation of nucleic acids as a quantitative measurement technique. This work is substantial because it advances SIP beyond the qualitative technique that has dominate the field for years. The first methods paper was published in Applied and Environmental Microbiology (Hungate et al. 2015), and this paper describes the mathematical model underlying the quantitative interpretation. A second methods paper (Schwartz et al. 2015) provides a conceptual overview of the method and its application to research problems. A third methods paper was just published (Koch et al. 2018), in which we develop the quantitative model combining sequencing and isotope data to estimate actual rates of microbial growth and death in natural populations. This work has met much enthusiasm in scientific presentations around the world. It has met with equally enthusiastic resistance in the peer-review process, though our record of publication to date argues that people are accepting the merits of the approach. The skepticism and resistance are also potentially signs that this technique is pushing the field forward, albeit with some of the discomfort that accompanies extrapolation. Part of this is a cultural element in the field – the field of microbiology is not accustomed to the assumptions of ecosystem science. Research conducted in this project has pushed the philosophical perspective that major advances can occur when we advocate a sound merger between the traditions of strong inference in microbiology with those of grounded scaling in ecosystem science.

  15. Rapid kinetics of iron responsive element (IRE) RNA/iron regulatory protein 1 and IRE-RNA/eIF4F complexes respond differently to metal ions.

    Khan, Mateen A; Ma, Jia; Walden, William E; Merrick, William C; Theil, Elizabeth C; Goss, Dixie J

    2014-06-01

    Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn(2+) decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn(2+) increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn(2+) eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. A Zr-based bulk metallic glass for future stent applications: Materials properties, finite element modeling, and in vitro human vascular cell response.

    Huang, Lu; Pu, Chao; Fisher, Richard K; Mountain, Deidra J H; Gao, Yanfei; Liaw, Peter K; Zhang, Wei; He, Wei

    2015-10-01

    Despite the prevalent use of crystalline alloys in current vascular stent technology, new biomaterials are being actively sought after to improve stent performance. In this study, we demonstrated the potential of a Zr-Al-Fe-Cu bulk metallic glass (BMG) to serve as a candidate stent material. The mechanical properties of the Zr-based BMG, determined under both static and cyclic loadings, were characterized by high strength, which would allow for the design of thinner stent struts to improve stent biocompatibility. Finite element analysis further complemented the experimental results and revealed that a stent made of the Zr-based BMG was more compliant with the beats of a blood vessel, compared with medical 316L stainless steel. The Zr-based BMG was found to be corrosion resistant in a simulated body environment, owing to the presence of a highly stable ZrO2-rich surface passive film. Application-specific biocompatibility studies were conducted using human aortic endothelial cells and smooth muscle cells. The Zr-Al-Fe-Cu BMG was found to support stronger adhesion and faster coverage of endothelial cells and slower growth of smooth muscle cells than 316L stainless steel. These results suggest that the Zr-based BMG could promote re-endothelialization and potentially lower the risk of restenosis, which are critical to improve vascular stent implantation integration. In general, findings in this study raised the curtain for the potential application of BMGs as future candidates for stent applications. Vascular stents are medical devices typically used to restore the lumen of narrowed or clogged blood vessel. Despite the clinical success of metallic materials in stent-assisted angioplasty, post-surgery complications persist due to the mechanical failures, corrosion, and in-stent restenosis of current stents. To overcome these hurdles, strategies including new designs and surface functionalization have been exercised. In addition, the development of new materials with

  17. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  18. Fluid element in SAP IV

    Yilmaz, C.; Akkas, N.

    1979-01-01

    In previous studies a fluid element is incorporated in the widely used general purpose finite element program SAPIV. This type of problem is of interest in the design of nuclear components involving geometric complexities and nonlinearities. The elasticity matrix of a general-purpose finite element program is modified in such a way that it becomes possible to idealize fluid as a structural finite element with zero shear modulus and a given bulk modules. Using the modified version of SAPIV, several solid-fluid interactions problems are solved. The numerical solutions are compared with the available analytical solutions. They are shown to be in reasonable aggrement. It is also shown that by solving an exterior-fluid interaction problem, the pressure wave propagation in the acoustic medium can be solved with the same approach. In this study, two of the problem not studied in the previous work will be presented. These problems are namely the effects of the link elements used at solid-fluid interfaces and of the concentrated loads on the response of the fluid medium. Truss elements are used as the link elements. After these investigations, it is decided that general purpose finite element programs with slight modifications can be used in the safety analysis of nuclear reactor plants. By this procedure it is possible to handle two-dimensional plane strain and tridimensional axisymmetric problems of this type. (orig.)

  19. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  20. In Vitro Growth of Curcuma longa L. in Response to Five Mineral Elements and Plant Density in Fed-Batch Culture Systems

    El-Hawaz, Rabia F.; Bridges, William C.; Adelberg, Jeffrey W.

    2015-01-01

    Plant density was varied with P, Ca, Mg, and KNO3 in a multifactor experiment to improve Curcuma longa L. micropropagation, biomass and microrhizome development in fed-batch liquid culture. The experiment had two paired D-optimal designs, testing sucrose fed-batch and nutrient sucrose fed-batch techniques. When sucrose became depleted, volume was restored to 5% m/v sucrose in 200 ml of modified liquid MS medium by adding sucrose solutions. Similarly, nutrient sucrose fed-batch was restored to set points with double concentration of treatments’ macronutrient and MS micronutrient solutions, along with sucrose solutions. Changes in the amounts of water and sucrose supplementations were driven by the interaction of P and KNO3 concentrations. Increasing P from 1.25 to 6.25 mM increased both multiplication and biomass. The multiplication ratio was greatest in the nutrient sucrose fed-batch technique with the highest level of P, 6 buds/vessel, and the lowest level of Ca and KNO3. The highest density (18 buds/vessel) produced the highest fresh biomass at the highest concentrations of KNO3 and P with nutrient sucrose fed-batch, and moderate Ca and Mg concentrations. However, maximal rhizome dry biomass required highest P, sucrose fed-batch, and a moderate plant density. Different media formulations and fed-batch techniques were identified to maximize the propagation and storage organ responses. A single experimental design was used to optimize these dual purposes. PMID:25830292

  1. In vitro growth of Curcuma longa L. in response to five mineral elements and plant density in fed-batch culture systems.

    El-Hawaz, Rabia F; Bridges, William C; Adelberg, Jeffrey W

    2015-01-01

    Plant density was varied with P, Ca, Mg, and KNO3 in a multifactor experiment to improve Curcuma longa L. micropropagation, biomass and microrhizome development in fed-batch liquid culture. The experiment had two paired D-optimal designs, testing sucrose fed-batch and nutrient sucrose fed-batch techniques. When sucrose became depleted, volume was restored to 5% m/v sucrose in 200 ml of modified liquid MS medium by adding sucrose solutions. Similarly, nutrient sucrose fed-batch was restored to set points with double concentration of treatments' macronutrient and MS micronutrient solutions, along with sucrose solutions. Changes in the amounts of water and sucrose supplementations were driven by the interaction of P and KNO3 concentrations. Increasing P from 1.25 to 6.25 mM increased both multiplication and biomass. The multiplication ratio was greatest in the nutrient sucrose fed-batch technique with the highest level of P, 6 buds/vessel, and the lowest level of Ca and KNO3. The highest density (18 buds/vessel) produced the highest fresh biomass at the highest concentrations of KNO3 and P with nutrient sucrose fed-batch, and moderate Ca and Mg concentrations. However, maximal rhizome dry biomass required highest P, sucrose fed-batch, and a moderate plant density. Different media formulations and fed-batch techniques were identified to maximize the propagation and storage organ responses. A single experimental design was used to optimize these dual purposes.

  2. Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

    Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

    2008-05-02

    Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

  3. Atbildība pret trešajām personām būvniecībā un par ekspluatācijā esošu būvi

    Zalamane, Adele

    2015-01-01

    Maģistra darba tēma ir civiltiesiskā atbildība pret trešajām personām par aizskārumu, kura pamatā ir būvniecības laikā pieļautas kļūdas. Darba mērķis ir noskaidrot pastāvošo regulējumu, apzināt tā trūkumus un piedāvāt risinājumus. Lai izpētītu civiltiesiskās atbildības regulējumu pret trešajām personām, ievērojot nesenos normatīvo aktu grozījumus būvniecības nozarē, izpētīts atbildības regulējums Būvniecības likumā, kurš bija spēkā līdz 2014.gada 1.oktobrim, un jaunajā Būvniecības likumā. ...

  4. Circadian expression of steroidogenic cytochromes P450 in the mouse adrenal gland--involvement of cAMP-responsive element modulator in epigenetic regulation of Cyp17a1.

    Košir, Rok; Zmrzljak, Ursula Prosenc; Bele, Tanja; Acimovic, Jure; Perse, Martina; Majdic, Gregor; Prehn, Cornelia; Adamski, Jerzy; Rozman, Damjana

    2012-05-01

    The cytochrome P450 (CYP) genes Cyp51, Cyp11a1, Cyp17a1, Cyb11b1, Cyp11b2 and Cyp21a1 are involved in the adrenal production of corticosteroids, whose circulating levels are circadian. cAMP signaling plays an important role in adrenal steroidogenesis. By using cAMP responsive element modulator (Crem) knockout mice, we show that CREM isoforms contribute to circadian expression of steroidogenic CYPs in the mouse adrenal gland. Most striking was the CREM-dependent hypomethylation of the Cyp17a1 promoter at zeitgeber time 12, which resulted in higher Cyp17a1 mRNA and protein expression in the knockout adrenal glands. The data indicate that products of the Crem gene control the epigenetic repression of Cyp17 in mouse adrenal glands. © 2011 The Authors Journal compilation © 2011 FEBS.

  5. Effect of dietary trace mineral supplementation and a multi-element trace mineral injection on shipping response and growth performance of beef cattle.

    Genther, O N; Hansen, S L

    2014-06-01

    To examine the effect of trace mineral (TM) status and TM injection on growth performance and carcass characteristics in beef cattle, 40 steers were used in a growing and finishing study. Steers were stratified by weight (323 ± 14.8 kg) and assigned to 1 of 2 treatments for an 84-d depletion period: 1) a corn silage-based diet supplemented with Cu, Mn, Se, and Zn to meet or exceed NRC recommendations (CON), or 2) CON diet without supplemental Cu, Mn, Se, or Zn but supplemented with 300 mg Fe and 5 mg Mo/kg diet DM as dietary TM antagonists (DEF) to induce mild deficiencies. To mimic shipping stress, steers were shipped for 20 h on d 88 and were received back on d 89. On d 91 an equal number of steers from both dietary treatments were injected with sterilized saline (SAL) or Multimin 90 (MM; containing 15, 60, 10, and 5 mg/mL of Cu, Zn, Mn, and Se, respectively) at a dose of 1 mL/68 kg BW. Steers were fed a common finishing diet supplemented with 10 mg Cu, 20 mg Mn, 0.1 mg Se, and 30 mg Zn/kg diet DM for the 90-d repletion period. Steers were harvested 91 d postinjection and carcass data were collected. During the depletion period, diet did not affect BW, ADG, DMI, or G:F (P > 0.20). During the shipping period (defined as the time between 2-d consecutive weights on d 83 and 84 and d 90 and 91), DEF steers tended to lose more weight per day than CON steers (P = 0.06) and had lesser DMI (P = 0.03), suggesting that response to shipping stress may be modulated by TM status. During the repletion period, ADG of DEF + MM steers was greater (P = 0.03) compared with DEF + SAL and was not different (P = 0.92) among CON + MM and CON + SAL steers. There was no effect of diet or injection on HCW or dressing percentage (P > 0.20). Within the CON group, TM injection decreased yield grade (P = 0.03) but did not affect yield grade of DEF steers (P > 0.20). Steers given TM injection had a larger rib eye area (P = 0.04) regardless of previous diet. Interestingly, both diet and

  6. Artificial Neural Network-Based Three-dimensional Continuous Response Relationship Construction of 3Cr20Ni10W2 Heat-Resisting Alloy and Its Application in Finite Element Simulation

    Li, Le; Wang, Li-yong

    2018-04-01

    The application of accurate constitutive relationship in finite element simulation would significantly contribute to accurate simulation results, which plays a critical role in process design and optimization. In this investigation, the true stress-strain data of 3Cr20Ni10W2 heat-resisting alloy were obtained from a series of isothermal compression tests conducted in a wide temperature range of 1203-1403 K and strain rate range of 0.01-10 s-1 on a Gleeble 1500 testing machine. Then the constitutive relationship was modeled by an optimally constructed and well-trained back-propagation artificial neural network (BP-ANN). The evaluation of the BP-ANN model revealed that it has admirable performance in characterizing and predicting the flow behaviors of 3Cr20Ni10W2 heat-resisting alloy. Meanwhile, a comparison between improved Arrhenius-type constitutive equation and BP-ANN model shows that the latter has higher accuracy. Consequently, the developed BP-ANN model was used to predict abundant stress-strain data beyond the limited experimental conditions and construct the three-dimensional continuous response relationship for temperature, strain rate, strain, and stress. Finally, the three-dimensional continuous response relationship was applied to the numerical simulation of isothermal compression tests. The results show that such constitutive relationship can significantly promote the accuracy improvement of numerical simulation for hot forming processes.

  7. Discrete Element Modeling

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  8. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  9. Chemistry of the elements

    Greenwood, N.N.; Earnshaw, A.

    1984-01-01

    This textbook presents an account of the chemistry of the elements for both undergraduate and postgraduate students. It covers not only the 'inorganic' chemistry of the elements, but also analytical, theoretical, industrial, organometallic;, bio-inorganic and other areas of chemistry which apply. The following elements of special nuclear interest are included: Rb, Cs, Fr, Sr, Ba, Ra, Po, At, Rn, Sc, Y, Zr, Hf, V, Nb, Ta, Mo, Tc, Ru, the Lanthanide Elements, the Actinide Elements. (U.K.)

  10. Elements to diminish radioactive accidents

    Cortes I, M.E.; Ramirez G, F.P.

    1998-01-01

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  11. Suppression of Thyroid Hormone Receptor-Mediated Transcription ...

    TH)-induced TR-mediated transcription. We further examined the effects of methamidophos on TR-thyroid hormone response element (TRE) binding using the liquid chemiluminescent DNA pull-down assay (LCDPA), and found no dissociation of ...

  12. La variabilité génétique chez l'huître plate Ostrea edulis (L. 1758) : inférence du nombre de géniteurs instantané d'une population

    Da Silva, Sara Maria Mira

    2001-01-01

    Les études de génétique des populations des bivalves marins ont fréquemment mit en évidence une relation hétérozygotie / valeur sélective, et un fort déficit en hétérozygotes. Parmi les hypothèses explicatives de ces deux phénomènes, la création d'individus consanguins dans les populations est particulièrement intéressante à tester. Le but de ce travail était de vérifier s'il pouvait y avoir un nombre faible de géniteurs à la base d'un événement de reproduction donné chez l'huître plate Ostre...

  13. La maison bourgeoise en milieu rural : de la maison de maître à la résidence secondaire. Préhistoire des campagnes periurbaines (début XIXe-1970)

    Thébault, Vincent

    2015-01-01

    L'importance et la diffusion du bâti bourgeois en milieu rural demeure une des questions les moins explorées du paysage social des campagnes françaises contemporaines. Dans un essai de géographie du capital foncier, Louis Bergeron notait que le xixe siècle n'était pas seulement celui de la reconstruction et de la multiplication des châteaux, mais aussi des maisons de maître et des bâtiments d'exploitation dont l'allure et les matériaux témoignent d'un nouvel aménagement, plus capitalistique,...

  14. O sednie terminu „social media”. „Web 2.0” a sprawność użytkowników w „generowaniu treści”.

    Toczyski, Piotr

    2014-01-01

    Wychodząc od ilościowego nadmiaru definicji „social media” i zarazem ich niedoboru pod względem jakości, wykonuję przegląd definicji tego pojęcia od 1896 roku. Okazuje się, że terminem „social media” w naukach społecznych posługiwano się już na ponad sto lat przed internetem. Współczesne rozstrzygnięcia definicyjne rozbijają się nie tylko o kompetencje definiujących „social media”, ale także o takie pojęcia jak „treść”, „użytkownik”, „społeczność” czy „Web 2.0” oraz ich wzajemne relacje w śro...

  15. The iTreAD project: a study protocol for a randomised controlled clinical trial of online treatment and social networking for binge drinking and depression in young people.

    Kay-Lambkin, F J; Baker, A L; Geddes, J; Hunt, S A; Woodcock, K L; Teesson, M; Oldmeadow, C; Lewin, T J; Bewick, B M; Brady, K; Spring, B; Deady, M; Barrett, E; Thornton, L

    2015-10-06

    Depression and binge drinking behaviours are common clinical problems, which cause substantial functional, economic and health impacts. These conditions peak in young adulthood, and commonly co-occur. Comorbid depression and binge drinking are undertreated in young people, who are reluctant to seek help via traditional pathways to care. The iTreAD project (internet Treatment for Alcohol and Depression) aims to provide and evaluate internet-delivered monitoring and treatment programs for young people with depression and binge drinking concerns. Three hundred sixty nine participants will be recruited to the trial, and will be aged 18-30 years will be eligible for the study if they report current symptoms of depression (score 5 or more on the depression subscale of the Depression Anxiety Stress Scale) and concurrent binge drinking practices (5 or more standard drinks at least twice in the prior month). Following screening and online baseline assessment, participants are randomised to: (a) online monthly self-assessments, (b) online monthly self-assessments + 12-months of access to a 4 week online automated cognitive behaviour therapy program for binge drinking and depression (DEAL); or (c) online monthly assessment + DEAL + 12-months of access to a social networking site (Breathing Space). Independent, blind follow-up assessments occur at 26, 39, 52 and 64-weeks post-baseline. The iTreAD project is the first randomised controlled trial combining online cognitive behaviour therapy, social networking and online monitoring for young people reporting concerns with depression and binge drinking. These treatments represent low-cost, wide-reach youth-appropriate treatment, which will have significantly public health implications for service design, delivery and health policy for this important age group. Australian and New Zealand Clinical Trials Registry ACTRN12614000310662. Date registered 24 March 2014.

  16. Tragédie et comédie : deux représentations de la pauvreté et de la marginalité dans le théâtre acadien contemporain

    Denis Bourque

    2012-05-01

    Full Text Available Le théâtre acadien contemporain est né de façon fulgurante avec une mise en scène à la fois tragique et comique de la pauvreté et de la marginalité sociale. Pour la première fois en Acadie, Antonine Maillet, dans Les Crasseux et La Sagouine : Pièce pour une femme seule, donnait, dans leur langage propre, la parole aux miséreux, aux exclus, aux parias de la société. Cette représentation de la pauvreté et de la marginalité comme étant à la fois tragique et comique s’est poursuivie dans le théâtre acadien. On la retrouve dans la pièce Le Djibou de Laval Goupil, par exemple, créée en 1975 et réécrite pour une nouvelle représentation en 1997 sous le titre de Le Djibou ou l’Ange déserteur. Dans les années 2000, Herménégilde Chiasson et Marcel-Romain Thériault reprendront ce thème de la pauvreté et de la marginalité en Acadie, Chiasson le fait de façon directe et comique dans Laurie ou la vie de galerie (2002, puis de façon tragique dans Le Christ est apparu au Gun Club (2005 ; Thériault, pour sa part, n’accorde la parole à ceux-ci que de façon indirecte et tragique dans Le filet : Une tragédie maritime (2009.

  17. Sodium phenylbutyrate enhances astrocytic neurotrophin synthesis via protein kinase C (PKC)-mediated activation of cAMP-response element-binding protein (CREB): implications for Alzheimer disease therapy.

    Corbett, Grant T; Roy, Avik; Pahan, Kalipada

    2013-03-22

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser(133)) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD.

  18. Salicylic-Acid-Induced Chilling- and Oxidative-Stress Tolerance in Relation to Gibberellin Homeostasis, C-Repeat/Dehydration-Responsive Element Binding Factor Pathway, and Antioxidant Enzyme Systems in Cold-Stored Tomato Fruit.

    Ding, Yang; Zhao, Jinhong; Nie, Ying; Fan, Bei; Wu, Shujuan; Zhang, Yu; Sheng, Jiping; Shen, Lin; Zhao, Ruirui; Tang, Xuanming

    2016-11-02

    Effects of salicylic acid (SA) on gibberellin (GA) homeostasis, C-repeat/dehydration-responsive element binding factor (CBF) pathway, and antioxidant enzyme systems linked to chilling- and oxidative-stress tolerance in tomato fruit were investigated. Mature green tomatoes (Solanum lycopersicum L. cv. Moneymaker) were treated with 0, 0.5, and 1 mM SA solution for 15 min before storage at 4 °C for 28 days. In comparison to 0 or 0.5 mM SA, 1 mM SA significantly decreased the chilling injury (CI) index in tomato fruit. In the SA-treated fruit, the upregulation of GA biosynthetic gene (GA3ox1) expression was followed by gibberellic acid (GA 3 ) surge and DELLA protein degradation. CBF1 participated in the SA-modulated tolerance and stimulated the expression of GA catabolic gene (GA2ox1). Furthermore, 1 mM SA enhanced activities of antioxidant enzymes and, thus, reduced reactive oxygen species accumulation. Our findings suggest that SA might protect tomato fruit from CI and oxidative damage through regulating GA metabolism, CBF1 gene expression, and antioxidant enzyme activities.

  19. Data Element Registry Services

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  20. Glycogen Synthase Kinase 3α Is the Main Isoform That Regulates the Transcription Factors Nuclear Factor-Kappa B and cAMP Response Element Binding in Bovine Endothelial Cells Infected with Staphylococcus aureus

    Octavio Silva-García

    2018-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutive enzyme implicated in the regulation of cytokine expression and the inflammatory response during bacterial infections. Mammals have two GSK3 isoforms named GSK3α and GSK3β that plays different but often overlapping functions. Although the role of GSK3β in cytokine regulation during the inflammatory response caused by bacteria is well described, GSK3α has not been found to participate in this process. Therefore, we tested if GSK3α may act as a regulatory isoform in the cytokine expression by bovine endothelial cells infected with Staphylococcus aureus because this bacterium is one of the major pathogens that cause tissue damage associated with inflammatory dysfunction. Interestingly, although both isoforms were phosphorylated–inactivated, we consistently observed a higher phosphorylation of GSK3α at Ser21 than that of GSK3β at Ser9 after bacterial challenge. During a temporal course of infection, we characterized a molecular switch from pro-inflammatory cytokine expression (IL-8, promoted by nuclear factor-kappa B (NF-κB, at an early stage (2 h to an anti-inflammatory cytokine expression (IL-10, promoted by cAMP response element binding (CREB, at a later stage (6 h. We observed an indirect effect of GSK3α activity on NF-κB activation that resulted in a low phosphorylation of CREB at Ser133, a decreased interaction between CREB and the co-activator CREB-binding protein (CBP, and a lower expression level of IL-10. Gene silencing of GSK3α and GSK3β with siRNA indicated that GSK3α knockout promoted the interaction between CREB and CBP that, in turn, increased the expression of IL-10, reduced the interaction of NF-κB with CBP, and reduced the expression of IL-8. These results indicate that GSK3α functions as the primary isoform that regulates the expression of IL-10 in endothelial cells infected with S. aureus.