WorldWideScience

Sample records for response element pathway

  1. Transuranic element pathways to man

    Bennett, B.G.

    1976-01-01

    Transfer to man of transuranic element contamination may occur by the inhalation or ingestion pathways. The measurements of globally dispersed fall-out radioactivity have provided pertinent data on the environmental behaviour of plutonium. Additional data may eventually become available for americium. From the measured and inferred concentrations of fall-out plutonium, the inhalation intake has been determined and the ICRP Task Group lung model used to estimate deposition in the lung and transfer to other body organs. The computed body burden reached a maximum of 4pCi in 1964 and is currently about 2.5pCi. A complete diet sampling has been conducted to determine ingestion intake. Plutonium concentration in food ranged from 0.01pCi/kg in shellfish to undetected (less than 0.0003pCi/kg) in milk. Annual intake in total diet is estimated to have been 1.6pCi in 1972. Low uptake by the gastrointestinal tract makes contribution to organ burdens from ingestion negligible. Long-term pathway considerations include plant uptake from the cumulative deposit in soil and resuspension. Downward movement in soil may limit the significance of these long-term pathway components. (author)

  2. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  3. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  4. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  5. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  6. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  7. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  8. DNA damage response pathway in radioadaptive response.

    Sasaki, Masao S; Ejima, Yosuke; Tachibana, Akira; Yamada, Toshiko; Ishizaki, Kanji; Shimizu, Takashi; Nomura, Taisei

    2002-07-25

    Radioadaptive response is a biological defense mechanism in which low-dose ionizing irradiation elicits cellular resistance to the genotoxic effects of subsequent irradiation. However, its molecular mechanism remains largely unknown. We previously demonstrated that the dose recognition and adaptive response could be mediated by a feedback signaling pathway involving protein kinase C (PKC), p38 mitogen activated protein kinase (p38MAPK) and phospholipase C (PLC). Further, to elucidate the downstream effector pathway, we studied the X-ray-induced adaptive response in cultured mouse and human cells with different genetic background relevant to the DNA damage response pathway, such as deficiencies in TP53, DNA-PKcs, ATM and FANCA genes. The results showed that p53 protein played a key role in the adaptive response while DNA-PKcs, ATM and FANCA were not responsible. Wortmannin, a specific inhibitor of phosphatidylinositol 3-kinase (PI3K), mimicked the priming irradiation in that the inhibitor alone rendered the cells resistant against the induction of chromosome aberrations and apoptosis by the subsequent X-ray irradiation. The adaptive response, whether it was afforded by low-dose X-rays or wortmannin, occurred in parallel with the reduction of apoptotic cell death by challenging doses. The inhibitor of p38MAPK which blocks the adaptive response did not suppress apoptosis. These observations indicate that the adaptive response and apoptotic cell death constitute a complementary defense system via life-or-death decisions. The p53 has a pivotal role in channeling the radiation-induced DNA double-strand breaks (DSBs) into an adaptive legitimate repair pathway, where the signals are integrated into p53 by a circuitous PKC-p38MAPK-PLC damage sensing pathway, and hence turning off the signals to an alternative pathway to illegitimate repair and apoptosis. A possible molecular mechanism of adaptive response to low-dose ionizing irradiation has been discussed in relation to

  9. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  10. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  11. Salicylic-Acid-Induced Chilling- and Oxidative-Stress Tolerance in Relation to Gibberellin Homeostasis, C-Repeat/Dehydration-Responsive Element Binding Factor Pathway, and Antioxidant Enzyme Systems in Cold-Stored Tomato Fruit.

    Ding, Yang; Zhao, Jinhong; Nie, Ying; Fan, Bei; Wu, Shujuan; Zhang, Yu; Sheng, Jiping; Shen, Lin; Zhao, Ruirui; Tang, Xuanming

    2016-11-02

    Effects of salicylic acid (SA) on gibberellin (GA) homeostasis, C-repeat/dehydration-responsive element binding factor (CBF) pathway, and antioxidant enzyme systems linked to chilling- and oxidative-stress tolerance in tomato fruit were investigated. Mature green tomatoes (Solanum lycopersicum L. cv. Moneymaker) were treated with 0, 0.5, and 1 mM SA solution for 15 min before storage at 4 °C for 28 days. In comparison to 0 or 0.5 mM SA, 1 mM SA significantly decreased the chilling injury (CI) index in tomato fruit. In the SA-treated fruit, the upregulation of GA biosynthetic gene (GA3ox1) expression was followed by gibberellic acid (GA 3 ) surge and DELLA protein degradation. CBF1 participated in the SA-modulated tolerance and stimulated the expression of GA catabolic gene (GA2ox1). Furthermore, 1 mM SA enhanced activities of antioxidant enzymes and, thus, reduced reactive oxygen species accumulation. Our findings suggest that SA might protect tomato fruit from CI and oxidative damage through regulating GA metabolism, CBF1 gene expression, and antioxidant enzyme activities.

  12. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  13. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  14. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  15. Benzo[a]pyrene affects Jurkat T cells in the activated state via the antioxidant response element dependent Nrf2 pathway leading to decreased IL-2 secretion and redirecting glutamine metabolism

    Murugaiyan, Jayaseelan; Rockstroh, Maxie; Wagner, Juliane [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Baumann, Sven [Department of Metabolomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Schorsch, Katrin [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Trump, Saskia; Lehmann, Irina [Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Bergen, Martin von [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aalborg (Denmark); Tomm, Janina M., E-mail: Janina.tomm@ufz.de [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany)

    2013-06-15

    There is a clear evidence that environmental pollutants, such as benzo[a]pyrene (B[a]P), can have detrimental effects on the immune system, whereas the underlying mechanisms still remain elusive. Jurkat T cells share many properties with native T lymphocytes and therefore are an appropriate model to analyze the effects of environmental pollutants on T cells and their activation. Since environmental compounds frequently occur at low, not acute toxic concentrations, we analyzed the effects of two subtoxic concentrations, 50 nM and 5 μM, on non- and activated cells. B[a]P interferes directly with the stimulation process as proven by an altered IL-2 secretion. Furthermore, B[a]P exposure results in significant proteomic changes as shown by DIGE analysis. Pathway analysis revealed an involvement of the AhR independent Nrf2 pathway in the altered processes observed in unstimulated and stimulated cells. A participation of the Nrf2 pathway in the change of IL-2 secretion was confirmed by exposing cells to the Nrf2 activator tBHQ. tBHQ and 5 μM B[a]P caused similar alterations of IL-2 secretion and glutamine/glutamate metabolism. Moreover, the proteome changes in unstimulated cells point towards a modified regulation of the cytoskeleton and cellular stress response, which was proven by western blotting. Additionally, there is a strong evidence for alterations in metabolic pathways caused by B[a]P exposure in stimulated cells. Especially the glutamine/glutamate metabolism was indicated by proteome pathway analysis and validated by metabolite measurements. The detrimental effects were slightly enhanced in stimulated cells, suggesting that stimulated cells are more vulnerable to the environmental pollutant model compound B[a]P. - Highlights: • B[a]P affects the proteome of Jurkat T cells also at low concentrations. • Exposure to B[a]P (50 nM, 5 μM) did not change Jurkat T cell viability. • Both B[a]P concentrations altered the IL-2 secretion of stimulated cells.

  16. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  17. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  18. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  19. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  20. Stress responses during ageing: molecular pathways regulating protein homeostasis.

    Kyriakakis, Emmanouil; Princz, Andrea; Tavernarakis, Nektarios

    2015-01-01

    The ageing process is characterized by deterioration of physiological function accompanied by frailty and ageing-associated diseases. The most broadly and well-studied pathways influencing ageing are the insulin/insulin-like growth factor 1 signaling pathway and the dietary restriction pathway. Recent studies in diverse organisms have also delineated emerging pathways, which collectively or independently contribute to ageing. Among them the proteostatic-stress-response networks, inextricably affect normal ageing by maintaining or restoring protein homeostasis to preserve proper cellular and organismal function. In this chapter, we survey the involvement of heat stress and endoplasmic reticulum stress responses in the regulation of longevity, placing emphasis on the cross talk between different response mechanisms and their systemic effects. We further discuss novel insights relevant to the molecular pathways mediating these stress responses that may facilitate the development of innovative interventions targeting age-related pathologies such as diabetes, cancer, cardiovascular and neurodegenerative diseases.

  1. The node-weighted Steiner tree approach to identify elements of cancer-related signaling pathways.

    Sun, Yahui; Ma, Chenkai; Halgamuge, Saman

    2017-12-28

    Cancer constitutes a momentous health burden in our society. Critical information on cancer may be hidden in its signaling pathways. However, even though a large amount of money has been spent on cancer research, some critical information on cancer-related signaling pathways still remains elusive. Hence, new works towards a complete understanding of cancer-related signaling pathways will greatly benefit the prevention, diagnosis, and treatment of cancer. We propose the node-weighted Steiner tree approach to identify important elements of cancer-related signaling pathways at the level of proteins. This new approach has advantages over previous approaches since it is fast in processing large protein-protein interaction networks. We apply this new approach to identify important elements of two well-known cancer-related signaling pathways: PI3K/Akt and MAPK. First, we generate a node-weighted protein-protein interaction network using protein and signaling pathway data. Second, we modify and use two preprocessing techniques and a state-of-the-art Steiner tree algorithm to identify a subnetwork in the generated network. Third, we propose two new metrics to select important elements from this subnetwork. On a commonly used personal computer, this new approach takes less than 2 s to identify the important elements of PI3K/Akt and MAPK signaling pathways in a large node-weighted protein-protein interaction network with 16,843 vertices and 1,736,922 edges. We further analyze and demonstrate the significance of these identified elements to cancer signal transduction by exploring previously reported experimental evidences. Our node-weighted Steiner tree approach is shown to be both fast and effective to identify important elements of cancer-related signaling pathways. Furthermore, it may provide new perspectives into the identification of signaling pathways for other human diseases.

  2. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Pathways to Healing: Person-centered Responses to Complementary Services

    Bertrand, Sharon W.; Fermon, Barbara; Coleman, Julie Foley

    2014-01-01

    Objectives: This research study assessed perceived changes in quality-of-life measures related to participation in complementary services consisting of a variety of nontraditional therapies and/or programs at Pathways: A Health Crisis Resource Center in Minneapolis, Minnesota. Design: Survey data were used to assess perceived changes participants ascribed to their experience with complementary services at Pathways. Quantitative data analysis was conducted using participant demographics together with participant ratings of items from the “Self-Assessment of Change” (SAC) measure developed at the University of Arizona, Tucson. Qualitative data analysis was conducted on written responses to an additional survey question: “To what extent has your participation at Pathways influenced your healing process?” Setting/Location: Pathways offers a variety of services, including one-to-one sessions using nontraditional healing therapies, support groups, educational classes, and practice groups such as yoga and meditation for those facing serious health challenges. These services are offered free of charge through community financial support using volunteer practitioners. Participants: People (126) diagnosed with serious health challenges who used Pathways services from 2007 through 2009. Interventions: Participation in self-selected Pathways services. Measures: Responses to items on the SAC measure plus written responses to the question, “To what extent has your participation at Pathways influenced your healing process?” Results: Quantitative findings: Participants reported experiencing significant changes across all components of the SAC measure. Qualitative findings: Responses to the open-ended survey question identified perspectives on the culture of Pathways and a shift in participants' perceptions of well-being based on their experience of Pathways services. Conclusions: Participation in services provided by the Pathways organization improved perceptions of

  4. Epigenetic telomere protection by Drosophila DNA damage response pathways.

    Oikemus, Sarah R; Queiroz-Machado, Joana; Lai, KuanJu; McGinnis, Nadine; Sunkel, Claudio; Brodsky, Michael H

    2006-05-01

    Analysis of terminal deletion chromosomes indicates that a sequence-independent mechanism regulates protection of Drosophila telomeres. Mutations in Drosophila DNA damage response genes such as atm/tefu, mre11, or rad50 disrupt telomere protection and localization of the telomere-associated proteins HP1 and HOAP, suggesting that recognition of chromosome ends contributes to telomere protection. However, the partial telomere protection phenotype of these mutations limits the ability to test if they act in the epigenetic telomere protection mechanism. We examined the roles of the Drosophila atm and atr-atrip DNA damage response pathways and the nbs homolog in DNA damage responses and telomere protection. As in other organisms, the atm and atr-atrip pathways act in parallel to promote telomere protection. Cells lacking both pathways exhibit severe defects in telomere protection and fail to localize the protection protein HOAP to telomeres. Drosophila nbs is required for both atm- and atr-dependent DNA damage responses and acts in these pathways during DNA repair. The telomere fusion phenotype of nbs is consistent with defects in each of these activities. Cells defective in both the atm and atr pathways were used to examine if DNA damage response pathways regulate telomere protection without affecting telomere specific sequences. In these cells, chromosome fusion sites retain telomere-specific sequences, demonstrating that loss of these sequences is not responsible for loss of protection. Furthermore, terminally deleted chromosomes also fuse in these cells, directly implicating DNA damage response pathways in the epigenetic protection of telomeres. We propose that recognition of chromosome ends and recruitment of HP1 and HOAP by DNA damage response proteins is essential for the epigenetic protection of Drosophila telomeres. Given the conserved roles of DNA damage response proteins in telomere function, related mechanisms may act at the telomeres of other organisms.

  5. Estradiol up-regulates L-type Ca2+ channels via membrane-bound estrogen receptor/phosphoinositide-3-kinase/Akt/cAMP response element-binding protein signaling pathway.

    Yang, Xiaoyan; Mao, Xiaofang; Xu, Gao; Xing, Shasha; Chattopadhyay, Ansuman; Jin, Si; Salama, Guy

    2018-05-01

    In long QT syndrome type 2, women are more prone than men to the lethal arrhythmia torsades de pointes. We previously reported that 17β-estradiol (E2) up-regulates L-type Ca 2+ channels and current (I Ca,L ) (∼30%) in rabbit ventricular myocytes by a classic genomic mechanism mediated by estrogen receptor-α (ERα). In long QT syndrome type 2 (I Kr blockade or bradycardia), the higher Ca 2+ influx via I Ca,L causes Ca 2+ overload, spontaneous sarcoplasmic reticulum Ca 2+ release, and reactivation of I Ca,L that triggers early afterdepolarizations and torsades de pointes. The purpose of this study was to investigate the molecular mechanisms whereby E2 up-regulates I Ca,L , which are poorly understood. H9C2 and rat myocytes were incubated with E2 ± ER antagonist, or inhibitors of downstream transcription factors, for 24 hours, followed by western blots of Cav1.2α1C and voltage-clamp measurements of I Ca,L . Incubation of H9C2 cells with E2 (10-100 nM) increased I Ca,L density and Cav1.2α1C expression, which were suppressed by the ER antagonist ICI182,780 (1 μM). Enhanced I Ca,L and Cav1.2α1C expression by E2 was suppressed by inhibitors of phosphoinositide-3-kinase (Pi3K) (30 μM LY294002; P L via plasma membrane ER and by activating Pi3K, Akt, and CREB signaling. The promoter regions of the CACNA1C gene (human-rabbit-rat) contain adjacent/overlapping binding sites for p-CREB and ERα, which suggests a synergistic regulation by these pathways. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  6. Discriminating response groups in metabolic and regulatory pathway networks.

    Van Hemert, John L; Dickerson, Julie A

    2012-04-01

    Analysis of omics experiments generates lists of entities (genes, metabolites, etc.) selected based on specific behavior, such as changes in response to stress or other signals. Functional interpretation of these lists often uses category enrichment tests using functional annotations like Gene Ontology terms and pathway membership. This approach does not consider the connected structure of biochemical pathways or the causal directionality of events. The Omics Response Group (ORG) method, described in this work, interprets omics lists in the context of metabolic pathway and regulatory networks using a statistical model for flow within the networks. Statistical results for all response groups are visualized in a novel Pathway Flow plot. The statistical tests are based on the Erlang distribution model under the assumption of independent and identically Exponential-distributed random walk flows through pathways. As a proof of concept, we applied our method to an Escherichia coli transcriptomics dataset where we confirmed common knowledge of the E.coli transcriptional response to Lipid A deprivation. The main response is related to osmotic stress, and we were also able to detect novel responses that are supported by the literature. We also applied our method to an Arabidopsis thaliana expression dataset from an abscisic acid study. In both cases, conventional pathway enrichment tests detected nothing, while our approach discovered biological processes beyond the original studies. We created a prototype for an interactive ORG web tool at http://ecoserver.vrac.iastate.edu/pathwayflow (source code is available from https://subversion.vrac.iastate.edu/Subversion/jlv/public/jlv/pathwayflow). The prototype is described along with additional figures and tables in Supplementary Material. julied@iastate.edu Supplementary data are available at Bioinformatics online.

  7. Reconstructing transport pathways for late Quaternary dust from eastern Australia using the composition of trace elements of long traveled dusts

    Petherick, Lynda M.; McGowan, Hamish A.; Kamber, Balz S.

    2009-04-01

    The southeast Australian dust transport corridor is the principal pathway through which continental emissions of dust from central and eastern Australia are carried to the oceans by the prevailing mid-latitude westerly circulation. The analysis of trace elements of aeolian dust, preserved in lake sediment on North Stradbroke Island, southeast Queensland, is used to reconstruct variation in the intensity and position of dust transport to the island over the past 25,000 yrs. Separation of local and long traveled dust content of lake sediments is achieved using a unique, four-element (Ga, Ni, Tl and Sc) separation method. The local and continental chronologies of aeolian deposition developed by this study show markedly different records, and indicate varied responses to climate variability on North Stradbroke Island (local aeolian sediment component) and in eastern and central Australia (long traveled dust component). The provenance of the continental component of the record to sub-geologic catchment scales was accomplished using a ternary mixing model in which the chemical identification of dusts extracted, from the lake sediments, was compared to potential chemical characteristics of surface dust from the source areas using 16 trace elements. The results indicate that the position and intensity of dust transport pathways during the late Quaternary varied considerably in response to changing atmospheric circulation patterns as well as to variations in sediment supply to dust source areas, which include the large anabranching river systems of the Lake Eyre and Murray-Darling Basins.

  8. Oxidative stress response pathways: Fission yeast as archetype

    Papadakis, Manos A.; Workman, Christopher

    2015-01-01

    Schizosaccharomyces pombe is a popular model eukaryotic organism to study diverse aspects of mammalian biology, including responses to cellular stress triggered by redox imbalances within its compartments. The review considers the current knowledge on the signaling pathways that govern the transc...

  9. Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2012-01-01

    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

  10. Association genetics and transcriptome analysis reveal a gibberellin-responsive pathway involved in regulating photosynthesis.

    Xie, Jianbo; Tian, Jiaxing; Du, Qingzhang; Chen, Jinhui; Li, Ying; Yang, Xiaohui; Li, Bailian; Zhang, Deqiang

    2016-05-01

    Gibberellins (GAs) regulate a wide range of important processes in plant growth and development, including photosynthesis. However, the mechanism by which GAs regulate photosynthesis remains to be understood. Here, we used multi-gene association to investigate the effect of genes in the GA-responsive pathway, as constructed by RNA sequencing, on photosynthesis, growth, and wood property traits, in a population of 435 Populus tomentosa By analyzing changes in the transcriptome following GA treatment, we identified many key photosynthetic genes, in agreement with the observed increase in measurements of photosynthesis. Regulatory motif enrichment analysis revealed that 37 differentially expressed genes related to photosynthesis shared two essential GA-related cis-regulatory elements, the GA response element and the pyrimidine box. Thus, we constructed a GA-responsive pathway consisting of 47 genes involved in regulating photosynthesis, including GID1, RGA, GID2, MYBGa, and 37 photosynthetic differentially expressed genes. Single nucleotide polymorphism (SNP)-based association analysis showed that 142 SNPs, representing 40 candidate genes in this pathway, were significantly associated with photosynthesis, growth, and wood property traits. Epistasis analysis uncovered interactions between 310 SNP-SNP pairs from 37 genes in this pathway, revealing possible genetic interactions. Moreover, a structural gene-gene matrix based on a time-course of transcript abundances provided a better understanding of the multi-gene pathway affecting photosynthesis. The results imply a functional role for these genes in mediating photosynthesis, growth, and wood properties, demonstrating the potential of combining transcriptome-based regulatory pathway construction and genetic association approaches to detect the complex genetic networks underlying quantitative traits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights

  11. Predicting protein folding pathways at the mesoscopic level based on native interactions between secondary structure elements

    Sze Sing-Hoi

    2008-07-01

    Full Text Available Abstract Background Since experimental determination of protein folding pathways remains difficult, computational techniques are often used to simulate protein folding. Most current techniques to predict protein folding pathways are computationally intensive and are suitable only for small proteins. Results By assuming that the native structure of a protein is known and representing each intermediate conformation as a collection of fully folded structures in which each of them contains a set of interacting secondary structure elements, we show that it is possible to significantly reduce the conformation space while still being able to predict the most energetically favorable folding pathway of large proteins with hundreds of residues at the mesoscopic level, including the pig muscle phosphoglycerate kinase with 416 residues. The model is detailed enough to distinguish between different folding pathways of structurally very similar proteins, including the streptococcal protein G and the peptostreptococcal protein L. The model is also able to recognize the differences between the folding pathways of protein G and its two structurally similar variants NuG1 and NuG2, which are even harder to distinguish. We show that this strategy can produce accurate predictions on many other proteins with experimentally determined intermediate folding states. Conclusion Our technique is efficient enough to predict folding pathways for both large and small proteins at the mesoscopic level. Such a strategy is often the only feasible choice for large proteins. A software program implementing this strategy (SSFold is available at http://faculty.cs.tamu.edu/shsze/ssfold.

  12. Stress Response Pathways in Ameloblasts: Implications for Amelogenesis and Dental Fluorosis

    John D. Bartlett

    2012-08-01

    Full Text Available Human enamel development of the permanent teeth takes place during childhood and stresses encountered during this period can have lasting effects on the appearance and structural integrity of the enamel. One of the most common examples of this is the development of dental fluorosis after childhood exposure to excess fluoride, an elemental agent used to increase enamel hardness and prevent dental caries. Currently the molecular mechanism responsible for dental fluorosis remains unknown; however, recent work suggests dental fluorosis may be the result of activated stress response pathways in ameloblasts during the development of permanent teeth. Using fluorosis as an example, the role of stress response pathways during enamel maturation is discussed.

  13. The intersection between DNA damage response and cell death pathways.

    Nowsheen, S; Yang, E S

    2012-10-01

    Apoptosis is a finely regulated process that serves to determine the fate of cells in response to various stresses. One such stress is DNA damage, which not only can signal repair processes but is also intimately involved in regulating cell fate. In this review we examine the relationship between the DNA damage/repair response in cell survival and apoptosis following insults to the DNA. Elucidating these pathways and the crosstalk between them is of great importance, as they eventually contribute to the etiology of human disease such as cancer and may play key roles in determining therapeutic response. This article is part of a Special Issue entitled "Apoptosis: Four Decades Later".

  14. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  15. Mechanisms Underlying the Antidepressant Response of Acupuncture via PKA/CREB Signaling Pathway.

    Jiang, Huili; Zhang, Xuhui; Wang, Yu; Zhang, Huimin; Li, Jing; Yang, Xinjing; Zhao, Bingcong; Zhang, Chuntao; Yu, Miao; Xu, Mingmin; Yu, Qiuyun; Liang, Xingchen; Li, Xiang; Shi, Peng; Bao, Tuya

    2017-01-01

    Protein kinase A (PKA)/cAMP response element-binding (CREB) protein signaling pathway, contributing to impaired neurogenesis parallel to depressive-like behaviors, has been identified as the crucial factor involved in the antidepressant response of acupuncture. However, the molecular mechanisms associated with antidepressant response of acupuncture, neurogenesis, and depressive-like behaviors ameliorating remain unexplored. The objective was to identify the mechanisms underlying the antidepressant response of acupuncture through PKA signaling pathway in depression rats by employing the PKA signaling pathway inhibitor H89 in in vivo experiments. Our results indicated that the expression of hippocampal PKA- α and p-CREB was significantly downregulated by chronic unpredicted mild stress (CUMS) procedures. Importantly, acupuncture reversed the downregulation of PKA- α and p-CREB. The expression of PKA- α was upregulated by fluoxetine, but not p-CREB. No significant difference was found between Acu and FLX groups on the expression of PKA- α and p-CREB. Interestingly, H89 inhibited the effects of acupuncture or fluoxetine on upregulating the expression of p-CREB, but not PKA- α . There was no significant difference in expression of CREB among the groups. Conclusively, our findings further support the hypothesis that acupuncture could ameliorate depressive-like behaviors by regulating PKA/CREB signaling pathway, which might be mainly mediated by regulating the phosphorylation level of CREB.

  16. Interaction Dynamics Determine Signaling and Output Pathway Responses

    Klement Stojanovski

    2017-04-01

    Full Text Available The understanding of interaction dynamics in signaling pathways can shed light on pathway architecture and provide insights into targets for intervention. Here, we explored the relevance of kinetic rate constants of a key upstream osmosensor in the yeast high-osmolarity glycerol-mitogen-activated protein kinase (HOG-MAPK pathway to signaling output responses. We created mutant pairs of the Sln1-Ypd1 complex interface that caused major compensating changes in the association (kon and dissociation (koff rate constants (kinetic perturbations but only moderate changes in the overall complex affinity (Kd. Yeast cells carrying a Sln1-Ypd1 mutant pair with moderate increases in kon and koff displayed a lower threshold of HOG pathway activation than wild-type cells. Mutants with higher kon and koff rates gave rise to higher basal signaling and gene expression but impaired osmoadaptation. Thus, the kon and koff rates of the components in the Sln1 osmosensor determine proper signaling dynamics and osmoadaptation.

  17. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  18. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  19. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  20. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  1. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  2. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  3. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors.

    Loboda, Andrey; Nebozhyn, Michael; Klinghoffer, Rich; Frazier, Jason; Chastain, Michael; Arthur, William; Roberts, Brian; Zhang, Theresa; Chenard, Melissa; Haines, Brian; Andersen, Jannik; Nagashima, Kumiko; Paweletz, Cloud; Lynch, Bethany; Feldman, Igor; Dai, Hongyue; Huang, Pearl; Watters, James

    2010-06-30

    Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90%) sensitivity but relatively low (50%) specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical utility in lung and breast tumors.

  4. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors

    Paweletz Cloud

    2010-06-01

    Full Text Available Abstract Background Hyperactivation of the Ras signaling pathway is a driver of many cancers, and RAS pathway activation can predict response to targeted therapies. Therefore, optimal methods for measuring Ras pathway activation are critical. The main focus of our work was to develop a gene expression signature that is predictive of RAS pathway dependence. Methods We used the coherent expression of RAS pathway-related genes across multiple datasets to derive a RAS pathway gene expression signature and generate RAS pathway activation scores in pre-clinical cancer models and human tumors. We then related this signature to KRAS mutation status and drug response data in pre-clinical and clinical datasets. Results The RAS signature score is predictive of KRAS mutation status in lung tumors and cell lines with high (> 90% sensitivity but relatively low (50% specificity due to samples that have apparent RAS pathway activation in the absence of a KRAS mutation. In lung and breast cancer cell line panels, the RAS pathway signature score correlates with pMEK and pERK expression, and predicts resistance to AKT inhibition and sensitivity to MEK inhibition within both KRAS mutant and KRAS wild-type groups. The RAS pathway signature is upregulated in breast cancer cell lines that have acquired resistance to AKT inhibition, and is downregulated by inhibition of MEK. In lung cancer cell lines knockdown of KRAS using siRNA demonstrates that the RAS pathway signature is a better measure of dependence on RAS compared to KRAS mutation status. In human tumors, the RAS pathway signature is elevated in ER negative breast tumors and lung adenocarcinomas, and predicts resistance to cetuximab in metastatic colorectal cancer. Conclusions These data demonstrate that the RAS pathway signature is superior to KRAS mutation status for the prediction of dependence on RAS signaling, can predict response to PI3K and RAS pathway inhibitors, and is likely to have the most clinical

  5. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  6. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  7. Branching points for transition pathways: assessing responses of actors to challenges on pathways to a low carbon future

    Foxon, Timothy J.; Pearson, Peter J.G.; Arapostathis, Stathis; Carlsson-Hyslop, Anna; Thornton, Judith

    2013-01-01

    This paper describes initial analysis of branching points on a set of transition pathways to a UK low carbon electricity future by 2050. As described in other papers in this special issue, we are exploring and analysing a set of core transition pathways, based on alternative governance patterns in which the ‘logics’ of market actors, government actors and civil society actors, respectively dominate. This core pathway analysis is enhanced by analyses of branching points within and across the pathways, which informs how competition between different logics plays out at key decision points. Branching points are defined as key decision points at which choices made by actors, in response to internal or external stresses or triggers, determine whether and in what ways the pathway is followed. A set of initial branching points for our three core transition pathways is identified through project and stakeholder workshops, and drawing on analysis of actors’ choices and responses at past branching points in energy system transitions. The potential responses of the actors are identified at these branching points, and risk mitigation strategies are formulated for the dominant actors to reinforce that pathway, as well as opportunities for actors to move away from the pathway. - Highlights: Transition Pathways is analysing three potential pathways to a low carbon future. ► Stresses lead to branching points, where actors make choices, creating pathways. ► These choices may lead to path-dependency. ► Differences in governance logics within transition pathways are also analysed. ► Studying branching points adds theoretical understanding and policy relevance to TP.

  8. The SOS response is permitted in Escherichia coli strains deficient in the expression of the mazEF pathway.

    Kalderon, Ziva; Kumar, Sathish; Engelberg-Kulka, Hanna

    2014-01-01

    The Escherichia coli (E. coli) SOS response is the largest, most complex, and best characterized bacterial network induced by DNA damage. It is controlled by a complex network involving the RecA and LexA proteins. We have previously shown that the SOS response to DNA damage is inhibited by various elements involved in the expression of the E. coli toxin-antitoxin mazEF pathway. Since the mazEF module is present on the chromosomes of most E. coli strains, here we asked: Why is the SOS response found in so many E. coli strains? Is the mazEF module present but inactive in those strains? We examined three E. coli strains used for studies of the SOS response, strains AB1932, BW25113, and MG1655. We found that each of these strains is either missing or inhibiting one of several elements involved in the expression of the mazEF-mediated death pathway. Thus, the SOS response only takes place in E. coli cells in which one or more elements of the E. coli toxin-antitoxin module mazEF or its downstream pathway is not functioning.

  9. An evaluation of the food chain pathway for transuranium elements dispersed in soils

    Linsley, G.S.; Simmonds, J.R.; Kelly, G.N.

    1978-12-01

    Man can be exposed to radiation from transuranium elements dispersed in soils by two main routes; through the inhalation of resuspended particles and by ingestion of food products derived from the contaminated soils. In this report relationships are derived between the concentration in soil of two radionuclides, plutonium-239 and americium-241, and the dose to man. The transfer of the transuranium radionuclides through the food chains to man is evaluated using compartment models which are dynamic in character. The two pathways to man are of the same order of importance, within the uncertainties of the available data, and both must be considered in dose assessments. The technique of sensitivity analysis is used to identify areas where further research and investigations are necessary to improve the reliability of the assessment of radiation dose to man. (author)

  10. Overweight adolescents' brain response to sweetened beverages mirrors addiction pathways.

    Feldstein Ewing, Sarah W; Claus, Eric D; Hudson, Karen A; Filbey, Francesca M; Yakes Jimenez, Elizabeth; Lisdahl, Krista M; Kong, Alberta S

    2017-08-01

    Many adolescents struggle with overweight/obesity, which exponentially increases in the transition to adulthood. Overweight/obesity places youth at risk for serious health conditions, including type 2 diabetes. In adults, neural substrates implicated in addiction (e.g., orbitofrontal cortex (OFC), striatum, amygdala, and ventral tegmental area) have been found to be relevant to risk for overweight/obesity. In this study, we examined three hypotheses to disentangle the potential overlap between addiction and overweight/obesity processing by examining (1) brain response to high vs. low calorie beverages, (2) the strength of correspondence between biometrics, including body mass index (BMI) and insulin resistance, and brain response and (3) the relationship between a measure of food addiction and brain response using an established fMRI gustatory cue exposure task with a sample of overweight/obese youth (M age = 16.46; M BMI = 33.1). Greater BOLD response was observed across the OFC, inferior frontal gyrus (IFG), nucleus accumbens, right amygdala, and additional frontoparietal and temporal regions in neural processing of high vs. low calorie beverages. Further, BMI scores positively correlated with BOLD activation in the high calorie > low calorie contrast in the right postcentral gyrus and central operculum. Insulin resistance positively correlated with BOLD activation across the bilateral middle/superior temporal gyrus, left OFC, and superior parietal lobe. No relationships were observed between measures of food addiction and brain response. These findings support the activation of parallel addiction-related neural pathways in adolescents' high calorie processing, while also suggesting the importance of refining conceptual and neurocognitive models to fit this developmental period.

  11. Yeast signaling pathways in the oxidative stress response

    Ikner, Aminah [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States); Shiozaki, Kazuhiro [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States)]. E-mail: kshiozaki@ucdavis.edu

    2005-01-06

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed.

  12. Yeast signaling pathways in the oxidative stress response

    Ikner, Aminah; Shiozaki, Kazuhiro

    2005-01-01

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed

  13. Subtype and pathway specific responses to anticancer compounds in breast cancer.

    Heiser, Laura M; Sadanandam, Anguraj; Kuo, Wen-Lin; Benz, Stephen C; Goldstein, Theodore C; Ng, Sam; Gibb, William J; Wang, Nicholas J; Ziyad, Safiyyah; Tong, Frances; Bayani, Nora; Hu, Zhi; Billig, Jessica I; Dueregger, Andrea; Lewis, Sophia; Jakkula, Lakshmi; Korkola, James E; Durinck, Steffen; Pepin, François; Guan, Yinghui; Purdom, Elizabeth; Neuvial, Pierre; Bengtsson, Henrik; Wood, Kenneth W; Smith, Peter G; Vassilev, Lyubomir T; Hennessy, Bryan T; Greshock, Joel; Bachman, Kurtis E; Hardwicke, Mary Ann; Park, John W; Marton, Laurence J; Wolf, Denise M; Collisson, Eric A; Neve, Richard M; Mills, Gordon B; Speed, Terence P; Feiler, Heidi S; Wooster, Richard F; Haussler, David; Stuart, Joshua M; Gray, Joe W; Spellman, Paul T

    2012-02-21

    Breast cancers are comprised of molecularly distinct subtypes that may respond differently to pathway-targeted therapies now under development. Collections of breast cancer cell lines mirror many of the molecular subtypes and pathways found in tumors, suggesting that treatment of cell lines with candidate therapeutic compounds can guide identification of associations between molecular subtypes, pathways, and drug response. In a test of 77 therapeutic compounds, nearly all drugs showed differential responses across these cell lines, and approximately one third showed subtype-, pathway-, and/or genomic aberration-specific responses. These observations suggest mechanisms of response and resistance and may inform efforts to develop molecular assays that predict clinical response.

  14. Making assessments while taking repeated risks: a pattern of multiple response pathways.

    Pleskac, Timothy J; Wershbale, Avishai

    2014-02-01

    Beyond simply a decision process, repeated risky decisions also require a number of cognitive processes including learning, search and exploration, and attention. In this article, we examine how multiple response pathways develop over repeated risky decisions. Using the Balloon Analogue Risk Task (BART) as a case study, we show that 2 different response pathways emerge over the course of the task. The assessment pathway is a slower, more controlled pathway where participants deliberate over taking a risk. The 2nd pathway is a faster, more automatic process where no deliberation occurs. Results imply the slower assessment pathway is taken as choice conflict increases and that the faster automatic response is a learned response. Based on these results, we modify an existing formal cognitive model of decision making during the BART to account for these dual response pathways. The slower more deliberative response process is modeled with a sequential sampling process where evidence is accumulated to a threshold, while the other response is given automatically. We show that adolescents with conduct disorder and substance use disorder symptoms not only evaluate risks differently during the BART but also differ in the rate at which they develop the more automatic response. More broadly, our results suggest cognitive models of judgment decision making need to transition from treating observed decisions as the result of a single response pathway to the result of multiple response pathways that change and develop over time.

  15. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  16. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  17. DESCENDING PATHWAYS AND THE HOPPING RESPONSE IN THE RABBIT

    HOBBELEN, JF; GRAMSBERGEN, A; VANHOF, MW

    1992-01-01

    Descending pathways were studied in 5 adult rabbits by means of HRP, injected in the cervical spinal cord (in C2 and C3) at the right side. Results indicate the existence of pathways from the contralateral motor cortex, bilateral projections from the red nuclei, from the vestibular nuclei and from

  18. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  19. Radiation-induced adaptive response and intracellular signal transduction pathways

    Tachibana, Akira

    2009-01-01

    As an essential biological function, cells can sense the radiation even at low dose and respond to it, and which is one of bases of the radiation-induced adaptive response (AR) where effects caused by high dose radiation are reduced by prior exposure to low dose radiation (LDR). Here described are studies of AR in well established m5S cells on the intracellular signal transduction that involves sensing of LDR and transmitting of its signal within the cell network. The first signal for AR yielded by LDR on the cell membrane is exactly unknown though hydrogen peroxide and phorbol ester (PMA) can reportedly cause AR. As PMA activates protein kinase C (PKC) and its inhibitors suppress AR, participation of PKC in AR has been suggested and supported by studies showing PKCα activation by LDR. In addition, p38 mitogen-activated protein kinase (MAPK) is shown to participate in AR by those facts that the enzyme is activated by LDR, a p38 MAPK inhibitor suppresses AR, and PKC inhibitors suppress the enzyme activation, which also suggesting that the signaling from PKC to p38 MAPK can become operative by LDR. However, the possible reverse signaling is also suggested, and thus the activation of positive feedback mechanism is postulated in PKC/p38 MAPK/phospholipase δ1/ PKC pathway. Cells introduced with siRNA against Prkca gene (coding PKCs) produce reduced amount of the enzyme, particularly, of PKCα. In those cells, AR by 5 Gy X-ray is not observed and thereby PKCα is involved in AR. The signaling in AR is only partly elucidated at present as above, and more detailed studies including identification of more PKC subtypes and signaling to DNA repair system are considered necessary. (K.T.)

  20. Targeting Plant Ethylene Responses by Controlling Essential Protein-Protein Interactions in the Ethylene Pathway.

    Bisson, Melanie M A; Groth, Georg

    2015-08-01

    The gaseous plant hormone ethylene regulates many processes of high agronomic relevance throughout the life span of plants. A central element in ethylene signaling is the endoplasmic reticulum (ER)-localized membrane protein ethylene insensitive2 (EIN2). Recent studies indicate that in response to ethylene, the extra-membranous C-terminal end of EIN2 is proteolytically processed and translocated from the ER to the nucleus. Here, we report that the conserved nuclear localization signal (NLS) mediating nuclear import of the EIN2 C-terminus provides an important domain for complex formation with ethylene receptor ethylene response1 (ETR1). EIN2 lacking the NLS domain shows strongly reduced affinity for the receptor. Interaction of EIN2 and ETR1 is also blocked by a synthetic peptide of the NLS motif. The corresponding peptide substantially reduces ethylene responses in planta. Our results uncover a novel mechanism and type of inhibitor interfering with ethylene signal transduction and ethylene responses in plants. Disruption of essential protein-protein interactions in the ethylene signaling pathway as shown in our study for the EIN2-ETR1 complex has the potential to guide the development of innovative ethylene antagonists for modern agriculture and horticulture. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  1. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  2. Common elements in interleukin 4 and insulin signaling pathways in factor-dependent hematopoietic cells.

    Wang, L M; Keegan, A D; Li, W; Lienhard, G E; Pacini, S; Gutkind, J S; Myers, M G; Sun, X J; White, M F; Aaronson, S A

    1993-05-01

    Interleukin 4 (IL-4), insulin, and insulin-like growth factor I (IGF-I) efficiently induced DNA synthesis in the IL-3-dependent murine myeloid cell lines FDC-P1 and FDC-P2. Although these factors could not individually sustain long-term growth of these lines, a combination of IL-4 with either insulin or IGF-I did support continuous growth. The principal tyrosine-phosphorylated substrate observed in FDC cells stimulated with IL-4, previously designated 4PS, was of the same size (170 kDa) as the major substrate phosphorylated in response to insulin or IGF-I. These substrates had phosphopeptides of the same size when analyzed by digestion with Staphylococcus aureus V8 protease, and each tightly associated with the 85-kDa component of phosphatidylinositol 3-kinase after factor stimulation. IRS-1, the principal substrate phosphorylated in response to insulin or IGF-I stimulation in nonhematopoietic cells, is similar in size to 4PS. However, anti-IRS-1 antibodies failed to efficiently precipitate 4PS, and some phosphopeptides generated by V8 protease digestion of IRS-1 were distinct in size from the phosphopeptides of 4PS. Nevertheless, IL-4, insulin, and IGF-I were capable of stimulating tyrosine phosphorylation of IRS-1 in FDC cells that expressed this substrate as a result of transfection. These findings indicate that (i) IL-4, insulin, and IGF-I use signal transduction pathways in FDC lines that have at least one major feature in common, the rapid tyrosine phosphorylation of 4PS, and (ii) insulin and IGF-I stimulation of hematopoietic cell lines leads to the phosphorylation of a substrate that may be related to but is not identical to IRS-1.

  3. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  4. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  5. Regulation of mat responses by a differentiation MAPK pathway in Saccharomyces cerevisiae.

    Sheelarani Karunanithi

    Full Text Available Fungal species exhibit diverse behaviors when presented with extracellular challenges. Pathogenic fungi can undergo cell differentiation and biofilm formation in response to fluctuating nutrient levels, and these responses are required for virulence. In the model fungal eukaryote Saccharomyces cerevisiae, nutrient limitation induces filamentous growth and biofilm/mat formation. Both responses require the same signal transduction (MAPK pathway and the same cell adhesion molecule (Flo11 but have been studied under different conditions. We found that filamentous growth and mat formation are aspects of a related response that is regulated by the MAPK pathway. Cells in yeast-form mats differentiated into pseudohyphae in response to nutrient limitation. The MAPK pathway regulated mat expansion (in the plane of the XY-axis and substrate invasion (downward in the plane of the Z-axis, which optimized the mat's response to extracellular nutrient levels. The MAPK pathway also regulated an upward growth pattern (in the plane of the Z-axis in response to nutrient limitation and changes in surface rigidity. Upward growth allowed for another level of mat responsiveness and resembled a type of colonial chemorepulsion. Together our results show that signaling pathways play critical roles in regulating social behaviors in which fungal cells participate. Signaling pathways may regulate similar processes in pathogens, whose highly nuanced responses are required for virulence.

  6. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  7. The octadecanoid signalling pathway in plants mediates a response to ultraviolet radiation

    Conconi, A.; Smerdon, M.J.; Howe, G.A.; Ryan, C.A.

    1996-01-01

    Many plant genes that respond to environmental and developmental changes are regulated by jasmonic acid, which is derived from linolenic acid via the octadecanoid pathway. Linolenic acid is an important fatty-acid constituent of membranes in most plant species and its intracellular levels increase in response to certain signals. Here we report that irradiation of tomato leaves with ultraviolet light induces the expression of several plant defensive genes that are normally activated through the octadecanoid pathway after wounding. The response to ultraviolet light is blocked by an inhibitor of the octadecanoid pathway and it does not occur in a tomato mutant defective in this pathway. The ultraviolet irradiation maximally induces the defence genes at levels where cyclobutane pyrimidine dimer formation, an indicator of DNA damage, is less than 0.2 dimers per gene. Our evidence indicates that this plant defence response to certain wavelengths of ultraviolet radiation requires the activation of the octadecanoid defence signalling pathway. (author)

  8. A "Bony" Proposition: Pathways Mediating Responses to Simulated Weightlessness and Radiation

    Tahimic, Candice; Globus, Ruth

    2016-01-01

    There is evidence that weightlessness and radiation, two elements of the spaceflight environment, can lead to detrimental changes in human musculoskeletal tissue, including bone loss and muscle atrophy. This bone loss is thought to be brought about by the increased activity of bone-resorbing osteoclasts and functional changes in bone-forming osteoblasts, cells that give rise to mature osteocytes. My current area of research focuses on understanding the mechanistic basis for the responses of bone to the spaceflight environment using earth-based animal and cellular models. The overarching goal is to identify molecular targets to prevent bone loss in space exploration and earth-based scenarios of radiotherapy, accidental radiation exposure and reduced mobility. In this talk, I will highlight two signaling pathways that potentially play a role in the response of bone to spaceflight-like conditions. Firstly, I will discuss the role of insulin-like growth factor 1 (IGF1) signaling as it pertains to the recovery of bone from simulated weightlessness (rodent hindlimb unloading model). Secondly, I will share recent findings from our study that aims to understand the emerging role of autophagy in maintaining the balance between bone formation and resorption (bone homeostasis) as well as normal skeletal structure.

  9. DMPD: Convergence of the NF-kappaB and IRF pathways in the regulation of the innateantiviral response. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 17706453 Convergence of the NF-kappaB and IRF pathways in the regulation of the innatea... (.png) (.svg) (.html) (.csml) Show Convergence of the NF-kappaB and IRF pathways in the regulation of the innatea... IRF pathways in the regulation of the innateantiviral response. Authors Hiscott J. Publication Cytokine Gro

  10. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  11. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  12. In vivo kinetic analysis of the penicillin biosynthesis pathway using PAA stimulus response experiments.

    Deshmukh, Amit T; Verheijen, Peter J T; Maleki Seifar, Reza; Heijnen, Joseph J; van Gulik, Walter M

    2015-11-01

    In this study we combined experimentation with mathematical modeling to unravel the in vivo kinetic properties of the enzymes and transporters of the penicillin biosynthesis pathway in a high yielding Penicillium chrysogenum strain. The experiment consisted of a step response experiment with the side chain precursor phenyl acetic acid (PAA) in a glucose-limited chemostat. The metabolite data showed that in the absence of PAA all penicillin pathway enzymes were expressed, leading to the production of a significant amount of 6-aminopenicillanic acid (6APA) as end product. After the stepwise perturbation with PAA, the pathway produced PenG within seconds. From the extra- and intracellular metabolite measurements, hypotheses for the secretion mechanisms of penicillin pathway metabolites were derived. A dynamic model of the penicillin biosynthesis pathway was then constructed that included the formation and transport over the cytoplasmic membrane of pathway intermediates, PAA and the product penicillin-G (PenG). The model parameters and changes in the enzyme levels of the penicillin biosynthesis pathway under in vivo conditions were simultaneously estimated using experimental data obtained at three different timescales (seconds, minutes, hours). The model was applied to determine changes in the penicillin pathway enzymes in time, calculate fluxes and analyze the flux control of the pathway. This led to a reassessment of the in vivo behavior of the pathway enzymes and in particular Acyl-CoA:Isopenicillin N Acyltransferase (AT). Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  13. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  14. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  15. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  16. Structural inhibition and reactivation of Escherichia coli septation by elements of the SOS and TER pathways

    Dopazo, A.; Tormo, A.; Aldea, M.; Vicente, M.

    1987-01-01

    The inhibition of cell division caused by induction of the SOS pathway in Escherichia coli structurally blocks septation, as deduced from two sets of results. Potential septation sites active at the time of SOS induction became inactivated, while those initiated during the following doubling time were active. Penicillin resistance increased in wild-type UV light-irradiated cells, a behavior similar to that observed in mutants in which structural blocks were introduced by inactivation of FtsA. Potential septation sites that have been structurally blocked by either the SOS division inhibitor, furazlocillin inhibition of PBP3, or inactivation of a TER pathway component, FtsA3, could be reactivated one doubling time after removal of the inhibitory agent in the presence of an active lon gene product. Reactivation of potential septation sites blocked by the presence of an inactivated FtsA3 was significantly lower when the lon protease was not active, suggesting that Lon plays a role in the removal of inactivated TER pathway products from the blocked potential septation sites

  17. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  18. Improved prognostic classification of breast cancer defined by antagonistic activation patterns of immune response pathway modules

    Teschendorff, Andrew E; Gomez, Sergio; Arenas, Alex; El-Ashry, Dorraya; Schmidt, Marcus; Gehrmann, Mathias; Caldas, Carlos

    2010-01-01

    Elucidating the activation pattern of molecular pathways across a given tumour type is a key challenge necessary for understanding the heterogeneity in clinical response and for developing novel more effective therapies. Gene expression signatures of molecular pathway activation derived from perturbation experiments in model systems as well as structural models of molecular interactions ('model signatures') constitute an important resource for estimating corresponding activation levels in tumours. However, relatively few strategies for estimating pathway activity from such model signatures exist and only few studies have used activation patterns of pathways to refine molecular classifications of cancer. Here we propose a novel network-based method for estimating pathway activation in tumours from model signatures. We find that although the pathway networks inferred from cancer expression data are highly consistent with the prior information contained in the model signatures, that they also exhibit a highly modular structure and that estimation of pathway activity is dependent on this modular structure. We apply our methodology to a panel of 438 estrogen receptor negative (ER-) and 785 estrogen receptor positive (ER+) breast cancers to infer activation patterns of important cancer related molecular pathways. We show that in ER negative basal and HER2+ breast cancer, gene expression modules reflecting T-cell helper-1 (Th1) and T-cell helper-2 (Th2) mediated immune responses play antagonistic roles as major risk factors for distant metastasis. Using Boolean interaction Cox-regression models to identify non-linear pathway combinations associated with clinical outcome, we show that simultaneous high activation of Th1 and low activation of a TGF-beta pathway module defines a subtype of particularly good prognosis and that this classification provides a better prognostic model than those based on the individual pathways. In ER+ breast cancer, we find that

  19. An ATM-independent S-phase checkpoint response involves CHK1 pathway

    Zhou, Xiang-Yang; Wang, Xiang; Hu, Baocheng; Guan, Jun; Iliakis, George; Wang, Ya

    2002-01-01

    After exposure to genotoxic stress, proliferating cells actively slow down the DNA replication through a S-phase checkpoint to provide time for repair. We report that in addition to the ataxia-telangiectasia mutated (ATM)-dependent pathway that controls the fast response, there is an ATM-independent pathway that controls the slow response to regulate the S-phase checkpoint after ionizing radiation in mammalian cells. The slow response of S-phase checkpoint, which is resistant to wortmannin, sensitive to caffeine and UCN-01, and related to cyclin-dependent kinase phosphorylation, is much stronger in CHK1 overexpressed cells, and it could be abolished by Chk1 antisense oligonucleotides. These results provide evidence that the ATM-independent slow response of S-phase checkpoint involves CHK1 pathway.

  20. Pathway analysis of systemic transcriptome responses to injected polystyrene particles in zebrafish larvae.

    Veneman, Wouter J; Spaink, Herman P; Brun, Nadja R; Bosker, Thijs; Vijver, Martina G

    2017-09-01

    Microplastics are a contaminant of emergent concern in the environment, however, to date there is a limited understanding on their movement within organisms and the response of organisms. In the current study zebrafish embryos at different development stages were exposed to 700nm fluorescent polystyrene (PS) particles and the response pathway after exposure was investigated using imaging and transcriptomics. Our results show limited spreading of particles within the larvae after injection during the blastula stage. This is in contrast to injection of PS particles in the yolk of 2-day old embryos, which resulted in redistribution of the PS particles throughout the bloodstream, and accumulation in the heart region. Although injection was local, the transcriptome profiling showed strong responses of zebrafish embryos exposed to PS particle, indicating a systemic response. We found several biological pathways activated which are related to an immune response in the PS exposed zebrafish larvae. Most notably the complement system was enriched as indicated by upregulation of genes in the alternative complement pathway (e.g. cfhl3, cfhl4, cfb and c9). The fact that complement pathway is activated indicates that plastic microparticles are integrated in immunological recognition processes. This was supported by fluorescence microscopy results, in which we observed co-localisation of neutrophils and macrophages around the PS particles. Identifying these key events can be a first building block to the development of an adverse outcome pathway (AOP). These data subsequently can be used within ecological and human risk assessment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Pathways of thirty-seven trace elements through coal-fired power plant

    Klein, D.H.; Andren, A.W.; Carter, J.A.; Emery, J.F.; Feldman, C.; Fulkerson, W.; Lyon, W.S.; Ogle, J.C.; Talmi, Y.; Van Hook, R.I.; Bolton, N.

    1975-01-01

    Coal, fly ash, slag, and combustion gases from a large cyclone-fed power plant 870 MW(e) were analyzed for a suite of elements. Mass balance calculations show that the sampling and analyses were generally adequate to describe the flows of these elements through the plant. Most Hg, some Se, and probably most Cl and Br were discharged to the atmosphere as gases. As, Cd, Cu, Ga, Mo, Pb, Sb, Se, and Zn were quite concentrated in fly ash compared to the slag, and were more concentrated in the ash discharged through the stack than in that collected by the precipitator. Al, Ba, Ca, Ce, Co, Eu, Fe, Hf, K, La, Mg, Mn, Rb, Sc, Si, Sm, Sr, Ta, Th, and Ti show little preferential partitioning between the slag and the collected or discharged fly ash. Cr, Sc, Na, Ni, U, and V exhibit behavior intermediate between the latter two groups

  2. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  3. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  4. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  5. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  6. Water quality assessment using the AREc32 reporter gene assay indicative of the oxidative stress response pathway.

    Escher, Beate I; Dutt, Mriga; Maylin, Erin; Tang, Janet Y M; Toze, Simon; Wolf, C Roland; Lang, Matti

    2012-11-01

    The reporter gene assay AREc32 is based on the induction of the Nrf2 mediated oxidative stress response pathway in the human breast cancer cell line MCF7, where eight copies of the antioxidant response element (ARE) are linked to a reporter gene encoding for luciferase. The Nrf2-ARE pathway is responsive to many chemicals that cause oxidative stress, among them a large number of pesticides and skin irritants. We adopted and validated the AREc32 bioassay for water quality testing. tert-Butylhydroquinone served as the positive control, phenol as the negative control and other reactive chemicals were assessed for their specificity. An environmentally relevant reference chemical, benzo(a)pyrene was the most potent inducer of all tested chemicals. The concentration causing an induction ratio (IR) of 1.5 (EC(IR1.5)) was chosen as the effect benchmark value. The assay was applied to 21 water samples ranging from sewage to drinking water, including secondary treatment and various tertiary treatment options (ozonation, biologically activated carbon filtration, membrane filtration, reverse osmosis, advanced oxidation, chlorination, chloramination). The samples were enriched by solid phase extraction. In most samples the oxidative stress response was far more sensitive than cytotoxicity. The primary and secondary treated effluent exceeded the effect threshold IR 1.5 at a relative enrichment factor (REF) of 1, i.e., the native samples were active. All tertiary treated samples were less potent and their EC(IR1.5) lay between REF 1 and 10. The Nrf2 pathway was induced at a REF of approximately 10 for surface waters and drinking water, and above this enrichment cytotoxicity took over in most samples and quenched the induction. The blank (ultrapure water run through the sample enrichment process) was cytotoxic at an REF of 100, which is the limit of concentrations range that can be evaluated. Treatment typically decreased both the cytotoxicity and oxidative stress response apart

  7. Dietary Selenium Levels Affect Selenoprotein Expression and Support the Interferon-γ and IL-6 Immune Response Pathways in Mice

    Petra A. Tsuji

    2015-08-01

    Full Text Available Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake.

  8. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  9. Crosstalk between the Tor and Gcn2 pathways in response to different stresses.

    Rødland, Gro Elise; Tvegård, Tonje; Boye, Erik; Grallert, Beáta

    2014-01-01

    Regulating growth and the cell cycle in response to environmental fluctuations is important for all organisms in order to maintain viability. Two major pathways for translational regulation are found in higher eukaryotes: the Tor signaling pathway and those operating through the eIF2α kinases. Studies from several organisms indicate that the two pathways are interlinked, in that Tor complex 1 (TORC1) negatively regulates the Gcn2 kinase. Furthermore, inactivation of TORC1 may be required for activation of Gcn2 in response to stress. Here, we use the model organism Schizosaccharomyces pombe to investigate this crosstalk further. We find that the relationship is more complex than previously thought. First, in response to UV irradiation and oxidative stress, Gcn2 is fully activated in the presence of TORC1 signaling. Second, during amino-acid starvation, activation of Gcn2 is dependent on Tor2 activity, and Gcn2 is required for timely inactivation of the Tor pathway. Our data show that the crosstalk between the two pathways varies with the actual stress applied.

  10. Aging causes decreased resistance to multiple stresses and a failure to activate specific stress response pathways

    Bergsma, Alexis L.; Senchuk, Megan M.; Van Raamsdonk, Jeremy M.

    2016-01-01

    In this work, we examine the relationship between stress resistance and aging. We find that resistance to multiple types of stress peaks during early adulthood and then declines with age. To dissect the underlying mechanisms, we use C. elegans transcriptional reporter strains that measure the activation of different stress responses including: the heat shock response, mitochondrial unfolded protein response, endoplasmic reticulum unfolded protein response, hypoxia response, SKN-1-mediated oxidative stress response, and the DAF-16-mediated stress response. We find that the decline in stress resistance with age is at least partially due to a decreased ability to activate protective mechanisms in response to stress. In contrast, we find that any baseline increase in stress caused by the advancing age is too mild to detectably upregulate any of the stress response pathways. Further exploration of how worms respond to stress with increasing age revealed that the ability to mount a hormetic response to heat stress is also lost with increasing age. Overall, this work demonstrates that resistance to all types of stress declines with age. Based on our data, we speculate that the decrease in stress resistance with advancing age results from a genetically-programmed inactivation of stress response pathways, not accumulation of damage. PMID:27053445

  11. Aging causes decreased resistance to multiple stresses and a failure to activate specific stress response pathways.

    Dues, Dylan J; Andrews, Emily K; Schaar, Claire E; Bergsma, Alexis L; Senchuk, Megan M; Van Raamsdonk, Jeremy M

    2016-04-01

    In this work, we examine the relationship between stress resistance and aging. We find that resistance to multiple types of stress peaks during early adulthood and then declines with age. To dissect the underlying mechanisms, we use C. elegans transcriptional reporter strains that measure the activation of different stress responses including: the heat shock response, mitochondrial unfolded protein response, endoplasmic reticulum unfolded protein response, hypoxia response, SKN-1-mediated oxidative stress response, and the DAF-16-mediated stress response. We find that the decline in stress resistance with age is at least partially due to a decreased ability to activate protective mechanisms in response to stress. In contrast, we find that any baseline increase in stress caused by the advancing age is too mild to detectably upregulate any of the stress response pathways. Further exploration of how worms respond to stress with increasing age revealed that the ability to mount a hormetic response to heat stress is also lost with increasing age. Overall, this work demonstrates that resistance to all types of stress declines with age. Based on our data, we speculate that the decrease in stress resistance with advancing age results from a genetically-programmed inactivation of stress response pathways, not accumulation of damage.

  12. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  13. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  14. A translational study on looming-evoked defensive response and the underlying subcortical pathway in autism.

    Hu, Yu; Chen, Zhuoming; Huang, Lu; Xi, Yue; Li, Bingxiao; Wang, Hong; Yan, Jiajian; Lee, Tatia M C; Tao, Qian; So, Kwok-Fai; Ren, Chaoran

    2017-11-07

    Rapidly approaching objects indicating threats can induce defensive response through activating a subcortical pathway comprising superior colliculus (SC), lateral posterior nucleus (LP), and basolateral amygdala (BLA). Abnormal defensive response has been reported in autism, and impaired synaptic connections could be the underlying mechanism. Whether the SC-LP-BLA pathway processes looming stimuli abnormally in autism is not clear. Here, we found that looming-evoked defensive response is impaired in a subgroup of the valproic acid (VPA) mouse model of autism. By combining the conventional neurotracer and transneuronal rabies virus tracing techniques, we demonstrated that synaptic connections in the SC-LP-BLA pathway were abnormal in VPA mice whose looming-evoked defensive responses were absent. Importantly, we further translated the finding to children with autism and observed that they did not present looming-evoked defensive response. Furthermore, the findings of the DTI with the probabilistic tractography showed that the structural connections of SC-pulvinar-amygdala in autism children were weak. The pulvinar is parallel to the LP in a mouse. Because looming-evoked defensive response is innate in humans and emerges much earlier than do social and language functions, the absence of defensive response could be an earlier sign of autism in children.

  15. Role of the Mixed-Lineage Protein Kinase Pathway in the Metabolic Stress Response to Obesity

    Shashi Kant

    2013-08-01

    Full Text Available Saturated free fatty acid (FFA is implicated in the metabolic response to obesity. In vitro studies indicate that FFA signaling may be mediated by the mixed-lineage protein kinase (MLK pathway that activates cJun NH2-terminal kinase (JNK. Here, we examined the role of the MLK pathway in vivo using a mouse model of diet-induced obesity. The ubiquitously expressed MLK2 and MLK3 protein kinases have partially redundant functions. We therefore compared wild-type and compound mutant mice that lack expression of MLK2 and MLK3. MLK deficiency protected mice against high-fat-diet-induced insulin resistance and obesity. Reduced JNK activation and increased energy expenditure contribute to the metabolic effects of MLK deficiency. These data confirm that the MLK pathway plays a critical role in the metabolic response to obesity.

  16. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  18. Thymus transcriptome reveals novel pathways in response to avian pathogenic Escherichia coli infection.

    Sun, H; Liu, P; Nolan, L K; Lamont, S J

    2016-12-01

    Avian pathogenic Escherichia coli (APEC) can cause significant morbidity in chickens. The thymus provides the essential environment for T cell development; however, the thymus transcriptome has not been examined for gene expression in response to APEC infection. An improved understanding of the host genomic response to APEC infection could inform future breeding programs for disease resistance and APEC control. We therefore analyzed the transcriptome of the thymus of birds challenged with APEC, contrasting susceptible and resistant phenotypes. Thousands of genes were differentially expressed in birds of the 5-day post infection (dpi) challenged-susceptible group vs. 5 dpi non-challenged, in 5 dpi challenged-susceptible vs. 5 dpi challenged-resistant birds, as well as in 5 dpi vs. one dpi challenged-susceptible birds. The Toll-like receptor signaling pathway was the major innate immune response for birds to respond to APEC infection. Moreover, lysosome and cell adhesion molecules pathways were common mechanisms for chicken response to APEC infection. The T-cell receptor signaling pathway, cell cycle, and p53 signaling pathways were significantly activated in resistant birds to resist APEC infection. These results provide a comprehensive assessment of global gene networks and biological functionalities of differentially expressed genes in the thymus under APEC infection. These findings provide novel insights into key molecular genetic mechanisms that differentiate host resistance from susceptibility in this primary lymphoid tissue, the thymus. © The Author 2016. Published by Oxford University Press on behalf of Poultry Science Association.

  19. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  20. Phytohormone signaling pathway analysis method for comparing hormone responses in plant-pest interactions

    Studham Matthew E

    2012-07-01

    Full Text Available Abstract Background Phytohormones mediate plant defense responses to pests and pathogens. In particular, the hormones jasmonic acid, ethylene, salicylic acid, and abscisic acid have been shown to dictate and fine-tune defense responses, and identification of the phytohormone components of a particular defense response is commonly used to characterize it. Identification of phytohormone regulation is particularly important in transcriptome analyses. Currently there is no computational tool to determine the relative activity of these hormones that can be applied to transcriptome analyses in soybean. Findings We developed a pathway analysis method that provides a broad measure of the activation or suppression of individual phytohormone pathways based on changes in transcript expression of pathway-related genes. The magnitude and significance of these changes are used to determine a pathway score for a phytohormone for a given comparison in a microarray experiment. Scores for individual hormones can then be compared to determine the dominant phytohormone in a given defense response. To validate this method, it was applied to publicly available data from previous microarray experiments that studied the response of soybean plants to Asian soybean rust and soybean cyst nematode. The results of the analyses for these experiments agreed with our current understanding of the role of phytohormones in these defense responses. Conclusions This method is useful in providing a broad measure of the relative induction and suppression of soybean phytohormones during a defense response. This method could be used as part of microarray studies that include individual transcript analysis, gene set analysis, and other methods for a comprehensive defense response characterization.

  1. Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.

    Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M

    2010-10-01

    Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response.

  2. Altering the sex determination pathway in Drosophila fat body modifies sex-specific stress responses.

    Argue, Kathryn J; Neckameyer, Wendi S

    2014-07-01

    The stress response in Drosophila melanogaster reveals sex differences in behavior, similar to what has been observed in mammals. However, unlike mammals, the sex determination pathway in Drosophila is well established, making this an ideal system to identify factors involved in the modulation of sex-specific responses to stress. In this study, we show that the Drosophila fat body, which has been shown to be important for energy homeostasis and sex determination, is a dynamic tissue that is altered in response to stress in a sex and time-dependent manner. We manipulated the sex determination pathway in the fat body via targeted expression of transformer and transformer-2 and analyzed these animals for changes in their response to stress. In the majority of cases, manipulation of transformer or transformer-2 was able to change the physiological output in response to starvation and oxidative stress to that of the opposite sex. Our data also uncover the possibility of additional downstream targets for transformer and transformer-2 that are separate from the sex determination pathway and can influence behavioral and physiological responses. Copyright © 2014 the American Physiological Society.

  3. Ebola Virus Altered Innate and Adaptive Immune Response Signalling Pathways: Implications for Novel Therapeutic Approaches.

    Kumar, Anoop

    2016-01-01

    Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.

  4. The CWI Pathway: Regulation of the Transcriptional Adaptive Response to Cell Wall Stress in Yeast

    Ana Belén Sanz

    2017-12-01

    Full Text Available Fungi are surrounded by an essential structure, the cell wall, which not only confers cell shape but also protects cells from environmental stress. As a consequence, yeast cells growing under cell wall damage conditions elicit rescue mechanisms to provide maintenance of cellular integrity and fungal survival. Through transcriptional reprogramming, yeast modulate the expression of genes important for cell wall biogenesis and remodeling, metabolism and energy generation, morphogenesis, signal transduction and stress. The yeast cell wall integrity (CWI pathway, which is very well conserved in other fungi, is the key pathway for the regulation of this adaptive response. In this review, we summarize the current knowledge of the yeast transcriptional program elicited to counterbalance cell wall stress situations, the role of the CWI pathway in the regulation of this program and the importance of the transcriptional input received by other pathways. Modulation of this adaptive response through the CWI pathway by positive and negative transcriptional feedbacks is also discussed. Since all these regulatory mechanisms are well conserved in pathogenic fungi, improving our knowledge about them will have an impact in the developing of new antifungal therapies.

  5. Human umbilical vein: involvement of cyclooxygenase-2 pathway in bradykinin B1 receptor-sensitized responses.

    Errasti, A E; Rey-Ares, V; Daray, F M; Rogines-Velo, M P; Sardi, S P; Paz, C; Podestá, E J; Rothlin, R P

    2001-08-01

    In isolated human umbilical vein (HUV), the contractile response to des-Arg9-bradykinin (des-Arg9-BK), selective BK B1 receptor agonist, increases as a function of the incubation time. Here, we evaluated whether cyclooxygenase (COX) pathway is involved in BK B1-sensitized response obtained in 5-h incubated HUV rings. The effect of different concentrations of indomethacin, sodium salicylate, ibuprofen, meloxicam, lysine clonixinate or NS-398 administrated 30 min before concentration-response curves (CRC) was studied. All treatments produced a significant rightward shift of the CRC to des-Arg9-BK in a concentration-dependent manner, which provides pharmacological evidence that COX pathway is involved in the BK B1 responses. Moreover, in this tissue, the NS-398 pKb (5.2) observed suggests that COX-2 pathway is the most relevant. The strong correlation between published pIC50 for COX-2 and the NSAIDs' pKbs estimated further supports the hypothesis that COX-2 metabolites are involved in BK B1 receptor-mediated responses. In other rings, indomethacin (30, 100 micromol/l) or NS-398 (10, 30 micromol/l) produced a significant rightward shift of the CRC to BK, selective BK B2 agonist, and its pKbs were similar to the values to inhibit BK B1 receptor responses, suggesting that COX-2 pathway also is involved in BK B2 receptor responses. Western blot analysis shows that COX-1 and COX-2 isoenzymes are present before and after 5-h in vitro incubation and apparently COX-2 does not suffer additional induction.

  6. Contributions of DNA repair and damage response pathways to the non-linear genotoxic responses of alkylating agents.

    Klapacz, Joanna; Pottenger, Lynn H; Engelward, Bevin P; Heinen, Christopher D; Johnson, George E; Clewell, Rebecca A; Carmichael, Paul L; Adeleye, Yeyejide; Andersen, Melvin E

    2016-01-01

    From a risk assessment perspective, DNA-reactive agents are conventionally assumed to have genotoxic risks at all exposure levels, thus applying a linear extrapolation for low-dose responses. New approaches discussed here, including more diverse and sensitive methods for assessing DNA damage and DNA repair, strongly support the existence of measurable regions where genotoxic responses with increasing doses are insignificant relative to control. Model monofunctional alkylating agents have in vitro and in vivo datasets amenable to determination of points of departure (PoDs) for genotoxic effects. A session at the 2013 Society of Toxicology meeting provided an opportunity to survey the progress in understanding the biological basis of empirically-observed PoDs for DNA alkylating agents. Together with the literature published since, this review discusses cellular pathways activated by endogenous and exogenous alkylation DNA damage. Cells have evolved conserved processes that monitor and counteract a spontaneous steady-state level of DNA damage. The ubiquitous network of DNA repair pathways serves as the first line of defense for clearing of the DNA damage and preventing mutation. Other biological pathways discussed here that are activated by genotoxic stress include post-translational activation of cell cycle networks and transcriptional networks for apoptosis/cell death. The interactions of various DNA repair and DNA damage response pathways provide biological bases for the observed PoD behaviors seen with genotoxic compounds. Thus, after formation of DNA adducts, the activation of cellular pathways can lead to the avoidance of a mutagenic outcome. The understanding of the cellular mechanisms acting within the low-dose region will serve to better characterize risks from exposures to DNA-reactive agents at environmentally-relevant concentrations. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Contributions of DNA repair and damage response pathways to the non-linear genotoxic responses of alkylating agents

    Klapacz, Joanna; Pottenger, Lynn H.; Engelward, Bevin P.; Heinen, Christopher D.; Johnson, George E.; Clewell, Rebecca A.; Carmichael, Paul L.; Adeleye, Yeyejide; Andersen, Melvin E.

    2016-01-01

    From a risk assessment perspective, DNA-reactive agents are conventionally assumed to have genotoxic risks at all exposure levels, thus applying a linear extrapolation for low-dose responses. New approaches discussed here, including more diverse and sensitive methods for assessing DNA damage and DNA repair, strongly support the existence of measurable regions where genotoxic responses with increasing doses are insignificant relative to control. Model monofunctional alkylating agents have in vitro and in vivo datasets amenable to determination of points of departure (PoDs) for genotoxic effects. A session at the 2013 Society of Toxicology meeting provided an opportunity to survey the progress in understanding the biological basis of empirically-observed PoDs for DNA alkylating agents. Together with the literature published since, this review discusses cellular pathways activated by endogenous and exogenous alkylation DNA damage. Cells have evolved conserved processes that monitor and counteract a spontaneous steady-state level of DNA damage. The ubiquitous network of DNA repair pathways serves as the first line of defense for clearing of the DNA damage and preventing mutation. Other biological pathways discussed here that are activated by genotoxic stress include post-translational activation of cell cycle networks and transcriptional networks for apoptosis/cell death. The interactions of various DNA repair and DNA damage response pathways provide biological bases for the observed PoD behaviors seen with genotoxic compounds. Thus, after formation of DNA adducts, the activation of cellular pathways can lead to the avoidance a mutagenic outcome. The understanding of the cellular mechanisms acting within the low-dose region will serve to better characterize risks from exposures to DNA-reactive agents at environmentally-relevant concentrations. PMID:27036068

  8. Role of the mixed-lineage protein kinase pathway in the metabolic stress response to obesity

    Kant, Shashi; Barrett, Tamera; Vertii, Anastassiia; Noh, Yun Hee; Jung, Dae Young; Kim, Jason K.; Davis, Roger J.

    2013-01-01

    Saturated free fatty acid (FFA) is implicated in the metabolic response to obesity. In vitro studies indicate that FFA signaling may be mediated by the mixed-lineage protein kinase (MLK) pathway that activates cJun NH2-terminal kinase (JNK). Here, we examined the role of the MLK pathway in vivo using a mouse model of diet-induced obesity. The ubiquitously expressed MLK2 and MLK3 protein kinases have partially redundant functions. We therefore compared wild-type and compound mutant mice that l...

  9. Essential elements of ecological literacy and the pathways to achieve it: Perspectives of ecologists

    McBride, Brooke Baldauf

    2011-12-01

    National assessments have led many to conclude that the level of ecological literacy among the general population in the United States is too low to enable effective social responses to current environmental challenges. However, the actual meaning of ecological literacy varies considerably between academic fields and has been a topic of intensive deliberation for several decades. Within the field of ecology in particular, a driving purpose behind this ongoing discussion has been to advance a complete, pedagogy-guiding, and broadly applicable framework for ecological literacy, allowing for the establishment of guidelines and tools for assessing educational achievement; yet, a widely accepted framework does not currently exist. What is ecological literacy and how can it be achieved? Through an extensive review of the literature, I traced the evolution of the related concepts of environmental literacy, ecological literacy, and ecoliteracy, and compared and contrasted the numerous proposed frameworks across multiple dimensions of affect, knowledge, skills, and behavior. In addition to characterizing the overall discourse, this analysis facilitated close examination of where we have been, where we are, and where we might be headed with respect to these vital conversations. To explore current perspectives on the topic, I analyzed the open-ended responses of more than 1,000 ecologists and other environmental scientists on the nature of ecological literacy and how it may be achieved. Factor analysis revealed the presence of six common dimensions underlying respondents' views of ecological literacy (cycles and webs, ecosystem services, negative human impacts, critical thinking/application, nature of ecological science, and biogeography) and five common dimensions for how to achieve it (education by mass media, formal/traditional education, financial incentive, participatory/interactive education, and communication/outreach by scientists). Based on these results, I proposed

  10. Proteomic Assessment of Biochemical Pathways That Are Critical to Nickel-Induced Toxicity Responses in Human Epithelial Cells

    Ge, Yue; Bruno, Maribel; Haykal-Coates, Najwa; Wallace, Kathleen; Andrews, Debora; Swank, Adam; Winnik, Witold; Ross, Jeffrey A.

    2016-01-01

    Understanding the mechanisms underlying toxicity initiated by nickel, a ubiquitous environmental contaminant and known human carcinogen is necessary for proper assessment of its risks to human and environment. Among a variety of toxic mechanisms, disruption of protein responses and protein response-based biochemical pathways represents a key mechanism through which nickel induces cytotoxicity and carcinogenesis. To identify protein responses and biochemical pathways that are critical to nickel-induced toxicity responses, we measured cytotoxicity and changes in expression and phosphorylation status of 14 critical biochemical pathway regulators in human BEAS-2B cells exposed to four concentrations of nickel using an integrated proteomic approach. A subset of the pathway regulators, including interleukin-6, and JNK, were found to be linearly correlated with cell viability, and may function as molecular determinants of cytotoxic responses of BEAS-2B cells to nickel exposures. In addition, 128 differentially expressed proteins were identified by two dimensional electrophoresis (2-DE) and mass spectrometry. Principal component analysis, hierarchical cluster analyses, and ingenuity signaling pathway analysis (IPA) identified putative nickel toxicity pathways. Some of the proteins and pathways identified have not previously been linked to nickel toxicity. Based on the consistent results obtained from both ELISA and 2-DE proteomic analysis, we propose a core signaling pathway regulating cytotoxic responses of human BEAS-2B cells to nickel exposures, which integrates a small set of proteins involved in glycolysis and gluconeogenesis pathways, apoptosis, protein degradation, and stress responses including inflammation and oxidative stress. PMID:27626938

  11. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    Arunita Chatterjee

    2016-06-01

    Full Text Available Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual.

  12. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  13. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  14. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  15. A Preliminary Investigation of Pathways to Inflated Responsibility Beliefs in Children with Obsessive Compulsive Disorder.

    Collins, Lindsey M; Coles, Meredith E

    2018-05-01

    Cognitive theorists posit that inflated responsibility beliefs contribute to the development of obsessive compulsive disorder (OCD). Salkovskis et al. (1999) proposed that experiencing heightened responsibility, overprotective parents and rigid rules, and thinking one influenced or caused a negative life event act as 'pathways' to the development of inflated responsibility beliefs, thereby increasing risk for OCD. Studies in adults with OCD and non-clinical adolescents support the link between these experiences and responsibility beliefs (Coles et al., 2015; Halvaiepour and Nosratabadi, 2015), but the theory has never been tested in youth with current OCD. We provided an initial test of the theory by Salkovskis et al. (1999) in youth with OCD. We predicted that childhood experiences proposed by Salkovskis et al. (1999) would correlate positively with responsibility and harm beliefs and OCD symptom severity. Twenty youth with OCD (age 9‒16 years) completed a new child-report measure of the experiences hypothesized by Salkovskis et al. (1999), the Pathways to Inflated Responsibility Beliefs Scale-Child Version (PIRBS-CV). Youth also completed the Obsessive Beliefs Questionnaire-Child Version (Coles et al., 2010) and the Obsessive Compulsive Inventory-Child Version (Foa et al., 2010). Consistent with hypotheses, the PIRBS-CV was significantly related to responsibility and harm beliefs and OCD symptom severity. Results provide initial support for the theory proposed by Salkovskis et al. (1999) as applied to youth with OCD. Future studies are needed to further assess the model in early-onset OCD.

  16. Transposable Element Misregulation Is Linked to the Divergence between Parental piRNA Pathways in Drosophila Hybrids.

    Romero-Soriano, Valèria; Modolo, Laurent; Lopez-Maestre, Hélène; Mugat, Bruno; Pessia, Eugénie; Chambeyron, Séverine; Vieira, Cristina; Garcia Guerreiro, Maria Pilar

    2017-06-01

    Interspecific hybridization is a genomic stress condition that leads to the activation of transposable elements (TEs) in both animals and plants. In hybrids between Drosophila buzzatii and Drosophila koepferae, mobilization of at least 28 TEs has been described. However, the molecular mechanisms underlying this TE release remain poorly understood. To give insight on the causes of this TE activation, we performed a TE transcriptomic analysis in ovaries (notorious for playing a major role in TE silencing) of parental species and their F1 and backcrossed (BC) hybrids. We find that 15.2% and 10.6% of the expressed TEs are deregulated in F1 and BC1 ovaries, respectively, with a bias toward overexpression in both cases. Although differences between parental piRNA (Piwi-interacting RNA) populations explain only partially these results, we demonstrate that piRNA pathway proteins have divergent sequences and are differentially expressed between parental species. Thus, a functional divergence of the piRNA pathway between parental species, together with some differences between their piRNA pools, might be at the origin of hybrid instabilities and ultimately cause TE misregulation in ovaries. These analyses were complemented with the study of F1 testes, where TEs tend to be less expressed than in D. buzzatii. This can be explained by an increase in piRNA production, which probably acts as a defence mechanism against TE instability in the male germline. Hence, we describe a differential impact of interspecific hybridization in testes and ovaries, which reveals that TE expression and regulation are sex-biased. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Responsive eLearning exercises to enhance student interaction with metabolic pathways.

    Roesler, William J; Dreaver-Charles, Kristine

    2018-05-01

    Successful learning of biochemistry requires students to engage with the material. In the past this often involved students writing out pathways by hand, and more recently directing students to online resources such as videos, songs, and animated slide presentations. However, even these latter resources do not really provide students an opportunity to engage with the material in an active fashion. As part of an online introductory metabolism course that was developed at our university, we created a series of twelve online interactive activities using Adobe Captivate 9. These activities targeted glycolysis, gluconeogenesis, the pentose phosphate pathway, glycogen metabolism, the citric acid cycle, and fatty acid oxidation. The interactive exercises consisted of two types. One involved dragging objects such as names of enzymes or allosteric modifiers to their correct drop locations such as a particular point in a metabolic pathway, a specific enzyme, and so forth. A second type involved clicking on objects, locations within a pathway, and so forth, in response to a particular question. In both types of exercises, students received feedback on their decisions in order to enhance learning. The student feedback received on these activities was very positive, and indicated that they found them to increase their confidence in the material and that they had learned the key principles of each pathway. © 2018 by The International Union of Biochemistry and Molecular Biology, 46(3):223-229, 2018. © 2018 The International Union of Biochemistry and Molecular Biology.

  18. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  19. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  20. Effect of deregulation of Sonic Hedgehog pathway on responses to DNA damage and cancer predisposition

    Charazac, Aurelie

    2015-01-01

    The Gorlin syndrome is a rare genetic disorder characterized by several developmental abnormalities. Due to mutations in PTCH1, a key player of the sonic hedgehog signaling pathway, clinical manifestations also includes hyper-radiosensitivity and an increased predisposition to the development of basal cell carcinomas. Given the implication of DNA repair system defects in hyper-radiosensitivity pathologies, we decided to study the effect of PTCH1 mutations on the DNA damage response in order to better understand the cellular and molecular mechanisms leading to Gorlin's phenotype.This study demonstrate a global failure of the DNA damage repair systems in Gorlin fibroblasts with respect to controls. It highlights in particular the collapse of the base excision repair pathway (BER) responsible for the repair of oxidative DNA damage. (author) [fr

  1. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  2. In vivo relevance for photoprotection by the vitamin D rapid response pathway.

    Dixon, K M; Deo, S S; Norman, A W; Bishop, J E; Halliday, G M; Reeve, V E; Mason, R S

    2007-03-01

    Vitamin D is produced by exposure of 7-dehydrocholesterol in the skin to UV irradiation (UVR) and further converted in the skin to the biologically active metabolite, 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and other compounds. UVR also results in DNA damage producing cyclobutane pyrimidine dimers (CPD). We previously reported that 1,25(OH)(2)D(3) at picomolar concentrations, protects human skin cells from UVR-induced apoptosis, and decreases CPD in surviving cells. 1,25(OH)(2)D(3) has been shown to generate biological responses via two pathways-the classical steroid receptor/genomic pathway or a rapid, non-genomic pathway mediated by a putative membrane receptor. Whether the rapid response pathway is physiologically relevant is unclear. A cis-locked, rapid-acting agonist 1,25(OH)(2)lumisterol(3) (JN), entirely mimicked the actions of 1,25(OH)(2)D(3) to reduce fibroblast and keratinocyte loss and CPD damage after UVR. The effects of 1,25(OH)(2)D(3) were abolished by a rapid-acting antagonist, but not by a genomic antagonist. Skh:hr1 mice exposed to three times the minimal erythemal dose of solar-simulated UVR and treated topically with 1,25(OH)(2)D(3) or JN immediately after UVR showed reduction in UVR-induced UVR-induced sunburn cells (pphotoprotective effects via the rapid pathway and raise the possibility that other D compounds produced in skin may contribute to the photoprotective effects.

  3. C-Jun N-terminal kinase signalling pathway in response to cisplatin.

    Yan, Dong; An, GuangYu; Kuo, Macus Tien

    2016-11-01

    Cisplatin (cis diamminedichloroplatinum II, cDDP) is one of the most effective cancer chemotherapeutic agents and is used in the treatment of many types of human malignancies. However, inherent tumour resistance is a major barrier to effective cisplatin therapy. So far, the mechanism of cDDP resistance has not been well defined. In general, cisplatin is considered to be a cytotoxic drug, for damaging DNA and inhibiting DNA synthesis, resulting in apoptosis via the mitochondrial death pathway or plasma membrane disruption. cDDP-induced DNA damage triggers signalling pathways that will eventually decide between cell life and death. As a member of the mitogen-activated protein kinases family, c-Jun N-terminal kinase (JNK) is a signalling pathway in response to extracellular stimuli, especially drug treatment, to modify the activity of numerous proteins locating in the mitochondria or the nucleus. Recent studies suggest that JNK signalling pathway plays a major role in deciding the fate of the cell and inducing resistance to cDDP-induced apoptosis in human tumours. c-Jun N-terminal kinase regulates several important cellular functions including cell proliferation, differentiation, survival and apoptosis while activating and inhibiting substrates for phosphorylation transcription factors (c-Jun, ATF2: Activating transcription factor 2, p53 and so on), which subsequently induce pro-apoptosis and pro-survival factors expression. Therefore, it is suggested that JNK signal pathway is a double-edged sword in cDDP treatment, simultaneously being a significant pro-apoptosis factor but also being associated with increased resistance to cisplatin-based chemotherapy. This review focuses on current knowledge concerning the role of JNK in cell response to cDDP, as well as their role in cisplatin resistance. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  4. SAVANNAH RIVER SITE CAPABILITIES FOR CONDUCTING INGESTION PATHWAY CONSEQUENCE ASSESSMENTS FOR EMERGENCY RESPONSE

    Hunter, C

    2007-12-11

    Potential airborne releases of radioactivity from facilities operated for the U. S. Department of Energy at the Savannah River Site could pose significant consequences to the public through the ingestion pathway. The Savannah River National Laboratory has developed a suite of technologies needed to conduct assessments of ingestion dose during emergency response, enabling emergency manager at SRS to develop initial protective action recommendation for state agencies early in the response and to make informed decisions on activation of additional Federal assets that would be needed to support long-term monitoring and assessment activities.

  5. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  6. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  7. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  8. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  9. Suppression of the auxin response pathway enhances susceptibility to Phytophthora cinnamomi while phosphite-mediated resistance stimulates the auxin signalling pathway

    2014-01-01

    Background Phytophthora cinnamomi is a devastating pathogen worldwide and phosphite (Phi), an analogue of phosphate (Pi) is highly effective in the control of this pathogen. Phi also interferes with Pi starvation responses (PSR), of which auxin signalling is an integral component. In the current study, the involvement of Pi and the auxin signalling pathways in host and Phi-mediated resistance to P. cinnamomi was investigated by screening the Arabidopsis thaliana ecotype Col-0 and several mutants defective in PSR and the auxin response pathway for their susceptibility to this pathogen. The response to Phi treatment was also studied by monitoring its effect on Pi- and the auxin response pathways. Results Here we demonstrate that phr1-1 (phosphate starvation response 1), a mutant defective in response to Pi starvation was highly susceptible to P. cinnamomi compared to the parental background Col-0. Furthermore, the analysis of the Arabidopsis tir1-1 (transport inhibitor response 1) mutant, deficient in the auxin-stimulated SCF (Skp1 − Cullin − F-Box) ubiquitination pathway was also highly susceptible to P. cinnamomi and the susceptibility of the mutants rpn10 and pbe1 further supported a role for the 26S proteasome in resistance to P. cinnamomi. The role of auxin was also supported by a significant (P < 0.001) increase in susceptibility of blue lupin (Lupinus angustifolius) to P. cinnamomi following treatment with the inhibitor of auxin transport, TIBA (2,3,5-triiodobenzoic acid). Given the apparent involvement of auxin and PSR signalling in the resistance to P. cinnamomi, the possible involvement of these pathways in Phi mediated resistance was also investigated. Phi (especially at high concentrations) attenuates the response of some Pi starvation inducible genes such as AT4, AtACP5 and AtPT2 in Pi starved plants. However, Phi enhanced the transcript levels of PHR1 and the auxin responsive genes (AUX1, AXR1and AXR2), suppressed the primary root

  10. Interaction of caffeine with the SOS response pathway in Escherichia coli.

    Whitney, Alyssa K; Weir, Tiffany L

    2015-01-01

    Previous studies have highlighted the antimicrobial activity of caffeine, both individually and in combination with other compounds. A proposed mechanism for caffeine's antimicrobial effects is inhibition of bacterial DNA repair pathways. The current study examines the influence of sub-lethal caffeine levels on the growth and morphology of SOS response pathway mutants of Escherichia coli. Growth inhibition after treatment with caffeine and methyl methane sulfonate (MMS), a mutagenic agent, was determined for E. coli mutants lacking key genes in the SOS response pathway. The persistence of caffeine's effects was explored by examining growth and morphology of caffeine and MMS-treated bacterial isolates in the absence of selective pressure. Caffeine significantly reduced growth of E. coli recA- and uvrA-mutants treated with MMS. However, there was no significant difference in growth between umuC-isolates treated with MMS alone and MMS in combination with caffeine after 48 h of incubation. When recA-isolates from each treatment group were grown in untreated medium, bacterial isolates that had been exposed to MMS or MMS with caffeine showed increased growth relative to controls and caffeine-treated isolates. Morphologically, recA-isolates that had been treated with caffeine and both caffeine and MMS together had begun to display filamentous growth. Caffeine treatment further reduced growth of recA- and uvrA-mutants treated with MMS, despite a non-functional SOS response pathway. However, addition of caffeine had very little effect on MMS inhibition of umuC-mutants. Thus, growth inhibition of E. coli with caffeine treatment may be driven by caffeine interaction with UmuC, but also appears to induce damage by additional mechanisms as evidenced by the additive effects of caffeine in recA- and uvrA-mutants.

  11. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  12. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  13. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  14. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  15. Endocrine responses and acute mTOR pathway phosphorylation to resistance exercise with leucine and whey

    MT Lane

    2017-02-01

    Full Text Available Leucine ingestion reportedly activates the mTOR pathway in skeletal muscle, contributing to a hypertrophy response. The purpose of the study was to compare the post-resistance exercise effects of leucine and whey protein supplementation on endocrine responses and muscle mTOR pathway phosphorylation. On visit 1, subjects (X±SD; n=20; age=27.8±2.8yrs provided baseline blood samples for analysis of cortisol, glucose and insulin; a muscle biopsy of the vastus lateralis muscle to assess mTOR signaling pathway phosphorylation; and were tested for maximum strength on the leg press and leg extension exercises. For visits 2 and 3, subjects were randomized in a double-blind crossover design to ingest either leucine and whey protein (10g+10g; supplement or a non-caloric placebo. During these visits, 5 sets of 10 repetitions were performed on both exercises, immediately followed by ingestion of the supplement or placebo. Blood was sampled 30 min post-, and a muscle biopsy 45 min post-exercise. Western blots quantified total and phosphorylated proteins. Insulin increased (α<.05 with supplementation with no change in glucose compared to placebo. Relative phosphorylation of AKT and rpS6 were greater with leucine and whey supplementation compared to placebo. Supplementation of leucine and whey protein immediately after heavy resistance exercise increases anabolic signaling in human skeletal muscle.

  16. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  17. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  18. Cellular Pathways in Response to Ionizing Radiation and Their Targetability for Tumor Radiosensitization

    Patrick Maier

    2016-01-01

    Full Text Available During the last few decades, improvements in the planning and application of radiotherapy in combination with surgery and chemotherapy resulted in increased survival rates of tumor patients. However, the success of radiotherapy is impaired by two reasons: firstly, the radioresistance of tumor cells and, secondly, the radiation-induced damage of normal tissue cells located in the field of ionizing radiation. These limitations demand the development of drugs for either radiosensitization of tumor cells or radioprotection of normal tissue cells. In order to identify potential targets, a detailed understanding of the cellular pathways involved in radiation response is an absolute requirement. This review describes the most important pathways of radioresponse and several key target proteins for radiosensitization.

  19. Existence of Inverted Profile in Chemically Responsive Molecular Pathways in the Zebrafish Liver

    Zhang, Xun; Li, Hu; Ma, Jing; Zhang, Louxin; Li, Baowen; Gong, Zhiyuan

    2011-01-01

    How a living organism maintains its healthy equilibrium in response to endless exposure of potentially harmful chemicals is an important question in current biology. By transcriptomic analysis of zebrafish livers treated by various chemicals, we defined hubs as molecular pathways that are frequently perturbed by chemicals and have high degree of functional connectivity to other pathways. Our network analysis revealed that these hubs were organized into two groups showing inverted functionality with each other. Intriguingly, the inverted activity profiles in these two groups of hubs were observed to associate only with toxicopathological states but not with physiological changes. Furthermore, these inverted profiles were also present in rat, mouse, and human under certain toxicopathological conditions. Thus, toxicopathological-associated anti-correlated profiles in hubs not only indicate their potential use in diagnosis but also development of systems-based therapeutics to modulate gene expression by chemical approach in order to rewire the deregulated activities of hubs back to normal physiology. PMID:22140468

  20. Intrinsic JNK-MAPK pathway involvement requires daf-16-mediated immune response during Shigella flexneri infection in C. elegans.

    Marudhupandiyan, Shanmugam; Balamurugan, Krishnaswamy

    2017-06-01

    The c-Jun N-terminal kinase-mitogen-activated protein kinase (JNK-MAPK) pathway assists in modulating signals for growth, survival, and metabolism, thereby coordinating many cellular events during normal and stress conditions. To understand the role of the JNK-MAPK pathway during bacterial infection, an in vivo model organism Caenorhabditis elegans was used. In order to check the involvement of the JNK-MAPK pathway, the survival rate of C. elegans wild type (WT), and JNK-MAPK pathway mutant worms' upon exposure to selective Gram-positive and Gram-negative pathogenic bacteria, was studied. Among the pathogens, Shigella flexneri M9OT was found to efficiently colonize inside the WT and JNK-MAPK pathway mutant worms. qPCR studies had suggested that the above pathway-specific genes kgb-2 and jnk-1 were prominently responsible for the immune response elicited by the host during the M9OT infection. In addition, daf-16, which is a major transcription factor of the insulin/insulin growth factor-1 signaling (IIS) pathway, was also found to be involved during the host response. Crosstalk between IIS and JNK-MAPK pathways has probably been involved in the activation of the host immune system, which consequently leads to lifespan extension. Furthermore, it is also observed that daf-16 activation by JNK-MAPK pathway leads to antimicrobial response, by activating lys-7 expression. These findings suggest that JNK-MAPK is not the sole pathway that enhances the immunity of the host. Nonetheless, the IIS pathway bridges the JNK-MAPK pathway that influences in protecting the host in counter to the M9OT infection.

  1. Variant allele frequency enrichment analysis in vitro reveals sonic hedgehog pathway to impede sustained temozolomide response in GBM.

    Biswas, Nidhan K; Chandra, Vikas; Sarkar-Roy, Neeta; Das, Tapojyoti; Bhattacharya, Rabindra N; Tripathy, Laxmi N; Basu, Sunandan K; Kumar, Shantanu; Das, Subrata; Chatterjee, Ankita; Mukherjee, Ankur; Basu, Pryiadarshi; Maitra, Arindam; Chattopadhyay, Ansuman; Basu, Analabha; Dhara, Surajit

    2015-01-21

    Neoplastic cells of Glioblastoma multiforme (GBM) may or may not show sustained response to temozolomide (TMZ) chemotherapy. We hypothesize that TMZ chemotherapy response in GBM is predetermined in its neoplastic clones via a specific set of mutations that alter relevant pathways. We describe exome-wide enrichment of variant allele frequencies (VAFs) in neurospheres displaying contrasting phenotypes of sustained versus reversible TMZ-responses in vitro. Enrichment of VAFs was found on genes ST5, RP6KA1 and PRKDC in cells showing sustained TMZ-effect whereas on genes FREM2, AASDH and STK36, in cells showing reversible TMZ-effect. Ingenuity pathway analysis (IPA) revealed that these genes alter cell-cycle, G2/M-checkpoint-regulation and NHEJ pathways in sustained TMZ-effect cells whereas the lysine-II&V/phenylalanine degradation and sonic hedgehog (Hh) pathways in reversible TMZ-effect cells. Next, we validated the likely involvement of the Hh-pathway in TMZ-response on additional GBM neurospheres as well as on GBM patients, by extracting RNA-sequencing-based gene expression data from the TCGA-GBM database. Finally, we demonstrated TMZ-sensitization of a TMZ non-responder neurosphere in vitro by treating them with the FDA-approved pharmacological Hh-pathway inhibitor vismodegib. Altogether, our results indicate that the Hh-pathway impedes sustained TMZ-response in GBM and could be a potential therapeutic target to enhance TMZ-response in this malignancy.

  2. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  3. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  4. Transcriptome changes in the phenylpropanoid pathway of Glycine max in response to Pseudomonas syringae infection

    Gonzalez Delkin O

    2006-11-01

    Full Text Available Abstract Background Reports of plant molecular responses to pathogenic infections have pinpointed increases in activity of several genes of the phenylpropanoid pathway leading to the synthesis of lignin and flavonoids. The majority of those findings were derived from single gene studies and more recently from several global gene expression analyses. We undertook a global transcriptional analysis focused on the response of genes of the multiple branches of the phenylpropanoid pathway to infection by the Pseudomonas syringae pv. glycinea with or without the avirulence gene avrB to characterize more broadly the contribution of the multiple branches of the pathway to the resistance response in soybean. Transcript abundance in leaves was determined from analysis of soybean cDNA microarray data and hybridizations to RNA blots with specific gene probes. Results The majority of the genes surveyed presented patterns of increased transcript accumulation. Some increased rapidly, 2 and 4 hours after inoculation, while others started to accumulate slowly by 8 – 12 hours. In contrast, transcripts of a few genes decreased in abundance 2 hours post inoculation. Most interestingly was the opposite temporal fluctuation in transcript abundance between early responsive genes in defense (CHS and IFS1 and F3H, the gene encoding a pivotal enzyme in the synthesis of anthocyanins, proanthocyanidins and flavonols. F3H transcripts decreased rapidly 2 hours post inoculation and increased during periods when CHS and IFS transcripts decreased. It was also determined that all but one (CHS4 family member genes (CHS1, CHS2, CHS3, CHS5, CHS6 and CHS7/8 accumulated higher transcript levels during the defense response provoked by the avirulent pathogen challenge. Conclusion Based on the mRNA profiles, these results show the strong bias that soybean has towards increasing the synthesis of isoflavonoid phytoalexins concomitant with the down regulation of genes required for the

  5. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  6. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  7. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  8. Streptozotocin induced activation of oxidative stress responsive splenic cell signaling pathways: Protective role of arjunolic acid

    Manna, Prasenjit; Ghosh, Jyotirmoy; Das, Joydeep; Sil, Parames C.

    2010-01-01

    Present study investigates the beneficial role of arjunolic acid (AA) against the alteration in the cytokine levels and simultaneous activation of oxidative stress responsive signaling pathways in spleen under hyperglycemic condition. Diabetes was induced by injection of streptozotocin (STZ) (at a dose of 70 mg/kg body weight, injected in the tail vain). STZ administration elevated the levels of IL-2 as well as IFN-γ and attenuated the level of TNF-α in the sera of diabetic animals. In addition, hyperglycemia is also associated with the increased production of intracellular reactive intermediates resulting with the elevation in lipid peroxidation, protein carbonylation and reduction in intracellular antioxidant defense. Investigating the oxidative stress responsive cell signaling pathways, increased expressions (immunoreactive concentrations) of phosphorylated p65 as well as its inhibitor protein phospho IκBα and phosphorylated mitogen activated protein kinases (MAPKs) have been observed in diabetic spleen tissue. Studies on isolated splenocytes revealed that hyperglycemia caused disruption of mitochondrial membrane potential, elevation in the concentration of cytosolic cytochrome c as well as activation of caspase 3 leading to apoptotic cell death. Histological examination revealed that diabetic induction depleted the white pulp scoring which is in agreement with the reduced immunological response. Treatment with AA prevented the hyperglycemia and its associated pathogenesis in spleen tissue. Results suggest that AA might act as an anti-diabetic and immunomodulatory agent against hyperglycemia.

  9. Depression and sickness behavior are Janus-faced responses to shared inflammatory pathways

    Maes Michael

    2012-06-01

    Full Text Available Abstract It is of considerable translational importance whether depression is a form or a consequence of sickness behavior. Sickness behavior is a behavioral complex induced by infections and immune trauma and mediated by pro-inflammatory cytokines. It is an adaptive response that enhances recovery by conserving energy to combat acute inflammation. There are considerable phenomenological similarities between sickness behavior and depression, for example, behavioral inhibition, anorexia and weight loss, and melancholic (anhedonia, physio-somatic (fatigue, hyperalgesia, malaise, anxiety and neurocognitive symptoms. In clinical depression, however, a transition occurs to sensitization of immuno-inflammatory pathways, progressive damage by oxidative and nitrosative stress to lipids, proteins, and DNA, and autoimmune responses directed against self-epitopes. The latter mechanisms are the substrate of a neuroprogressive process, whereby multiple depressive episodes cause neural tissue damage and consequent functional and cognitive sequelae. Thus, shared immuno-inflammatory pathways underpin the physiology of sickness behavior and the pathophysiology of clinical depression explaining their partially overlapping phenomenology. Inflammation may provoke a Janus-faced response with a good, acute side, generating protective inflammation through sickness behavior and a bad, chronic side, for example, clinical depression, a lifelong disorder with positive feedback loops between (neuroinflammation and (neurodegenerative processes following less well defined triggers.

  10. Relaxation response induces temporal transcriptome changes in energy metabolism, insulin secretion and inflammatory pathways.

    Manoj K Bhasin

    Full Text Available The relaxation response (RR is the counterpart of the stress response. Millennia-old practices evoking the RR include meditation, yoga and repetitive prayer. Although RR elicitation is an effective therapeutic intervention that counteracts the adverse clinical effects of stress in disorders including hypertension, anxiety, insomnia and aging, the underlying molecular mechanisms that explain these clinical benefits remain undetermined. To assess rapid time-dependent (temporal genomic changes during one session of RR practice among healthy practitioners with years of RR practice and also in novices before and after 8 weeks of RR training, we measured the transcriptome in peripheral blood prior to, immediately after, and 15 minutes after listening to an RR-eliciting or a health education CD. Both short-term and long-term practitioners evoked significant temporal gene expression changes with greater significance in the latter as compared to novices. RR practice enhanced expression of genes associated with energy metabolism, mitochondrial function, insulin secretion and telomere maintenance, and reduced expression of genes linked to inflammatory response and stress-related pathways. Interactive network analyses of RR-affected pathways identified mitochondrial ATP synthase and insulin (INS as top upregulated critical molecules (focus hubs and NF-κB pathway genes as top downregulated focus hubs. Our results for the first time indicate that RR elicitation, particularly after long-term practice, may evoke its downstream health benefits by improving mitochondrial energy production and utilization and thus promoting mitochondrial resiliency through upregulation of ATPase and insulin function. Mitochondrial resiliency might also be promoted by RR-induced downregulation of NF-κB-associated upstream and downstream targets that mitigates stress.

  11. Systems Analysis of Adaptive Responses to MAP Kinase Pathway Blockade in BRAF Mutant Melanoma.

    Brian J Capaldo

    Full Text Available Fifty percent of cutaneous melanomas are driven by activated BRAFV600E, but tumors treated with RAF inhibitors, even when they respond dramatically, rapidly adapt and develop resistance. Thus, there is a pressing need to identify the major mechanisms of intrinsic and adaptive resistance and develop drug combinations that target these resistance mechanisms. In a combinatorial drug screen on a panel of 12 treatment-naïve BRAFV600E mutant melanoma cell lines of varying levels of resistance to mitogen-activated protein kinase (MAPK pathway inhibition, we identified the combination of PLX4720, a targeted inhibitor of mutated BRaf, and lapatinib, an inhibitor of the ErbB family of receptor tyrosine kinases, as synergistically cytotoxic in the subset of cell lines that displayed the most resistance to PLX4720. To identify potential mechanisms of resistance to PLX4720 treatment and synergy with lapatinib treatment, we performed a multi-platform functional genomics analysis to profile the genome as well as the transcriptional and proteomic responses of these cell lines to treatment with PLX4720. We found modest levels of resistance correlated with the zygosity of the BRAF V600E allele and receptor tyrosine kinase (RTK mutational status. Layered over base-line resistance was substantial upregulation of many ErbB pathway genes in response to BRaf inhibition, thus generating the vulnerability to combination with lapatinib. The transcriptional responses of ErbB pathway genes are associated with a number of transcription factors, including ETS2 and its associated cofactors that represent a convergent regulatory mechanism conferring synergistic drug susceptibility in the context of diverse mutational landscapes.

  12. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  13. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  14. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  15. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  16. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  17. Amygdala-prefrontal pathways and the dopamine system affect nociceptive responses in the prefrontal cortex

    Onozawa Kitaro

    2011-11-01

    Full Text Available Abstract Background We previously demonstrated nociceptive discharges to be evoked by mechanical noxious stimulation in the prefrontal cortex (PFC. The nociceptive responses recorded in the PFC are conceivably involved in the affective rather than the sensory-discriminative dimension of pain. The PFC receives dense projection from the limbic system. Monosynaptic projections from the basolateral nucleus of the amygdala (BLA to the PFC are known to produce long-lasting synaptic plasticity. We examined effects of high frequency stimulation (HFS delivered to the BLA on nociceptive responses in the rat PFC. Results HFS induced long lasting suppression (LLS of the specific high threshold responses of nociceptive neurons in the PFC. Microinjection of N-methyl-D-aspartic acid (NMDA receptor antagonists (2-amino-5-phosphonovaleric acid (APV, dizocilpine (MK-801 and also metabotropic glutamate receptor (mGluR group antagonists (α-methyl-4-carboxyphenylglycine (MCPG, and 2-[(1S,2S-2-carboxycyclopropyl]-3-(9H-xanthen-9-yl-D-alanine (LY341495, prevented the induction of LLS of nociceptive responses. We also examined modulatory effects of dopamine (DA on the LLS of nociceptive responses. With depletion of DA in response to 6-hydroxydopamine (6-OHDA injection into the ipsilateral forebrain bundle, LLS of nociceptive responses was decreased, while nociceptive responses were normally evoked. Antagonists of DA receptor subtypes D2 (sulpiride and D4 (3-{[4-(4-chlorophenyl piperazin-1-yl] methyl}-1H-pyrrolo [2, 3-b] pyridine (L-745,870, microinjected into the PFC, inhibited LLS of nociceptive responses. Conclusions Our results indicate that BLA-PFC pathways inhibited PFC nociceptive cell activities and that the DA system modifies the BLA-PFC regulatory function.

  18. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  19. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  20. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  1. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  2. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  3. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  4. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  6. Identification of a novel TIF-IA-NF-κB nucleolar stress response pathway.

    Chen, Jingyu; Lobb, Ian T; Morin, Pierre; Novo, Sonia M; Simpson, James; Kennerknecht, Kathrin; von Kriegsheim, Alex; Batchelor, Emily E; Oakley, Fiona; Stark, Lesley A

    2018-06-05

    p53 as an effector of nucleolar stress is well defined, but p53 independent mechanisms are largely unknown. Like p53, the NF-κB transcription factor plays a critical role in maintaining cellular homeostasis under stress. Many stresses that stimulate NF-κB also disrupt nucleoli. However, the link between nucleolar function and activation of the NF-κB pathway is as yet unknown. Here we demonstrate that artificial disruption of the PolI complex stimulates NF-κB signalling. Unlike p53 nucleolar stress response, this effect does not appear to be linked to inhibition of rDNA transcription. We show that specific stress stimuli of NF-κB induce degradation of a critical component of the PolI complex, TIF-IA. This degradation precedes activation of NF-κB and is associated with increased nucleolar size. It is mimicked by CDK4 inhibition and is dependent upon a novel pathway involving UBF/p14ARF and S44 of the protein. We show that blocking TIF-IA degradation blocks stress effects on nucleolar size and NF-κB signalling. Finally, using ex vivo culture, we show a strong correlation between degradation of TIF-IA and activation of NF-κB in freshly resected, human colorectal tumours exposed to the chemopreventative agent, aspirin. Together, our study provides compelling evidence for a new, TIF-IA-NF-κB nucleolar stress response pathway that has in vivo relevance and therapeutic implications.

  7. Metformin inhibits inflammatory response via AMPK–PTEN pathway in vascular smooth muscle cells

    Kim, Sun Ae; Choi, Hyoung Chul

    2012-01-01

    Highlights: ► PTEN was induced by metformin and inhibited by compound C and AMPK siRNA. ► Metformin suppressed TNF-α-induced COX-2 and iNOS mRNA expression. ► Compound C and bpv (pic) increased iNOS and COX-2 protein expression. ► NF-κB activation was restored by inhibiting AMPK and PTEN. ► AMPK and PTEN regulated TNF-α-induced ROS production in VSMCs. -- Abstract: Atherosclerosis is a chronic inflammation of the coronary arteries. Vascular smooth muscle cells (VSMCs) stimulated by cytokines and chemokines accelerate the inflammatory response and migrate to the injured endothelium during the progression of atherosclerosis. Activation of AMP activated protein kinase (AMPK), a key sensor maintaining metabolic homeostasis, suppresses the inflammatory response. However, how AMPK regulates the inflammatory response is poorly understood. To identify the mechanism of this response, we focused on phosphatase and tensin homolog (PTEN), which is a negative regulator of inflammation. We investigated that activation of AMPK-induced PTEN expression and suppression of the inflammatory response through the AMPK–PTEN pathway in VSMCs. We treated with the well-known AMPK activator metformin to induce PTEN expression. PTEN was induced by metformin (2 mM) and inhibited by compound C (10 μM) and AMPK siRNA. Tumor necrosis factor-alpha (TNF-α) was used to induce inflammation. The inflammatory response was confirmed by cyclooxygenase (COX)-2, inducible nitric oxide synthase (iNOS) expression, and activation of nuclear factor (NF)-κB. Metformin suppressed COX-2 and iNOS mRNA and protein expression dose dependently. Treatment with compound C and bpv (pic) in the presence of metformin, iNOS and COX-2 protein expression increased. NF-κB activation decreased in response to metformin and was restored by inhibiting AMPK and PTEN. Inhibiting AMPK and PTEN restored ROS levels stimulated with TNF-α. Taken together, PTEN could be a possible downstream regulator of AMPK, and the

  8. Metformin inhibits inflammatory response via AMPK-PTEN pathway in vascular smooth muscle cells

    Kim, Sun Ae [Department of Pharmacology, Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of); Choi, Hyoung Chul, E-mail: hcchoi@med.yu.ac.kr [Department of Pharmacology, Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of)

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer PTEN was induced by metformin and inhibited by compound C and AMPK siRNA. Black-Right-Pointing-Pointer Metformin suppressed TNF-{alpha}-induced COX-2 and iNOS mRNA expression. Black-Right-Pointing-Pointer Compound C and bpv (pic) increased iNOS and COX-2 protein expression. Black-Right-Pointing-Pointer NF-{kappa}B activation was restored by inhibiting AMPK and PTEN. Black-Right-Pointing-Pointer AMPK and PTEN regulated TNF-{alpha}-induced ROS production in VSMCs. -- Abstract: Atherosclerosis is a chronic inflammation of the coronary arteries. Vascular smooth muscle cells (VSMCs) stimulated by cytokines and chemokines accelerate the inflammatory response and migrate to the injured endothelium during the progression of atherosclerosis. Activation of AMP activated protein kinase (AMPK), a key sensor maintaining metabolic homeostasis, suppresses the inflammatory response. However, how AMPK regulates the inflammatory response is poorly understood. To identify the mechanism of this response, we focused on phosphatase and tensin homolog (PTEN), which is a negative regulator of inflammation. We investigated that activation of AMPK-induced PTEN expression and suppression of the inflammatory response through the AMPK-PTEN pathway in VSMCs. We treated with the well-known AMPK activator metformin to induce PTEN expression. PTEN was induced by metformin (2 mM) and inhibited by compound C (10 {mu}M) and AMPK siRNA. Tumor necrosis factor-alpha (TNF-{alpha}) was used to induce inflammation. The inflammatory response was confirmed by cyclooxygenase (COX)-2, inducible nitric oxide synthase (iNOS) expression, and activation of nuclear factor (NF)-{kappa}B. Metformin suppressed COX-2 and iNOS mRNA and protein expression dose dependently. Treatment with compound C and bpv (pic) in the presence of metformin, iNOS and COX-2 protein expression increased. NF-{kappa}B activation decreased in response to metformin and was restored by inhibiting AMPK

  9. Genome-wide association study and biological pathway analysis of the Eimeria maxima response in broilers.

    Hamzić, Edin; Buitenhuis, Bart; Hérault, Frédéric; Hawken, Rachel; Abrahamsen, Mitchel S; Servin, Bertrand; Elsen, Jean-Michel; Pinard-van der Laan, Marie-Hélène; Bed'Hom, Bertrand

    2015-11-25

    Coccidiosis is the most common and costly disease in the poultry industry and is caused by protozoans of the Eimeria genus. The current control of coccidiosis, based on the use of anticoccidial drugs and vaccination, faces serious obstacles such as drug resistance and the high costs for the development of efficient vaccines, respectively. Therefore, the current control programs must be expanded with complementary approaches such as the use of genetics to improve the host response to Eimeria infections. Recently, we have performed a large-scale challenge study on Cobb500 broilers using E. maxima for which we investigated variability among animals in response to the challenge. As a follow-up to this challenge study, we performed a genome-wide association study (GWAS) to identify genomic regions underlying variability of the measured traits in the response to Eimeria maxima in broilers. Furthermore, we conducted a post-GWAS functional analysis to increase our biological understanding of the underlying response to Eimeria maxima challenge. In total, we identified 22 single nucleotide polymorphisms (SNPs) with q value Eimeria maxima in broilers. Furthermore, the post-GWAS functional analysis indicates that biological pathways and networks involved in tissue proliferation and repair along with the primary innate immune response may play the most important role during the early stage of Eimeria maxima infection in broilers.

  10. IAPs Regulate Distinct Innate Immune Pathways to Co-ordinate the Response to Bacterial Peptidoglycans.

    Stafford, Che A; Lawlor, Kate E; Heim, Valentin J; Bankovacki, Aleksandra; Bernardini, Jonathan P; Silke, John; Nachbur, Ueli

    2018-02-06

    Inhibitors of apoptosis (IAPs) proteins are critical regulators of innate immune signaling pathways and therefore have potential as drug targets. X-linked IAP (XIAP) and cellular IAP1 and IAP2 (cIAP1 and cIAP2) are E3 ligases that have been shown to be required for signaling downstream of NOD2, an intracellular receptor for bacterial peptidoglycan. We used genetic and biochemical approaches to compare the responses of IAP-deficient mice and cells to NOD2 stimulation. In all cell types tested, XIAP is the only IAP required for signaling immediately downstream of NOD2, while cIAP1 and cIAP2 are dispensable for NOD2-induced nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) activation. However, mice lacking cIAP1 or TNFR1 have a blunted cytokine response to NOD2 stimulation. We conclude that cIAPs regulate NOD2-dependent autocrine TNF signaling in vivo and highlight the importance of physiological context in the interplay of innate immune signaling pathways. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  12. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-01-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...

  13. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  14. Source-pathway-receptor investigation of the fate of trace elements derived from shotgun pellets discharged in terrestrial ecosystems managed for game shooting

    Sneddon, Jennifer; Clemente, Rafael; Riby, Philip; Lepp, Nicholas W.

    2009-01-01

    Spent shotgun pellets may contaminate terrestrial ecosystems. We examined the fate of elements originating from shotgun pellets in pasture and woodland ecosystems. Two source-receptor pathways: i) soil-soil pore water-plant and ii) whole earthworm/worm gut contents - washed and unwashed small mammal hair were investigated. Concentrations of Pb and associated contaminants were higher in soils from shot areas than controls. Arsenic and lead concentrations were positively correlated in soils, soil pore water and associated biota. Element concentrations in biota were below statutory levels in all locations. Bioavailability of lead to small mammals, based on concentrations in washed body hair was low. Lead movement from soil water to higher trophic levels was minor compared to lead adsorbed onto body surfaces. Lead was concentrated in earthworm gut and some plants. Results indicate that managed game shooting presents minimal risk in terms of element transfer to soils and their associated biota. - Source-receptor pathway analysis of a managed game shooting site showed no environmental risk of trace element transfer.

  15. Source-pathway-receptor investigation of the fate of trace elements derived from shotgun pellets discharged in terrestrial ecosystems managed for game shooting

    Sneddon, Jennifer [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom); Clemente, Rafael, E-mail: rclemente@cebas.csic.e [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom); Riby, Philip [School of Pharmacy and Chemistry, Liverpool John Moores University, Liverpool L3 3AF (United Kingdom); Lepp, Nicholas W., E-mail: n.w.lepp@ljmu.ac.u [School of Natural Sciences and Psychology, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF (United Kingdom)

    2009-10-15

    Spent shotgun pellets may contaminate terrestrial ecosystems. We examined the fate of elements originating from shotgun pellets in pasture and woodland ecosystems. Two source-receptor pathways: i) soil-soil pore water-plant and ii) whole earthworm/worm gut contents - washed and unwashed small mammal hair were investigated. Concentrations of Pb and associated contaminants were higher in soils from shot areas than controls. Arsenic and lead concentrations were positively correlated in soils, soil pore water and associated biota. Element concentrations in biota were below statutory levels in all locations. Bioavailability of lead to small mammals, based on concentrations in washed body hair was low. Lead movement from soil water to higher trophic levels was minor compared to lead adsorbed onto body surfaces. Lead was concentrated in earthworm gut and some plants. Results indicate that managed game shooting presents minimal risk in terms of element transfer to soils and their associated biota. - Source-receptor pathway analysis of a managed game shooting site showed no environmental risk of trace element transfer.

  16. A Fasting-Responsive Signaling Pathway that Extends Life Span in C. elegans

    Masaharu Uno

    2013-01-01

    Full Text Available Intermittent fasting is one of the most effective dietary restriction regimens that extend life span in C. elegans and mammals. Fasting-stimulus responses are key to the longevity response; however, the mechanisms that sense and transduce the fasting stimulus remain largely unknown. Through a comprehensive transcriptome analysis in C. elegans, we find that along with the FOXO transcription factor DAF-16, AP-1 (JUN-1/FOS-1 plays a central role in fasting-induced transcriptional changes. KGB-1, one of the C. elegans JNKs, acts as an activator of AP-1 and is activated in response to fasting. KGB-1 and AP-1 are involved in intermittent fasting-induced longevity. Fasting-induced upregulation of the components of the SCF E3 ubiquitin ligase complex via AP-1 and DAF-16 enhances protein ubiquitination and reduces protein carbonylation. Our results thus identify a fasting-responsive KGB-1/AP-1 signaling pathway, which, together with DAF-16, causes transcriptional changes that mediate longevity, partly through regulating proteostasis.

  17. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  18. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  19. Nonassociative learning as gated neural integrator and differentiator in stimulus-response pathways

    Young Daniel L

    2006-08-01

    Full Text Available Abstract Nonassociative learning is a basic neuroadaptive behavior exhibited across animal phyla and sensory modalities but its role in brain intelligence is unclear. Current literature on habituation and sensitization, the classic "dual process" of nonassociative learning, gives highly incongruous accounts between varying experimental paradigms. Here we propose a general theory of nonassociative learning featuring four base modes: habituation/primary sensitization in primary stimulus-response pathways, and desensitization/secondary sensitization in secondary stimulus-response pathways. Primary and secondary modes of nonassociative learning are distinguished by corresponding activity-dependent recall, or nonassociative gating, of neurotransmission memory. From the perspective of brain computation, nonassociative learning is a form of integral-differential calculus whereas nonassociative gating is a form of Boolean logic operator – both dynamically transforming the stimulus-response relationship. From the perspective of sensory integration, nonassociative gating provides temporal filtering whereas nonassociative learning affords low-pass, high-pass or band-pass/band-stop frequency filtering – effectively creating an intelligent sensory firewall that screens all stimuli for attention and resultant internal model adaptation and reaction. This unified framework ties together many salient characteristics of nonassociative learning and nonassociative gating and suggests a common kernel that correlates with a wide variety of sensorimotor integration behaviors such as central resetting and self-organization of sensory inputs, fail-safe sensorimotor compensation, integral-differential and gated modulation of sensorimotor feedbacks, alarm reaction, novelty detection and selective attention, as well as a variety of mental and neurological disorders such as sensorimotor instability, attention deficit hyperactivity, sensory defensiveness, autism

  20. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  1. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  2. Dietary flavonoid derivatives enhance chemotherapeutic effect by inhibiting the DNA damage response pathway

    Kuo, Ching-Ying; Zupkó, István; Chang, Fang-Rong; Hunyadi, Attila; Wu, Chin-Chung; Weng, Teng-Song; Wang, Hui-Chun

    2016-01-01

    Flavonoids are the most common group of polyphenolic compounds and abundant in dietary fruits and vegetables. Diet high in vegetables or dietary flavonoid supplements is associated with reduced mortality rate for patients with breast cancer. Many studies have been proposed for mechanisms linking flavonoids to improving chemotherapy efficacy in many types of cancers, but data on this issue is still limited. Herein, we report on a new mechanism through which dietary flavonoids inhibit DNA damage checkpoints and repair pathways. We found that dietary flavonoids could inhibit Chk1 phosphorylation and decrease clonogenic cell growth once breast cancer cells receive ultraviolet irradiation, cisplatin, or etoposide treatment. Since the ATR-Chk1 pathway mainly involves response to DNA replication stress, we propose that flavonoid derivatives reduce the side effect of chemotherapy by improving the sensitivity of cycling cells. Therefore, we propose that increasing intake of common dietary flavonoids is beneficial to breast cancer patients who are receiving DNA-damaging chemotherapy, such as cisplatin or etoposide-based therapy. - Highlights: • First report on inhibition of both DNA damage and repair by dietary flavonoids • Dietary flavonoids inhibit cisplatin- and UV-induced Chk1 phosphorylation. • Flavonoids combined with cisplatin or UV treatment show notable growth inhibition. • Promising treatment proposal for patients who are receiving adjuvant chemotherapy

  3. HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis

    Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

    2017-01-01

    ABSTRACT Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis. PMID:27846364

  4. HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis.

    Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

    2017-01-02

    Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis.

  5. Dietary flavonoid derivatives enhance chemotherapeutic effect by inhibiting the DNA damage response pathway

    Kuo, Ching-Ying [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Zupkó, István [Department of Pharmacodynamics and Biopharmacy, University of Szeged, Eötvös Utca 6, Szeged H-6720 (Hungary); Chang, Fang-Rong [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Hunyadi, Attila [Institute of Pharmacognosy, Faculty of Pharmacy, University of Szeged, Eötvös Utca 6, Szeged H-6720 (Hungary); Wu, Chin-Chung; Weng, Teng-Song [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Wang, Hui-Chun, E-mail: wanghc@kmu.edu.tw [Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); PhD Program in Translational Medicine, College of Medicine and PhD Program in Toxicology, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Research Center for Natural Product and Drug Development, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Translational Research Center and Cancer Center, Kaohsiung Medical University Hospital, Kaohsiung 80756, Taiwan (China); Department of Marine Biotechnology and Resources, National Sun Yat-Sen University, Kaohsiung 80424, Taiwan (China); Department of Fragrance and Cosmetic Science, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2016-11-15

    Flavonoids are the most common group of polyphenolic compounds and abundant in dietary fruits and vegetables. Diet high in vegetables or dietary flavonoid supplements is associated with reduced mortality rate for patients with breast cancer. Many studies have been proposed for mechanisms linking flavonoids to improving chemotherapy efficacy in many types of cancers, but data on this issue is still limited. Herein, we report on a new mechanism through which dietary flavonoids inhibit DNA damage checkpoints and repair pathways. We found that dietary flavonoids could inhibit Chk1 phosphorylation and decrease clonogenic cell growth once breast cancer cells receive ultraviolet irradiation, cisplatin, or etoposide treatment. Since the ATR-Chk1 pathway mainly involves response to DNA replication stress, we propose that flavonoid derivatives reduce the side effect of chemotherapy by improving the sensitivity of cycling cells. Therefore, we propose that increasing intake of common dietary flavonoids is beneficial to breast cancer patients who are receiving DNA-damaging chemotherapy, such as cisplatin or etoposide-based therapy. - Highlights: • First report on inhibition of both DNA damage and repair by dietary flavonoids • Dietary flavonoids inhibit cisplatin- and UV-induced Chk1 phosphorylation. • Flavonoids combined with cisplatin or UV treatment show notable growth inhibition. • Promising treatment proposal for patients who are receiving adjuvant chemotherapy.

  6. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  7. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  8. The effects of graded levels of calorie restriction: VI. Impact of short-term graded calorie restriction on transcriptomic responses of the hypothalamic hunger and circadian signaling pathways.

    Derous, Davina; Mitchell, Sharon E; Green, Cara L; Chen, Luonan; Han, Jing-Dong J; Wang, Yingchun; Promislow, Daniel E L; Lusseau, David; Speakman, John R; Douglas, Alex

    2016-04-01

    Food intake and circadian rhythms are regulated by hypothalamic neuropeptides and circulating hormones, which could mediate the anti-ageing effect of calorie restriction (CR). We tested whether these two signaling pathways mediate CR by quantifying hypothalamic transcripts of male C57BL/6 mice exposed to graded levels of CR (10 % to 40 %) for 3 months. We found that the graded CR manipulation resulted in upregulation of core circadian rhythm genes, which correlated negatively with circulating levels of leptin, insulin-like growth factor 1 (IGF-1), insulin, and tumor necrosis factor alpha (TNF-α). In addition, key components in the hunger signaling pathway were expressed in a manner reflecting elevated hunger at greater levels of restriction, and which also correlated negatively with circulating levels of insulin, TNF-α, leptin and IGF-1. Lastly, phenotypes, such as food anticipatory activity and body temperature, were associated with expression levels of both hunger genes and core clock genes. Our results suggest modulation of the hunger and circadian signaling pathways in response to altered levels of circulating hormones, that are themselves downstream of morphological changes resulting from CR treatment, may be important elements in the response to CR, driving some of the key phenotypic outcomes.

  9. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  10. Yeast as a Tool to Study Signaling Pathways in Mitochondrial Stress Response and Cytoprotection

    Maša Ždralević

    2012-01-01

    Full Text Available Cell homeostasis results from the balance between cell capability to adapt or succumb to environmental stress. Mitochondria, in addition to supplying cellular energy, are involved in a range of processes deciding about cellular life or death. The crucial role of mitochondria in cell death is well recognized. Mitochondrial dysfunction has been associated with the death process and the onset of numerous diseases. Yet, mitochondrial involvement in cellular adaptation to stress is still largely unexplored. Strong interest exists in pharmacological manipulation of mitochondrial metabolism and signaling. The yeast Saccharomyces cerevisiae has proven a valuable model organism in which several intracellular processes have been characterized in great detail, including the retrograde response to mitochondrial dysfunction and, more recently, programmed cell death. In this paper we review experimental evidences of mitochondrial involvement in cytoprotection and propose yeast as a model system to investigate the role of mitochondria in the cross-talk between prosurvival and prodeath pathways.

  11. Polyclonal immune responses to antigens associated with cancer signaling pathways and new strategies to enhance cancer vaccines.

    Clay, Timothy M; Osada, Takuya; Hartman, Zachary C; Hobeika, Amy; Devi, Gayathri; Morse, Michael A; Lyerly, H Kim

    2011-04-01

    Aberrant signaling pathways are a hallmark of cancer. A variety of strategies for inhibiting signaling pathways have been developed, but monoclonal antibodies against receptor tyrosine kinases have been among the most successful. A challenge for these therapies is therapeutic unresponsiveness and acquired resistance due to mutations in the receptors, upregulation of alternate growth and survival pathways, or inadequate function of the monoclonal antibodies. Vaccines are able to induce polyclonal responses that can have a multitude of affects against the target molecule. We began to explore therapeutic vaccine development to antigens associated with these signaling pathways. We provide an illustrative example in developing therapeutic cancer vaccines inducing polyclonal adaptive immune responses targeting the ErbB family member HER2. Further, we will discuss new strategies to augment the clinical efficacy of cancer vaccines by enhancing vaccine immunogenicity and reversing the immunosuppressive tumor microenvironment.

  12. Ethylene Receptors Signal via a Noncanonical Pathway to Regulate Abscisic Acid Responses1[OPEN

    Bakshi, Arkadipta; Fernandez, Jessica C.

    2018-01-01

    Ethylene is a gaseous plant hormone perceived by a family of receptors in Arabidopsis (Arabidopsis thaliana) including ETHYLENE RESPONSE1 (ETR1) and ETR2. Previously we showed that etr1-6 loss-of-function plants germinate better and etr2-3 loss-of-function plants germinate worse than wild-type under NaCl stress and in response to abscisic acid (ABA). In this study, we expanded these results by showing that ETR1 and ETR2 have contrasting roles in the control of germination under a variety of inhibitory conditions for seed germination such as treatment with KCl, CuSO4, ZnSO4, and ethanol. Pharmacological and molecular biology results support a model where ETR1 and ETR2 are indirectly affecting the expression of genes encoding ABA signaling proteins to affect ABA sensitivity. The receiver domain of ETR1 is involved in this function in germination under these conditions and controlling the expression of genes encoding ABA signaling proteins. Epistasis analysis demonstrated that these contrasting roles of ETR1 and ETR2 do not require the canonical ethylene signaling pathway. To explore the importance of receptor-protein interactions, we conducted yeast two-hybrid screens using the cytosolic domains of ETR1 and ETR2 as bait. Unique interacting partners with either ETR1 or ETR2 were identified. We focused on three of these proteins and confirmed the interactions with receptors. Loss of these proteins led to faster germination in response to ABA, showing that they are involved in ABA responses. Thus, ETR1 and ETR2 have both ethylene-dependent and -independent roles in plant cells that affect responses to ABA. PMID:29158332

  13. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

    Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

    2013-01-01

    After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

  15. Molecular pathways in the bystander response of cells exposed to very low fluences of alpha particles

    Little, J.B.

    2000-01-01

    Full text: We have examined biological effects in cell populations exposed to very low mean doses of alpha radiation by which only a small fraction of the cells are actually traversed by an alpha particle. We showed earlier that an enhanced frequency of sister chromatid exchanges and HPRT mutations occur in the non-irradiated, 'bystander' cells. The frequency of mutations induced by a single alpha particle traversing the nucleus of a cell was increased nearly fivefold at the lowest fluence studied, a result of mutations occurring in bystander cells. This was associated with a similar increase in the induction of micronuclei, indicating the induction of DNA damage in bystander cells. In order to gain information concerning molecular pathways, we studied changes in gene expression in bystander cells in confluent cultures of human diploid fibroblasts or mouse embryo-derived fibroblasts (MEFs) by western analysis and in-situ immunofluorescence. The expression levels of p53, p21 Waf1 and p34 cdc2 were significantly modulated in bystander cells. The upregulation of p53 and p21 Waf1 did not occur in cultures irradiated at low density, and was markedly reduced in the presence of the gap junction inhibitor lindane. The importance of gap-junction mediated intercellular communication was confirmed in connexin-43 knockout MEFs. Western blot analyses and electrophoretic mobility shift assays indicate that the bystander response is suppressed by incubation with superoxide dismutase as well as an inhibitor of NADPH oxidase, and is associated with the induction of NFKB, suggesting the effect is mediated by oxidative stress. The stress-activated protein kinase p38 and its downstream effector ATF2 are also induced in bystander cells independent of oxidative stress. These results will be discussed in terms of whether activation of the p53 damage response pathway is the direct result of signaling from irradiated cells, or rather is a consequence of DNA induced damage in the bystander

  16. MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway.

    Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A; Pfeffer, Lawrence M

    2017-12-22

    Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro , and inhibited GBM tumorigenesis in vivo . Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro , and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway.

  17. Histamine Induces Bovine Rumen Epithelial Cell Inflammatory Response via NF-κB Pathway

    Xudong Sun

    2017-06-01

    Full Text Available Background/Aims: Subacute ruminal acidosis (SARA is a common disease in high-producing lactating cows. Rumenitis is the initial insult of SARA and is associated with the high concentrations of histamine produced in the rumen of dairy cows during SARA. However, the exact mechanism remains unclear. The objective of the current study is to investigate whether histamine induces inflammation of rumen epithelial cells and the underlying mechanism of this process. Methods: Bovine rumen epithelial cells were cultured and treated with different concentrations of histamine and pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor cultured in different pH medium (pH 7.2 or 5.5. qRT-PCR, Western-blotting, ELISA and immunocytofluorescence were used to evaluate whether histamine activated the NF-κB pathway and inflammatory cytokines. Results: The results showed that histamine significantly increased the activity of IKK β and the phosphorylation levels of IκB α, as well as upregulated the mRNA and protein expression levels of NF-κB p65 in the rumen epithelial cells cultured in neutral (pH=7.2 and acidic (pH=5.5 medium. Furthermore, histamine treatment also significantly increased the transcriptional activity of NF-κB p65. High expression and transcriptional activity of NF-κB p65 significantly increased the mRNA expressions and concentrations of inflammatory cytokines, tumor necrosis factor alpha (TNF-α, interleukin 6 (IL-6 and interleukin 1 beta (IL-1β, thereby inducing the inflammatory response in bovine rumen epithelial cells. However, inhibition of NF-κB p65 by PDTC significantly decreased the expressions and concentrations of the inflammatory cytokines induced by histamine in the rumen epithelial cells cultured in the neutral and acidic medium. Conclusion: The present data indicate that histamine induces the inflammatory response of bovine rumen epithelial cells through the NF-κB pathway.

  18. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  19. Co-ordinate but disproportionate activation of apoptotic, regenerative and inflammatory pathways characterizes the liver response to acute amebic infection.

    Pelosof, Lorraine C; Davis, Paul H; Zhang, Zhi; Zhang, Xiaochun; Stanley, Samuel L

    2006-03-01

    The liver has the remarkable ability to respond to injury with repair and regeneration. The protozoan parasite Entamoeba histolytica is the major cause of liver abscess worldwide. We report a transcriptional analysis of the response of mouse liver to E. histolytica infection, the first study looking at acute liver infection by a non-viral pathogen. Focusing on early time points, we identified 764 genes with altered transcriptional levels in amebic liver abscess. The response to infection is rapid and complex, with concurrent increased expression of genes linked to host defence through IL-1, TLR2, or interferon-induced pathways, liver regeneration via activation of IL-6 pathways, and genes associated with programmed cell death possibly through TNFalpha or Fas pathways. A comparison of amebic liver infection with the liver response to partial hepatectomy or toxins reveals striking similarities between amebic liver abscess and non-infectious injury in key components of the liver regeneration pathways. However, the response in amebic liver abscess is biased towards apoptosis when compared with acute liver injury from hepatectomy, toxins, or other forms of liver infection. E. histolytica infection of the liver simultaneously activates inflammatory, regenerative and apoptotic pathways, but the sum of these early responses is biased towards programmed cell death.

  20. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  1. JAK/STAT signaling pathway-mediated immune response in silkworm (Bombyx mori) challenged by Beauveria bassiana.

    Geng, Tao; Lv, Ding-Ding; Huang, Yu-Xia; Hou, Cheng-Xiang; Qin, Guang-Xing; Guo, Xi-Jie

    2016-12-20

    Innate immunity was critical in insects defensive system and able to be induced by Janus kinase/signal transducer and activator of transcription cascade transduction (JAK/STAT) signaling pathway. Currently, it had been identified many JAK/STAT signaling pathway-related genes in silkworm, but little function was known on insect innate immunity. To explore the roles of JAK/STAT pathway in antifungal immune response in silkworm (Bombyx mori) against Beauveria bassiana infection, the expression patterns of B. mori C-type lectin 5 (BmCTL5) and genes encoding 6 components of JAK/STAT signaling pathway in silkworm challenged by B. bassiana were analyzed using quantitative real time PCR. Meanwhile the activation of JAK/STAT signaling pathway by various pathogenic micro-organisms and the affect of JAK/STAT signaling pathway inhibitors on antifungal activity in silkworm hemolymph was also detected. Moreover, RNAi assay of BmCTL5 and the affect on expression levels of signaling factors were also analyzed. We found that JAK/STAT pathway could be obviously activated in silkworm challenged with B. bassiana and had no response to bacteria and B. mori cytoplasmic polyhedrosis virus (BmCPV). However, the temporal expression patterns of JAK/STAT signaling pathway related genes were significantly different. B. mori downstream receptor kinase (BmDRK) might be a positive regulator of JAK/STAT signaling pathway in silkworm against B. bassiana infection. Moreover, antifungal activity assay showed that the suppression of JAK/STAT signaling pathway by inhibitors could significantly inhibit the antifungal activity in hemolymph and resulted in increased sensitivity of silkworm to B. bassiana infection, indicating that JAK/STAT signaling pathway might be involved in the synthesis and secretion of antifungal substances. The results of RNAi assays suggested that BmCTL5 might be one pattern recognition receptors for JAK/STAT signaling pathway in silkworm. These findings yield insights for better

  2. Functional specialization of the small interfering RNA pathway in response to virus infection.

    Joao Trindade Marques

    Full Text Available In Drosophila, post-transcriptional gene silencing occurs when exogenous or endogenous double stranded RNA (dsRNA is processed into small interfering RNAs (siRNAs by Dicer-2 (Dcr-2 in association with a dsRNA-binding protein (dsRBP cofactor called Loquacious (Loqs-PD. siRNAs are then loaded onto Argonaute-2 (Ago2 by the action of Dcr-2 with another dsRBP cofactor called R2D2. Loaded Ago2 executes the destruction of target RNAs that have sequence complementarity to siRNAs. Although Dcr-2, R2D2, and Ago2 are essential for innate antiviral defense, the mechanism of virus-derived siRNA (vsiRNA biogenesis and viral target inhibition remains unclear. Here, we characterize the response mechanism mediated by siRNAs against two different RNA viruses that infect Drosophila. In both cases, we show that vsiRNAs are generated by Dcr-2 processing of dsRNA formed during viral genome replication and, to a lesser extent, viral transcription. These vsiRNAs seem to preferentially target viral polyadenylated RNA to inhibit viral replication. Loqs-PD is completely dispensable for silencing of the viruses, in contrast to its role in silencing endogenous targets. Biogenesis of vsiRNAs is independent of both Loqs-PD and R2D2. R2D2, however, is required for sorting and loading of vsiRNAs onto Ago2 and inhibition of viral RNA expression. Direct injection of viral RNA into Drosophila results in replication that is also independent of Loqs-PD. This suggests that triggering of the antiviral pathway is not related to viral mode of entry but recognition of intrinsic features of virus RNA. Our results indicate the existence of a vsiRNA pathway that is separate from the endogenous siRNA pathway and is specifically triggered by virus RNA. We speculate that this unique framework might be necessary for a prompt and efficient antiviral response.

  3. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  4. Comprehensive transcriptome analyses correlated with untargeted metabolome reveal differentially expressed pathways in response to cell wall alterations.

    Reem, Nathan T; Chen, Han-Yi; Hur, Manhoi; Zhao, Xuefeng; Wurtele, Eve Syrkin; Li, Xu; Li, Ling; Zabotina, Olga

    2018-03-01

    This research provides new insights into plant response to cell wall perturbations through correlation of transcriptome and metabolome datasets obtained from transgenic plants expressing cell wall-modifying enzymes. Plants respond to changes in their cell walls in order to protect themselves from pathogens and other stresses. Cell wall modifications in Arabidopsis thaliana have profound effects on gene expression and defense response, but the cell signaling mechanisms underlying these responses are not well understood. Three transgenic Arabidopsis lines, two with reduced cell wall acetylation (AnAXE and AnRAE) and one with reduced feruloylation (AnFAE), were used in this study to investigate the plant responses to cell wall modifications. RNA-Seq in combination with untargeted metabolome was employed to assess differential gene expression and metabolite abundance. RNA-Seq results were correlated with metabolite abundances to determine the pathways involved in response to cell wall modifications introduced in each line. The resulting pathway enrichments revealed the deacetylation events in AnAXE and AnRAE plants induced similar responses, notably, upregulation of aromatic amino acid biosynthesis and changes in regulation of primary metabolic pathways that supply substrates to specialized metabolism, particularly those related to defense responses. In contrast, genes and metabolites of lipid biosynthetic pathways and peroxidases involved in lignin polymerization were downregulated in AnFAE plants. These results elucidate how primary metabolism responds to extracellular stimuli. Combining the transcriptomics and metabolomics datasets increased the power of pathway prediction, and demonstrated the complexity of pathways involved in cell wall-mediated signaling.

  5. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  6. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  7. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  8. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  9. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  10. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  11. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  12. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  13. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  14. Organotypic Cultures of Intervertebral Disc Cells: Responses to Growth Factors and Signaling Pathways Involved

    Harris Pratsinis

    2015-01-01

    Full Text Available Intervertebral disc (IVD degeneration is strongly associated with low back pain, a major cause of disability worldwide. An in-depth understanding of IVD cell physiology is required for the design of novel regenerative therapies. Accordingly, aim of this work was the study of IVD cell responses to mitogenic growth factors in a three-dimensional (3D organotypic milieu, comprising characteristic molecules of IVD’s extracellular matrix. In particular, annulus fibrosus (AF cells were cultured inside collagen type-I gels, while nucleus pulposus (NP cells in chondroitin sulfate A (CSA supplemented collagen gels, and the effects of Platelet-Derived Growth Factor (PDGF, basic Fibroblast Growth Factor (bFGF, and Insulin-Like Growth Factor-I (IGF-I were assessed. All three growth factors stimulated DNA synthesis in both AF and NP 3D cell cultures, with potencies similar to those observed previously in monolayers. CSA supplementation inhibited basal DNA synthesis rates, without affecting the response to growth factors. ERK and Akt were found to be phosphorylated following growth factor stimulation. Blockade of these two signaling pathways using pharmacologic inhibitors significantly, though not completely, inhibited growth factor-induced DNA synthesis. The proposed culture systems may prove useful for further in vitro studies aiming at future interventions for IVD regeneration.

  15. Computational Model of Antidepressant Response Heterogeneity as Multi-pathway Neuroadaptation

    Mariam B. Camacho

    2017-12-01

    Full Text Available Current hypotheses cannot fully explain the clinically observed heterogeneity in antidepressant response. The therapeutic latency of antidepressants suggests that therapeutic outcomes are achieved not by the acute effects of the drugs, but rather by the homeostatic changes that occur as the brain adapts to their chronic administration. We present a computational model that represents the known interactions between the monoaminergic neurotransmitter-producing brain regions and associated non-monoaminergic neurotransmitter systems, and use the model to explore the possible ways in which the brain can homeostatically adjust to chronic antidepressant administration. The model also represents the neuron-specific neurotransmitter receptors that are known to adjust their strengths (expressions or sensitivities in response to chronic antidepressant administration, and neuroadaptation in the model occurs through sequential adjustments in these receptor strengths. The main result is that the model can reach similar levels of adaptation to chronic administration of the same antidepressant drug or combination along many different pathways, arriving correspondingly at many different receptor strength configurations, but not all of those adapted configurations are also associated with therapeutic elevations in monoamine levels. When expressed as the percentage of adapted configurations that are also associated with elevations in one or more of the monoamines, our modeling results largely agree with the percentage efficacy rates of antidepressants and antidepressant combinations observed in clinical trials. Our neuroadaptation model provides an explanation for the clinical reports of heterogeneous outcomes among patients chronically administered the same antidepressant drug regimen.

  16. Astroglial Pentose Phosphate Pathway Rates in Response to High-Glucose Environments

    Shinichi Takahashi

    2012-02-01

    Full Text Available ROS (reactive oxygen species play an essential role in the pathophysiology of diabetes, stroke and neurodegenerative disorders. Hyperglycaemia associated with diabetes enhances ROS production and causes oxidative stress in vascular endothelial cells, but adverse effects of either acute or chronic high-glucose environments on brain parenchymal cells remain unclear. The PPP (pentose phosphate pathway and GSH participate in a major defence mechanism against ROS in brain, and we explored the role and regulation of the astroglial PPP in response to acute and chronic high-glucose environments. PPP activity was measured in cultured neurons and astroglia by determining the difference in rate of 14CO2 production from [1-14C]glucose and [6-14C]glucose. ROS production, mainly H2O2, and GSH were also assessed. Acutely elevated glucose concentrations in the culture media increased PPP activity and GSH level in astroglia, decreasing ROS production. Chronically elevated glucose environments also induced PPP activation. Immunohistochemical analyses revealed that chronic high-glucose environments induced ER (endoplasmic reticulum stress (presumably through increased hexosamine biosynthetic pathway flux. Nuclear translocation of Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2, which regulates G6PDH (glyceraldehyde-6-phosphate dehydrogenase by enhancing transcription, was also observed in association with BiP (immunoglobulin heavy-chain-binding protein expression. Acute and chronic high-glucose environments activated the PPP in astroglia, preventing ROS elevation. Therefore a rapid decrease in glucose level seems to enhance ROS toxicity, perhaps contributing to neural damage when insulin levels given to diabetic patients are not properly calibrated and plasma glucose levels are not adequately maintained. These findings may also explain the lack of evidence for clinical benefits from strict glycaemic control during the acute phase of stroke.

  17. Free fatty acid palmitate activates unfolded protein response pathway and promotes apoptosis in meniscus cells.

    Haywood, J; Yammani, R R

    2016-05-01

    Obesity is the major risk factor for the development of osteoarthritis (OA); however, the mechanisms involved are not clearly understood. Obesity is associated with increased production of adipokine and elevated levels of circulating free fatty acids (FFA). A recent study has shown that saturated fatty acid palmitate induced pro-inflammatory and pro-apoptotic pathways in chondrocytes. Meniscus has been shown to be more susceptible than articular cartilage to catabolic stimuli. Thus, the aim of this study was to determine the effect of FFA (specifically, palmitate) on meniscus cells. Cultured primary porcine meniscus cells were stimulated with 500 μM FFA (palmitate and oleate) for 24 h to induce endoplasmic reticulum (ER) stress. After treatment, cell lysates were prepared and immunoblotted for C/EBP homologous protein (CHOP). To determine the activation of unfolded protein response (UPR) signaling, cell lysates were probed for cJun n-terminal kinase (JNK), cleaved caspase -3 and Xbp-1s, an alternative mRNA splicing product generated due to Ire1α activation. Treatment of isolated primary meniscus cells with palmitate but not oleate induced expression of CHOP and Xbp-1s. Palmitate treatment of meniscus cells also activated JNK and increased expression of caspase-3, thus promoting apoptosis in meniscus cells. Palmitate induces ER stress and promotes apoptotic pathways in meniscus cells. This is the first study to establish ER stress as a key metabolic mechanistic link between obesity and OA, in addition to (or operating with) biomechanical factors. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  18. Astroglial pentose phosphate pathway rates in response to high-glucose environments

    Takahashi, Shinichi; Izawa, Yoshikane; Suzuki, Norihiro

    2012-01-01

    ROS (reactive oxygen species) play an essential role in the pathophysiology of diabetes, stroke and neurodegenerative disorders. Hyperglycaemia associated with diabetes enhances ROS production and causes oxidative stress in vascular endothelial cells, but adverse effects of either acute or chronic high-glucose environments on brain parenchymal cells remain unclear. The PPP (pentose phosphate pathway) and GSH participate in a major defence mechanism against ROS in brain, and we explored the role and regulation of the astroglial PPP in response to acute and chronic high-glucose environments. PPP activity was measured in cultured neurons and astroglia by determining the difference in rate of 14CO2 production from [1-14C]glucose and [6-14C]glucose. ROS production, mainly H2O2, and GSH were also assessed. Acutely elevated glucose concentrations in the culture media increased PPP activity and GSH level in astroglia, decreasing ROS production. Chronically elevated glucose environments also induced PPP activation. Immunohistochemical analyses revealed that chronic high-glucose environments induced ER (endoplasmic reticulum) stress (presumably through increased hexosamine biosynthetic pathway flux). Nuclear translocation of Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2), which regulates G6PDH (glyceraldehyde-6-phosphate dehydrogenase) by enhancing transcription, was also observed in association with BiP (immunoglobulin heavy-chain-binding protein) expression. Acute and chronic high-glucose environments activated the PPP in astroglia, preventing ROS elevation. Therefore a rapid decrease in glucose level seems to enhance ROS toxicity, perhaps contributing to neural damage when insulin levels given to diabetic patients are not properly calibrated and plasma glucose levels are not adequately maintained. These findings may also explain the lack of evidence for clinical benefits from strict glycaemic control during the acute phase of stroke. PMID:22300409

  19. The dectin-1/inflammasome pathway is responsible for the induction of protective T-helper 17 responses that discriminate between yeasts and hyphae of Candida albicans.

    Cheng, Shih-Chin; van de Veerdonk, Frank L; Lenardon, Megan; Stoffels, Monique; Plantinga, Theo; Smeekens, Sanne; Rizzetto, Lisa; Mukaremera, Liliane; Preechasuth, Kanya; Cavalieri, Duccio; Kanneganti, Thirumala Devi; van der Meer, Jos W M; Kullberg, Bart Jan; Joosten, Leo A B; Gow, Neil A R; Netea, Mihai G

    2011-08-01

    In the mucosa, the immune pathways discriminating between colonizing and invasive Candida, thus inducing tolerance or inflammation, are poorly understood. Th17 responses induced by Candida albicans hyphae are central for the activation of mucosal antifungal immunity. An essential step for the discrimination between yeasts and hyphae and induction of Th17 responses is the activation of the inflammasome by C. albicans hyphae and the subsequent release of active IL-1β in macrophages. Inflammasome activation in macrophages results from differences in cell-wall architecture between yeasts and hyphae and is partly mediated by the dectin-1/Syk pathway. These results define the dectin-1/inflammasome pathway as the mechanism that enables the host immune system to mount a protective Th17 response and distinguish between colonization and tissue invasion by C. albicans.

  20. cGAS/STING Pathway in Cancer: Jekyll and Hyde Story of Cancer Immune Response

    Debojit Bose

    2017-11-01

    Full Text Available The last two decades have witnessed enormous growth in the field of cancer immunity. Mechanistic insights of cancer immunoediting have not only enhanced our understanding but also paved the way to target and/or harness the innate immune system to combat cancer, called cancer immunotherapy. Cyclic GMP-AMP synthase (cGAS/Stimulator of interferon genes(STING pathway has recently emerged as nodal player in cancer immunity and is currently being explored as potential therapeutic target. Although therapeutic activation of this pathway has shown promising anti-tumor effects in vivo, evidence also indicates the role of this pathway in inflammation mediated carcinogenesis. This review highlights our current understanding of cGAS/STING pathway in cancer, its therapeutic targeting and potential alternate approaches to target this pathway. Optimal therapeutic targeting and artificial tunability of this pathway still demand in depth understanding of cGAS/STING pathway regulation and homeostasis.

  1. cGAS/STING Pathway in Cancer: Jekyll and Hyde Story of Cancer Immune Response.

    Bose, Debojit

    2017-11-18

    The last two decades have witnessed enormous growth in the field of cancer immunity. Mechanistic insights of cancer immunoediting have not only enhanced our understanding but also paved the way to target and/or harness the innate immune system to combat cancer, called cancer immunotherapy. Cyclic GMP-AMP synthase (cGAS)/Stimulator of interferon genes(STING) pathway has recently emerged as nodal player in cancer immunity and is currently being explored as potential therapeutic target. Although therapeutic activation of this pathway has shown promising anti-tumor effects in vivo, evidence also indicates the role of this pathway in inflammation mediated carcinogenesis. This review highlights our current understanding of cGAS/STING pathway in cancer, its therapeutic targeting and potential alternate approaches to target this pathway. Optimal therapeutic targeting and artificial tunability of this pathway still demand in depth understanding of cGAS/STING pathway regulation and homeostasis.

  2. Deduction and Analysis of the Interacting Stress Response Pathways of Metal/Radionuclide-reducing Bacteria

    Zhou, Jizhong [University of Oklahoma; He, Zhili [University of Oklahoma

    2010-02-28

    Project Title: Deduction and Analysis of the Interacting Stress Response Pathways of Metal/Radionuclide-reducing Bacteria DOE Grant Number: DE-FG02-06ER64205 Principal Investigator: Jizhong (Joe) Zhou (University of Oklahoma) Key members: Zhili He, Aifen Zhou, Christopher Hemme, Joy Van Nostrand, Ye Deng, and Qichao Tu Collaborators: Terry Hazen, Judy Wall, Adam Arkin, Matthew Fields, Aindrila Mukhopadhyay, and David Stahl Summary Three major objectives have been conducted in the Zhou group at the University of Oklahoma (OU): (i) understanding of gene function, regulation, network and evolution of Desulfovibrio vugaris Hildenborough in response to environmental stresses, (ii) development of metagenomics technologies for microbial community analysis, and (iii) functional characterization of microbial communities with metagenomic approaches. In the past a few years, we characterized four CRP/FNR regulators, sequenced ancestor and evolved D. vulgaris strains, and functionally analyzed those mutated genes identified in salt-adapted strains. Also, a new version of GeoChip 4.0 has been developed, which also includes stress response genes (StressChip), and a random matrix theory-based conceptual framework for identifying functional molecular ecological networks has been developed with the high throughput functional gene array hybridization data as well as pyrosequencing data from 16S rRNA genes. In addition, GeoChip and sequencing technologies as well as network analysis approaches have been used to analyze microbial communities from different habitats. Those studies provide a comprehensive understanding of gene function, regulation, network, and evolution in D. vulgaris, and microbial community diversity, composition and structure as well as their linkages with environmental factors and ecosystem functioning, which has resulted in more than 60 publications.

  3. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  4. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  5. 'Omics analysis of low dose acetaminophen intake demonstrates novel response pathways in humans

    Jetten, Marlon J.A.; Gaj, Stan [Department of Toxicogenomics, Maastricht University, Universitiessingel 50 6229 ER Maastricht (Netherlands); Ruiz-Aracama, Ainhoa [RIKILT, Institute of Food Safety, Wageningen UR, PO Box 230, 6700 AE, Wageningen (Netherlands); Kok, Theo M. de [Department of Toxicogenomics, Maastricht University, Universitiessingel 50 6229 ER Maastricht (Netherlands); Delft, Joost H.M. van, E-mail: j.vandelft@maastrichtuniversity.nl [Department of Toxicogenomics, Maastricht University, Universitiessingel 50 6229 ER Maastricht (Netherlands); Lommen, Arjen [RIKILT, Institute of Food Safety, Wageningen UR, PO Box 230, 6700 AE, Wageningen (Netherlands); Someren, Eugene P. van [Research Group Microbiology and Systems Biology, TNO, PO Box 360 3700 AJ Zeist (Netherlands); Jennen, Danyel G.J.; Claessen, Sandra M. [Department of Toxicogenomics, Maastricht University, Universitiessingel 50 6229 ER Maastricht (Netherlands); Peijnenburg, Ad A.C.M. [RIKILT, Institute of Food Safety, Wageningen UR, PO Box 230, 6700 AE, Wageningen (Netherlands); Stierum, Rob H. [Research Group Microbiology and Systems Biology, TNO, PO Box 360 3700 AJ Zeist (Netherlands); Kleinjans, Jos C.S. [Department of Toxicogenomics, Maastricht University, Universitiessingel 50 6229 ER Maastricht (Netherlands)

    2012-03-15

    Acetaminophen is the primary cause of acute liver toxicity in Europe/USA, which led the FDA to reconsider recommendations concerning safe acetaminophen dosage/use. Unfortunately, the current tests for liver toxicity are no ideal predictive markers for liver injury, i.e. they only measure acetaminophen exposure after profound liver toxicity has already occurred. Furthermore, these tests do not provide mechanistic information. Here, 'omics techniques (global analysis of metabolomic/gene-expression responses) may provide additional insight. To better understand acetaminophen-induced responses at low doses, we evaluated the effects of (sub-)therapeutic acetaminophen doses on metabolite formation and global gene-expression changes (including, for the first time, full-genome human miRNA expression changes) in blood/urine samples from healthy human volunteers. Many known and several new acetaminophen-metabolites were detected, in particular in relation to hepatotoxicity-linked, oxidative metabolism of acetaminophen. Transcriptomic changes indicated immune-modulating effects (2 g dose) and oxidative stress responses (4 g dose). For the first time, effects of acetaminophen on full-genome human miRNA expression have been considered and confirmed the findings on mRNA level. 'Omics techniques outperformed clinical chemistry tests and revealed novel response pathways to acetaminophen in humans. Although no definitive conclusion about potential immunotoxic effects of acetaminophen can be drawn from this study, there are clear indications that the immune system is triggered even after intake of low doses of acetaminophen. Also, oxidative stress-related gene responses, similar to those seen after high dose acetaminophen exposure, suggest the occurrence of possible pre-toxic effects of therapeutic acetaminophen doses. Possibly, these effects are related to dose-dependent increases in levels of hepatotoxicity-related metabolites. -- Highlights: ► 'Omics techniques

  6. 'Omics analysis of low dose acetaminophen intake demonstrates novel response pathways in humans

    Jetten, Marlon J.A.; Gaj, Stan; Ruiz-Aracama, Ainhoa; Kok, Theo M. de; Delft, Joost H.M. van; Lommen, Arjen; Someren, Eugene P. van; Jennen, Danyel G.J.; Claessen, Sandra M.; Peijnenburg, Ad A.C.M.; Stierum, Rob H.; Kleinjans, Jos C.S.

    2012-01-01

    Acetaminophen is the primary cause of acute liver toxicity in Europe/USA, which led the FDA to reconsider recommendations concerning safe acetaminophen dosage/use. Unfortunately, the current tests for liver toxicity are no ideal predictive markers for liver injury, i.e. they only measure acetaminophen exposure after profound liver toxicity has already occurred. Furthermore, these tests do not provide mechanistic information. Here, 'omics techniques (global analysis of metabolomic/gene-expression responses) may provide additional insight. To better understand acetaminophen-induced responses at low doses, we evaluated the effects of (sub-)therapeutic acetaminophen doses on metabolite formation and global gene-expression changes (including, for the first time, full-genome human miRNA expression changes) in blood/urine samples from healthy human volunteers. Many known and several new acetaminophen-metabolites were detected, in particular in relation to hepatotoxicity-linked, oxidative metabolism of acetaminophen. Transcriptomic changes indicated immune-modulating effects (2 g dose) and oxidative stress responses (4 g dose). For the first time, effects of acetaminophen on full-genome human miRNA expression have been considered and confirmed the findings on mRNA level. 'Omics techniques outperformed clinical chemistry tests and revealed novel response pathways to acetaminophen in humans. Although no definitive conclusion about potential immunotoxic effects of acetaminophen can be drawn from this study, there are clear indications that the immune system is triggered even after intake of low doses of acetaminophen. Also, oxidative stress-related gene responses, similar to those seen after high dose acetaminophen exposure, suggest the occurrence of possible pre-toxic effects of therapeutic acetaminophen doses. Possibly, these effects are related to dose-dependent increases in levels of hepatotoxicity-related metabolites. -- Highlights: ► 'Omics techniques outperformed

  7. Aberrant DNA damage response pathways may predict the outcome of platinum chemotherapy in ovarian cancer.

    Dimitra T Stefanou

    Full Text Available Ovarian carcinoma (OC is the most lethal gynecological malignancy. Despite the advances in the treatment of OC with combinatorial regimens, including surgery and platinum-based chemotherapy, patients generally exhibit poor prognosis due to high chemotherapy resistance. Herein, we tested the hypothesis that DNA damage response (DDR pathways are involved in resistance of OC patients to platinum chemotherapy. Selected DDR signals were evaluated in two human ovarian carcinoma cell lines, one sensitive (A2780 and one resistant (A2780/C30 to platinum treatment as well as in peripheral blood mononuclear cells (PBMCs from OC patients, sensitive (n = 7 or resistant (n = 4 to subsequent chemotherapy. PBMCs from healthy volunteers (n = 9 were studied in parallel. DNA damage was evaluated by immunofluorescence γH2AX staining and comet assay. Higher levels of intrinsic DNA damage were found in A2780 than in A2780/C30 cells. Moreover, the intrinsic DNA damage levels were significantly higher in OC patients relative to healthy volunteers, as well as in platinum-sensitive patients relative to platinum-resistant ones (all P<0.05. Following carboplatin treatment, A2780 cells showed lower DNA repair efficiency than A2780/C30 cells. Also, following carboplatin treatment of PBMCs ex vivo, the DNA repair efficiency was significantly higher in healthy volunteers than in platinum-resistant patients and lowest in platinum-sensitive ones (t1/2 for loss of γH2AX foci: 2.7±0.5h, 8.8±1.9h and 15.4±3.2h, respectively; using comet assay, t1/2 of platinum-induced damage repair: 4.8±1.4h, 12.9±1.9h and 21.4±2.6h, respectively; all P<0.03. Additionally, the carboplatin-induced apoptosis rate was higher in A2780 than in A2780/C30 cells. In PBMCs, apoptosis rates were inversely correlated with DNA repair efficiencies of these cells, being significantly higher in platinum-sensitive than in platinum-resistant patients and lowest in healthy volunteers (all P<0.05. We conclude

  8. Histamine Induces Bovine Rumen Epithelial Cell Inflammatory Response via NF-κB Pathway.

    Sun, Xudong; Yuan, Xue; Chen, Liang; Wang, Tingting; Wang, Zhe; Sun, Guoquan; Li, Xiaobing; Li, Xinwei; Liu, Guowen

    2017-01-01

    Subacute ruminal acidosis (SARA) is a common disease in high-producing lactating cows. Rumenitis is the initial insult of SARA and is associated with the high concentrations of histamine produced in the rumen of dairy cows during SARA. However, the exact mechanism remains unclear. The objective of the current study is to investigate whether histamine induces inflammation of rumen epithelial cells and the underlying mechanism of this process. Bovine rumen epithelial cells were cultured and treated with different concentrations of histamine and pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) cultured in different pH medium (pH 7.2 or 5.5). qRT-PCR, Western-blotting, ELISA and immunocytofluorescence were used to evaluate whether histamine activated the NF-κB pathway and inflammatory cytokines. The results showed that histamine significantly increased the activity of IKK β and the phosphorylation levels of IκB α, as well as upregulated the mRNA and protein expression levels of NF-κB p65 in the rumen epithelial cells cultured in neutral (pH=7.2) and acidic (pH=5.5) medium. Furthermore, histamine treatment also significantly increased the transcriptional activity of NF-κB p65. High expression and transcriptional activity of NF-κB p65 significantly increased the mRNA expressions and concentrations of inflammatory cytokines, tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6) and interleukin 1 beta (IL-1β), thereby inducing the inflammatory response in bovine rumen epithelial cells. However, inhibition of NF-κB p65 by PDTC significantly decreased the expressions and concentrations of the inflammatory cytokines induced by histamine in the rumen epithelial cells cultured in the neutral and acidic medium. The present data indicate that histamine induces the inflammatory response of bovine rumen epithelial cells through the NF-κB pathway. © 2017 The Author(s). Published by S. Karger AG, Basel.

  9. The sequence of cortical activity inferred by response latency variability in the human ventral pathway of face processing.

    Lin, Jo-Fu Lotus; Silva-Pereyra, Juan; Chou, Chih-Che; Lin, Fa-Hsuan

    2018-04-11

    Variability in neuronal response latency has been typically considered caused by random noise. Previous studies of single cells and large neuronal populations have shown that the temporal variability tends to increase along the visual pathway. Inspired by these previous studies, we hypothesized that functional areas at later stages in the visual pathway of face processing would have larger variability in the response latency. To test this hypothesis, we used magnetoencephalographic data collected when subjects were presented with images of human faces. Faces are known to elicit a sequence of activity from the primary visual cortex to the fusiform gyrus. Our results revealed that the fusiform gyrus showed larger variability in the response latency compared to the calcarine fissure. Dynamic and spectral analyses of the latency variability indicated that the response latency in the fusiform gyrus was more variable than in the calcarine fissure between 70 ms and 200 ms after the stimulus onset and between 4 Hz and 40 Hz, respectively. The sequential processing of face information from the calcarine sulcus to the fusiform sulcus was more reliably detected based on sizes of the response variability than instants of the maximal response peaks. With two areas in the ventral visual pathway, we show that the variability in response latency across brain areas can be used to infer the sequence of cortical activity.

  10. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  11. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  12. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  13. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  14. Investigation of radiation-induced multilayered signalling response of the inflammatory pathway

    Babini, G.; Ugolini, M.; Morini, J.; Baiocco, G.; Ottolenghi, A.; Mariotti, L.; Tabarelli de Fatis, P.; Liotta, M.

    2015-01-01

    Ionising radiation exposure of cells might induce the perturbation of cell functions and, in particular, the activation or inhibition of several important pathways. This perturbation can cause the deregulation of both intra- and extra-cellular signalling cascades (such as the inflammatory pathway) and alter not only the behaviour of directly exposed cells but also the neighbouring nonirradiated ones, through the so-called bystander effect. The aim of the present work was to investigate the complex nonlinear interactions between the inflammatory pathway and other strictly interlaced signalling pathways, such as Erk1/2 and Akt/PKB, focusing on the radiation-induced perturbation of such pathways in the dose range of 0 -2 Gy. The results show how radiation affects these interconnected pathways and how confounding factors, such as the change of culture medium, can hide radiation-induced perturbations. (authors)

  15. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  17. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  18. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  19. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  20. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  1. Spliced X-box binding protein 1 couples the unfolded protein response to hexosamine biosynthetic pathway.

    Wang, Zhao V; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L; Morales, Cyndi R; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A; Rothermel, Beverly A; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P A; Ferdous, Anwarul; Gillette, Thomas G; Scherer, Philipp E; Hill, Joseph A

    2014-03-13

    The hexosamine biosynthetic pathway (HBP) generates uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Lipoxin A4, a 5-lipoxygenase pathway metabolite, modulates immune response during acute respiratory tularemia.

    Singh, Anju; Rahman, Tabassum; Bartiss, Rose; Arabshahi, Alireza; Prasain, Jeevan; Barnes, Stephen; Musteata, Florin Marcel; Sellati, Timothy J

    2017-02-01

    Respiratory infection with Francisella tularensis (Ft) is characterized by a muted, acute host response, followed by sepsis-like syndrome that results in death. Infection with Ft establishes a principally anti-inflammatory environment that subverts host-cell death programs to facilitate pathogen replication. Although the role of cytokines has been explored extensively, the role of eicosanoids in tularemia pathogenesis is not fully understood. Given that lipoxin A 4 (LXA 4 ) has anti-inflammatory properties, we investigated whether this lipid mediator affects host responses manifested early during infection. The addition of exogenous LXA 4 inhibits PGE 2 release by Ft-infected murine monocytes in vitro and diminishes apoptotic cell death. Tularemia pathogenesis was characterized in 5‑lipoxygenase-deficient (Alox5 -/- ) mice that are incapable of generating LXA 4 Increased release of proinflammatory cytokines and chemokines, as well as increased apoptosis, was observed in Alox5 -/- mice as compared with their wild-type counterparts. Alox5 -/- mice also exhibited elevated recruitment of neutrophils during the early phase of infection and increased resistance to lethal challenge. Conversely, administration of exogenous LXA 4 to Alox5 -/- mice made them more susceptible to infection thus mimicking wild-type animals. Taken together, our results suggest that 5-LO activity is a critical regulator of immunopathology observed during the acute phase of respiratory tularemia, regulating bacterial burden and neutrophil recruitment and production of proinflammatory modulators and increasing morbidity and mortality. These studies identify a detrimental role for the 5-LO-derived lipid mediator LXA 4 in Ft-induced immunopathology. Targeting this pathway may have therapeutic benefit as an adjunct to treatment with antibiotics and conventional antimicrobial peptides, which often have limited efficacy against intracellular bacteria. © Society for Leukocyte Biology.

  3. Virtual Institute of Microbial Stress and Survival: Deduction of Stress Response Pathways in Metal and Radionuclide Reducing Microorganisms

    None

    2004-04-17

    The projects application goals are to: (1) To understand bacterial stress-response to the unique stressors in metal/radionuclide contamination sites; (2) To turn this understanding into a quantitative, data-driven model for exploring policies for natural and biostimulatory bioremediation; (3) To implement proposed policies in the field and compare results to model predictions; and (4) Close the experimental/computation cycle by using discrepancies between models and predictions to drive new measurements and construction of new models. The projects science goals are to: (1) Compare physiological and molecular response of three target microorganisms to environmental perturbation; (2) Deduce the underlying regulatory pathways that control these responses through analysis of phenotype, functional genomic, and molecular interaction data; (3) Use differences in the cellular responses among the target organisms to understand niche specific adaptations of the stress and metal reduction pathways; (4) From this analysis derive an understanding of the mechanisms of pathway evolution in the environment; and (5) Ultimately, derive dynamical models for the control of these pathways to predict how natural stimulation can optimize growth and metal reduction efficiency at field sites.

  4. l-Arginine induces antioxidant response to prevent oxidative stress via stimulation of glutathione synthesis and activation of Nrf2 pathway.

    Liang, Mingcai; Wang, Zhengxuan; Li, Hui; Cai, Liang; Pan, Jianghao; He, Hongjuan; Wu, Qiong; Tang, Yinzhao; Ma, Jiapei; Yang, Lin

    2018-05-01

    Arginine is a conditionally essential amino acid. To elucidate the influence of l-arginine on the activation of endogenous antioxidant defence, male Wistar rats were orally administered daily with l-arginine at different levels of 25, 50, 100 mg/100 g body weight. After 7 and 14 days feeding, the antioxidative capacities and glutathione (GSH) contents in the plasma and in the liver were uniformly enhanced with the increasing consumption of l-arginine, whereas the oxidative stress was effectively suppressed by l-arginine treatment. After 14 days feeding, the mRNA levels and protein expressions of Keap1 and Cul3 were gradually reduced by increasing l-arginine intake, resulting that the nuclear factor Nrf2 was activated. Upon activation of Nrf2, the expressions of antioxidant responsive element (ARE)-dependent genes and proteins (GCLC, GCLM, GS, GR, GST, GPx, CAT, SOD, NQO1, HO-1) were up-regulated by l-arginine feeding, indicating an upward trend in antioxidant capacity uniformly with the increasing consumption of l-arginine. The present study demonstrates that the supplementation of l-arginine stimulates GSH synthesis and activates Nrf2 pathway, leading to the up-regulation of ARE-driven antioxidant expressions via Nrf2-Keap1 pathway. Results suggest the availability of l-arginine is a critical factor to suppress oxidative stress and induce an endogenous antioxidant response. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  6. Plant uptake of trace elements on a Swiss military shooting range: Uptake pathways and land management implications

    Robinson, Brett H. [Swiss Federal Institute of Technology (ETH), Universitaetstrasse 16, CH-8092 Zuerich (Switzerland)], E-mail: brett.robinson@env.ethz.ch; Bischofberger, Simone; Stoll, Andreas; Schroer, Dirk; Furrer, Gerhard; Roulier, Stephanie; Gruenwald, Anna; Attinger, Werner; Schulin, Rainer [Swiss Federal Institute of Technology (ETH), Universitaetstrasse 16, CH-8092 Zuerich (Switzerland)

    2008-06-15

    Over 400 tons of Pb enters Swiss soils annually at some 2000 military shooting ranges (MSRs). We measured elements in the leaves of 10 plant species and associated rhizospheric soil on the stop butt of a disused MSR. The geometric mean concentrations of Pb, Sb, Cu, Ni in rhizospheric soils were 10,171 mg/kg, 5067 mg/kg, 4125 mg/kg and 917 mg/kg. Some species contained Pb, Cu and Ni, above concentrations (30 mg/kg, 25 mg/kg and 50 mg/kg) shown to be toxic to livestock. Most contaminants in leaves resulted from surface deposition. However, at soil Pb concentrations >60,000 mg/kg, Equisetum arvense and Tussilago farfara took up >1000 mg/kg Pb into the leaves. These plants are not hyperaccumulators, having <100 mg/kg Pb in leaves at lower soil concentrations. Removal of soil with more than 30,000 Pb, from which one could smelt this metal to offset remediation costs, followed by revegetation, would minimise dust and hence leaf-borne contaminants. - Establishment of a complete vegetation cover on shooting ranges would reduce the contamination of plant leaves by toxic trace elements.

  7. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  8. Proteomics and pathway analysis of N-glycosylated mammary gland proteins in response to Escherichia coli mastitis in cattle.

    Yang, Yongxin; Shen, Weijun; Zhao, Xiaowei; Zhao, Huiling; Huang, Dongwei; Cheng, Guanglong

    2014-06-01

    The aim of this study was to investigate the N-linked glycosylated protein profile of mammary tissue from healthy cows and cows with mastitis due to Escherichia coli, in order to understand the molecular mechanisms of the host response to mastitis. N-glycopeptides were enriched with a lectin mixture and identified through high-accuracy mass spectrometry. A total of 551 N-glycosylation sites, corresponding to 294 proteins, were identified in the mammary tissues of healthy cows; these glycoproteins were categorised into three functional groups and clustered into 11 specific pathways. A total of 511 N-glycosylation sites, corresponding to 283 glycosylated proteins, were detected in the mammary tissues of cows with E. coli mastitis. There were differences in N-glycosylation sites in 98 proteins in the mammary tissues of healthy cows and cows with mastitis due to E. coli. Most proteins with altered glycosylation were those involved in responses to stress, cell adhesion and the immune response, and were assigned to five specific pathways based on their gene ontology annotation. The results from this study show that the glycosylated protein profile in the mammary tissues of healthy and mastitic cows are different, and altered glycoproteins are associated with several pathways, including the lysosome and O-glycan biosynthesis pathways. Copyright © 2014. Published by Elsevier Ltd.

  9. Transcriptome analysis shows activation of the arginine deiminase pathway in Lactococcus lactis as a response to ethanol stress.

    Díez, Lorena; Solopova, Ana; Fernández-Pérez, Rocío; González, Miriam; Tenorio, Carmen; Kuipers, Oscar P; Ruiz-Larrea, Fernanda

    2017-09-18

    This paper describes the molecular response of Lactococcus lactis NZ9700 to ethanol. This strain is a well-known nisin producer and a lactic acid bacteria (LAB) model strain. Global transcriptome profiling using DNA microarrays demonstrated a bacterial adaptive response to the presence of 2% ethanol in the culture broth and differential expression of 67 genes. The highest up-regulation was detected for those genes involved in arginine degradation through the arginine deiminase (ADI) pathway (20-40 fold up-regulation). The metabolic responses to ethanol of wild type L. lactis strains were studied and compared to those of regulator-deletion mutants MG∆argR and MG∆ahrC. The results showed that in the presence of 2% ethanol those strains with an active ADI pathway reached higher growth rates when arginine was available in the culture broth than in absence of arginine. In a chemically defined medium strains with an active ADI pathway consumed arginine and produced ornithine in the presence of 2% ethanol, hence corroborating that arginine catabolism is involved in the bacterial response to ethanol. This is the first study of the L. lactis response to ethanol stress to demonstrate the relevance of arginine catabolism for bacterial adaptation and survival in an ethanol containing medium. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  11. Role of the Antigen Capture Pathway in the Induction of a Neutralizing Antibody Response to Anthrax Protective Antigen

    Anita Verma

    2018-02-01

    Full Text Available Toxin neutralizing antibodies represent the major mode of protective immunity against a number of toxin-mediated bacterial diseases, including anthrax; however, the cellular mechanisms that lead to optimal neutralizing antibody responses remain ill defined. Here we show that the cellular binding pathway of anthrax protective antigen (PA, the binding component of anthrax toxin, determines the toxin neutralizing antibody response to this antigen. PA, which binds cellular receptors and efficiently enters antigen-presenting cells by receptor-mediated endocytosis, was found to elicit robust anti-PA IgG and toxin neutralizing antibody responses. In contrast, a receptor binding-deficient mutant of PA, which does not bind receptors and only inefficiently enters antigen-presenting cells by macropinocytosis, elicited very poor antibody responses. A chimeric protein consisting of the receptor binding-deficient PA mutant tethered to the binding subunit of cholera toxin, which efficiently enters cells using the cholera toxin receptor rather than the PA receptor, elicited an anti-PA IgG antibody response similar to that elicited by wild-type PA; however, the chimeric protein elicited a poor toxin neutralizing antibody response. Taken together, our results demonstrate that the antigen capture pathway can dictate the magnitudes of the total IgG and toxin neutralizing antibody responses to PA as well as the ratio of the two responses.

  12. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  13. Intermittent fasting could ameliorate cognitive function against distress by regulation of inflammatory response pathway

    Marjan Shojaie

    2017-11-01

    Full Text Available Undesirable and desirable effects of stressors on the body are assigned to distress and eustress, respectively. Immune system and brain are the most susceptible parts to stressful conditions, whereas long-lasting alterations in putative immune proteins involved in tension such as corticosterone (CORT, interleukin 6 (IL-6, and tumor necrosis factor-alpha (TNF-α can impact learning and memory. Intermittent fasting (IF is a repeated regular cycle of dietary restriction with well-known beneficial properties on the body. The aim of this study was to identify the eustress effects of IF on cognitive function by assessing the critical inflammatory factors in chronic distress. Forty male mice were divided into four groups (n = 10/group. Distress and control normally received food and water, whereas IF and IF with distress groups were daily deprived of food and water for two hours. In the second week, the electrical foot shock was induced to distress and IF with distress groups. Finally, the cognitive functions of all mice were evaluated by Barnes maze, their blood samples were taken to determine the plasma level of CORT, IL-6 and TNF-α, and the removed brain and adrenal glands were weighed in the third week. A significant gain in plasma level of CORT, IL-6 and TNF-α with a considerable brain hypotrophy and adrenal hypertrophy was found in distress group, whereas IF caused a remarkable reduction of the plasma inflammatory factors, especially in IF with distress mice (P ≤ 0.05. In conclusion, IF could improve cognitive function and preserve the brain against distress by regulation of inflammatory response pathway.

  14. Intermittent fasting could ameliorate cognitive function against distress by regulation of inflammatory response pathway.

    Shojaie, Marjan; Ghanbari, Farzane; Shojaie, Nasrin

    2017-11-01

    Undesirable and desirable effects of stressors on the body are assigned to distress and eustress, respectively. Immune system and brain are the most susceptible parts to stressful conditions, whereas long-lasting alterations in putative immune proteins involved in tension such as corticosterone (CORT), interleukin 6 (IL-6), and tumor necrosis factor-alpha (TNF-α) can impact learning and memory. Intermittent fasting (IF) is a repeated regular cycle of dietary restriction with well-known beneficial properties on the body. The aim of this study was to identify the eustress effects of IF on cognitive function by assessing the critical inflammatory factors in chronic distress. Forty male mice were divided into four groups (n = 10/group). Distress and control normally received food and water, whereas IF and IF with distress groups were daily deprived of food and water for two hours. In the second week, the electrical foot shock was induced to distress and IF with distress groups. Finally, the cognitive functions of all mice were evaluated by Barnes maze, their blood samples were taken to determine the plasma level of CORT, IL-6 and TNF-α, and the removed brain and adrenal glands were weighed in the third week. A significant gain in plasma level of CORT, IL-6 and TNF-α with a considerable brain hypotrophy and adrenal hypertrophy was found in distress group, whereas IF caused a remarkable reduction of the plasma inflammatory factors, especially in IF with distress mice ( P  ≤ 0.05). In conclusion, IF could improve cognitive function and preserve the brain against distress by regulation of inflammatory response pathway.

  15. Responses of the insulin signaling pathways in the brown adipose tissue of rats following cold exposure.

    Wang, Xiaofei; Wahl, Richard

    2014-01-01

    The insulin signaling pathway is critical for the control of blood glucose levels. Brown adipose tissue (BAT) has also been implicated as important in glucose homeostasis. The effect of short-term cold exposure on this pathway in BAT has not been explored. We evaluated the effect of 4 hours of cold exposure on the insulin pathway in the BAT of rats. Whole genomic microarray chips were used to examine the transcripts of the pathway in BAT of rats exposed to 4°C and 22°C for 4 hours. The 4 most significantly altered pathways following 4 hours of cold exposure were the insulin signaling pathway, protein kinase A, PI3K/AKT and ERK/MAPK signaling. The insulin signaling pathway was the most affected. In the documented 142 genes of the insulin pathway, 42 transcripts (29.6%) responded significantly to this cold exposure with the least false discovery rate (Benjamini-Hochberg Multiple Testing: -log10 (p-value)  = 7.18). Twenty-seven genes (64%) were up-regulated, including the insulin receptor (Insr), insulin substrates 1 and 2 (Irs1 and Irs2). Fifteen transcripts (36%) were down-regulated. Multiple transcripts of the primary target and secondary effector targets for the insulin signaling were also up-regulated, including those for carbohydrate metabolism. Using western blotting, we demonstrated that the cold induced higher Irs2, Irs1, and Akt-p protein levels in the BAT than in the BAT of controls maintained at room temperature, and higher Akt-p protein level in the muscle. this study demonstrated that 4 hours of cold exposure stimulated the insulin signaling pathway in the BAT and muscle of overnight fasted rats. This raises the possibility that acute cold stimulation may have potential to improve glucose clearance and insulin sensitivity.

  16. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  17. Retinoblastoma pathway defects show differential ability to activate the constitutive DNA damage response in human tumorigenesis

    Tort, F.; Bartkova, J.; Sehested, M.

    2006-01-01

    culture models with differential defects of retinoblastoma pathway components, as overexpression of cyclin D1 or lack of p16(Ink4a), either alone or combined, did not elicit detectable DDR. In contrast, inactivation of pRb, the key component of the pathway, activated the DDR in cultured human or mouse...... with their hierarchical positions along the retinoblastoma pathway. Our data provide new insights into oncogene-evoked DDR in human tumorigenesis, with potential implications for individualized management of tumors with elevated cyclin D1 versus cyclin E, due to their distinct clinical variables and biological behavior....

  18. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  19. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  20. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  1. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  2. Computation of restoration of ligand response in the random kinetics of a prostate cancer cell signaling pathway.

    Dana, Saswati; Nakakuki, Takashi; Hatakeyama, Mariko; Kimura, Shuhei; Raha, Soumyendu

    2011-01-01

    Mutation and/or dysfunction of signaling proteins in the mitogen activated protein kinase (MAPK) signal transduction pathway are frequently observed in various kinds of human cancer. Consistent with this fact, in the present study, we experimentally observe that the epidermal growth factor (EGF) induced activation profile of MAP kinase signaling is not straightforward dose-dependent in the PC3 prostate cancer cells. To find out what parameters and reactions in the pathway are involved in this departure from the normal dose-dependency, a model-based pathway analysis is performed. The pathway is mathematically modeled with 28 rate equations yielding those many ordinary differential equations (ODE) with kinetic rate constants that have been reported to take random values in the existing literature. This has led to us treating the ODE model of the pathways kinetics as a random differential equations (RDE) system in which the parameters are random variables. We show that our RDE model captures the uncertainty in the kinetic rate constants as seen in the behavior of the experimental data and more importantly, upon simulation, exhibits the abnormal EGF dose-dependency of the activation profile of MAP kinase signaling in PC3 prostate cancer cells. The most likely set of values of the kinetic rate constants obtained from fitting the RDE model into the experimental data is then used in a direct transcription based dynamic optimization method for computing the changes needed in these kinetic rate constant values for the restoration of the normal EGF dose response. The last computation identifies the parameters, i.e., the kinetic rate constants in the RDE model, that are the most sensitive to the change in the EGF dose response behavior in the PC3 prostate cancer cells. The reactions in which these most sensitive parameters participate emerge as candidate drug targets on the signaling pathway. 2011 Elsevier Ireland Ltd. All rights reserved.

  3. Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora.

    Norman-Setterblad, C; Vidal, S; Palva, E T

    2000-04-01

    We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.

  4. Taxonomic and functional diversity provides insight into microbial pathways and stress responses in the saline Qinghai Lake, China.

    Qiuyuan Huang

    Full Text Available Microbe-mediated biogeochemical cycles contribute to the global climate system and have sensitive responses and feedbacks to environmental stress caused by climate change. Yet, little is known about the effects of microbial biodiversity (i.e., taxonmic and functional diversity on biogeochemical cycles in ecosytems that are highly sensitive to climate change. One such sensitive ecosystem is Qinghai Lake, a high-elevation (3196 m saline (1.4% lake located on the Tibetan Plateau, China. This study provides baseline information on the microbial taxonomic and functional diversity as well as the associated stress response genes. Illumina metagenomic and metatranscriptomic datasets were generated from lake water samples collected at two sites (B and E. Autotrophic Cyanobacteria dominated the DNA samples, while heterotrophic Proteobacteria dominated the RNA samples at both sites. Photoheterotrophic Loktanella was also present at both sites. Photosystem II was the most active pathway at site B; while, oxidative phosphorylation was most active at site E. Organisms that expressed photosystem II or oxidative phosphorylation also expressed genes involved in photoprotection and oxidative stress, respectively. Assimilatory pathways associated with the nitrogen cycle were dominant at both sites. Results also indicate a positive relationship between functional diversity and the number of stress response genes. This study provides insight into the stress resilience of microbial metabolic pathways supported by greater taxonomic diversity, which may affect the microbial community response to climate change.

  5. Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.

    Kitazono, Tomohiro; Hara-Kuge, Sayuri; Matsuda, Osamu; Inoue, Akitoshi; Fujiwara, Manabi; Ishihara, Takeshi

    2017-10-18

    Forgetting memories is important for animals to properly respond to continuously changing environments. To elucidate the mechanisms of forgetting, we used one of the behavioral plasticities of Caenorhabditis elegans hermaphrodite, olfactory adaptation to an attractive odorant, diacetyl, as a simple model of learning. In C. elegans, the TIR-1/JNK-1 pathway accelerates forgetting of olfactory adaptation by facilitating neural secretion from AWC sensory neurons. In this study, to identify the downstream effectors of the TIR-1/JNK-1 pathway, we conducted a genetic screen for suppressors of the gain-of-function mutant of tir-1 ( ok1052 ), which shows excessive forgetting. Our screening showed that three proteins-a membrane protein, MACO-1; a receptor tyrosine kinase, SCD-2; and its putative ligand, HEN-1-regulated forgetting downstream of the TIR-1/JNK-1 pathway. We further demonstrated that MACO-1 and SCD-2/HEN-1 functioned in parallel genetic pathways, and only MACO-1 regulated forgetting of olfactory adaptation to isoamyl alcohol, which is an attractive odorant sensed by different types of sensory neurons. In olfactory adaptation, odor-evoked Ca 2+ responses in olfactory neurons are attenuated by conditioning and recovered thereafter. A Ca 2+ imaging study revealed that this attenuation is sustained longer in maco-1 and scd-2 mutant animals than in wild-type animals like the TIR-1/JNK-1 pathway mutants. Furthermore, temporal silencing by histamine-gated chloride channels revealed that the neuronal activity of AWC neurons after conditioning is important for proper forgetting. We propose that distinct signaling pathways, each of which has a specific function, may coordinately and temporally regulate forgetting by controlling sensory responses. SIGNIFICANCE STATEMENT Active forgetting is an important process to understand the whole mechanisms of memories. Recent papers have reported that the noncell autonomous regulations are required for proper forgetting in

  6. Effective connectivity reveals important roles for both the hyperdirect (fronto-subthalamic) and indirect (fronto-striatal-pallidal) fronto-basal ganglia pathways during response inhibition

    Jahfari, S.; Waldorp, L.; van den Wildenberg, W.P.M.; Scholte, H.S.; Ridderinkhof, K.R.; Forstmann, B.U.

    2011-01-01

    Fronto-basal ganglia pathways play a crucial role in voluntary action control, including the ability to inhibit motor responses. Response inhibition might be mediated via a fast hyperdirect pathway connecting the right inferior frontal gyrus (rIFG) and the presupplementary motor area (preSMA) with

  7. Training signaling pathway maps to biochemical data with constrained fuzzy logic: quantitative analysis of liver cell responses to inflammatory stimuli.

    Melody K Morris

    2011-03-01

    Full Text Available Predictive understanding of cell signaling network operation based on general prior knowledge but consistent with empirical data in a specific environmental context is a current challenge in computational biology. Recent work has demonstrated that Boolean logic can be used to create context-specific network models by training proteomic pathway maps to dedicated biochemical data; however, the Boolean formalism is restricted to characterizing protein species as either fully active or inactive. To advance beyond this limitation, we propose a novel form of fuzzy logic sufficiently flexible to model quantitative data but also sufficiently simple to efficiently construct models by training pathway maps on dedicated experimental measurements. Our new approach, termed constrained fuzzy logic (cFL, converts a prior knowledge network (obtained from literature or interactome databases into a computable model that describes graded values of protein activation across multiple pathways. We train a cFL-converted network to experimental data describing hepatocytic protein activation by inflammatory cytokines and demonstrate the application of the resultant trained models for three important purposes: (a generating experimentally testable biological hypotheses concerning pathway crosstalk, (b establishing capability for quantitative prediction of protein activity, and (c prediction and understanding of the cytokine release phenotypic response. Our methodology systematically and quantitatively trains a protein pathway map summarizing curated literature to context-specific biochemical data. This process generates a computable model yielding successful prediction of new test data and offering biological insight into complex datasets that are difficult to fully analyze by intuition alone.

  8. Objective assessment of chromatic and achromatic pattern adaptation reveals the temporal response properties of different visual pathways.

    Robson, Anthony G; Kulikowski, Janus J

    2012-11-01

    The aim was to investigate the temporal response properties of magnocellular, parvocellular, and koniocellular visual pathways using increment/decrement changes in contrast to elicit visual evoked potentials (VEPs). Static achromatic and isoluminant chromatic gratings were generated on a monitor. Chromatic gratings were modulated along red/green (R/G) or subject-specific tritanopic confusion axes, established using a minimum distinct border criterion. Isoluminance was determined using minimum flicker photometry. Achromatic and chromatic VEPs were recorded to contrast increments and decrements of 0.1 or 0.2 superimposed on the static gratings (masking contrast 0-0.6). Achromatic increment/decrement changes in contrast evoked a percept of apparent motion when the spatial frequency was low; VEPs to such stimuli were positive in polarity and largely unaffected by high levels of static contrast, consistent with transient response mechanisms. VEPs to finer achromatic gratings showed marked attenuation as static contrast was increased. Chromatic VEPs to R/G or tritan chromatic contrast increments were of negative polarity and showed progressive attenuation as static contrast was increased, in keeping with increasing desensitization of the sustained responses of the color-opponent visual pathways. Chromatic contrast decrement VEPs were of positive polarity and less sensitive to pattern adaptation. The relative contribution of sustained/transient mechanisms to achromatic processing is spatial frequency dependent. Chromatic contrast increment VEPs reflect the sustained temporal response properties of parvocellular and koniocellular pathways. Cortical VEPs can provide an objective measure of pattern adaptation and can be used to probe the temporal response characteristics of different visual pathways.

  9. Adenosine Triphosphate (ATP Is a Candidate Signaling Molecule in the Mitochondria-to-Nucleus Retrograde Response Pathway

    Zhengchang Liu

    2013-03-01

    Full Text Available Intracellular communication from the mitochondria to the nucleus is achieved via the retrograde response. In budding yeast, the retrograde response, also known as the RTG pathway, is regulated positively by Rtg1, Rtg2, Rtg3 and Grr1 and negatively by Mks1, Lst8 and two 14-3-3 proteins, Bmh1/2. Activation of retrograde signaling leads to activation of Rtg1/3, two basic helix-loop-helix leucine zipper transcription factors. Rtg1/3 activation requires Rtg2, a cytoplasmic protein with an N-terminal adenosine triphosphate (ATP binding domain belonging to the actin/Hsp70/sugar kinase superfamily. The critical regulatory step of the retrograde response is the interaction between Rtg2 and Mks1. Rtg2 binds to and inactivates Mks1, allowing for activation of Rtg1/3 and the RTG pathway. When the pathway is inactive, Mks1 has dissociated from Rtg2 and bound to Bmh1/2, preventing activation of Rtg1/3. What signals association or disassociation of Mks1 and Rtg2 is unknown. Here, we show that ATP at physiological concentrations dissociates Mks1 from Rtg2 in a highly cooperative fashion. We report that ATP-mediated dissociation of Mks1 from Rtg2 is conserved in two other fungal species, K. lactis and K. waltii. Activation of Rtg1/3 upregulates expression of genes encoding enzymes catalyzing the first three reactions of the Krebs cycle, which is coupled to ATP synthesis through oxidative phosphorylation. Therefore, we propose that the retrograde response is an ATP homeostasis pathway coupling ATP production with ATP-mediated repression of the retrograde response by releasing Mks1 from Rtg2.

  10. Commercial African Catfish (Clarias gariepinus Recirculating Aquaculture Systems: Assessment of Element and Energy Pathways with Special Focus on the Phosphorus Cycle

    Sebastian Marcus Strauch

    2018-05-01

    Full Text Available The reuse of effluent waters and sediments from African catfish (Clarias gariepinus recirculation aquaculture systems requires a deeper understanding of the nutrient and energy flows and material pathways. Three semi-commercial systems, differing in stocking density, were sampled for nutritive and pollutant elements of the input- (tap water, feed and output pathways (fillet, carcass, process water, sediments by ICP-OES/MS and calorimetry. Highly water-soluble elements, e.g., potassium, accumulated in the water, whereas iron, copper, chromium and uranium where found in the solids. Feed derived phosphorous was accounted for, 58.3–64.2% inside the fish, 9.7–19.3% in sediments, and small amounts 9.6–15.5% in the process waters. A total of 7.1–9.9% of the feed accumulated as dry matter in the sediments, comprising 5.5–8.7% total organic carbon and 3.7–5.2% nitrogen. A total of 44.5–47.1% of the feed energy was found in the fish and 5.7–7.7% in the sediments. For reuse of water and nutrients in hydroponics, the macro-nutrients potassium, nitrate, phosphorus and the micro-nutrient iron were deficient when compared with generalized recommendations for plant nutrition. Low energy contents and C/N-ratio restrict the solely use of African catfish solids for biogas production or vermiculture. Using the outputs both for biogas supplement and general fertilizer in aquaponics farming (s.l. (combined with additional nutrients appears possible.

  11. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  12. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  13. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  14. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  16. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  17. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  18. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  19. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  20. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  1. Delineation of glutamate pathways and secretory responses in pancreatic islets with ß-cell-specific abrogation of the glutamate dehydrogenase

    Vetterli, Laurene; Carobbio, Stefania; Pournourmohammadi, Shirin

    2012-01-01

    isolated from βGlud1(-/-) mice exhibited half of the response measured in control islets. The amplifying pathway, tested at stimulatory glucose concentrations in the presence of KCl and diazoxide, was markedly inhibited in βGlud1(-/-) islets. On glucose stimulation, net synthesis of glutamate from α......-ketoglutarate was impaired in GDH-deficient islets. Accordingly, glucose-induced elevation of glutamate levels observed in control islets was absent in βGlud1(-/-) islets. Parallel biochemical pathways, namely alanine and aspartate aminotransferases, could not compensate for the lack of GDH. However, the secretory response...... to glucose was fully restored by the provision of cellular glutamate when βGlud1(-/-) islets were exposed to dimethyl glutamate. This shows that permissive levels of glutamate are required for the full development of glucose-stimulated insulin secretion and that GDH plays an indispensable role...

  2. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  3. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  4. Protein Profiles Reveal Diverse Responsive Signaling Pathways in Kernels of Two Maize Inbred Lines with Contrasting Drought Sensitivity

    Liming Yang

    2014-10-01

    Full Text Available Drought stress is a major factor that contributes to disease susceptibility and yield loss in agricultural crops. To identify drought responsive proteins and explore metabolic pathways involved in maize tolerance to drought stress, two maize lines (B73 and Lo964 with contrasting drought sensitivity were examined. The treatments of drought and well water were applied at 14 days after pollination (DAP, and protein profiles were investigated in developing kernels (35 DAP using iTRAQ (isobaric tags for relative and absolute quantitation. Proteomic analysis showed that 70 and 36 proteins were significantly altered in their expression under drought treatments in B73 and Lo964, respectively. The numbers and levels of differentially expressed proteins were generally higher in the sensitive genotype, B73, implying an increased sensitivity to drought given the function of the observed differentially expressed proteins, such as redox homeostasis, cell rescue/defense, hormone regulation and protein biosynthesis and degradation. Lo964 possessed a more stable status with fewer differentially expressed proteins. However, B73 seems to rapidly initiate signaling pathways in response to drought through adjusting diverse defense pathways. These changes in protein expression allow for the production of a drought stress-responsive network in maize kernels.

  5. HMGB1 induces an inflammatory response in endothelial cells via the RAGE-dependent endoplasmic reticulum stress pathway

    Luo, Ying; Li, Shu-Jun; Yang, Jian; Qiu, Yuan-Zhen; Chen, Fang-Ping

    2013-01-01

    Highlights: •Mechanisms of inflammatory response induced by HMGB1 are incompletely understood. •We found that endoplasmic reticulum stress mediate the inflammatory response induced by HMGB1. •RAGE-mediated ERS pathways are involved in those processes. •We reported a new mechanism for HMGB1 induced inflammatory response. -- Abstract: The high mobility group 1B protein (HMGB1) mediates chronic inflammatory responses in endothelial cells, which play a critical role in atherosclerosis. However, the underlying mechanism is unknown. The goal of our study was to identify the effects of HMGB1 on the RAGE-induced inflammatory response in endothelial cells and test the possible involvement of the endoplasmic reticulum stress pathway. Our results showed that incubation of endothelial cells with HMGB1 (0.01–1 μg/ml) for 24 h induced a dose-dependent activation of endoplasmic reticulum stress transducers, as assessed by PERK and IRE1 protein expression. Moreover, HMGB1 also promoted nuclear translocation of ATF6. HMGB1-mediated ICAM-1 and P-selectin production was dramatically suppressed by PERK siRNA or IRE1 siRNA. However, non-targeting siRNA had no such effects. HMGB1-induced increases in ICAM-1 and P-selectin expression were also inhibited by a specific eIF2α inhibitor (salubrinal) and a specific JNK inhibitor (SP600125). Importantly, a blocking antibody specifically targeted against RAGE (anti-RAGE antibody) decreased ICAM-1, P-selectin and endoplasmic reticulum stress molecule (PERK, eIF2α, IRE1 and JNK) protein expression levels. Collectively, these novel findings suggest that HMGB1 promotes an inflammatory response by inducing the expression of ICAM-1 and P-selectin via RAGE-mediated stimulation of the endoplasmic reticulum stress pathway

  6. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  7. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  8. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways

    Vavitsas, Konstantinos; Rue, Emil Østergaard; Stefánsdóttir, Lára Kristín

    2017-01-01

    BACKGROUND: There are an increasing number of studies regarding genetic manipulation of cyanobacteria to produce commercially interesting compounds. The majority of these works study the expression and optimization of a selected heterologous pathway, largely ignoring the wholeness and complexity...... different compounds, the cyanogenic glucoside dhurrin and the diterpenoid 13R-manoyl oxide in Synechocystis PCC 6803. We used genome-scale metabolic modelling to study fluxes in individual reactions and pathways, and we determined the concentrations of key metabolites, such as amino acids, carotenoids...

  9. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  10. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  11. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  12. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  13. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  14. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  15. Repeated allergen exposure reduce early phase airway response and leukotriene release despite upregulation of 5-lipoxygenase pathways

    Cui Zhi-Hua

    2012-03-01

    Full Text Available Abstract Background Allergen induced early phase airway response and airway plasma exudation are predominantly mediated by inflammatory mast cell mediators including histamine, cysteinyl leukotrienes (cysLTs and thromboxane A2 (TXA2. The aim of the present study was to evaluate whether repeated allergen exposure affects early phase airway response to allergen challenge. Methods A trimellitic anhydride (TMA sensitized guinea pig model was used to investigate the effects of low dose repeated allergen exposure on cholinergic airway responsiveness, early phase airway response and plasma exudation, as well as local airway production of mast cell derived cysteinyl leukotrienes and thromboxane B2 (TXB2 after allergen challenge. Results Repeated low dose allergen exposure increased cholinergic airway responsiveness. In contrast, early phase airway response and plasma exudation in response to a high-dose allergen challenge were strongly attenuated after repeated low dose allergen exposure. Inhibition of the airway response was unspecific to exposed allergen and independent of histamine receptor blocking. Furthermore, a significant reduction of cysteinyl leukotrienes and TXB2 was found in the airways of animals repeatedly exposed to a low dose allergen. However, in vitro stimulation of airway tissue from animals repeatedly exposed to a low dose allergen with arachidonic acid and calcium ionophore (A23187 induced production of cysteinyl leukotrienes and TXB2, suggesting enhanced activity of 5-lipoxygenase and cyclooxygenase pathways. Conclusions The inhibition of the early phase airway response, cysteinyl leukotriene and TXB2 production after repeated allergen exposure may result from unresponsive effector cells.

  16. Identifying parasitic current pathways in CIGS solar cells by modelling dark J-V response

    Williams, B.L.; Smit, S.; Kniknie, B.J.; Bakker, K.J.; Keuning, W.; Kessels, W.M.M.; Schropp, R.E.I.; Creatore, M.

    2015-01-01

    An equivalent circuit model, which allows for the presence of three types of shunting pathways, has been developed to describe the dark J-V characteristics in CIGS solar cells. Excellent agreement between the model and experimental data was apparent throughout a temperature range of 183-323K.

  17. Aging causes decreased resistance to multiple stresses and a failure to activate specific stress response pathways

    Dues, Dylan J.; Andrews, Emily K.; Schaar, Claire E.; Bergsma, Alexis L.; Senchuk, Megan M.; Van Raamsdonk, Jeremy M.

    2016-01-01

    In this work, we examine the relationship between stress resistance and aging. We find that resistance to multiple types of stress peaks during early adulthood and then declines with age. To dissect the underlying mechanisms, we use C. elegans transcriptional reporter strains that measure the activation of different stress responses including: the heat shock response, mitochondrial unfolded protein response, endoplasmic reticulum unfolded protein response, hypoxia response, SKN-1-mediated oxi...

  18. The urban and community health pathway: preparing socially responsive physicians through community-engaged learning.

    Meurer, Linda N; Young, Staci A; Meurer, John R; Johnson, Sheri L; Gilbert, Ileen A; Diehr, Sabina

    2011-10-01

    One of five options for the new required Medical College of Wisconsin Pathways program, the Urban and Community Health Pathway (UCHP), links training with community needs and assets to prepare students with the knowledge, skills, and attitudes to provide effective care in urban, underserved settings; promote community health; and reduce health disparities. Students spend at least 10 hours per month on pathway activities: 4 hours of core material delivered through readings, didactics, case discussions, and site visits; and at least 6 hours of experiential noncore activities applying core competencies, guided by an Individualized Learning Plan and faculty advisor. Noncore activities include community-engaged research, service-learning activities or other relevant experiences, and submission of a synthesis paper addressing pathway competencies. The first cohort of students began their pathways in January 2010. Of 560 participating students, 95 (of which 48 were first-year, 21 second-year, and 26 third-year students) selected UCHP. Core sessions focused on public health, social determinants, cultural humility, poverty, the local healthcare system, and safety net. During noncore time, students engaged in projects addressing homelessness, obesity, advocacy, Hmong and Latino health, HIV, asthma, and violence prevention. Students enjoyed working with peers across classes and favored interactive, community-based sessions over didactics in the classroom. Students' papers reflected a range of service and scholarly activities and a deepened appreciation of social and economic influences on health. The UCHP enriches the traditional curriculum with individualized, community-based experiences to build knowledge about health determinants and skills in partnering with communities to improve health. Copyright © 2011 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  19. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  20. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  1. Deconvolution of trace element (As, Cr, Mo, Th, U) sources and pathways to surface waters of a gold mining-influenced watershed.

    Grosbois, C; Schäfer, J; Bril, H; Blanc, G; Bossy, A

    2009-03-01

    The Upper Isle River (SW France) drains the second most productive gold-mining district of France. A high resolution survey during one hydrological year of As, Cl(-), Cr, Fe, Mn, Mo, SO(4)(2-), Th and U dissolved concentrations in surface water aimed to better understand pathways of trace element export to the river system downstream from the mining district. Dissolved concentrations of As (up to 35000 ng/L) and Mo (up to 292 ng/L) were about 3-fold higher than the regional dissolved background and showed a negative logarithmic relation with discharge. Dissolved concentrations of Cr (up to 483 ng/L), Th (up to 48 ng/L) and U (up to 184 ng/L) increased with discharge. Geochemical relationships between molar ratios in surface water, geochemical background as well as rain- and groundwater data were combined. The contrasting behavior of distinct element groups was explained by a scenario involving three seasonal components: (i) The high flow component is poorly concentrated in As and Mo but highly concentrated in Cr, Th, U. This has been attributed to diffuse sources such as water-soil interactions, atmospheric inputs, bedrock and bed sediment weathering. Although this component probably also includes a contribution by weathering of sulfide veins, this signal is masked by dilution. (ii) One low flow component presents high SO(4)(2-), Fe, As and Mo and moderate Cr, Th and U concentrations. This component has been attributed to point sources such as mine gallery effluents, mining waste weathering and groundwater inputs from natural and/or mining-induced sulfide oxidation in the ore deposit. (iii) A second low flow component showing high As plus Mo concentrations associated with very low SO(4)(2-), Fe, Cr, Th and U concentrations, probably reflects trace element scavenging by ferric oxyhydroxide formation in the adjacent aquifer. This is supported by the decrease of Fe, Cr, Th and U in surface waters. Flux estimates suggest contrasting element-specific impacts on annual

  2. Prunus domestica pathogenesis-related protein-5 activates the defense response pathway and enhances the resistance to fungal infection.

    Ashraf El-kereamy

    Full Text Available Pathogenesis-related protein-5 (PR-5 has been implicated in plant disease resistance and its antifungal activity has been demonstrated in some fruit species. However, their roles, especially their interactions with the other defense responses in plant cells, are still not fully understood. In this study, we have cloned and characterized a new PR-5 cDNA named PdPR5-1 from the European plum (Prunus domestica. Expression of PdPR5-1 was studied in different cultivars varying in resistance to the brown rot disease caused by the necrotrophic fungus Monilinia fructicola. In addition transgenic Arabidopsis, ectopically expressing PdPR5-1 was used to study its role in other plant defense responses after fungal infection. We show that the resistant cultivars exhibited much higher levels of transcripts than the susceptible cultivars during fruit ripening. However, significant rise in the transcript levels after infection with M. fructicola was observed in the susceptible cultivars too. Transgenic Arabidopsis plants exhibited more resistance to Alternaria brassicicola. Further, there was a significant increase in the transcripts of genes involved in the phenylpropanoid biosynthesis pathway such as phenylalanine ammonia-lyase (PAL and phytoalexin (camalexin pathway leading to an increase in camalexin content after fungal infection. Our results show that PdPR5-1 gene, in addition to its anti-fungal properties, has a possible role in activating other defense pathways, including phytoalexin production.

  3. Response of the JAK-STAT signaling pathway to oxygen deprivation in the red eared slider turtle, Trachemys scripta elegans.

    Bansal, Saumya; Biggar, Kyle K; Krivoruchko, Anastasia; Storey, Kenneth B

    2016-11-15

    The red-eared slider turtle, Trachemys scripta elegans, is a model organism commonly used to study the environmental stress of anoxia. It exhibits multiple biochemical adaptations to ensure its survival during the winter months where quantities of oxygen are largely depleted. We proposed that JAK-STAT signaling would display stress responsive regulation to mediate the survival of the red-eared slider turtle, Trachemys scripta elegans, during anoxic stress. Importantly, the JAK-STAT signaling pathway is involved in transmitting extracellular signals to the nucleus resulting in the expression of select genes that aid cell survival and growth. Immunoblotting was used to compare the relative phosphorylation levels of JAK proteins, STAT proteins, and two of its inhibitors, SOCS and PIAS, in response to anoxia. A clear activation of the JAK-STAT pathway was observed in the liver tissue while no significant changes were found in the skeletal muscle. To further support our findings we also found an increase in mRNA transcripts of downstream targets of STATs, namely bcl-xL and bcl-2, using PCR analysis in the liver tissues. These findings suggest an important role for the JAK-STAT pathway in exhibiting natural anoxia tolerance by the red-eared slider turtle. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  5. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  6. Response of tobacco to the Pseudomonas syringae pv. Tomato DC3000 is mainly dependent on salicylic acid signaling pathway.

    Liu, Yang; Wang, Li; Cai, Guohua; Jiang, Shanshan; Sun, Liping; Li, Dequan

    2013-07-01

    Pseudomonas syringae pv. Tomato DC3000 (Pst DC3000) was the first pathogen to be demonstrated to infect Arabidopsis and to cause disease symptoms in the laboratory setting. However, the defense response to Pst DC3000 was unclear in tobacco. In this report, the expression profiles of twelve defense response-related genes were analyzed after treatment with salicylic acid (SA), jasmonic acid (JA), and pathogen Pst DC3000 by qRT-PCR. According to our results, it could be presented that the genes primarily induced by SA were also induced to higher levels after Pst DC3000 infection. SA accumulation could be induced to a higher level than that of JA after Pst DC3000 infection. In addition, SA could result in hypersensitive response (HR), which did not completely depend on accumulation of reactive oxygen species. These results indicated that tobacco mainly depended on SA signaling pathway rather than on JA signaling pathway in response to Pst DC3000. Further study demonstrated that JA could significantly inhibit the accumulation of SA and the generation of the HR induced by Pst DC3000. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  7. Which downstream signal transduction pathway(s) of H-ras are necessary for the cellular response(s) to ionizing radiation? (Results of an astro research fellowship year)

    Rudoltz, Marc S.; Muschel, Ruth J.; McKenna, W. Gillies

    1996-01-01

    Purpose/Background: The H-ras oncogene encodes a protein which is an essential component of multiple downstream effector pathways required for induction of proliferation and differentiation. Ras plays a role in the control some of these signal transduction pathways, such as the MAP kinase pathway which controls gene expression and the Rac-Rho pathway which controls cell morphology. Previous work from our laboratory has associated H-ras expression with radiation resistance, a prolonged delay in G2 following exposure to ionizing radiation, and suppression of radiation-induced apoptosis. In addition, H-ras cooperates with myc in transformation. Recent work by White et al. (Cell 80:533-541, 1995) and Joneson et al. (Science 271: 810-812, 1996) describes three mutations in H-ras which were engineered to eliminate different downstream signal transduction pathways of H-ras. T35S contains a serine in place of threonine at amino acid 35 and is defective for ras-induced cytoskeletal changes and initiation of DNA synthesis. E37G contains a glutamic acid in place of glycine at amino acid 37 which eliminates interaction of H-ras with a GDP/GTP exchange factor. C40 contains a substitution of cysteine for tyrosine at amino acid 40 and is defective for H-ras induction of the MAP kinase pathway. We propose that by expressing these mutant H-ras proteins in immortalized cells the downstream pathways of H-ras which regulate the cellular response(s) to ionizing radiation may be determined. Materials and Methods: pHP-5 plasmids encoding these H-ras mutant genes (see White et al.) were transfected by calcium phosphate precipitation into MR4 cells, rat embryo fibroblasts immortalized by expression of v-myc. In this vector, the cDNA for H-ras is placed under the control of a CMV constitutive promoter, and selection is provided by hygromycin. The transfections performed were as follows: V12Ras (no mutation), T35S, E37G, C40, T35S + E37G, and T35S + C40. Twenty four hours after transfection

  8. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  9. DMPD: The Lps locus: genetic regulation of host responses to bacteriallipopolysaccharide. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 10669111 The Lps locus: genetic regulation of host responses to bacteriallipopolysaccharide. Qur...e The Lps locus: genetic regulation of host responses to bacteriallipopolysaccharide. Authors Qur

  10. Pharmacometabolomics of response to sertraline and to placebo in major depressive disorder - possible role for methoxyindole pathway.

    Hongjie Zhu

    Full Text Available Therapeutic response to selective serotonin (5-HT reuptake inhibitors in Major Depressive Disorder (MDD varies considerably among patients, and the onset of antidepressant therapeutic action is delayed until after 2 to 4 weeks of treatment. The objective of this study was to analyze changes within methoxyindole and kynurenine (KYN branches of tryptophan pathway to determine whether differential regulation within these branches may contribute to mechanism of variation in response to treatment. Metabolomics approach was used to characterize early biochemical changes in tryptophan pathway and correlated biochemical changes with treatment outcome. Outpatients with MDD were randomly assigned to sertraline (n = 35 or placebo (n = 40 in a double-blind 4-week trial; response to treatment was measured using the 17-item Hamilton Rating Scale for Depression (HAMD17. Targeted electrochemistry based metabolomic platform (LCECA was used to profile serum samples from MDD patients. The response rate was slightly higher for sertraline than for placebo (21/35 [60%] vs. 20/40 [50%], respectively, χ(2(1  = 0.75, p = 0.39. Patients showing a good response to sertraline had higher pretreatment levels of 5-methoxytryptamine (5-MTPM, greater reduction in 5-MTPM levels after treatment, an increase in 5-Methoxytryptophol (5-MTPOL and Melatonin (MEL levels, and decreases in the (KYN/MEL and 3-Hydroxykynurenine (3-OHKY/MEL ratios post-treatment compared to pretreatment. These changes were not seen in the patients showing poor response to sertraline. In the placebo group, more favorable treatment outcome was associated with increases in 5-MTPOL and MEL levels and significant decreases in the KYN/MEL and 3-OHKY/MEL; changes in 5-MTPM levels were not associated with the 4-week response. These results suggest that recovery from a depressed state due to treatment with drug or with placebo could be associated with preferential utilization of serotonin for

  11. Metabolomics by proton nuclear magnetic resonance spectroscopy of the response to chloroethylnitrosourea reveals drug efficacy and tumor adaptive metabolic pathways.

    Morvan, Daniel; Demidem, Aicha

    2007-03-01

    Metabolomics of tumors may allow discovery of tumor biomarkers and metabolic therapeutic targets. Metabolomics by two-dimensional proton high-resolution magic angle spinning nuclear magnetic resonance spectroscopy was applied to investigate metabolite disorders following treatment by chloroethylnitrosourea of murine B16 melanoma (n = 33) and 3LL pulmonary carcinoma (n = 31) in vivo. Treated tumors of both types resumed growth after a delay. Nitrosoureas provoke DNA damage but the metabolic consequences of genotoxic stress are little known yet. Although some differences were observed in the metabolite profile of untreated tumor types, the prominent metabolic features of the response to nitrosourea were common to both. During the growth inhibition phase, there was an accumulation of glucose (more than x10; P < 0.05), glutamine (x3 to 4; P < 0.01), and aspartate (x2 to 5; P < 0.01). This response testified to nucleoside de novo synthesis down-regulation and drug efficacy. However, this phase also involved the increase in alanine (P < 0.001 in B16 melanoma), the decrease in succinate (P < 0.001), and the accumulation of serine-derived metabolites (glycine, phosphoethanolamine, and formate; P < 0.01). This response witnessed the activation of pathways implicated in energy production and resumption of nucleotide de novo synthesis, thus metabolic pathways of DNA repair and adaptation to treatment. During the growth recovery phase, it remained polyunsaturated fatty acid accumulation (x1.5 to 2; P < 0.05) and reduced utilization of glucose compared with glutamine (P < 0.05), a metabolic fingerprint of adaptation. Thus, this study provides the proof of principle that metabolomics of tumor response to an anticancer agent may help discover metabolic pathways of drug efficacy and adaptation to treatment.

  12. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  13. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  14. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  15. DMPD: Role of Toll-like receptor responses for sepsis pathogenesis. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 18086373 Role of Toll-like receptor responses for sepsis pathogenesis. Weighardt H,... of Toll-like receptor responses for sepsis pathogenesis. PubmedID 18086373 Title Role of Toll-like receptor... responses for sepsis pathogenesis. Authors Weighardt H, Holzmann B. Publication

  16. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  17. Arsenic trioxide mediates HAPI microglia inflammatory response and subsequent neuron apoptosis through p38/JNK MAPK/STAT3 pathway

    Mao, Jiamin [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Yang, Jianbing [Department of Pediatrics, Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001 (China); Zhang, Yan [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Li, Ting [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Wang, Cheng [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Xu, Lingfei; Hu, Qiaoyun; Wang, Xiaoke; Jiang, Shengyang [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China); Chen, Gang, E-mail: chengang@ntu.edu.cn [Department of Environmental Health, School of Public Health, Nantong University, Nantong, Jiangsu 226001 (China)

    2016-07-15

    Arsenic is a widely distributed toxic metalloid all over the world. Inorganic arsenic species are supposed to affect astrocytic functions and to cause neuron apoptosis in CNS. Microglias are the key cell type involved in innate immune responses in CNS, and microglia activation has been linked to inflammation and neurotoxicity. In this study, using ELISA, we showed that Arsenic trioxide up-regulated the expression and secretion of IL-1β in a dose-dependent manner and a time-dependent manner in cultured HAPI microglia cells. The secretion of IL-1β caused the apoptosis of SH-SY5Y. These pro-inflammatory responses were inhibited by the STAT3 blocker, AG490 and P38/JNK MAPK blockers SB202190, SP600125. Further, Arsenic trioxide exposure could induce phosphorylation and activation of STAT3, and the translocation of STAT3 from the cytosol to the nucleus in this HAPI microglia cell line. Thus, the STAT3 signaling pathway can be activated after Arsenic trioxide treatment. However, P38/JNK MAPK blockers SB202190, SP600125 also obviously attenuated STAT3 activation and transnuclear transport induced by Arsenic trioxide. In concert with these results, we highlighted that the secretion of IL-1β and STAT3 activation induced by Arsenic trioxide can be mediated by elevation of P38/JNK MAPK in HAPI microglia cells and then induced the toxicity of neurons. - Highlights: • Arsenic trioxide exposure induced expression of IL-β in HAPI microglia. • Arsenic trioxide exposure induced activation of MAPK pathways in HAPI microglia. • Arsenic trioxide exposure induced activation of STAT3 pathways in HAPI microglia. • The expression of IL-β though P38/JNK MAPK/STAT3 pathways in HAPI microglia.

  18. Arsenic trioxide mediates HAPI microglia inflammatory response and subsequent neuron apoptosis through p38/JNK MAPK/STAT3 pathway

    Mao, Jiamin; Yang, Jianbing; Zhang, Yan; Li, Ting; Wang, Cheng; Xu, Lingfei; Hu, Qiaoyun; Wang, Xiaoke; Jiang, Shengyang; Nie, Xiaoke; Chen, Gang

    2016-01-01

    Arsenic is a widely distributed toxic metalloid all over the world. Inorganic arsenic species are supposed to affect astrocytic functions and to cause neuron apoptosis in CNS. Microglias are the key cell type involved in innate immune responses in CNS, and microglia activation has been linked to inflammation and neurotoxicity. In this study, using ELISA, we showed that Arsenic trioxide up-regulated the expression and secretion of IL-1β in a dose-dependent manner and a time-dependent manner in cultured HAPI microglia cells. The secretion of IL-1β caused the apoptosis of SH-SY5Y. These pro-inflammatory responses were inhibited by the STAT3 blocker, AG490 and P38/JNK MAPK blockers SB202190, SP600125. Further, Arsenic trioxide exposure could induce phosphorylation and activation of STAT3, and the translocation of STAT3 from the cytosol to the nucleus in this HAPI microglia cell line. Thus, the STAT3 signaling pathway can be activated after Arsenic trioxide treatment. However, P38/JNK MAPK blockers SB202190, SP600125 also obviously attenuated STAT3 activation and transnuclear transport induced by Arsenic trioxide. In concert with these results, we highlighted that the secretion of IL-1β and STAT3 activation induced by Arsenic trioxide can be mediated by elevation of P38/JNK MAPK in HAPI microglia cells and then induced the toxicity of neurons. - Highlights: • Arsenic trioxide exposure induced expression of IL-β in HAPI microglia. • Arsenic trioxide exposure induced activation of MAPK pathways in HAPI microglia. • Arsenic trioxide exposure induced activation of STAT3 pathways in HAPI microglia. • The expression of IL-β though P38/JNK MAPK/STAT3 pathways in HAPI microglia.

  19. Constitutive MHC class I molecules negatively regulate TLR-triggered inflammatory responses via the Fps-SHP-2 pathway.

    Xu, Sheng; Liu, Xingguang; Bao, Yan; Zhu, Xuhui; Han, Chaofeng; Zhang, Peng; Zhang, Xuemin; Li, Weihua; Cao, Xuetao

    2012-04-22

    The molecular mechanisms that fine-tune Toll-like receptor (TLR)-triggered innate inflammatory responses remain to be fully elucidated. Major histocompatibility complex (MHC) molecules can mediate reverse signaling and have nonclassical functions. Here we found that constitutively expressed membrane MHC class I molecules attenuated TLR-triggered innate inflammatory responses via reverse signaling, which protected mice from sepsis. The intracellular domain of MHC class I molecules was phosphorylated by the kinase Src after TLR activation, then the tyrosine kinase Fps was recruited via its Src homology 2 domain to phosphorylated MHC class I molecules. This led to enhanced Fps activity and recruitment of the phosphatase SHP-2, which interfered with TLR signaling mediated by the signaling molecule TRAF6. Thus, constitutive MHC class I molecules engage in crosstalk with TLR signaling via the Fps-SHP-2 pathway and control TLR-triggered innate inflammatory responses.

  20. Prokaryotic responses to ammonium and organic carbon reveal alternative CO2 fixation pathways and importance of alkaline phosphatase in the mesopelagic North Atlantic

    Federico Baltar

    2016-10-01

    Full Text Available To decipher the response of mesopelagic prokaryotic communities to input of nutrients, we tracked changes in prokaryotic abundance, extracellular enzymatic activities, heterotrophic production, dark dissolved inorganic carbon (DIC fixation, community composition (16S rRNA sequencing and community gene expression (metatranscriptomics in 3 microcosm experiments with water from the mesopelagic North Atlantic. Responses in 3 different treatments amended with thiosulfate, ammonium or organic matter (i.e. pyruvate plus acetate were compared to unamended controls. The strongest stimulation was found in the organic matter enrichments, where all measured rates increased >10-fold. Strikingly, in the organic matter treatment, the dark DIC fixation rates —assumed to be related to autotrophic metabolisms— were equally stimulated as all the other heterotrophic-related parameters. This increase in DIC fixation rates was paralleled by an up-regulation of genes involved in DIC assimilation via anaplerotic pathways. Alkaline phosphatase was the metabolic rate most strongly stimulated and its activity seemed to be related to cross-activation by nonpartner histidine kinases, and/or the activation of genes involved in the regulation of elemental balance during catabolic processes. These findings suggest that episodic events such as strong sedimentation of organic matter into the mesopelagic might trigger rapid increases of originally rare members of the prokaryotic community, enhancing heterotrophic and autotrophic carbon uptake rates, ultimately affecting carbon cycling. Our experiments highlight a number of fairly unstudied microbial processes of potential importance in mesopelagic waters that require future attention.

  1. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  2. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  3. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  4. Alteration of cellular behavior and response to PI3K pathway inhibition by culture in 3D collagen gels.

    Brian Fallica

    Full Text Available Most investigations into cancer cell drug response are performed with cells cultured on flat (2D tissue culture plastic. Emerging research has shown that the presence of a three-dimensional (3D extracellular matrix (ECM is critical for normal cell behavior including migration, adhesion, signaling, proliferation and apoptosis. In this study we investigate differences between cancer cell signaling in 2D culture and a 3D ECM, employing real-time, live cell tracking to directly observe U2OS human osteosarcoma and MCF7 human breast cancer cells embedded in type 1 collagen gels. The activation of the important PI3K signaling pathway under these different growth conditions is studied, and the response to inhibition of both PI3K and mTOR with PI103 investigated. Cells grown in 3D gels show reduced proliferation and migration as well as reduced PI3K pathway activation when compared to cells grown in 2D. Our results quantitatively demonstrate that a collagen ECM can protect U2OS cells from PI103. Overall, our data suggests that 3D gels may provide a better medium for investigation of anti-cancer drugs than 2D monolayers, therefore allowing better understanding of cellular response and behavior in native like environments.

  5. [TLR2 modulates Staphylococcus aureus-induced inflammatory response and autophagy in macrophages through PI3K signaling pathway].

    Li, Shuai; Fang, Lei; Wang, Jiong; Liu, Rongyu

    2017-09-01

    Objective To investigate the molecular mechanisms of Toll-like receptor 2 (TLR2) taking part in inflammatory response in Staphylococcus aureus (SA)-induced asthma. Methods We established the cell inflammatory response model through stimulating mouse RAW264.7 macrophages with SA. The TLR2, myeloid differentiation factor 88 (MyD88), phosphoinositide-3 kinase (PI3K), nuclear factor κBp65 (NF-κBp65), phospho-NF-κBp65, beclin-1 and microtubule-associated protein 1 light chain 3B (LC3B) were detected by Western blot analysis after treatment with TLR2 small interfering RNA (siRNA) and 3-methyladenine (3-MA), and the tumor necrosis factor α (TNF-α) and interleukin 6 (IL-6) were determined by ELISA. In addition, the number of autolysosomes was observed by the laser scanning confocal microscope. Results SA-stimulated macrophages activated various signaling pathways including TLR2. TLR2 siRNA markedly repressed the expressions of PI3K, phospho-NF-κBp65, the autophagy protein beclin-1 and LC3B as well as the number of autolysosomes and the production of TNF- and IL-6. We also demonstrated that 3-MA had the same effect on autophagy and inflammation as TLR2 siRNA did. Conclusion TLR2 modulates SA-induced inflammatory response and autophagy in macrophages through PI3K signaling pathway.

  6. Response rate of fibrosarcoma cells to cytotoxic drugs on the expression level correlates to the therapeutic response rate of fibrosarcomas and is mediated by regulation of apoptotic pathways

    Lehnhardt, Marcus; Mueller, Oliver; Klein-Hitpass, Ludger; Kuhnen, Cornelius; Homann, Heinz Herbert; Daigeler, Adrien; Steinau, Hans Ulrich; Roehrs, Sonja; Schnoor, Laura; Steinstraesser, Lars

    2005-01-01

    Because of the high resistance rate of fibrosarcomas against cytotoxic agents clinical chemotherapy of these tumors is not established. A better understanding of the diverse modes of tumor cell death following cytotoxic therapies will provide a molecular basis for new chemotherapeutic strategies. In this study we elucidated the response of a fibrosarcoma cell line to clinically used cytostatic agents on the level of gene expression. HT1080 fibrosarcoma cells were exposed to the chemotherapeutic agents doxorubicin, actinomycin D or vincristine. Total RNA was isolated and the gene expression patterns were analyzed by microarray analysis. Expression levels for 46 selected candidate genes were validated by quantitative real-time PCR. The analysis of the microarray data resulted in 3.309 (actinomycin D), 1.019 (doxorubicin) and 134 (vincristine) probesets that showed significant expression changes. For the RNA synthesis blocker actinomycin D, 99.4% of all differentially expressed probesets were under-represented. In comparison, probesets down-regulated by doxorubicin comprised only 37.4% of all genes effected by this agent. Closer analysis of the differentially regulated genes revealed that doxorubicin induced cell death of HT1080 fibrosarcoma cells mainly by regulating the abundance of factors mediating the mitochondrial (intrinsic) apoptosis pathway. Furthermore doxorubicin influences other pathways and crosstalk to other pathways (including to the death receptor pathway) at multiple levels. We found increased levels of cytochrome c, APAF-1 and members of the STAT-family (STAT1, STAT3), while Bcl-2 expression was decreased. Caspase-1, -3, -6, -8, and -9 were increased indicating that these proteases are key factors in the execution of doxorubicin mediated apoptosis. This study demonstrates that chemotherapy regulates the expression of apoptosis-related factors in fibrosarcoma cells. The number and the specific pattern of the genes depend on the used cytotoxic drug

  7. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  8. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  9. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  10. DMPD: Cytosolic DNA recognition for triggering innate immune responses. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 18280611 Cytosolic DNA recognition for triggering innate immune responses. Takaoka ...A, Taniguchi T. Adv Drug Deliv Rev. 2008 Apr 29;60(7):847-57. Epub 2007 Dec 31. (.png) (.svg) (.html) (.csml) Show Cytosol...ic DNA recognition for triggering innate immune responses. PubmedID 18280611 Title Cytosolic D

  11. DMPD: Macrophage migration inhibitory factor and host innate immune responses tomicrobes. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 14620137 Macrophage migration inhibitory factor and host innate immune responses to...microbes. Calandra T. Scand J Infect Dis. 2003;35(9):573-6. (.png) (.svg) (.html) (.csml) Show Macrophage migration... inhibitory factor and host innate immune responses tomicrobes. PubmedID 14620137 Title Macrophage migration

  12. DMPD: Innate immune responses during infection. [Dynamic Macrophage Pathway CSML Database

    Full Text Available va Correia J. Vaccine. 2004 Dec 6;22 Suppl 1:S25-30. (.png) (.svg) (.html) (.csml) Show Innate immune responses during infection. Pub...medID 15576198 Title Innate immune responses during infection. Authors Ulevitch RJ,

  13. The acute neutrophil response mediated by S100 alarmins during vaginal Candida infections is independent of the Th17-pathway.

    Yano, Junko; Kolls, Jay K; Happel, Kyle I; Wormley, Floyd; Wozniak, Karen L; Fidel, Paul L

    2012-01-01

    Vulvovaginal candidiasis (VVC) caused by Candida albicans affects a significant number of women during their reproductive ages. Clinical observations revealed that a robust vaginal polymorphonuclear neutrophil (PMN) migration occurs in susceptible women, promoting pathological inflammation without affecting fungal burden. Evidence to date in the mouse model suggests that a similar acute PMN migration into the vagina is mediated by chemotactic S100A8 and S100A9 alarmins produced by vaginal epithelial cells in response to Candida. Based on the putative role for the Th17 response in mucosal candidiasis as well as S100 alarmin induction, this study aimed to determine whether the Th17 pathway plays a role in the S100 alarmin-mediated acute inflammation during VVC using the experimental mouse model. For this, IL-23p19(-/-), IL-17RA(-/-) and IL-22(-/-) mice were intravaginally inoculated with Candida, and vaginal lavage fluids were evaluated for fungal burden, PMN infiltration, the presence of S100 alarmins and inflammatory cytokines and chemokines. Compared to wild-type mice, the cytokine-deficient mice showed comparative levels of vaginal fungal burden and PMN infiltration following inoculation. Likewise, inoculated mice of all strains with substantial PMN infiltration exhibited elevated levels of vaginal S100 alarmins in both vaginal epithelia and secretions in the vaginal lumen. Finally, cytokine analyses of vaginal lavage fluid from inoculated mice revealed equivalent expression profiles irrespective of the Th17 cytokine status or PMN response. These data suggest that the vaginal S100 alarmin response to Candida does not require the cells or cytokines of the Th17 lineage, and therefore, the immunopathogenic inflammatory response during VVC occurs independently of the Th17-pathway.

  14. Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system.

    Xin Sun

    2010-02-01

    Full Text Available Inflammatory response following central nervous system (CNS injury contributes to progressive neuropathology and reduction in functional recovery. Axons are sensitive to mechanical injury and toxic inflammatory mediators, which may lead to demyelination. Although it is well documented that degenerated myelin triggers undesirable inflammatory responses in autoimmune diseases such as multiple sclerosis (MS and its animal model, experimental autoimmune encephalomyelitis (EAE, there has been very little study of the direct inflammatory consequences of damaged myelin in spinal cord injury (SCI, i.e., there is no direct evidence to show that myelin debris from injured spinal cord can trigger undesirable inflammation in vitro and in vivo. Our data showed that myelin can initiate inflammatory responses in vivo, which is complement receptor 3 (CR3-dependent via stimulating macrophages to express pro-inflammatory molecules and down-regulates expression of anti-inflammatory cytokines. Mechanism study revealed that myelin-increased cytokine expression is through activation of FAK/PI3K/Akt/NF-kappaB signaling pathways and CR3 contributes to myelin-induced PI3K/Akt/NF-kappaB activation and cytokine production. The myelin induced inflammatory response is myelin specific as sphingomyelin (the major lipid of myelin and myelin basic protein (MBP, one of the major proteins of myelin are not able to activate NF-kappaB signaling pathway. In conclusion, our results demonstrate a crucial role of myelin as an endogenous inflammatory stimulus that induces pro-inflammatory responses and suggest that blocking myelin-CR3 interaction and enhancing myelin debris clearance may be effective interventions for treating SCI.

  15. Revisiting the slow force response: the role of the PKG signaling pathway in the normal and the ischemic heart.

    Castro-Ferreira, Ricardo; Neves, João Sérgio; Ladeiras-Lopes, Ricardo; Leite-Moreira, André M; Neiva-Sousa, Manuel; Almeida-Coelho, João; Ferreira-Martins, João; F Leite-Moreira, Adelino

    2014-09-01

    The myocardial response to acute stretch consists of a two-phase increase in contractility: an acute increase by the Frank-Starling mechanism and a gradual and time-dependent increase in force generated known as the slow force response (SFR). The SFR is actively modulated by different signaling pathways, but the role of protein kinase G (PKG) signaling is unknown. In this study we aim to characterize the role of the PKG signaling pathway in the SFR under normal and ischemic conditions. Rabbit papillary muscles were stretched from 92 to 100% of maximum length (Lmax) under basal conditions, in the absence (1) or presence of: a PKG agonist (2) and a PKG inhibitor (3); under ischemic conditions in the absence (4) or presence of: a PKG agonist (5); a nitric oxide (NO) donor (6) and a phosphodiesterase 5 (PDE5) inhibitor (7). Under normoxia, the SFR was significantly attenuated by inhibition of PKG and remained unaltered with PKG activation. Ischemia induced a progressive decrease in myocardial contractility after stretch. Neither the PKG agonist nor the NO donor altered the myocardial response to stretch under ischemic conditions. However, the use of a PDE5 inhibitor in ischemia partially reversed the progressive deterioration in contractility. PKG activity is essential for the SFR. During ischemia, a progressive decline in the force is observed in response to acute myocardial stretch. This dysfunctional response can be partially reversed by the use of PDE5 inhibitors. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  16. A Health Economics Response to the Review of the Liverpool Care Pathway

    Coast, Joanna

    2013-01-01

    Abstract Background: In 2011 the Palliative Care Funding Review highlighted concerns about the funding, provision, and quality of care at the end of life. Two years on, an independent review of the Liverpool Care Pathway—prompted by a storm of negative media coverage— has raised concerns around a lack of funding, availability of support for the dying and their relatives, and patient centered care. There are recommendations to increase funding through a national tariff for palliative care services, address inconsistencies, and replace the Liverpool Care Pathway with individual end-of-life care plans. Objective: This paper explores the economic implications of the review's recommendations and links these to inadequacies with the current economic framework currently recommended for use in the United Kingdom by the National Institute for Health and Care Excellence, before highlighting aspects of ongoing research aimed at addressing these inadequacies. Methods: As well as the published report More Care, Less Pathway, we draw upon preliminary qualitative evidence from 19 semistructured interviews conducted with academics specializing in economics and/or end-of-life care. Conclusions: While there is a need for increased funding in the short term (highlighted in recent reviews), increasing funding to services that have little evidence base appears to be an irresponsible long-term strategy. Hence there should also be increased investment in research and increased emphasis in particular on developing economic tools to evaluate services. PMID:24199790

  17. Monoethylhexyl Phthalate Elicits an Inflammatory Response in Adipocytes Characterized by Alterations in Lipid and Cytokine Pathways.

    Manteiga, Sara; Lee, Kyongbum

    2017-04-01

    A growing body of evidence links endocrine-disrupting chemicals (EDCs) with obesity-related metabolic diseases. While it has been shown that EDCs can predispose individuals toward adiposity by affecting developmental processes, little is known about the chemicals' effects on adult adipose tissue. Our aim was to study the effects of low, physiologically relevant doses of EDCs on differentiated murine adipocytes. We combined metabolomics, proteomics, and gene expression analysis to characterize the effects of mono-ethylhexyl phthalate (MEHP) in differentiated adipocytes. Repeated exposure to MEHP over several days led to changes in metabolite and enzyme levels indicating elevated lipogenesis and lipid oxidation. The chemical exposure also increased expression of major inflammatory cytokines, including chemotactic factors. Proteomic and gene expression analysis revealed significant alterations in pathways regulated by peroxisome proliferator activated receptor-γ (PPARγ). Inhibiting the nuclear receptor's activity using a chemical antagonist abrogated not only the alterations in PPARγ-regulated metabolic pathways, but also the increases in cytokine expression. Our results show that MEHP can induce a pro-inflammatory state in differentiated adipocytes. This effect is at least partially mediated PPARγ.

  18. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  19. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  20. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  1. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  2. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  3. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  4. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  5. Brain transcriptional responses to high-fat diet in Acads-deficient mice reveal energy sensing pathways.

    Claudia Kruger

    Full Text Available How signals from fatty acid metabolism are translated into changes in food intake remains unclear. Previously we reported that mice with a genetic inactivation of Acads (acyl-coenzyme A dehydrogenase, short-chain, the enzyme responsible for mitochondrial beta-oxidation of C4-C6 short-chain fatty acids (SCFAs, shift consumption away from fat and toward carbohydrate when offered a choice between diets. In the current study, we sought to indentify candidate genes and pathways underlying the effects of SCFA oxidation deficiency on food intake in Acads-/- mice.We performed a transcriptional analysis of gene expression in brain tissue of Acads-/- and Acads+/+ mice fed either a high-fat (HF or low-fat (LF diet for 2 d. Ingenuity Pathway Analysis revealed three top-scoring pathways significantly modified by genotype or diet: oxidative phosphorylation, mitochondrial dysfunction, and CREB signaling in neurons. A comparison of statistically significant responses in HF Acads-/- vs. HF Acads+/+ (3917 and Acads+/+ HF vs. LF Acads+/+ (3879 revealed 2551 genes or approximately 65% in common between the two experimental comparisons. All but one of these genes were expressed in opposite direction with similar magnitude, demonstrating that HF-fed Acads-deficient mice display transcriptional responses that strongly resemble those of Acads+/+ mice fed LF diet. Intriguingly, genes involved in both AMP-kinase regulation and the neural control of food intake followed this pattern. Quantitative RT-PCR in hypothalamus confirmed the dysregulation of genes in these pathways. Western blotting showed an increase in hypothalamic AMP-kinase in Acads-/- mice and HF diet increased, a key protein in an energy-sensing cascade that responds to depletion of ATP.Our results suggest that the decreased beta-oxidation of short-chain fatty acids in Acads-deficient mice fed HF diet produces a state of energy deficiency in the brain and that AMP-kinase may be the cellular energy

  6. Reconceptualising adaptation to climate change as part of pathways of change and response

    Wise, RM

    2014-01-01

    Full Text Available on contexts with clearly identified decision-makers and unambiguous goals; as a result, they generally assume prevailing governance regimes are conducive for adaptation and hence constrain responses to proximate causes of vulnerability. In this paper, we...

  7. The NRF2-KEAP1 Pathway Is an Early Responsive Gene Network in Arsenic Exposed Lymphoblastoid Cells

    Córdova, Emilio J.; Martínez-Hernández, Angélica; Uribe-Figueroa, Laura; Centeno, Federico; Morales-Marín, Mirna; Koneru, Harsha; Coleman, Matthew A.; Orozco, Lorena

    2014-01-01

    Inorganic arsenic (iAs), a major environmental contaminant, has risen as an important health problem worldwide. More detailed identification of the molecular mechanisms associated with iAs exposure would help to establish better strategies for prevention and treatment. Although chronic iAs exposures have been previously studied there is little to no information regarding the early events of exposure to iAs. To better characterize the early mechanisms of iAs exposure we conducted gene expression studies using sublethal doses of iAs at two different time-points. The major transcripts differentially regulated at 2 hrs of iAs exposure included antioxidants, detoxificants and chaperones. Moreover, after 12 hrs of exposure many of the down-regulated genes were associated with DNA replication and S phase cell cycle progression. Interestingly, the most affected biological pathway by both 2 or 12 hrs of iAs exposure were the Nrf2-Keap1 pathway, represented by the highly up-regulated HMOX1 transcript, which is transcriptionally regulated by the transcription factor Nrf2. Additional Nrf2 targets included SQSTM1 and ABCB6, which were not previously associated with acute iAs exposure. Signalling pathways such as interferon, B cell receptor and AhR route were also responsive to acute iAs exposure. Since HMOX1 expression increased early (20 min) and was responsive to low iAs concentrations (0.1 µM), this gene could be a suitable early biomarker for iAs exposure. In addition, the novel Nrf2 targets SQSTM1 and ABCB6 could play an important and previously unrecognized role in cellular protection against iAs. PMID:24516582

  8. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  9. Modulation of vasodilator response via the nitric oxide pathway after acute methyl mercury chloride exposure in rats.

    Omanwar, S; Saidullah, B; Ravi, K; Fahim, M

    2013-01-01

    Mercury exposure induces endothelial dysfunction leading to loss of endothelium-dependent vasorelaxation due to decreased nitric oxide (NO) bioavailability via increased oxidative stress. Our aim was to investigate whether acute treatment with methyl mercury chloride changes the endothelium-dependent vasodilator response and to explore the possible mechanisms behind the observed effects. Wistar rats were treated with methyl mercury chloride (5 mg/kg, po.). The methyl mercury chloride treatment resulted in an increased aortic vasorelaxant response to acetylcholine (ACh). In methyl-mercury-chloride-exposed rats, the % change in vasorelaxant response of ACh in presence of Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME; 10(-4) M) was significantly increased, and in presence of glybenclamide (10(-5) M), the response was similar to that of untreated rats, indicating the involvement of NO and not of endothelium-derived hyperpolarizing factor (EDHF). In addition, superoxide dismutase (SOD) + catalase treatment increased the NO modulation of vasodilator response in methyl-mercury-chloride-exposed rats. Our results demonstrate an increase in the vascular reactivity to ACh in aorta of rats acutely exposed to methyl mercury chloride. Methyl mercury chloride induces nitric oxide synthase (NOS) and increases the NO production along with inducing oxidative stress without affecting the EDHF pathway.

  10. Modulation of Vasodilator Response via the Nitric Oxide Pathway after Acute Methyl Mercury Chloride Exposure in Rats

    S. Omanwar

    2013-01-01

    Full Text Available Mercury exposure induces endothelial dysfunction leading to loss of endothelium-dependent vasorelaxation due to decreased nitric oxide (NO bioavailability via increased oxidative stress. Our aim was to investigate whether acute treatment with methyl mercury chloride changes the endothelium-dependent vasodilator response and to explore the possible mechanisms behind the observed effects. Wistar rats were treated with methyl mercury chloride (5 mg/kg, po.. The methyl mercury chloride treatment resulted in an increased aortic vasorelaxant response to acetylcholine (ACh. In methyl-mercury-chloride-exposed rats, the % change in vasorelaxant response of ACh in presence of Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME; 10-4 M was significantly increased, and in presence of glybenclamide (10-5 M, the response was similar to that of untreated rats, indicating the involvement of NO and not of endothelium-derived hyperpolarizing factor (EDHF. In addition, superoxide dismutase (SOD + catalase treatment increased the NO modulation of vasodilator response in methyl-mercury-chloride-exposed rats. Our results demonstrate an increase in the vascular reactivity to ACh in aorta of rats acutely exposed to methyl mercury chloride. Methyl mercury chloride induces nitric oxide synthase (NOS and increases the NO production along with inducing oxidative stress without affecting the EDHF pathway.

  11. The Interplay between Cyclic AMP, MAPK, and NF-κB Pathways in Response to Proinflammatory Signals in Microglia

    Mousumi Ghosh

    2015-01-01

    Full Text Available Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-α and IL-1β, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-α stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-α produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-κB in this regulation. Following TNF-α there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-κB-p65, IκB degradation, and NF-κB p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-κB activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease.

  12. Pathway-Enriched Gene Signature Associated with 53BP1 Response to PARP Inhibition in Triple-Negative Breast Cancer.

    Hassan, Saima; Esch, Amanda; Liby, Tiera; Gray, Joe W; Heiser, Laura M

    2017-12-01

    Effective treatment of patients with triple-negative (ER-negative, PR-negative, HER2-negative) breast cancer remains a challenge. Although PARP inhibitors are being evaluated in clinical trials, biomarkers are needed to identify patients who will most benefit from anti-PARP therapy. We determined the responses of three PARP inhibitors (veliparib, olaparib, and talazoparib) in a panel of eight triple-negative breast cancer cell lines. Therapeutic responses and cellular phenotypes were elucidated using high-content imaging and quantitative immunofluorescence to assess markers of DNA damage (53BP1) and apoptosis (cleaved PARP). We determined the pharmacodynamic changes as percentage of cells positive for 53BP1, mean number of 53BP1 foci per cell, and percentage of cells positive for cleaved PARP. Inspired by traditional dose-response measures of cell viability, an EC 50 value was calculated for each cellular phenotype and each PARP inhibitor. The EC 50 values for both 53BP1 metrics strongly correlated with IC 50 values for each PARP inhibitor. Pathway enrichment analysis identified a set of DNA repair and cell cycle-associated genes that were associated with 53BP1 response following PARP inhibition. The overall accuracy of our 63 gene set in predicting response to olaparib in seven breast cancer patient-derived xenograft tumors was 86%. In triple-negative breast cancer patients who had not received anti-PARP therapy, the predicted response rate of our gene signature was 45%. These results indicate that 53BP1 is a biomarker of response to anti-PARP therapy in the laboratory, and our DNA damage response gene signature may be used to identify patients who are most likely to respond to PARP inhibition. Mol Cancer Ther; 16(12); 2892-901. ©2017 AACR . ©2017 American Association for Cancer Research.

  13. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  15. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  16. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  17. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  18. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  19. Pharmacogenomics of Methotrexate Membrane Transport Pathway: Can Clinical Response to Methotrexate in Rheumatoid Arthritis Be Predicted?

    Aurea Lima

    2015-06-01

    Full Text Available Background: Methotrexate (MTX is widely used for rheumatoid arthritis (RA treatment. Single nucleotide polymorphisms (SNPs could be used as predictors of patients’ therapeutic outcome variability. Therefore, this study aims to evaluate the influence of SNPs in genes encoding for MTX membrane transport proteins in order to predict clinical response to MTX. Methods: Clinicopathological data from 233 RA patients treated with MTX were collected, clinical response defined, and patients genotyped for 23 SNPs. Genotype and haplotype analyses were performed using multivariate methods and a genetic risk index (GRI for non-response was created. Results: Increased risk for non-response was associated to SLC22A11 rs11231809 T carriers; ABCC1 rs246240 G carriers; ABCC1 rs3784864 G carriers; CGG haplotype for ABCC1 rs35592, rs2074087 and rs3784864; and CGG haplotype for ABCC1 rs35592, rs246240 and rs3784864. GRI demonstrated that patients with Index 3 were 16-fold more likely to be non-responders than those with Index 1. Conclusions: This study revealed that SLC22A11 and ABCC1 may be important to identify those patients who will not benefit from MTX treatment, highlighting the relevance in translating these results to clinical practice. However, further validation by independent studies is needed to develop the field of personalized medicine to predict clinical response to MTX treatment.

  20. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  1. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  2. Genome-wide association study and biological pathway analysis for response to Eimeria maxima in broilers

    Hamzic, Edin; Buitenhuis, Albert Johannes; Hérault, Frédéric

    2015-01-01

    Background Coccidiosis is the most common and costly disease in the poultry industry and which caused by protozoans from the genus of Eimeria. The current control of coccidiosis, based on the use of anticoccidial drugs and vaccination, faces serious obstacles such as drug resistance and the high...... costs for development of efficient vaccines, respectively. Therefore, the present control programs must be expanded with complementary approaches such as the use of genetics for improvement of the host’s response to Eimeria infections. Recently, we have performed a large-scale challenge study on Cobb500...... of the measured traits in the response to Eimeria maxima in broilers. Furthermore, we conducted a post-GWAS functional analysis with the aim of gaining a better biological understanding of the underlying response to Eimeria maxima challenge in broilers. Results In total, we identified 22 single nucleotide...

  3. Evolution pathways for the formation of Nano-Cu{sub 2}ZnSnSe{sub 4} absorber materials via elemental sources and isophorondiamine chelation

    Lee, P.Y. [Institute of Microelectronics and Department of Electrical Engineering, Advanced Optoelectronic Technology Center, Center for Micro/Nano Science and Technology, National Cheng Kung University, Tainan 701, Taiwan (China); Shei, S.C., E-mail: scshei@mail.nutn.edu.tw [Department of Electrical Engineering, National University of Tainan, Tainan 70005, Taiwan (China); Chang, S.J. [Institute of Microelectronics and Department of Electrical Engineering, Advanced Optoelectronic Technology Center, Center for Micro/Nano Science and Technology, National Cheng Kung University, Tainan 701, Taiwan (China)

    2013-10-15

    Highlights: •We carry out the CZTSe nanocrystals in the isophorondiamine solution •We demonstrate the reaction from binary and ternary into quaternary nanocrystals. •We characterize the CZTSe nanocrystals with a stannite structure. -- Abstract: This paper reports the preparation of Cu{sub 2}ZnSnSe{sub 4} (CZTSe) nanocrystals via a method under nitrogen atmosphere at a temperature of 235 °C using elemental copper, zinc, tin, and Se powders as precursors, and isophorondiamine (IPDA) as a coordinating solvent. We investigated the influence of reaction time on the crystal structure, shape, particle size, optical properties, and composition of the nanocrystals. We also carried out a systematic study of the growth and evolution pathways of quaternary CZTSe nanocrystals in the IPDA solution. The reaction began with the formation of binary and ternary crystals, which subsequently transformed into Cu{sub 2}ZnSnSe{sub 4} nanocrystals. These binary and ternary compounds dissolved during the course of the reaction to produce the molecular precursor used in the formation of monophasic Cu{sub 2}ZnSnSe{sub 4} nanocrystals. Experimental results indicate that the phase changes in CZTSe nanocrystals are time-dependent. Spherical CZTSe nanocrystals with diameters in the range of 20–30 nm were obtained at 20 h. Characterization using X-ray diffraction (XRD) confirmed the as-synthesized CZTSe as single-phase quaternary nanocrystals with a stannite structure. The band gap energy of the as-synthesized CZTSe nanocrystals is 1.6 eV. The proposed process of synthesizing CZTSe nanocrystals is applicable to the production of inexpensive thin film solar cells using a relatively simple, low cost, and convenient coordinating solvent route.

  4. Aromatic Glucosinolate Biosynthesis Pathway in Barbarea vulgaris and its Response to Plutella xylostella Infestation

    Liu, Tongjin; Zhang, Xiaohui; Yang, Haohui; Agerbirk, Niels; Qiu, Yang; Wang, Haiping; Shen, Di; Song, Jiangping; Li, Xixiang

    2016-01-01

    The inducibility of the glucosinolate resistance mechanism is an energy-saving strategy for plants, but whether induction would still be triggered by glucosinolate-tolerant Plutella xylostella (diamondback moth, DBM) after a plant had evolved a new resistance mechanism (e.g., saponins in Barbara vulgaris) was unknown. In B. vulgaris, aromatic glucosinolates derived from homo-phenylalanine are the dominant glucosinolates, but their biosynthesis pathway was unclear. In this study, we used G-type (pest-resistant) and P-type (pest-susceptible) B. vulgaris to compare glucosinolate levels and the expression profiles of their biosynthesis genes before and after infestation by DBM larvae. Two different stereoisomers of hydroxylated aromatic glucosinolates are dominant in G- and P-type B. vulgaris, respectively, and are induced by DBM. The transcripts of genes in the glucosinolate biosynthesis pathway and their corresponding transcription factors were identified from an Illumina dataset of G- and P-type B. vulgaris. Many genes involved or potentially involved in glucosinolate biosynthesis were induced in both plant types. The expression patterns of six DBM induced genes were validated by quantitative PCR (qPCR), while six long-fragment genes were validated by molecular cloning. The core structure biosynthetic genes showed high sequence similarities between the two genotypes. In contrast, the sequence identity of two apparent side chain modification genes, the SHO gene in the G-type and the RHO in P-type plants, showed only 77.50% identity in coding DNA sequences and 65.48% identity in deduced amino acid sequences. The homology to GS-OH in Arabidopsis, DBM induction of the transcript and a series of qPCR and glucosinolate analyses of G-type, P-type and F1 plants indicated that these genes control the production of S and R isomers of 2-hydroxy-2-phenylethyl glucosinolate. These glucosinolates were significantly induced by P. xylostella larvae in both the susceptiple P

  5. Aromatic glucosinolate biosynthesis pathway in Barbarea vulgaris and its response to Plutella xylostella infestation

    Tongjin eLiu

    2016-02-01

    Full Text Available The inducibility of the glucosinolate resistance mechanism is an energy-saving strategy for plants, but whether induction would still be triggered by glucosinolate-tolerant Plutella xylostella (diamondback moth, DBM after a plant had evolved a new resistance mechanism (e.g. saponins in Barbara vulgaris was unknown. In B. vulgaris, aromatic glucosinolates derived from homo-phenylalanine are the dominate glucosinolates, but their biosynthesis pathway are unclear in this plant. In this study, we used G-type (pest-resistant and P-type (pest-susceptible B. vulgaris to compare glucosinolate levels and the expression profiles of their biosynthesis genes before and after infestation by DBM larvae. Two different stereoisomers of hydroxylated aromatic glucosinolates are dominant in G- and P-type B. vulgaris, respectively, and are induced by DBM. The transcripts of genes in the glucosinolate biosynthesis pathway and their corresponding transcription factors were identified from an Illumina dataset of G- and P-type B. vulgaris. Many genes involved or potentially involved in glucosinolate biosynthesis were induced in both plant types. The expression patterns of six DBM induced genes were validated by quantitative PCR (qPCR, while six long-fragment genes were validated by molecular cloning. The core structure biosynthetic genes showed high sequence similarities between the two genotypes. In contrast, the sequence identity of two apparent side chain modification genes, the SHO gene in the G-type and the RHO in P-type plants, showed only 77.50% identity in coding DNA sequences and 65.48% identity in deduced amino acid sequences. The homology to GS-OH in Arabidopsis, DBM induction of the transcript and a series of qPCR and glucosinolate analyses of G-type, P-type and F1 plants indicated that these genes control the production of S and R isomers of 2-hydroxy-2-phenylethyl glucosinolate. These glucosinolates were significantly induced by P. xylostella larvae in

  6. Adaptive Activation of a Stress Response Pathway Improves Learning and Memory Through Gs and β-Arrestin-1-Regulated Lactate Metabolism.

    Dong, Jun-Hong; Wang, Yi-Jing; Cui, Min; Wang, Xiao-Jing; Zheng, Wen-Shuai; Ma, Ming-Liang; Yang, Fan; He, Dong-Fang; Hu, Qiao-Xia; Zhang, Dao-Lai; Ning, Shang-Lei; Liu, Chun-Hua; Wang, Chuan; Wang, Yue; Li, Xiang-Yao; Yi, Fan; Lin, Amy; Kahsai, Alem W; Cahill, Thomas Joseph; Chen, Zhe-Yu; Yu, Xiao; Sun, Jin-Peng

    2017-04-15

    Stress is a conserved physiological response in mammals. Whereas moderate stress strengthens memory to improve reactions to previously experienced difficult situations, too much stress is harmful. We used specific β-adrenergic agonists, as well as β 2 -adrenergic receptor (β2AR) and arrestin knockout models, to study the effects of adaptive β2AR activation on cognitive function using Morris water maze and object recognition experiments. We used molecular and cell biological approaches to elucidate the signaling subnetworks. We observed that the duration of the adaptive β2AR activation determines its consequences on learning and memory. Short-term formoterol treatment, for 3 to 5 days, improved cognitive function; however, prolonged β2AR activation, for more than 6 days, produced harmful effects. We identified the activation of several signaling networks downstream of β2AR, as well as an essential role for arrestin and lactate metabolism in promoting cognitive ability. Whereas Gs-protein kinase A-cyclic adenosine monophosphate response element binding protein signaling modulated monocarboxylate transporter 1 expression, β-arrestin-1 controlled expression levels of monocarboxylate transporter 4 and lactate dehydrogenase A through the formation of a β-arrestin-1/phospho-mitogen-activated protein kinase/hypoxia-inducible factor-1α ternary complex to upregulate lactate metabolism in astrocyte-derived U251 cells. Conversely, long-term treatment with formoterol led to the desensitization of β2ARs, which was responsible for its decreased beneficial effects. Our results not only revealed that β-arrestin-1 regulated lactate metabolism to contribute to β2AR functions in improved memory formation, but also indicated that the appropriate management of one specific stress pathway, such as through the clinical drug formoterol, may exert beneficial effects on cognitive abilities. Copyright © 2016 Society of Biological Psychiatry. All rights reserved.

  7. ATM directs DNA damage responses and proteostasis via genetically separable pathways.

    Lee, Ji-Hoon; Mand, Michael R; Kao, Chung-Hsuan; Zhou, Yi; Ryu, Seung W; Richards, Alicia L; Coon, Joshua J; Paull, Tanya T

    2018-01-09

    The protein kinase ATM is a master regulator of the DNA damage response but also responds directly to oxidative stress. Loss of ATM causes ataxia telangiectasia, a neurodegenerative disorder with pleiotropic symptoms that include cerebellar dysfunction, cancer, diabetes, and premature aging. We genetically separated the activation of ATM by DNA damage from that by oxidative stress using separation-of-function mutations. We found that deficient activation of ATM by the Mre11-Rad50-Nbs1 complex and DNA double-strand breaks resulted in loss of cell viability, checkpoint activation, and DNA end resection in response to DNA damage. In contrast, loss of oxidative activation of ATM had minimal effects on DNA damage-related outcomes but blocked ATM-mediated initiation of checkpoint responses after oxidative stress and resulted in deficiencies in mitochondrial function and autophagy. In addition, expression of a variant ATM incapable of activation by oxidative stress resulted in widespread protein aggregation. These results indicate a direct relationship between the mechanism of ATM activation and its effects on cellular metabolism and DNA damage responses in human cells and implicate ATM in the control of protein homeostasis. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  8. Ohmyungsamycins promote antimicrobial responses through autophagy activation via AMP-activated protein kinase pathway.

    Kim, Tae Sung; Shin, Yern-Hyerk; Lee, Hye-Mi; Kim, Jin Kyung; Choe, Jin Ho; Jang, Ji-Chan; Um, Soohyun; Jin, Hyo Sun; Komatsu, Masaaki; Cha, Guang-Ho; Chae, Han-Jung; Oh, Dong-Chan; Jo, Eun-Kyeong

    2017-06-13

    The induction of host cell autophagy by various autophagy inducers contributes to the antimicrobial host defense against Mycobacterium tuberculosis (Mtb), a major pathogenic strain that causes human tuberculosis. In this study, we present a role for the newly identified cyclic peptides ohmyungsamycins (OMS) A and B in the antimicrobial responses against Mtb infections by activating autophagy in murine bone marrow-derived macrophages (BMDMs). OMS robustly activated autophagy, which was essentially required for the colocalization of LC3 autophagosomes with bacterial phagosomes and antimicrobial responses against Mtb in BMDMs. Using a Drosophila melanogaster-Mycobacterium marinum infection model, we showed that OMS-A-induced autophagy contributed to the increased survival of infected flies and the limitation of bacterial load. We further showed that OMS triggered AMP-activated protein kinase (AMPK) activation, which was required for OMS-mediated phagosome maturation and antimicrobial responses against Mtb. Moreover, treating BMDMs with OMS led to dose-dependent inhibition of macrophage inflammatory responses, which was also dependent on AMPK activation. Collectively, these data show that OMS is a promising candidate for new anti-mycobacterial therapeutics by activating antibacterial autophagy via AMPK-dependent signaling and suppressing excessive inflammation during Mtb infections.

  9. M2-like macrophages are responsible for collagen degradation through a mannose receptor–mediated pathway

    Madsen, Daniel H.; Leonard, Daniel; Masedunskas, Andrius; Moyer, Amanda; Jürgensen, Henrik Jessen; Peters, Diane E.; Amornphimoltham, Panomwat; Selvaraj, Arul; Yamada, Susan S.; Brenner, David A.; Burgdorf, Sven; Engelholm, Lars H.; Behrendt, Niels; Holmbeck, Kenn; Weigert, Roberto

    2013-01-01

    Tissue remodeling processes critically depend on the timely removal and remodeling of preexisting collagen scaffolds. Nevertheless, many aspects related to the turnover of this abundant extracellular matrix component in vivo are still incompletely understood. We therefore took advantage of recent advances in optical imaging to develop an assay to visualize collagen turnover in situ and identify cell types and molecules involved in this process. Collagen introduced into the dermis of mice underwent cellular endocytosis in a partially matrix metalloproteinase–dependent manner and was subsequently routed to lysosomes for complete degradation. Collagen uptake was predominantly executed by a quantitatively minor population of M2-like macrophages, whereas more abundant Col1a1-expressing fibroblasts and Cx3cr1-expressing macrophages internalized collagen at lower levels. Genetic ablation of the collagen receptors mannose receptor (Mrc1) and urokinase plasminogen activator receptor–associated protein (Endo180 and Mrc2) impaired this intracellular collagen degradation pathway. This study demonstrates the importance of receptor-mediated cellular uptake to collagen turnover in vivo and identifies a key role of M2-like macrophages in this process. PMID:24019537

  10. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  11. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  12. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Kallikrein–Kinin System Suppresses Type I Interferon Responses: A Novel Pathway of Interferon Regulation

    Alecia Seliga

    2018-02-01

    Full Text Available The Kallikrein–Kinin System (KKS, comprised of kallikreins (klks, bradykinins (BKs angiotensin-converting enzyme (ACE, and many other molecules, regulates a number of physiological processes, including inflammation, coagulation, angiogenesis, and control of blood pressure. In this report, we show that KKS regulates Type I IFN responses, thought to be important in lupus pathogenesis. We used CpG (TLR9 ligand, R848 (TLR7 ligand, or recombinant IFN-α to induce interferon-stimulated genes (ISGs and proteins, and observed that this response was markedly diminished by BKs, klk1 (tissue kallikrein, or captopril (an ACE inhibitor. BKs significantly decreased the ISGs induced by TLRs in vitro and in vivo (in normal and lupus-prone mice, and in human PBMCs, especially the induction of Irf7 gene (p < 0.05, the master regulator of Type I IFNs. ISGs induced by IFN-α were also suppressed by the KKS. MHC Class I upregulation, a classic response to Type I IFNs, was reduced by BKs in murine dendritic cells (DCs. BKs decreased phosphorylation of STAT2 molecules that mediate IFN signaling. Among the secreted pro-inflammatory cytokines/chemokines analyzed (IL-6, IL12p70, and CXCL10, the strongest suppressive effect was on CXCL10, a highly Type I IFN-dependent cytokine, upon CpG stimulation, both in normal and lupus-prone DCs. klks that break down into BKs, also suppressed CpG-induced ISGs in murine DCs. Captopril, a drug that inhibits ACE and increases BK, suppressed ISGs, both in mouse DCs and human PBMCs. The effects of BK were reversed with indomethacin (compound that inhibits production of PGE2, suggesting that BK suppression of IFN responses may be mediated via prostaglandins. These results highlight a novel regulatory mechanism in which members of the KKS control the Type I IFN response and suggest a role for modulators of IFNs in the pathogenesis of lupus and interferonopathies.

  14. The sandfly Lutzomyia longipalpis LL5 embryonic cell line has active Toll and Imd pathways and shows immune responses to bacteria, yeast and Leishmania.

    Tinoco-Nunes, Bruno; Telleria, Erich Loza; da Silva-Neves, Monique; Marques, Christiane; Azevedo-Brito, Daisy Aline; Pitaluga, André Nóbrega; Traub-Csekö, Yara Maria

    2016-04-20

    Lutzomyia longipalpis is the main vector of visceral leishmaniasis in Latin America. Sandfly immune responses are poorly understood. In previous work we showed that these vector insects respond to bacterial infections by modulating a defensin gene expression and activate the Imd pathway in response to Leishmania infection. Aspects of innate immune pathways in insects (including mosquito vectors of human diseases) have been revealed by studying insect cell lines, and we have previously demonstrated antiviral responses in the L. longipalpis embryonic cell line LL5. The expression patterns of antimicrobial peptides (AMPs) and transcription factors were evaluated after silencing the repressors of the Toll pathway (cactus) and Imd pathway (caspar). AMPs and transcription factor expression patterns were also evaluated after challenge with heat-killed bacteria, heat-killed yeast, or live Leishmania. These studies showed that LL5 cells have active Toll and Imd pathways, since they displayed an increased expression of AMP genes following silencing of the repressors cactus and caspar, respectively. These pathways were also activated by challenges with bacteria, yeast and Leishmania infantum chagasi. We demonstrated that L. longipalpis LL5 embryonic cells respond to immune stimuli and are therefore a good model to study the immunological pathways of this important vector of leishmaniasis.

  15. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  16. Amitriptyline induces early growth response-1 gene expression via ERK and JNK mitogen-activated protein kinase pathways in rat C6 glial cells.

    Chung, Eun Young; Shin, Soon Young; Lee, Young Han

    2007-07-05

    Astrocytes play important roles in guiding the construction of the nervous system, controlling extracellular ions and neurotransmitters, and regulating CNS synaptogenesis. Egr-1 is a transcription factor involved in neuronal differentiation and astrocyte cell proliferation. In this study, we investigated whether the tricyclic antidepressant (TCA) amitriptyline induces Egr-1 expression in astrocytes using rat C6 glioma cells as a model. We found that amitriptyline increased the expression of Egr-1 in a dose- and time-dependent manner. The amitriptyline-induced Egr-1 expression was mediated through serum response elements (SREs) in the Egr-1 promoter. SREs were activated by the Ets-domain transcription factor Elk-1 through the ERK and JNK mitogen-activated protein (MAP) kinase pathways. The inhibition of the ERK and JNK MAP kinase signals attenuated amitriptyline-induced transactivation of Gal4-Elk-1 and Egr-1 promoter activity. Our findings suggest that the induction of Egr-1 expression in astrocytes may be required to attain the therapeutic effects of antidepressant drugs.

  17. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  18. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  19. Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.

    Mongelli, Vanesa; Saleh, Maria-Carla

    2016-09-29

    Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.

  20. Converging Pathways in Autism Spectrum Disorders: Interplay Between Synaptic Dysfunction and Immune Responses

    Irina eVoineagu

    2013-11-01

    Full Text Available Autism spectrum disorders (ASD are highly heritable, yet genetically heterogeneous neurodevelopmental conditions. Recent genome-wide association and gene expression studies have provided evidence supporting the notion that the large number of genetic variants associated with ASD converge toward a core set of dysregulated biological processes. Here we review recent data demonstrating the involvement of synaptic dysfunction and abnormal immune responses in ASD, and discuss the functional interplay between the two phenomena.

  1. Unfolded Protein Response Signaling and MAP Kinase Pathways Underlie Pathogenesis of Arsenic-induced Cutaneous Inflammation

    Li, Changzhao; Xu, Jianmin; Li, Fugui; Chaudhary, Sandeep C.; Weng, Zhiping; Wen, Jianming; Elmets, Craig A.; Ahsan, Habibul; Athar, Mohammad

    2011-01-01

    Arsenic exposure through drinking water is a major global public health problem and is associated with an enhanced risk of various cancers including skin cancer. In human skin, arsenic induces precancerous melanosis and keratosis, which may progress to basal cell and squamous cell carcinoma. However, the mechanism by which these pathophysiological alterations occur remains elusive. In this study, we showed that sub-chronic arsenic exposure to SKH-1 mice induced unfolded protein response (UPR)...

  2. Expression of three topologically distinct membrane proteins elicits unique stress response pathways in the yeast Saccharomyces cerevisiae.

    Buck, Teresa M; Jordan, Rick; Lyons-Weiler, James; Adelman, Joshua L; Needham, Patrick G; Kleyman, Thomas R; Brodsky, Jeffrey L

    2015-06-01

    Misfolded membrane proteins are retained in the endoplasmic reticulum (ER) and are subject to ER-associated degradation, which clears the secretory pathway of potentially toxic species. While the transcriptional response to environmental stressors has been extensively studied, limited data exist describing the cellular response to misfolded membrane proteins. To this end, we expressed and then compared the transcriptional profiles elicited by the synthesis of three ER retained, misfolded ion channels: The α-subunit of the epithelial sodium channel, ENaC, the cystic fibrosis transmembrane conductance regulator, CFTR, and an inwardly rectifying potassium channel, Kir2.1, which vary in their mass, membrane topologies, and quaternary structures. To examine transcriptional profiles in a null background, the proteins were expressed in yeast, which was previously used to examine the degradation requirements for each substrate. Surprisingly, the proteins failed to induce a canonical unfolded protein response or heat shock response, although messages encoding several cytosolic and ER lumenal protein folding factors rose when αENaC or CFTR was expressed. In contrast, the levels of these genes were unaltered by Kir2.1 expression; instead, the yeast iron regulon was activated. Nevertheless, a significant number of genes that respond to various environmental stressors were upregulated by all three substrates, and compared with previous microarray data we deduced the existence of a group of genes that reflect a novel misfolded membrane protein response. These data indicate that aberrant proteins in the ER elicit profound yet unique cellular responses. Copyright © 2015 the American Physiological Society.

  3. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    Snyder-Talkington, Brandi N. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Dymacek, Julian [Lane Department of Computer Science and Electrical Engineering, West Virginia University, Morgantown, WV 26506-6070 (United States); Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Pacurari, Maricica [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Denvir, James [Department of Biochemistry and Microbiology, Marshall University, Huntington, WV 25755 (United States); Castranova, Vincent [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Qian, Yong, E-mail: yaq2@cdc.gov [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Guo, Nancy L., E-mail: lguo@hsc.wvu.edu [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States)

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 μg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung

  4. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    Snyder-Talkington, Brandi N.; Dymacek, Julian; Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R.; Pacurari, Maricica; Denvir, James; Castranova, Vincent; Qian, Yong; Guo, Nancy L.

    2013-01-01

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 μg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung

  5. Horizontal acquisition of a hypoxia-responsive molybdenum cofactor biosynthesis pathway contributed to Mycobacterium tuberculosis pathoadaptation.

    Levillain, Florence; Poquet, Yannick; Mallet, Ludovic; Mazères, Serge; Marceau, Michael; Brosch, Roland; Bange, Franz-Christoph; Supply, Philip; Magalon, Axel; Neyrolles, Olivier

    2017-11-01

    The unique ability of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, to persist for long periods of time in lung hypoxic lesions chiefly contributes to the global burden of latent TB. We and others previously reported that the M. tuberculosis ancestor underwent massive episodes of horizontal gene transfer (HGT), mostly from environmental species. Here, we sought to explore whether such ancient HGT played a part in M. tuberculosis evolution towards pathogenicity. We were interested by a HGT-acquired M. tuberculosis-specific gene set, namely moaA1-D1, which is involved in the biosynthesis of the molybdenum cofactor. Horizontal acquisition of this gene set was striking because homologues of these moa genes are present all across the Mycobacterium genus, including in M. tuberculosis. Here, we discovered that, unlike their paralogues, the moaA1-D1 genes are strongly induced under hypoxia. In vitro, a M. tuberculosis moaA1-D1-null mutant has an impaired ability to respire nitrate, to enter dormancy and to survive in oxygen-limiting conditions. Conversely, heterologous expression of moaA1-D1 in the phylogenetically closest non-TB mycobacterium, Mycobacterium kansasii, which lacks these genes, improves its capacity to respire nitrate and grants it with a marked ability to survive oxygen depletion. In vivo, the M. tuberculosis moaA1-D1-null mutant shows impaired survival in hypoxic granulomas in C3HeB/FeJ mice, but not in normoxic lesions in C57BL/6 animals. Collectively, our results identify a novel pathway required for M. tuberculosis resistance to host-imposed stress, namely hypoxia, and provide evidence that ancient HGT bolstered M. tuberculosis evolution from an environmental species towards a pervasive human-adapted pathogen.

  6. Serotonin 2B Receptors in Mesoaccumbens Dopamine Pathway Regulate Cocaine Responses.

    Doly, Stéphane; Quentin, Emily; Eddine, Raphaël; Tolu, Stefania; Fernandez, Sebastian P; Bertran-Gonzalez, Jesus; Valjent, Emmanuel; Belmer, Arnauld; Viñals, Xavier; Callebert, Jacques; Faure, Philippe; Meye, Frank J; Hervé, Denis; Robledo, Patricia; Mameli, Manuel; Launay, Jean-Marie; Maldonado, Rafael; Maroteaux, Luc

    2017-10-25

    Addiction is a maladaptive pattern of behavior following repeated use of reinforcing drugs in predisposed individuals, leading to lifelong changes. Common among these changes are alterations of neurons releasing dopamine in the ventral and dorsal territories of the striatum. The serotonin 5-HT 2B receptor has been involved in various behaviors, including impulsivity, response to antidepressants, and response to psychostimulants, pointing toward putative interactions with the dopamine system. Despite these findings, it remains unknown whether 5-HT 2B receptors directly modulate dopaminergic activity and the possible mechanisms involved. To answer these questions, we investigated the contribution of 5-HT 2B receptors to cocaine-dependent behavioral responses. Male mice permanently lacking 5-HT 2B receptors, even restricted to dopamine neurons, developed heightened cocaine-induced locomotor responses. Retrograde tracing combined with single-cell mRNA amplification indicated that 5-HT 2B receptors are expressed by mesolimbic dopamine neurons. In vivo and ex vivo electrophysiological recordings showed that 5-HT 2B -receptor inactivation in dopamine neurons affects their neuronal activity and increases AMPA-mediated over NMDA-mediated excitatory synaptic currents. These changes are associated with lower ventral striatum dopamine activity and blunted cocaine self-administration. These data identify the 5-HT 2B receptor as a pharmacological intermediate and provide mechanistic insight into attenuated dopamine tone following exposure to drugs of abuse. SIGNIFICANCE STATEMENT Here we report that mice lacking 5-HT 2B receptors totally or exclusively in dopamine neurons exhibit heightened cocaine-induced locomotor responses. Despite the sensitized state of these mice, we found that associated changes include lower ventral striatum dopamine activity and lower cocaine operant self-administration. We described the selective expression of 5-HT 2B receptors in a subpopulation of

  7. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  9. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  10. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  11. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  12. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  13. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  14. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  15. Ethanol Decreases Inflammatory Response in Human Lung Epithelial Cells by Inhibiting the Canonical NF-kB-Pathway

    Katharina Mörs

    2017-08-01

    Full Text Available Background/Aims: Alcohol (ethanol, EtOH as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma was linked to nuclear factor-kappaB (NF-ĸB. Here, we analyzed alcohol`s effects and mechanisms underlying its influence on NF-ĸB-signaling during acute inflammation in human lung epithelial cells. Methods: A549-cells were stimulated with interleukin (IL-1β, or sera from trauma patients (TP or healthy volunteers, with positive/negative blood alcohol concentrations (BAC, and subsequently exposed to EtOH (170 Mm, 1h. IL-6-release and neutrophil adhesion to A549 were analyzed. Specific siRNA-NIK mediated downregulation of non-canonical, and IKK-NBD-inhibition of canonical NF-ĸB signaling were performed. Nuclear levels of activated p50 and p52 NF-ĸB-subunits were detected using TransAm ELISA. Results: Both stimuli significantly induced IL-6-release (39.79±4.70 vs. 0.58±0.8 pg/ml and neutrophil adhesion (132.30±8.80 vs. 100% control, p<0.05 to A549-cells. EtOH significantly decreased IL-6-release (22.90±5.40, p<0.05 and neutrophil adherence vs. controls (105.40±14.5%, p<0.05. IL-1β-induced significant activation of canonical/p50 and non-canonical/p52 pathways. EtOH significantly reduced p50 (34.90±23.70 vs. 197.70±36.43, p<0.05 not p52 activation. Inhibition of canonical pathway was further increased by EtOH (less p50-activation, while p52 remained unaltered. Inhibition of non-canonical pathway was unchanged by EtOH. Conclusion: Here, alcohol`s anti-inflammatory effects are mediated via decreasing nuclear levels of activated p50-subunit and canonical NF-ĸB signaling pathway.

  16. Ethanol Decreases Inflammatory Response in Human Lung Epithelial Cells by Inhibiting the Canonical NF-kB-Pathway.

    Mörs, Katharina; Hörauf, Jason-Alexander; Kany, Shinwan; Wagner, Nils; Sturm, Ramona; Woschek, Mathias; Perl, Mario; Marzi, Ingo; Relja, Borna

    2017-01-01

    Alcohol (ethanol, EtOH) as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma) was linked to nuclear factor-kappaB (NF-ĸB). Here, we analyzed alcohol`s effects and mechanisms underlying its influence on NF-ĸB-signaling during acute inflammation in human lung epithelial cells. A549-cells were stimulated with interleukin (IL)-1β, or sera from trauma patients (TP) or healthy volunteers, with positive/negative blood alcohol concentrations (BAC), and subsequently exposed to EtOH (170 Mm, 1h). IL-6-release and neutrophil adhesion to A549 were analyzed. Specific siRNA-NIK mediated downregulation of non-canonical, and IKK-NBD-inhibition of canonical NF-ĸB signaling were performed. Nuclear levels of activated p50 and p52 NF-ĸB-subunits were detected using TransAm ELISA. Both stimuli significantly induced IL-6-release (39.79±4.70 vs. 0.58±0.8 pg/ml) and neutrophil adhesion (132.30±8.80 vs. 100% control, p<0.05) to A549-cells. EtOH significantly decreased IL-6-release (22.90±5.40, p<0.05) and neutrophil adherence vs. controls (105.40±14.5%, p<0.05). IL-1β-induced significant activation of canonical/p50 and non-canonical/p52 pathways. EtOH significantly reduced p50 (34.90±23.70 vs. 197.70±36.43, p<0.05) not p52 activation. Inhibition of canonical pathway was further increased by EtOH (less p50-activation), while p52 remained unaltered. Inhibition of non-canonical pathway was unchanged by EtOH. Here, alcohol`s anti-inflammatory effects are mediated via decreasing nuclear levels of activated p50-subunit and canonical NF-ĸB signaling pathway. © 2017 The Author(s). Published by S. Karger AG, Basel.

  17. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  18. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  19. Shigella dysenteriae infection activates proinflammatory response through β-catenin/NF-κB signaling pathway.

    Ashidha Gopal

    Full Text Available Shigella dysenteriae (S.dysenteriae the causative agent of bacillary dysentery invades the human colonic epithelium resulting in severe intestinal inflammatory response and epithelial destruction. However, the mechanism by which S.dysenteriae infection regulates proinflammatory cytokines during intestinal inflammation is still obscure. In this study, we evaluated whether the interaction of β-catenin and NF-κB regulates proinflammatory cytokines TNF-α and IL-8 by modulating GSK-3β activity during S.dysenteriae infection in rat ileal loop model. Here we demonstrated that S.dysenteriae infection stimulate β-catenin degradation which in turn decreased the association between NF-κB and β-catenin. Also, we showed that S.dysenteriae infection increased GSK-3β kinase activity which in turn phosphorylates β-catenin for its degradation by ubiquitination and upregulates IL-8 through NF-κB activation thereby leading to inflammation. Thus these findings revealed the role of β-catenin/ NF-κB and GSK-3β in modulating the inflammatory response during bacterial infection and also showed that β-catenin acts as a critical regulator of inflammation.

  20. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  1. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  2. Regulation of heme oxygenase-1 expression and MAPK pathways in response to kaempferol and rhamnocitrin in PC12 cells

    Hong, J.-T.; Yen, J.-H.; Wang Lisu; Lo, Y.-H.; Chen, Z.-T.; Wu, M.-J.

    2009-01-01

    Oxidative stress has been considered as a major cause of cellular injuries in a variety of clinical abnormalities, especially neural diseases. Our aim of research is to investigate the protective effects and mechanisms of kaempferol and rhamnocitrin (kaempferol-7-methyl ether) on oxidative damage in rat pheochromocytoma PC12 cells induced by a limited supply of serum and hydrogen peroxide (H 2 O 2 ). The current result demonstrated that kaempferol protected PC12 cells from serum deprivation-induced apoptosis. Pretreatment of cells with kaempferol also diminished intracellular generation of reactive oxygen species (ROS) in response to H 2 O 2 and strongly elevated cell viability. RT-Q-PCR and Western blotting revealed that kaempferol and rhamnocitrin significantly induced heme oxygenase (HO)-1 gene expression. Addition of zinc protoporphyrin (Znpp), a HO-1 competitive inhibitor, significantly attenuated their protective effects in H 2 O 2 -treated cells, indicating the vital role of HO-1 in cell resistance to oxidative injury. While investigating the signaling pathways responsible for HO-1 induction, we observed that kaempferol induced sustained extracellular signal-regulated protein kinase 1/2 (ERK1/2) in PC12 cells grown in low serum medium; while rhamnocitrin only stimulated transient ERK cascade. Addition of U0126, a highly selective inhibitor of MEK1/2, which is upstream of ERK1/2, had no effect on kaempferol- or rhamnocitrin-induced HO-1 mRNA expression, indicating no direct cross-talk between these two pathways. Furthermore, both kaempferol and rhamnocitrin were able to persistently attenuate p38 phosphorylation. Taking together, the above findings suggest that kaempferol and rhamnocitrin can augment cellular antioxidant defense capacity, at least in part, through regulation of HO-1 expression and MAPK signal transduction.

  3. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  4. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  5. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  6. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  7. ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

    Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

    2017-10-05

    Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

  8. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  9. Genes of the unfolded protein response pathway harbor risk alleles for primary open angle glaucoma.

    Mary Anna Carbone

    Full Text Available The statistical power of genome-wide association (GWA studies to detect risk alleles for human diseases is limited by the unfavorable ratio of SNPs to study subjects. This multiple testing problem can be surmounted with very large population sizes when common alleles of large effects give rise to disease status. However, GWA approaches fall short when many rare alleles may give rise to a common disease, or when the number of subjects that can be recruited is limited. Here, we demonstrate that this multiple testing problem can be overcome by a comparative genomics approach in which an initial genome-wide screen in a genetically amenable model organism is used to identify human orthologues that may harbor risk alleles for adult-onset primary open angle glaucoma (POAG. Glaucoma is a major cause of blindness, which affects over 60 million people worldwide. Several genes have been associated with juvenile onset glaucoma, but genetic factors that predispose to adult onset primary open angle glaucoma (POAG remain largely unknown. Previous genome-wide analysis in a Drosophila ocular hypertension model identified transcripts with altered regulation and showed induction of the unfolded protein response (UPR upon overexpression of transgenic human glaucoma-associated myocilin (MYOC. We selected 16 orthologous genes with 62 polymorphic markers and identified in two independent human populations two genes of the UPR that harbor POAG risk alleles, BIRC6 and PDIA5. Thus, effectiveness of the UPR in response to accumulation of misfolded or aggregated proteins may contribute to the pathogenesis of POAG and provide targets for early therapeutic intervention.

  10. Genes of the unfolded protein response pathway harbor risk alleles for primary open angle glaucoma.

    Carbone, Mary Anna; Chen, Yuhong; Hughes, Guy A; Weinreb, Robert N; Zabriskie, Norman A; Zhang, Kang; Anholt, Robert R H

    2011-01-01

    The statistical power of genome-wide association (GWA) studies to detect risk alleles for human diseases is limited by the unfavorable ratio of SNPs to study subjects. This multiple testing problem can be surmounted with very large population sizes when common alleles of large effects give rise to disease status. However, GWA approaches fall short when many rare alleles may give rise to a common disease, or when the number of subjects that can be recruited is limited. Here, we demonstrate that this multiple testing problem can be overcome by a comparative genomics approach in which an initial genome-wide screen in a genetically amenable model organism is used to identify human orthologues that may harbor risk alleles for adult-onset primary open angle glaucoma (POAG). Glaucoma is a major cause of blindness, which affects over 60 million people worldwide. Several genes have been associated with juvenile onset glaucoma, but genetic factors that predispose to adult onset primary open angle glaucoma (POAG) remain largely unknown. Previous genome-wide analysis in a Drosophila ocular hypertension model identified transcripts with altered regulation and showed induction of the unfolded protein response (UPR) upon overexpression of transgenic human glaucoma-associated myocilin (MYOC). We selected 16 orthologous genes with 62 polymorphic markers and identified in two independent human populations two genes of the UPR that harbor POAG risk alleles, BIRC6 and PDIA5. Thus, effectiveness of the UPR in response to accumulation of misfolded or aggregated proteins may contribute to the pathogenesis of POAG and provide targets for early therapeutic intervention.

  11. Role of genetic polymorphisms in NFKB-mediated inflammatory pathways in response to primary chemoradiation therapy for rectal cancer.

    Dzhugashvili, Maia; Luengo-Gil, Ginés; García, Teresa; González-Conejero, Rocío; Conesa-Zamora, Pablo; Escolar, Pedro Pablo; Calvo, Felipe; Vicente, Vicente; Ayala de la Peña, Francisco

    2014-11-01

    To investigate whether polymorphisms of genes related to inflammation are associated with pathologic response (primary endpoint) in patients with rectal cancer treated with primary chemoradiation therapy (PCRT). Genomic DNA of 159 patients with locally advanced rectal cancer treated with PCRT was genotyped for polymorphisms rs28362491 (NFKB1), rs1213266/rs5789 (PTGS1), rs5275 (PTGS2), and rs16944/rs1143627 (IL1B) using TaqMan single nucleotide polymorphism genotyping assays. The association between each genotype and pathologic response (poor response vs complete or partial response) was analyzed using logistic regression models. The NFKB1 DEL/DEL genotype was associated with pathologic response (odds ratio [OR], 6.39; 95% confidence interval [CI], 0.78-52.65; P=.03) after PCRT. No statistically significant associations between other polymorphisms and response to PCRT were observed. Patients with the NFKB1 DEL/DEL genotype showed a trend for longer disease-free survival (log-rank test, P=.096) and overall survival (P=.049), which was not significant in a multivariate analysis that included pathologic response. Analysis for 6 polymorphisms showed that patients carrying the haplotype rs28362491-DEL/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G (13.7% of cases) had a higher response rate to PCRT (OR, 8.86; 95% CI, 1.21-64.98; P=.034) than the reference group (rs28362491-INS/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G). Clinically significant (grade ≥2) acute organ toxicity was also more frequent in patients with that same haplotype (OR, 4.12; 95% CI, 1.11-15.36; P=.037). Our results suggest that genetic variation in NFKB-related inflammatory pathways might influence sensitivity to primary chemoradiation for rectal cancer. If confirmed, an inflammation-related radiogenetic profile might be used to select patients with rectal cancer for preoperative combined-modality treatment. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Role of Genetic Polymorphisms in NFKB-Mediated Inflammatory Pathways in Response to Primary Chemoradiation Therapy for Rectal Cancer

    Dzhugashvili, Maia; Luengo-Gil, Ginés; García, Teresa; González-Conejero, Rocío; Conesa-Zamora, Pablo; Escolar, Pedro Pablo; Calvo, Felipe; Vicente, Vicente; Ayala de la Peña, Francisco

    2014-01-01

    Purpose: To investigate whether polymorphisms of genes related to inflammation are associated with pathologic response (primary endpoint) in patients with rectal cancer treated with primary chemoradiation therapy (PCRT). Methods and Materials: Genomic DNA of 159 patients with locally advanced rectal cancer treated with PCRT was genotyped for polymorphisms rs28362491 (NFKB1), rs1213266/rs5789 (PTGS1), rs5275 (PTGS2), and rs16944/rs1143627 (IL1B) using TaqMan single nucleotide polymorphism genotyping assays. The association between each genotype and pathologic response (poor response vs complete or partial response) was analyzed using logistic regression models. Results: The NFKB1 DEL/DEL genotype was associated with pathologic response (odds ratio [OR], 6.39; 95% confidence interval [CI], 0.78-52.65; P=.03) after PCRT. No statistically significant associations between other polymorphisms and response to PCRT were observed. Patients with the NFKB1 DEL/DEL genotype showed a trend for longer disease-free survival (log-rank test, P=.096) and overall survival (P=.049), which was not significant in a multivariate analysis that included pathologic response. Analysis for 6 polymorphisms showed that patients carrying the haplotype rs28362491-DEL/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G (13.7% of cases) had a higher response rate to PCRT (OR, 8.86; 95% CI, 1.21-64.98; P=.034) than the reference group (rs28362491-INS/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G). Clinically significant (grade ≥2) acute organ toxicity was also more frequent in patients with that same haplotype (OR, 4.12; 95% CI, 1.11-15.36; P=.037). Conclusions: Our results suggest that genetic variation in NFKB-related inflammatory pathways might influence sensitivity to primary chemoradiation for rectal cancer. If confirmed, an inflammation-related radiogenetic profile might be used to select patients with rectal cancer for preoperative combined-modality treatment

  13. Regulation of HIV-Gag Expression and Targeting to the Endolysosomal/Secretory Pathway by the Luminal Domain of Lysosomal-Associated Membrane Protein (LAMP-1) Enhance Gag-Specific Immune Response

    Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros

    2014-01-01

    We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692

  14. Liver genomic responses to ciguatoxin: evidence for activation of phase I and phase II detoxification pathways following an acute hypothermic response in mice.

    Morey, Jeanine S; Ryan, James C; Bottein Dechraoui, Marie-Yasmine; Rezvani, Amir H; Levin, Edward D; Gordon, Christopher J; Ramsdell, John S; Van Dolah, Frances M

    2008-06-01

    Ciguatoxins (CTX) are polyether neurotoxins that target voltage-gated sodium channels and are responsible for ciguatera, the most common fish-borne food poisoning in humans. This study characterizes the global transcriptional response of mouse liver to a symptomatic dose (0.26 ng/g) of the highly potent Pacific ciguatoxin-1 (P-CTX-1). At 1 h post-exposure 2.4% of features on a 44K whole genome array were differentially expressed (p or = 1.5 and p < or = 0.0001 in at least one time point) and a trend set of 1550 genes were used for further analysis. Early gene expression was likely influenced prominently by an acute 4 degrees C decline in core body temperature by 1 h, which resolved by 8 h following exposure. An initial downregulation of 32 different solute carriers, many involved in sodium transport, was observed. Differential gene expression in pathways involving eicosanoid biosynthesis and cholesterol homeostasis was also noted. Cytochrome P450s (Cyps) were of particular interest due to their role in xenobiotic metabolism. Twenty-seven genes, mostly members of Cyp2 and Cyp4 families, showed significant changes in expression. Many Cyps underwent an initial downregulation at 1 h but were quickly and strongly upregulated at 4 and 24 h post-exposure. In addition to Cyps, increases in several glutathione S-transferases were observed, an indication that both phase I and phase II metabolic reactions are involved in the hepatic response to CTX in mice.

  15. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  16. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  17. Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria

    Herrou, Julien; Willett, Jonathan W.; Czy; #380; , Daniel M.; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean (UC)

    2016-12-19

    ABSTRACT

    Brucella abortusσE1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σE1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σSinEnterobacteriaceae, which suggests a functional role for this transport system in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σE1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li+ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure

  18. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  19. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  20. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  1. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  2. Complexity of the Microglial Activation Pathways that Drive Innate Host Responses During Lethal Alphavirus Encephalitis in Mice

    Nilufer Esen

    2012-04-01

    Full Text Available Microglia express multiple TLRs (Toll-like receptors and provide important host defence against viruses that invade the CNS (central nervous system. Although prior studies show these cells become activated during experimental alphavirus encephalitis in mice to generate cytokines and chemokines that influence virus replication, tissue inflammation and neuronal survival, the specific PRRs (pattern recognition receptors and signalling intermediates controlling microglial activation in this setting remain unknown. To investigate these questions directly in vivo, mice ablated of specific TLR signalling molecules were challenged with NSV (neuroadapted Sindbis virus and CNS viral titres, inflammatory responses and clinical outcomes followed over time. To approach this problem specifically in microglia, the effects of NSV on primary cells derived from the brains of wild-type and mutant animals were characterized in vitro. From the standpoint of the virus, microglial activation required viral uncoating and an intact viral genome; inactivated virus particles did not elicit measurable microglial responses. At the level of the target cell, NSV triggered multiple PRRs in microglia to produce a broad range of inflammatory mediators via non-overlapping signalling pathways. In vivo, disease survival was surprisingly independent of TLR-driven responses, but still required production of type-I IFN (interferon to control CNS virus replication. Interestingly, the ER (endoplasmic reticulum protein UNC93b1 facilitated host survival independent of its known effects on endosomal TLR signalling. Taken together, these data show that alphaviruses activate microglia via multiple PRRs, highlighting the complexity of the signalling networks by which CNS host responses are elicited by these infections.

  3. Transformation of binaural response properties in the ascending auditory pathway: influence of time-varying interaural phase disparity.

    Spitzer, M W; Semple, M N

    1998-12-01

    Transformation of binaural response properties in the ascending auditory pathway: influence of time-varying interaural phase disparity. J. Neurophysiol. 80: 3062-3076, 1998. Previous studies demonstrated that tuning of inferior colliculus (IC) neurons to interaural phase disparity (IPD) is often profoundly influenced by temporal variation of IPD, which simulates the binaural cue produced by a moving sound source. To determine whether sensitivity to simulated motion arises in IC or at an earlier stage of binaural processing we compared responses in IC with those of two major IPD-sensitive neuronal classes in the superior olivary complex (SOC), neurons whose discharges were phase locked (PL) to tonal stimuli and those that were nonphase locked (NPL). Time-varying IPD stimuli consisted of binaural beats, generated by presenting tones of slightly different frequencies to the two ears, and interaural phase modulation (IPM), generated by presenting a pure tone to one ear and a phase modulated tone to the other. IC neurons and NPL-SOC neurons were more sharply tuned to time-varying than to static IPD, whereas PL-SOC neurons were essentially uninfluenced by the mode of stimulus presentation. Preferred IPD was generally similar in responses to static and time-varying IPD for all unit populations. A few IC neurons were highly influenced by the direction and rate of simulated motion, but the major effect for most IC neurons and all SOC neurons was a linear shift of preferred IPD at high rates-attributable to response latency. Most IC and NPL-SOC neurons were strongly influenced by IPM stimuli simulating motion through restricted ranges of azimuth; simulated motion through partially overlapping azimuthal ranges elicited discharge profiles that were highly discontiguous, indicating that the response associated with a particular IPD is dependent on preceding portions of the stimulus. In contrast, PL-SOC responses tracked instantaneous IPD throughout the trajectory of simulated

  4. Regular Exercise Enhances the Immune Response Against Microbial Antigens Through Up-Regulation of Toll-like Receptor Signaling Pathways

    Qishi Zheng

    2015-09-01

    Full Text Available Background/Aims: Regular physical exercise can enhance resistance to many microbial infections. However, little is known about the mechanism underlying the changes in the immune system induced by regular exercise. Methods: We recruited members of a university badminton club as the regular exercise (RE group and healthy sedentary students as the sedentary control (SC group. We investigated the distribution of peripheral blood mononuclear cell (PBMC subsets and functions in the two groups. Results: There were no significant differences in plasma cytokine levels between the RE and SC groups in the true resting state. However, enhanced levels of IFN-γ, TNF-α, IL-6, IFN-α and IL-12 were secreted by PBMCs in the RE group following microbial antigen stimulation, when compared to the SC group. In contrast, the levels of TNF-α and IL-6 secreted by PBMC in the RE group were suppressed compared with those in SC group following non-microbial antigen stimulation (concanavalin A or α-galactosylceramide. Furthermore, PBMC expression of TLR2, TLR7 and MyD88 was significantly increased in the RE group in response to microbial antigen stimulation. Conclusion: Regular exercise enhances immune cell activation in response to pathogenic stimulation leading to enhanced cytokine production mediated via the TLR signaling pathways.

  5. Platelet-activating factor receptor (PAF-R)-dependent pathways control tumour growth and tumour response to chemotherapy

    Oliveira, Soraya I de; Andrade, Luciana NS; Onuchic, Ana C; Nonogaki, Sueli; Fernandes, Patrícia D; Pinheiro, Mônica C; Rohde, Ciro BS; Chammas, Roger; Jancar, Sonia

    2010-01-01

    Phagocytosis of apoptotic cells by macrophages induces a suppressor phenotype. Previous data from our group suggested that this occurs via Platelet-activating factor receptor (PAF-R)-mediated pathways. In the present study, we investigated the impact of apoptotic cell inoculation or induction by a chemotherapeutic agent (dacarbazine, DTIC) on tumour growth, microenvironmental parameters and survival, and the effect of treatment with a PAF-R antagonist (WEB2170). These studies were performed in murine tumours: Ehrlich Ascitis Tumour (EAT) and B16F10 melanoma. Tumour growth was assessed by direct counting of EAT cells in the ascitis or by measuring the volume of the solid tumour. Parameters of the tumour microenvironment, such as the frequency of cells expressing cyclo-oxygenase-2 (COX-2), caspase-3 and galectin-3, and microvascular density, were determined by immunohistochemistry. Levels of vascular endothelium growth factor (VEGF) and prostaglandin E2 (PGE2) were determined by ELISA, and levels of nitric oxide (NO) by Griess reaction. PAF-R expression was analysed by immunohistochemistry and flow cytometry. Inoculation of apoptotic cells before EAT implantation stimulated tumour growth. This effect was reversed by in vivo pre-treatment with WEB2170. This treatment also reduced tumour growth and modified the microenvironment by reducing PGE2, VEGF and NO production. In B16F10 melanoma, WEB2170 alone or in association with DTIC significantly reduced tumour volume. Survival of the tumour-bearing mice was not affected by WEB2170 treatment but was significantly improved by the combination of DTIC with WEB2170. Tumour microenvironment elements were among the targets of the combination therapy since the relative frequency of COX-2 and galectin-3 positive cells and the microvascular density within the tumour mass were significantly reduced by treatment with WEB2170 or DTIC alone or in combination. Antibodies to PAF-R stained the cells from inside the tumour, but not the

  6. Early transcriptional response to aminoglycoside antibiotic suggests alternate pathways leading to apoptosis of sensory hair cells in the mouse inner ear

    Neil eSegil

    2015-05-01

    Full Text Available Aminoglycoside antibiotics are the drug of choice for treating many bacterial infections, but their administration results in hearing loss in nearly one fourth of the patients who receive them. Several biochemical pathways have been implicated in aminoglycoside antibiotic ototoxicity; however, little is known about how hair cells respond to aminoglycoside antibiotics at the transcriptome level. Here we have investigated the genome-wide response to the aminoglycoside antibiotic gentamicin. Using organotypic cultures of the perinatal organ of Corti, we performed RNA sequencing using cDNA libraries obtained from FACS-purified hair cells. Within 3 hours of gentamicin treatment, the messenger RNA level of more than three thousand genes in hair cells changed significantly. Bioinformatic analysis of these changes highlighted several known signal transduction pathways, including the JNK pathway and the NF-κB pathway, in addition to genes involved in the stress response, apoptosis, cell cycle control, and DNA damage repair. In contrast, only 698 genes, mainly involved in cell cycle and metabolite biosynthetic processes, were significantly affected in the non-hair cell population. The gene expression profiles of hair cells in response to gentamicin share a considerable similarity with those previously observed in gentamicin-induced nephrotoxicity. Our findings suggest that previously observed early responses to gentamicin in hair cells in specific signaling pathways are reflected in changes in gene expression. Additionally, the observed changes in gene expression of cell cycle regulatory genes indicate a disruption of the postmitotic state, which may suggest an alternative pathway regulating gentamicin-induced hair cell death. This work provides a more comprehensive view of aminoglycoside antibiotic ototoxicity, and thus contribute to identifying potential pathways or therapeutic targets to alleviate this important side effect of aminoglycoside

  7. Pantoprazole blocks the JAK2/STAT3 pathway to alleviate skeletal muscle wasting in cancer cachexia by inhibiting inflammatory response.

    Guo, Dunwei; Wang, Chaoyi; Wang, Qiang; Qiao, Zhongpeng; Tang, Hua

    2017-06-13

    Cancer cachexia is often present in patients with advanced malignant tumors, and the subsequent body weight reduction results in poor quality of life. However, there has been no progress in developing effective clinical therapeutic strategies for skeletal muscle wasting in cancer cachexia. Herein, we explored the functions of pantoprazole on cancer cachexia skeletal muscle wasting. The mouse colon adenocarcinoma cell line C26 was inoculated in the right forelimb of male BALB/C mice to establish a cancer cachexia model. The animals were treated with or without different concentrations of pantoprazole orally, and the body weight, tumor growth, spontaneous activity, and muscle functions were determined at various time points. Two weeks later, the levels of serum IL-6 and TNF-α, the mRNA levels of gastrocnemius JAK2 and STAT3, and the expression levels of p-JAK2, p-STAT3, Fbx32, and MuRF1 were examined with ELISA assay, qRT-PCR assay, and Western blotting, respectively. Further studies were performed to assess the levels of Fbx32 and MuRF1 expression and morphological changes. Pantoprazole can alleviate cancer cachexia-induced body weight reduction and inhibit skeletal muscle wasting in a dose-dependent manner. Our results indicated that pantoprazole treatment can decrease the levels of serum IL-6 and TNF-α (56.3% and 67.6%, respectively), and inhibit the activation of the JAK2/STAT3 signaling pathway. Moreover, the expression levels of MuRF1 and Fbx32 were also suppressed after pantoprazole treatment. Our findings suggested that pantoprazole can alleviate cancer cachexia skeletal muscle wasting by inhibiting the inflammatory response and blocking the JAK2/STAT3 or ubiquitin proteasome pathway.

  8. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  9. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  10. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  11. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  12. Assessing Basal and Acute Autophagic Responses in the Adult Drosophila Nervous System: The Impact of Gender, Genetics and Diet on Endogenous Pathway Profiles.

    Eric P Ratliff

    Full Text Available The autophagy pathway is critical for the long-term homeostasis of cells and adult organisms and is often activated during periods of stress. Reduced pathway efficacy plays a central role in several progressive neurological disorders that are associated with the accumulation of cytotoxic peptides and protein aggregates. Previous studies have shown that genetic and transgenic alterations to the autophagy pathway impacts longevity and neural aggregate profiles of adult Drosophila. In this study, we have identified methods to measure the acute in vivo induction of the autophagy pathway in the adult fly CNS. Our findings indicate that the genotype, age, and gender of adult flies can influence pathway responses. Further, we demonstrate that middle-aged male flies exposed to intermittent fasting (IF had improved neuronal autophagic profiles. IF-treated flies also had lower neural aggregate profiles, maintained more youthful behaviors and longer lifespans, when compared to ad libitum controls. In summary, we present methodology to detect dynamic in vivo changes that occur to the autophagic profiles in the adult Drosophila CNS and that a novel IF-treatment protocol improves pathway response in the aging nervous system.

  13. Survival pathways under stress

    First page Back Continue Last page Graphics. Survival pathways under stress. Bacteria survive by changing gene expression. pattern. Three important pathways will be discussed: Stringent response. Quorum sensing. Proteins performing function to control oxidative damage.

  14. Ethylene Responses in Rice Roots and Coleoptiles Are Differentially Regulated by a Carotenoid Isomerase-Mediated Abscisic Acid Pathway[OPEN

    Yin, Cui-Cui; Ma, Biao; Collinge, Derek Phillip; Pogson, Barry James; He, Si-Jie; Xiong, Qing; Duan, Kai-Xuan; Chen, Hui; Yang, Chao; Lu, Xiang; Wang, Yi-Qin; Zhang, Wan-Ke; Chu, Cheng-Cai; Sun, Xiao-Hong; Fang, Shuang; Chu, Jin-Fang; Lu, Tie-Gang; Chen, Shou-Yi; Zhang, Jin-Song

    2015-01-01

    Ethylene and abscisic acid (ABA) act synergistically or antagonistically to regulate plant growth and development. ABA is derived from the carotenoid biosynthesis pathway. Here, we analyzed the interplay among ethylene, carotenoid biogenesis, and ABA in rice (Oryza sativa) using the rice ethylene response mutant mhz5, which displays a reduced ethylene response in roots but an enhanced ethylene response in coleoptiles. We found that MHZ5 encodes a carotenoid isomerase and that the mutation in mhz5 blocks carotenoid biosynthesis, reduces ABA accumulation, and promotes ethylene production in etiolated seedlings. ABA can largely rescue the ethylene response of the mhz5 mutant. Ethylene induces MHZ5 expression, the production of neoxanthin, an ABA biosynthesis precursor, and ABA accumulation in roots. MHZ5 overexpression results in enhanced ethylene sensitivity in roots and reduced ethylene sensitivity in coleoptiles. Mutation or overexpression of MHZ5 also alters the expression of ethylene-responsive genes. Genetic studies revealed that the MHZ5-mediated ABA pathway acts downstream of ethylene signaling to inhibit root growth. The MHZ5-mediated ABA pathway likely acts upstream but negatively regulates ethylene signaling to control coleoptile growth. Our study reveals novel interactions among ethylene, carotenogenesis, and ABA and provides insight into improvements in agronomic traits and adaptive growth through the manipulation of these pathways in rice. PMID:25841037

  15. Propranolol modulates the collateral vascular responsiveness to vasopressin via a G(α)-mediated pathway in portal hypertensive rats.

    Lee, Jing-Yi; Huo, Teh-Ia; Huang, Hui-Chun; Lee, Fa-Yauh; Lin, Han-Chieh; Chuang, Chiao-Lin; Chang, Ching-Chih; Wang, Sun-Sang; Lee, Shou-Dong

    2011-12-01

    Gastro-oesophageal variceal haemorrhage is one of the most dreadful complications of portal hypertension and can be controlled with vasoconstrictors. Nevertheless, sympathetic tone abnormality and vascular hyporesponsiveness in portal hypertension may impede the haemostatic effects of vasoconstrictors. Propranolol, a β-blocker binding the G-protein-coupled adrenoceptor, is a portal hypotensive agent. However, whether propranolol influences the collateral vasoresponse is unknown. Portal hypertension was induced by PVL (portal vein ligation) in Sprague-Dawley rats. In an acute study with an in situ perfusion model, the collateral responsiveness to AVP (arginine vasopressin) was evaluated with vehicle, propranolol (10 μmol/l), propranolol plus suramin (100 μmol/l, a G(α) inhibitor) or suramin pre-incubation. G(α) mRNA expression in the splenorenal shunt, the most prominent intra-abdominal collateral vessel, was measured. In the chronic study, rats received DW (distilled water) or propranolol (10 mg x kg(-1) of body weight x day(-1)) for 9 days. Then the concentration-response relationship of AVP and G(α) mRNA expression were assessed. Propranolol pre-incubation elevated the perfusion pressure changes of collaterals in response to AVP, which was inhibited by suramin. The splenorenal shunt G(αq) and G(α11) mRNA expression were enhanced by propranolol. The group treated with propranolol plus suramin had a down-regulation of G(α11) as compared with the propranolol group. Chronic propranolol treatment reduced mean arterial pressure, PP (portal pressure) and the perfusion pressure changes of collaterals to AVP. G(αs) expression was up-regulated. In conclusion, propranolol pre-incubation enhanced the portal-systemic collateral AVP responsiveness in portal hypertensive rats, which was related to G(αq) and G(α11) up-regulation. In contrast, the attenuated AVP responsiveness by chronic propranolol treatment was related to G(αs) up-regulation. The G(α) signalling

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  17. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  18. Ginsenoside F2 reduces hair loss by controlling apoptosis through the sterol regulatory element-binding protein cleavage activating protein and transforming growth factor-β pathways in a dihydrotestosterone-induced mouse model.

    Shin, Heon-Sub; Park, Sang-Yong; Hwang, Eun-Son; Lee, Don-Gil; Mavlonov, Gafurjon Turdalievich; Yi, Tae-Hoo

    2014-01-01

    This study was conducted to test whether ginsenoside F2 can reduce hair loss by influencing sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and the transforming growth factor beta (TGF-β) pathway of apoptosis in dihydrotestosterone (DHT)-treated hair cells and in a DHT-induced hair loss model in mice. Results for ginsenoside F2 were compared with finasteride. DHT inhibits proliferation of hair cells and induces androgenetic alopecia and was shown to activate an apoptosis signal pathway both in vitro and in vivo. The cell-based 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that the proliferation rates of DHT-treated human hair dermal papilla cells (HHDPCs) and HaCaTs increased by 48% in the ginsenoside F2-treated group and by 12% in the finasteride-treated group. Western blot analysis showed that ginsenoside F2 decreased expression of TGF-β2 related factors involved in hair loss. The present study suggested a hair loss related pathway by changing SCAP related apoptosis pathway, which has been known to control cholesterol metabolism. SCAP, sterol regulatory element-binding protein (SREBP) and caspase-12 expression in the ginsenoside F2-treated group were decreased compared to the DHT and finasteride-treated group. C57BL/6 mice were also prepared by injection with DHT and then treated with ginsenoside F2 or finasteride. Hair growth rate, density, thickness measurements and tissue histotological analysis in these groups suggested that ginsenoside F2 suppressed hair cell apoptosis and premature entry to catagen more effectively than finasteride. Our results indicated that ginsenoside F2 decreased the expression of TGF-β2 and SCAP proteins, which have been suggested to be involved in apoptosis and entry into catagen. This study provides evidence those factors in the SCAP pathway could be targets for hair loss prevention drugs.

  19. Early brain response to low-dose radiation exposure involves molecular networks and pathways associated with cognitive functions, advanced aging and Alzheimer's disease.

    Lowe, Xiu R; Bhattacharya, Sanchita; Marchetti, Francesco; Wyrobek, Andrew J

    2009-01-01

    Understanding the cognitive and behavioral consequences of brain exposures to low-dose ionizing radiation has broad relevance for health risks from medical radiation diagnostic procedures, radiotherapy and environmental nuclear contamination as well as for Earth-orbit and space missions. Analyses of transcriptome profiles of mouse brain tissue after whole-body irradiation showed that low-dose exposures (10 cGy) induced genes not affected by high-dose radiation (2 Gy) and that low-dose genes were associated with unique pathways and functions. The low-dose response had two major components: pathways that are consistently seen across tissues and pathways that were specific for brain tissue. Low-dose genes clustered into a saturated network (P < 10(-53)) containing mostly down-regulated genes involving ion channels, long-term potentiation and depression, vascular damage, etc. We identified nine neural signaling pathways that showed a high degree of concordance in their transcriptional response in mouse brain tissue after low-dose irradiation, in the aging human brain (unirradiated), and in brain tissue from patients with Alzheimer's disease. Mice exposed to high-dose radiation did not show these effects and associations. Our findings indicate that the molecular response of the mouse brain within a few hours after low-dose irradiation involves the down-regulation of neural pathways associated with cognitive dysfunctions that are also down-regulated in normal human aging and Alzheimer's disease.

  20. Early Brain Response to Low-Dose Radiation Exposure Involves Molecular Networks and Pathways Associated with Cognitive Functions, Advanced Aging and Alzheimer's Disease

    Lowe, Xiu R.; Bhattacharya, Sanchita; Marchetti, Francesco; Wyrobek, Andrew J.

    2008-01-01

    Understanding the cognitive and behavioral consequences of brain exposures to low-dose ionizing radiation has broad relevance for health risks from medical radiation diagnostic procedures, radiotherapy, environmental nuclear contamination, as well as earth orbit and space missions. Analyses of transcriptome profiles of murine brain tissue after whole-body radiation showed that low-dose exposures (10 cGy) induced genes not affected by high dose (2 Gy), and low-dose genes were associated with unique pathways and functions. The low-dose response had two major components: pathways that are consistently seen across tissues, and pathways that were brain tissue specific. Low-dose genes clustered into a saturated network (p -53 ) containing mostly down-regulated genes involving ion channels, long-term potentiation and depression, vascular damage, etc. We identified 9 neural signaling pathways that showed a high degree of concordance in their transcriptional response in mouse brain tissue after low-dose radiation, in the aging human brain (unirradiated), and in brain tissue from patients with Alzheimer's disease. Mice exposed to high-dose radiation did not show these effects and associations. Our findings indicate that the molecular response of the mouse brain within a few hours after low-dose irradiation involves the down-regulation of neural pathways associated with cognitive dysfunctions that are also down regulated in normal human aging and Alzheimer's disease

  1. Early Brain Response to Low-Dose Radiation Exposure Involves Molecular Networks and Pathways Associated with Cognitive Functions, Advanced Aging and Alzheimer's Disease

    Lowe, Xiu R; Bhattacharya, Sanchita; Marchetti, Francesco; Wyrobek, Andrew J.

    2008-06-06

    Understanding the cognitive and behavioral consequences of brain exposures to low-dose ionizing radiation has broad relevance for health risks from medical radiation diagnostic procedures, radiotherapy, environmental nuclear contamination, as well as earth orbit and space missions. Analyses of transcriptome profiles of murine brain tissue after whole-body radiation showed that low-dose exposures (10 cGy) induced genes not affected by high dose (2 Gy), and low-dose genes were associated with unique pathways and functions. The low-dose response had two major components: pathways that are consistently seen across tissues, and pathways that were brain tissue specific. Low-dose genes clustered into a saturated network (p < 10{sup -53}) containing mostly down-regulated genes involving ion channels, long-term potentiation and depression, vascular damage, etc. We identified 9 neural signaling pathways that showed a high degree of concordance in their transcriptional response in mouse brain tissue after low-dose radiation, in the aging human brain (unirradiated), and in brain tissue from patients with Alzheimer's disease. Mice exposed to high-dose radiation did not show these effects and associations. Our findings indicate that the molecular response of the mouse brain within a few hours after low-dose irradiation involves the down-regulation of neural pathways associated with cognitive dysfunctions that are also down regulated in normal human aging and Alzheimer's disease.

  2. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  3. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  4. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  5. Systems Biology Model of Interactions between Tissue Growth Factors and DNA Damage Pathways: Low Dose Response and Cross-Talk in TGFβ and ATM Signaling

    Cucinotta, Francis A

    2016-01-01

    The etiology of radiation carcinogenesis has been described in terms of aberrant changes that span several levels of biological organization. Growth factors regulate many important cellular and tissue functions including apoptosis, differentiation and proliferation. A variety of genetic and epigenetic changes of growth factors have been shown to contribute to cancer initiation and progression. It is known that cellular and tissue damage to ionizing radiation is in part initiated by the production of reactive oxygen species, which can activate cytokine signaling, and the DNA damage response pathways, most notably the ATM signaling pathway. Recently, the transforming growth factor β (TGFβ) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation. The relevance of this interaction with the ATM pathway is not known although p53 becomes phosphorylated and DNA damage responses are involved. However, growth factor interactions with DNA damage responses have not been elucidated particularly at low doses, and further characterization of their relationship to cancer processes is warranted. Our goal will be to use a systems biology approach to mathematically and experimentally describe the low-dose responses and cross-talk between the ATM and TGFβ pathways initiated by low- and high-LET radiation. We will characterize ATM and TGFβ signaling in epithelial and fibroblast cells using 2D models and ultimately extending to 3D organotypic cell culture models to begin to elucidate possible differences that may occur for different cell types and/or inter-cellular communication. We will investigate the roles of the Smad and Activating transcription factor 2 (ATF2) proteins as the potential major contributors to crosstalk between the TGFβ and ATM pathways, and links to cell cycle control and/or the DNA damage response, and potential differences in their responses at low and high doses. We have developed various experimental

  6. Systems Biology Model of Interactions Between Tissue Growth Factors and DNA Damage Pathways: Low Dose Response and Cross-Talk in TGFbeta and ATM Signaling

    O' Neill, Peter [University of Oxford; Anderson, Jennifer [University of Oxford

    2014-10-02

    The etiology of radiation carcinogenesis has been described in terms of aberrant changes that span several levels of biological organization. Growth factors regulate many important cellular and tissue functions including apoptosis, differentiation and proliferation. A variety of genetic and epigenetic changes of growth factors have been shown to contribute to cancer initiation and progression. It is known that cellular and tissue damage to ionizing radiation is in part initiated by the production of reactive oxygen species, which can activate cytokine signaling, and the DNA damage response pathways, most notably the ATM signaling pathway. Recently the transforming growth factor β (TGFβ) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation. The relevance of this interaction with the ATM pathway is not known although p53 becomes phosphorylated and DNA damage responses are involved. However, growth factor interactions with DNA damage responses have not been elucidated particularly at low doses and further characterization of their relationship to cancer processes is warranted. Our goal will be to use a systems biology approach to mathematically and experimentally describe the low dose responses and cross-talk between the ATM and TGFβ pathways initiated by low and high LET radiation. We will characterize ATM and TGFβ signaling in epithelial and fibroblast cells using 2D models and ultimately extending to 3D organotypic cell culture models to begin to elucidate possible differences that may occur for different cell types and/or inter-cellular communication. We will investigate the roles of the Smad and Activating transcription factor 2 (ATF2) proteins as the potential major contributors to cross- talk between the TGFβ and ATM pathways, and links to cell cycle control and/or the DNA damage response, and potential differences in their responses at low and high doses. We have developed various experimental

  7. Systems Biology Model of Interactions between Tissue Growth Factors and DNA Damage Pathways: Low Dose Response and Cross-Talk in TGFβ and ATM Signaling

    Cucinotta, Francis A [Univ. of Nevada, Las Vegas, NV (United States)

    2016-09-01

    The etiology of radiation carcinogenesis has been described in terms of aberrant changes that span several levels of biological organization. Growth factors regulate many important cellular and tissue functions including apoptosis, differentiation and proliferation. A variety of genetic and epigenetic changes of growth factors have been shown to contribute to cancer initiation and progression. It is known that cellular and tissue damage to ionizing radiation is in part initiated by the production of reactive oxygen species, which can activate cytokine signaling, and the DNA damage response pathways, most notably the ATM signaling pathway. Recently, the transforming growth factor β (TGFβ) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation. The relevance of this interaction with the ATM pathway is not known although p53 becomes phosphorylated and DNA damage responses are involved. However, growth factor interactions with DNA damage responses have not been elucidated particularly at low doses, and further characterization of their relationship to cancer processes is warranted. Our goal will be to use a systems biology approach to mathematically and experimentally describe the low-dose responses and cross-talk between the ATM and TGFβ pathways initiated by low- and high-LET radiation. We will characterize ATM and TGFβ signaling in epithelial and fibroblast cells using 2D models and ultimately extending to 3D organotypic cell culture models to begin to elucidate possible differences that may occur for different cell types and/or inter-cellular communication. We will investigate the roles of the Smad and Activating transcription factor 2 (ATF2) proteins as the potential major contributors to crosstalk between the TGFβ and ATM pathways, and links to cell cycle control and/or the DNA damage response, and potential differences in their responses at low and high doses. We have developed various experimental

  8. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  9. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  10. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  11. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of