WorldWideScience

Sample records for response element located

  1. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  2. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  3. Apparatus for locating defective nuclear fuel elements

    Lawrie, W.E.

    1979-01-01

    An ultrasonic search unit for locating defective fuel elements within a fuel assembly used in a water cooled nuclear reactor is presented. The unit is capable of freely traversing the restricted spaces between the fuel elements

  4. Detection and location of leaking TRIGA fuel elements

    Bouchey, G.D.; Gage, S.J.

    1970-01-01

    Several TRIGA facilities have experienced difficulty resulting from cladding failures of aluminum clad TRIGA fuel elements. Recently, at the University of Texas at Austin reactor facility, fission product releases were observed during 250 kW operation and were attributed to a leaking fuel element. A rather extensive testing program has been undertaken to locate the faulty element. The used sniffer device is described, which provides a quick, easily constructed, and extremely sensitive means of locating leaking fuel elements. The difficulty at The University of Texas was compounded by extremely low levels and the sporadic nature of the releases. However, in the more typical situation, in which a faulty element consistently releases relatively large quantities of fission gas, such a device should locate the leak with little difficulty

  5. Location analysis for the estrogen receptor-? reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-? (ER?)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ER?-bound loci and quantify the incidence of ERE sequences under two stringencies of detection:

  6. Nuclear responses in INTOR plasma stabilization elements

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  7. The finite element response matrix method

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  8. Integrating Responsive Building Elements in Buildings

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  9. Congestion Service Facilities Location Problem with Promise of Response Time

    Dandan Hu

    2013-01-01

    Full Text Available In many services, promise of specific response time is advertised as a commitment by the service providers for the customer satisfaction. Congestion on service facilities could delay the delivery of the services and hurts the overall satisfaction. In this paper, congestion service facilities location problem with promise of response time is studied, and a mixed integer nonlinear programming model is presented with budget constrained. The facilities are modeled as M/M/c queues. The decision variables of the model are the locations of the service facilities and the number of servers at each facility. The objective function is to maximize the demands served within specific response time promised by the service provider. To solve this problem, we propose an algorithm that combines greedy and genetic algorithms. In order to verify the proposed algorithm, a lot of computational experiments are tested. And the results demonstrate that response time has a significant impact on location decision.

  10. The finite element response Matrix method

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  11. Lattice location of the group V elements Sb, As, and P in ZnO

    Wahl, Ulrich; Mendonça, Tânia; Decoster, Stefan

    2010-01-01

    Modifying the properties of ZnO by means of incorporating antimony, arsenic or phosphorus impurities is of interest since these group V elements have been reported in the literature among the few successful p-type dopants in this technologically promising II-VI compound. The lattice location of ion-implanted Sb, As, and P in ZnO single crystals was investigated by means of the electron emission channeling technique using the radioactive isotopes $^{124}$Sb, $^{73}$As and $^{33}$P and it is found that they preferentially occupy substitutional Zn sites while the possible fractions on substitutional O sites are a few percent at maximum. The lattice site preference is understandable from the relatively large ionic size of the heavy mass group V elements. Unfortunately the presented results cannot finally settle the interesting issue whether substitutional Sb, As or P on oxygen sites or Sb$_{Zn}$−2V$_{Zn}$, As$_{Zn}$−2V$_{Zn}$ or P$_{Zn}$−2V$_{Zn}$ complexes (as suggested in the literature) are responsible f...

  12. Method of locating a leaking fuel element in a fast breeder power reactor

    Honekamp, J.R.; Fryer, R.M.

    1976-01-01

    Failed fuel detection and location in an FBR is accomplished by mass spectrometric analysis of the cover gas for the 134 Xe/ 133 Xe ratio, and correlation with the theoretical ratio in fuel elements of known power level and burnup. (E.C.B.)

  13. Considering Affective Responses towards Environments for Enhancing Location Based Services

    Huang, H.; Gartner, G.; Klettner, S.; Schmidt, M.

    2014-04-01

    A number of studies in the field of environmental psychology show that humans perceive and evaluate their surroundings affectively. Some places are experienced as unsafe, while some others as attractive and interesting. Experiences from daily life show that many of our daily behaviours and decision-making are often influenced by this kind of affective responses towards environments. Location based services (LBS) are often designed to assist and support people's behaviours and decision-making in space. In order to provide services with high usefulness (usability and utility), LBS should consider these kinds of affective responses towards environments. This paper reports on the results of a research project, which studies how people's affective responses towards environments can be modelled and acquired, as well as how LBS can benefit by considering these affective responses. As one of the most popular LBS applications, mobile pedestrian navigation systems are used as an example for illustration.

  14. On analyzing free-response data on location level

    Bandos, Andriy I.; Obuchowski, Nancy A.

    2017-03-01

    Free-response ROC (FROC) data are typically collected when primary question of interest is focused on the proportions of the correct detection-localization of known targets and frequencies of false positive responses, which can be multiple per subject (image). These studies are particularly relevant for CAD and related applications. The fundamental tool of the location-level FROC analysis is the FROC curve. Although there are many methods of FROC analysis, as we describe in this work, some of the standard and popular approaches, while important, are not suitable for analyzing specifically the location-level FROC performance as summarized by the FROC curve. Analysis of the FROC curve, on the other hand, might not be straightforward. Recently we developed an approach for the location-level analysis of the FROC data using the well-known tools for clustered ROC analysis. In the current work, based on previously developed concepts, and using specific examples, we demonstrate the key reasons why specifically location-level FROC performance cannot be fully addressed by the common approaches as well as illustrate the proposed solution. Specifically, we consider the two most salient FROC approaches, namely JAFROC and the area under the exponentially transformed FROC curve (AFE) and show that clearly superior FROC curves can have lower values for these indices. We describe the specific features that make these approaches inconsistent with FROC curves. This work illustrates some caveats for using the common approaches for location-level FROC analysis and provides guidelines for the appropriate assessment or comparison of FROC systems.

  15. TE-Locate: A Tool to Locate and Group Transposable Element Occurrences Using Paired-End Next-Generation Sequencing Data

    Platzer, Alexander; Nizhynska, Viktoria; Long, Quan

    2012-01-01

    Transposable elements (TEs) are common mobile DNA elements present in nearly all genomes. Since the movement of TEs within a genome can sometimes have phenotypic consequences, an accurate report of TE actions is desirable. To this end, we developed TE-Locate, a computational tool that uses paired-end reads to identify the novel locations of known TEs. TE-Locate can utilize either a database of TE sequences, or annotated TEs within the reference sequence of interest. This makes TE-Locate usefu...

  16. Integrating Environmentally Responsive Elements in Buildings

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  17. HEAVY-ELEMENT ENRICHMENT OF A JUPITER-MASS PROTOPLANET AS A FUNCTION OF ORBITAL LOCATION

    Helled, R.; Schubert, G.

    2009-01-01

    One possible mechanism for giant planet formation is disk instability in which the planet is formed as a result of gravitational instability in the protoplanetary disk surrounding the young star. The final composition and core mass of the planet will depend on the planet's mass, environment, and the planetesimal accretion efficiency. We calculate heavy-element enrichment in a Jupiter-mass protoplanet formed by disk instability at various radial distances from the star, considering different disk masses and surface density distributions. Although the available mass for accretion increases with radial distance (a) for disk solid surface density (σ) functions σ = σ 0 a -α with α 5 years of planetary evolution, when the planet is extended and before gap opening and type II migration take place. The accreted mass is calculated for disk masses of 0.01, 0.05, and 0.1 M sun with α = 1/2, 1, and 3/2. We show that a Jupiter-mass protoplanet can accrete 1-110 M + of heavy elements, depending on the disk properties. Due to the limitation on the accretion timescale, our results provide lower bounds on heavy-element enrichment. Our results can explain the large variation in heavy-element enrichment found in extrasolar giant planets. Since higher disk surface density is found to lead to larger heavy-element enrichment, our model results are consistent with the correlation between heavy-element enrichment and stellar metallicity. Our calculations also suggest that Jupiter could have formed at a larger radial distance than its current location while still accreting the mass of heavy elements predicted by interior models. We conclude that in the disk instability model the final composition of a giant planet is strongly determined by its formation environment. The heavy-element abundance of a giant planet does not discriminate between its origin by either disk instability or core accretion.

  18. Investigating the Microscopic Location of Trace Elements in High-Alpine Glacier Ice

    Avak, Sven Erik; Birrer, Mario; Laurent, Oscar; Guillong, Marcel; Wälle, Markus; Jenk, Theo Manuel; Bartels-Rausch, Thorsten; Schwikowski, Margit; Eichler, Anja

    2017-04-01

    Past changes in atmospheric pollution can be reconstructed from high-alpine ice core trace element records (Schwikowski et al., 2004). Percolation of meltwater alters the information originally stored in these environmental archives. Eichler et al. (2001) suggested that the preservation of major ions with respect to meltwater percolation depends on their location in the crystal ice lattice, i.e. grain boundaries versus grain interiors. Other studies have also focused on the effect of meltwater on organic pollutant concentrations as well as on stable isotope profiles in ice cores, whereas no information exists about trace elements. Here, we investigate for the first time the effect of the microscopic location of anthropogenic, dust and volcanic related trace elements on the behavior during meltwater percolation by using two different approaches. On the one hand we assess the microscopic location of trace elements indirectly by analyzing trace element concentrations in a high-alpine ice core, which has been shown to be affected by an inflow of meltwater, using discrete inductively coupled plasma mass spectrometry (ICP-MS). Impurities located at grain boundaries are prone to be removed by meltwater and tend to be depleted in the affected section of the record whereas those incorporated into the ice interior are preserved and not disturbed in the record. In the second approach we work towards a direct quantification of differences in concentrations of trace elements between ice grain boundaries and grain interiors in samples both from unaffected and affected sections of this ice core. Therefore we use cryocell laser ablation (LA) ICP-MS, which is the method of choice for the direct in situ chemical analysis of trace elements at a sub-millimeter resolution in glacier ice (Reinhardt et al., 2001, Della Lunga et al., 2014, Sneed et al., 2015). We will present first results of both approaches with regard to the evaluation of the potential of trace elements as environmental

  19. INFLUENCE OF BROKEN ROTOR BARS LOCATION IN THE SQUIRREL CAGE INDUCTION MOTOR USING FINITE ELEMENT METHOD

    N. Halem

    2013-06-01

    Full Text Available It is well known that the number of broken bars and varying load affect on the amplitudes of specific harmonic components in the process analysis of induction motors under broken rotor bars. The location of broken bars is an important factor which affects the diagnosis of the broken bars defect. In this paper the simulation is determinate for different cases for distribution of broken bars under induction motor pole in order to show the impact of broken bars location upon the amplitude of harmonic fault. The simulation results are obtained by using time stepping finite elements (TSFE method. The geometrical characteristics of motor, the effects of slotting and the magnetic saturation of lamination core are included in induction motor model.

  20. INFLUENCE OF BROKEN ROTOR BARS LOCATION IN THE SQUIRREL CAGE INDUCTION MOTOR USING FINITE ELEMENT METHOD

    N. Halem

    2015-07-01

    Full Text Available It is well known that the number of broken bars and varying load affect on the amplitudes of specific harmonic components  in the process analysis of induction motors under broken rotor bars. The location of broken bars is an important factor which affects the diagnosis of the broken bars defect. In this paper the simulation is determinate for different cases for distribution of broken bars under induction motor pole in order to show the impact of broken bars location upon the amplitude of harmonic fault. The simulation results are obtained by using time stepping finite elements (TSFE method. The geometrical characteristics of motor, the effects of slotting and the magnetic saturation of lamination core are included in induction motor model.

  1. Failure location prediction by finite element analysis for an additive manufactured mandible implant.

    Huo, Jinxing; Dérand, Per; Rännar, Lars-Erik; Hirsch, Jan-Michaél; Gamstedt, E Kristofer

    2015-09-01

    In order to reconstruct a patient with a bone defect in the mandible, a porous scaffold attached to a plate, both in a titanium alloy, was designed and manufactured using additive manufacturing. Regrettably, the implant fractured in vivo several months after surgery. The aim of this study was to investigate the failure of the implant and show a way of predicting the mechanical properties of the implant before surgery. All computed tomography data of the patient were preprocessed to remove metallic artefacts with metal deletion technique before mandible geometry reconstruction. The three-dimensional geometry of the patient's mandible was also reconstructed, and the implant was fixed to the bone model with screws in Mimics medical imaging software. A finite element model was established from the assembly of the mandible and the implant to study stresses developed during mastication. The stress distribution in the load-bearing plate was computed, and the location of main stress concentration in the plate was determined. Comparison between the fracture region and the location of the stress concentration shows that finite element analysis could serve as a tool for optimizing the design of mandible implants. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

  2. TE-Locate: A Tool to Locate and Group Transposable Element Occurrences Using Paired-End Next-Generation Sequencing Data.

    Platzer, Alexander; Nizhynska, Viktoria; Long, Quan

    2012-09-12

    Transposable elements (TEs) are common mobile DNA elements present in nearly all genomes. Since the movement of TEs within a genome can sometimes have phenotypic consequences, an accurate report of TE actions is desirable. To this end, we developed TE-Locate, a computational tool that uses paired-end reads to identify the novel locations of known TEs. TE-Locate can utilize either a database of TE sequences, or annotated TEs within the reference sequence of interest. This makes TE-Locate useful in the search for any mobile sequence, including retrotransposed gene copies. One major concern is to act on the correct hierarchy level, thereby avoiding an incorrect calling of a single insertion as multiple events of TEs with high sequence similarity. We used the (super)family level, but TE-Locate can also use any other level, right down to the individual transposable element. As an example of analysis with TE-Locate, we used the Swedish population in the 1,001 Arabidopsis genomes project, and presented the biological insights gained from the novel TEs, inducing the association between different TE superfamilies. The program is freely available, and the URL is provided in the end of the paper.

  3. TE-Locate: A Tool to Locate and Group Transposable Element Occurrences Using Paired-End Next-Generation Sequencing Data

    Quan Long

    2012-09-01

    Full Text Available Transposable elements (TEs are common mobile DNA elements present in nearly all genomes. Since the movement of TEs within a genome can sometimes have phenotypic consequences, an accurate report of TE actions is desirable. To this end, we developed TE-Locate, a computational tool that uses paired-end reads to identify the novel locations of known TEs. TE-Locate can utilize either a database of TE sequences, or annotated TEs within the reference sequence of interest. This makes TE-Locate useful in the search for any mobile sequence, including retrotransposed gene copies. One major concern is to act on the correct hierarchy level, thereby avoiding an incorrect calling of a single insertion as multiple events of TEs with high sequence similarity. We used the (superfamily level, but TE-Locate can also use any other level, right down to the individual transposable element. As an example of analysis with TE-Locate, we used the Swedish population in the 1,001 Arabidopsis genomes project, and presented the biological insights gained from the novel TEs, inducing the association between different TE superfamilies. The program is freely available, and the URL is provided in the end of the paper.

  4. Process and equipment for locating defective fuel rods of a reactor fuel element

    Jester, A.; Honig, H.

    1977-01-01

    By this equipment, well-known processes for determining defective fuel rods of a reactor fuel element are improved in such a fashion that defective fuel rods can be located individually, so that it is possible to replace them. The equipment consists of a cylindrical test vessel open above, which accommodates the element to be tested, so that an annular space is left between the latter's external circumference and the wall of the vessel, and so that the fuel rods project above the vessel. A bell in the shape of a frustrum of a cone is inverted over the test vessel, which has an infra-red measuring equipment at a certain distance above the tops of the fuel rods. The fuel element to be tested together with the test vessel and hood are immersed in a basin full of water, which displaces water by means of gas from the hood. The post-shutdown heat increases the temperature in the water space of the test vessel, which is stabilised at 100 0 C. In each defective fuel rod the water which has penetrated the defective fuel rod previously, or does so now, starts to boil. The steam rising in the fuel rod raises the temperature of the defective fuel rod compared to all the sound ones. The subsequent measurement easily determines this. Where one can expect interference with the measurement by appreciable amounts of gamma rays, the measuring equipment is removed from the path of radiation by mirror deflection in a suitably shaped measuring hood. (FW) [de

  5. Incorrect Responses to Locative Commands: A Case Study.

    Duchan, Judith; Siegel, Leo

    1979-01-01

    A six-year-old with a language problem responded consistently to 100 locative commands by putting objects in containers and on flat surfaces regardless of the preposition or order of the nouns in the commands. (Author/CL)

  6. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  7. Learning and affective responses in location-choice dynamics

    Qi Han; Theo Arentze; Harry J P Timmermans

    2013-01-01

    In this paper we discuss the development of a dynamic agent-based model which simulates how agents search and explore in nonstationary environments and ultimately develop habitual, context-dependent, activity–travel patterns. Conceptually, the creation of a choice set is context dependent. Individuals are assumed to have aspiration levels associated with location attributes that, in combination with evaluation results, determine whether the agent will start exploring or persist in habitual be...

  8. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  9. Characteristic and analysis of structural elements of corporate social responsibility

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  10. Elements of a national emergency response system for nuclear accidents

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  11. Importance of location and exterior of city hotels as elements of guest satisfaction

    Tepavčević Jelena

    2016-01-01

    Full Text Available Business practices and attitudes of tourists show that hospitality represents the primary factor in the development of urban tourism. It is considered that, besides the exclusive appearance, there is no business success for hotel properties without a proper location. It is known that a typical tourist would like to be close enough to tourist attractions, to be able to reach them on foot. This paper deals with the importance of location and exterior of urban hotels on guests decision on the selection and overall satisfaction with hotel products. The survey was conducted in the hotels two largest urban centers in Serbia (Belgrade and Novi Sad. The aim of the research is an insight into the real impact of location and exterior when assessing the guest satisfaction. Descriptive statistical analysis, t-test and regression analysis were used for statistical data processing.

  12. Specificity determinants for the abscisic acid response element ?

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  13. Half a Year of Co-located Gaseous Elemental Mercury Measurements: Investigation of Temporal Changes in Measurement Differences

    Veselík, P.; Dvorská, Alice; Michálek, J.

    2017-01-01

    Roč. 26, č. 5 (2017), s. 3128-3137 ISSN 1018-4619 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : gaseous elemental mercury * Tekran 2537B * co-located measurement * capability indices * regression * cluster analysis Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7) Impact factor: 0.425, year: 2016

  14. How different location modes influence responses in a Simon-like task.

    Luo, Chunming; Proctor, Robert W

    2017-11-01

    Spatial information can be conveyed not only by stimulus position but by the meaning of a location word or direction of an arrow. We examined whether all the location-, arrow- and word-based Simon effects or some of them can be observed when a location word or an arrow is presented eccentrically and a left-right keypress is made to indicate its ink color. Results showed that only the location-based Simon effect was observed for location words, whereas an additional smaller arrow-based Simon effect, compared to the location-based Simon effect was observed, for arrows. These results showed spatial location, arrow direction, and location word stimulus dimensions affect response position codes in a spatial-to-verbal priority order, consistent with the possibility that they can activate mode-specific spatial representations.

  15. LOCATION AND POTENTIAL PORT OF GDYNIA AS ELEMENTS OF ITS COMPETITIVENESS

    Adam Salomon

    2017-06-01

    Full Text Available The main aim of this article is to characterize the current operation of the port of Gdynia. Another goal is to describe the port’s location and potential for cargo handling and storage in 2007-2015 as factors determining competitiveness. The article focuses on the characteristics of the port in Gdynia, taking into account its geographical location and specialization. The article analyses the legal basis of operation of the port, its capital and organizational structure as well as governing bodies. In addition, the major universal and specialist terminals operating in the port area are described. The article also discusses the most important investments made in the port in 2007-2015 to improve its operation and ensure the best quality of service.

  16. Elemental analysis and radiation hazards parameters of bauxite located in Saudi Arabia

    Alashrah, S.; E Taher, A.

    2017-04-01

    Since Bauxite has been widely used in industry and in scientific investigations for producing Aluminum, it is important to measure the radionuclides concentrations to determine the health effect. The Bauxite mine is located in Az Zabirah city in Saudi Arabia. The concentrations of the radionuclides in the bauxite samples were measured using γ-ray spectrometer NaI (Tl). The average and range values of the concentrations of 226Ra, 232Th and 40K were 102.2 (141.1-62.7), 156.3 (202.8-102.8) and 116.8 (191.7- 48.9) Bq/kg respectively. These results were compared with the reported ranges in the literature from other locations around the world. The radiation hazard parameters; radium equivalent activity, annual dose, external hazard were also calculated and compared with the recommended levels by International Commission on Radiological Protection (ICRP-60) and united nations scientific committee on the effects of atomic radiation UNSCEAR reports. There are no studies for the natural radioactivity in the bauxite mine in Az Zabirah city, so these results are a start to establishing a database in this location.

  17. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  18. SINGLE-SHELL TANKS LEAK INTEGRITY ELEMENTS/SX FARM LEAK CAUSES AND LOCATIONS - 12127

    VENETZ TJ; WASHENFELDER D; JOHNSON J; GIRARDOT C

    2012-01-25

    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-9IF Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal I-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX-111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and drywells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  19. Single-Shell Tanks Leak Integrity Elements/ SX Farm Leak Causes and Locations - 12127

    Girardot, Crystal [URS- Safety Management Solutions, Richland, Washington 99352 (United States); Harlow, Don [ELR Consulting Richland, Washington 99352 (United States); Venetz, Theodore; Washenfelder, Dennis [Washington River Protection Solutions, LLC Richland, Washington 99352 (United States); Johnson, Jeremy [U.S. Department of Energy, Office of River Protection Richland, Washington 99352 (United States)

    2012-07-01

    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-91F Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal 1-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX- 111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and dry-wells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  20. Relation between the location of elements in the periodic table and various organ-uptake rates.

    Ando, A; Ando, I; Hiraki, T; Hisada, K

    1989-01-01

    Fifty four elements and 65 radioactive compounds were examined to determine the organ uptake rates for rats 3, 24 and 48 h after i.v. injection of these compounds. They were prepared as carrier free nuclides, or containing a small amount of stable nuclide. Generally speaking, behaviors of K, Rb, Cs and Tl in all the organs were very similar to one another, but they differed from that of Na. Bivalent hard acids were avidly taken up into bone; therefore, uptake rates in soft tissues were very small. Hard acids of tri-, quadri- and pentavalence which were taken up into the soft tissue organs decreased more slowly from these organs than other ions. Soft acids such as Hg2+ were bound very firmly to the component in the kidney. Anions (with few exceptions), GeCl4 and SbCl3 were rapidly excreted in urine, so that the uptake rates in organs were low.

  1. Spectral response of multi-element silicon detectors

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  2. Finite element simulation of impact response of wire mesh screens

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  3. An Unexpected Location of the Arginine Catabolic Mobile Element (ACME) in a USA300-Related MRSA Strain

    Damkjær Bartels, Mette; Hansen, Lars H.; Boye, Kit

    2011-01-01

    In methicillin resistant Staphylococcus aureus (MRSA), the arginine catabolic mobile element (ACME) was initially described in USA300 (t008-ST8) where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec). A common health-care associated MRSA in Copenhagen, Denmark (t024......-ST8) is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing...... of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1) and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME...

  4. Relation between the location of elements in the periodic table and tumor-uptake rate

    Ando, A; Ando, I; Hiraki, T; Hisada, K

    1985-01-01

    The bipositive ions and anions, with few exceptions, indicated a low tumor uptake rate. On the other hand, compounds of Hg, Au and Bi, which have a strong binding power to protein, showed a high tumor uptake rate. As Hg/sup 2 +/, Au/sup +/ and Bi/sup 3 +/ are soft acids according to the classification of Lewis acids, it was thought that these ions would bind strongly to soft bases (R-SH, R-S-) present in tumor tissue. For many hard acids such as /sup 85/Sr/sup 2 +/, /sup 67/Ga/sup 3 +/, /sup 181/Hf/sup 4 +/, and /sup 95/Nb/sup 5 +/, tumor uptake rates are shown as a function of ionic potentials of the metal ions. Considering the present data and previously reported results, it was presumed that hard acids of trivalence, quadrivalence and pentavalence would replace calcium in the calcium salts of hard bases. Ionic potentials of alkaline metals and Tl were small, but the tumor-uptake rate of these elements indicated various values. As Ge and Sb are bound by covalent bonds to chloride, GeCl/sub 4/ and SbCl/sub 3/ behaved differently from many metallic compounds in tumor tissue.

  5. [Relations between location of elements in periodic table and affinity for the kidneys (author's transl)].

    Ando, A; Hisada, K; Ando, I

    1977-10-01

    The distribution of many inorganic compounds in rats was investigated in order to evaluate kidney affinity of inorganic compounds. In these experiments, 30%, 10-20% and 4-10% of administered dose was localized in the kidneys in 203Hg-acetate and 203 Bi-acetate, in H198AuCl4, 103PdCl2, 201TlCl, 210Pd(NO3)2 and H2(127M)TeO3, and in Na2(51)CrO4, 54MnCl2, (114m)InCl3 and 7BeCl2, respectively. Some bipositive ions and anions was hardly taken up into the kidneys. And in many hard acids according to classification of Lewis acids, the uptake rate into the kidneys was usually small. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate in the kidneys. As Hg++, Au+ and Bi+++ was soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (RSH, RS-) present in the kidney.

  6. Relation between the location of elements in the periodic table and tumor-uptake rate.

    Ando, A; Ando, I; Hiraki, T; Hisada, K

    1985-01-01

    The bipositive ions and anions, with few exceptions, indicated a low tumor uptake rate. On the other hand, compounds of Hg, Au and Bi, which have a strong binding power to protein, showed a high tumor uptake rate. As Hg2+, Au+ and Bi3+ are soft acids according to the classification of Lewis acids, it was thought that these ions would bind strongly to soft bases (R-SH, R-S-) present in tumor tissue. For many hard acids such as 85Sr2+, 67Ga3+, 181Hf4+, and 95Nb5+, tumor uptake rates are shown as a function of ionic potentials (valency/ionic radii) of the metal ions. Considering the present data and previously reported results, it was presumed that hard acids of trivalence, quadrivalence and pentavalence would replace calcium in the calcium salts of hard bases (calcium salts of acid mucopolysaccharides, etc.). Ionic potentials of alkaline metals and Tl were small, but the tumor-uptake rate of these elements indicated various values. As Ge and Sb are bound by covalent bonds to chloride, GeCl4 and SbCl3 behaved differently from many metallic compounds in tumor tissue.

  7. [Relation between location of elements in periodic table and affinity for the malignant tumor (author's transl)].

    Ando, A; Hisada, K; Ando, I

    1977-10-01

    Affinity of many inorganic compounds for the malignant tumor was examined, using the rats which were subcutaneously transplanted with Yoshida sarcoma. And the relations between the uptake rate into the malignant tumor and in vitro binding power to the protein were investigated in these compounds. In these experiments, the bipositive ions and anions had not affinity for the tumor tissue with a few exceptions. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate into the malignant tumor. As Hg++, Au+ and Bi+++ are soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (R-SH, R-S-) present in the tumor tissue. In many hard acids (according to classification of Lewis acids), the uptake rate into the tumor was shown as a function of ionic potentials (valency/ionic radii) of the metal ions. It is presumed that the chemical bond of these hard acids in the tumor tissue is ionic bond to hard base (R-COO-, R-PO3(2-), R-SO3-, R-NH2).

  8. TRACE ELEMENT CONTENTS IN TOPSOIL LOCATED NEAR STEEL PLANT IN KRAKOW-NOWA HUTA

    Paweł Mundała

    2014-10-01

    Full Text Available The paper presents the results of cadmium, lead and zinc contents in topsoils of arable land located in vicinity Steel Plant in Krakow-Nowa Huta. Soil samples were collected in autumn 2007 from the 0-20 cm layer placed in a west-east trnsect of 7,5 km length. It started approximately 5km east form the border of the steel plant. .Sampled area is characterized by high level of agriculture, where the dominant crops have been vegetables, mainly cabbage and cauliflower. It was found, the soil was not contaminated with heavy metals. All samples met the requirements of the Polish Minister of the Environment. Also the assessment according to Institute of Soil Science and Plant Cultivation method showed only incerased content 60% in case of zinc and only 13% for Cd. Any levels of pollution were not observed. There also decreasing trend of accumulation were stated as a function of growing distance from the steel plant.

  9. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  10. Location, location, location

    Anderson, S.P.; Goeree, J.K.; Ramer, R.

    1997-01-01

    We analyze the canonical location-then-price duopoly game with general log- concave consumer densities. A unique pure-strategy equilibrium to the two-stage game exists if the density is not "too asymmetric" and not "too concave." These criteria are satisfied by many commonly used densities.

  11. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Demand response with locational dynamic pricing to support the integration of renewables

    Dupont, B.; De Jonghe, C.; Olmos, L.; Belmans, R.

    2014-01-01

    Electricity production from centralised and decentralised renewable energy resources in Europe is gaining significance, resulting in operational challenges in the electricity system. Although these challenges add to the locational and time dependency of the underlying cost of operating the system, this variability in time and location is not reflected in residential tariff schemes. Consequently, residential users are not incentivised to react to varying system conditions and to help the integration of renewable energy resources. Therefore, this paper provides a theoretical framework for designing a locational dynamic pricing scheme. This can be used to assess existing tariff structures for consumption and injection, and can serve as a theoretical background for developing new tariff schemes. Starting from the underlying costs, this paper shows that the potential for locational dynamic pricing depends on the locational and time dependency of its cost drivers. When converting costs into tariffs, the tariff design should be determined. This includes the advance notice of sending tariffs to users, and the length of price blocks and price patterns. This tariff design should find a balance between tariff principles related to costs, practicality and social acceptability on the one hand, and the resulting demand response incentive on the other. - Highlights: • The integration of renewables affects the locational and time dependency of costs. • Locational dynamic pricing reflects cost variability and allows demand response. • A theoretical framework for designing and assessing tariff schemes is proposed. • Tariff variability depends on the locational and time dependency of its cost drivers. • The tariff design should consider the resulting demand response incentive

  13. Auditory-visual integration modulates location-specific repetition suppression of auditory responses.

    Shrem, Talia; Murray, Micah M; Deouell, Leon Y

    2017-11-01

    Space is a dimension shared by different modalities, but at what stage spatial encoding is affected by multisensory processes is unclear. Early studies observed attenuation of N1/P2 auditory evoked responses following repetition of sounds from the same location. Here, we asked whether this effect is modulated by audiovisual interactions. In two experiments, using a repetition-suppression paradigm, we presented pairs of tones in free field, where the test stimulus was a tone presented at a fixed lateral location. Experiment 1 established a neural index of auditory spatial sensitivity, by comparing the degree of attenuation of the response to test stimuli when they were preceded by an adapter sound at the same location versus 30° or 60° away. We found that the degree of attenuation at the P2 latency was inversely related to the spatial distance between the test stimulus and the adapter stimulus. In Experiment 2, the adapter stimulus was a tone presented from the same location or a more medial location than the test stimulus. The adapter stimulus was accompanied by a simultaneous flash displayed orthogonally from one of the two locations. Sound-flash incongruence reduced accuracy in a same-different location discrimination task (i.e., the ventriloquism effect) and reduced the location-specific repetition-suppression at the P2 latency. Importantly, this multisensory effect included topographic modulations, indicative of changes in the relative contribution of underlying sources across conditions. Our findings suggest that the auditory response at the P2 latency is affected by spatially selective brain activity, which is affected crossmodally by visual information. © 2017 Society for Psychophysiological Research.

  14. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Specificity determinants for the abscisic acid response element.

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  16. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  17. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  18. Location and orientation of panel on the screen as a structural visual element to highlight text displayed

    Léger, Laure; Chevalier, Aline

    2017-07-01

    Searching for information on the internet has become a daily activity. It is considered to be a complex cognitive activity that involves visual attention. Many studies have demonstrated that users' information search are affected both by the spatial configuration of words and the elements displayed on the screen: elements that are used to structure web pages. One of these elements, the web panel, contains information. Web panel is a rectangular area with a colored background that was used to highlighting content presented in this specific rectangular area. Our general hypothesis was that the presence of a panel on a web page would affect the structure of a word display, as a result, information search accuracy. We carried out an experiment in which we manipulated the presence vs. the absence of a panel, as well as its orientation on the screen (vertical vs. horizontal). Twenty participants were asked to answer questions while their eye movements were recorded. Results showed that the presence of a panel resulted in reduced accuracy and shorter response times. Panel orientation affected scanpaths, especially when they were orientated vertically. We discuss these findings and suggest ways in which this research could be developed further in future.

  19. The yeast genome may harbor hypoxia response elements (HRE).

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  20. Finite element modelling of Plantar Fascia response during running on different surface types

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  1. Lichen Parmelia sulcata time response model to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  2. A Game Theoretical Model for Location of Terror Response Facilities under Capacitated Resources

    Lingpeng Meng

    2013-01-01

    Full Text Available This paper is concerned with the effect of capacity constraints on the locations of terror response facilities. We assume that the state has limited resources, and multiple facilities may be involved in the response until the demand is satisfied consequently. We formulate a leader-follower game model between the state and the terrorist and prove the existence and uniqueness of the Nash equilibrium. An integer linear programming is proposed to obtain the equilibrium results when the facility number is fixed. The problem is demonstrated by a case study of the 19 districts of Shanghai, China.

  3. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  4. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  5. Solving a Location, Allocation, and Capacity Planning Problem with Dynamic Demand and Response Time Service Level

    Carrie Ka Yuk Lin

    2014-01-01

    Full Text Available Logistic systems with uncertain demand, travel time, and on-site processing time are studied here where sequential trip travel is allowed. The relationship between three levels of decisions: facility location, demand allocation, and resource capacity (number of service units, satisfying the response time requirement, is analysed. The problem is formulated as a stochastic mixed integer program. A simulation-based hybrid heuristic is developed to solve the dynamic problem under different response time service level. An initial solution is obtained from solving static location-allocation models, followed by iterative improvement of the three levels of decisions by ejection, reinsertion procedure with memory of feasible and infeasible service regions. Results indicate that a higher response time service level could be achieved by allocating a given resource under an appropriate decentralized policy. Given a response time requirement, the general trend is that the minimum total capacity initially decreases with more facilities. During this stage, variability in travel time has more impact on capacity than variability in demand arrivals. Thereafter, the total capacity remains stable and then gradually increases. When service level requirement is high, the dynamic dispatch based on first-come-first-serve rule requires smaller capacity than the one by nearest-neighbour rule.

  6. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  7. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  8. Identification of minute damage in composite bridge structures equipped with fiber optic sensors using the location of neutral axis and finite element analysis

    Li, Xi; Glisic, Branko

    2016-04-01

    By definition, the neutral axis of a loaded composite beam structure is the curve along which the section experiences zero bending strain. When no axial loading is present, the location of the neutral axis passes through the centroid of stiffness of the beam cross-section. In the presence of damage, the centroid of stiffness, as well as the neutral axis, shift from the healthy position. The concept of neutral axis can be widely applied to all beam-like structures. According to literature, a change in location of the neutral axis can be associated with damage in the corresponding cross-section. In this paper, the movement of neutral axis near locations of minute damage in a composite bridge structure was studied using finite element analysis and experimental results. The finite element model was developed based on a physical scale model of a composite simply-supported structure with controlled minute damage in the reinforced concrete deck. The structure was equipped with long-gauge fiber optic strain and temperature sensors at a healthy reference location as well as two locations of damage. A total of 12 strain sensors were installed during construction and used to monitor the structure during various loading events. This paper aims to explain previous experimental results which showed that the observed positions of neutral axis near damage locations were higher than the predicted healthy locations in some loading events. Analysis has shown that finite element analysis has potential to simulate and explain the physical behavior of the test structure.

  9. Evaluation of the seismic response of historical masonry bell towers located in South-East Lombardy, Italy

    Valente, Marco; Milani, Gabriele; Shehu, Rafael

    2017-07-01

    This study presents some FE results regarding the behavior under horizontal loads of two existing masonry towers located in South-East Lombardy, Italy. The towers, albeit unique for geometric and architectural features, show some affinities that justify a comparative analysis, as for instance the location and the similar masonry material. Their structural behavior under horizontal loads is therefore influenced by geometrical issues, such as slenderness, walls thickness, perforations, irregularities, presence of internal vaults, etc., which may be responsible for a peculiar output. The geometry of the towers is deduced from both existing available documentation and in-situ surveys. On the basis of such geometrical data, a detailed 3D realistic mesh is conceived, with a point by point characterization of each single geometric element. The FE models are analyzed under seismic loads acting along geometric axes of the plan section, with non-linear dynamic excitation assumptions. A damage-plasticity material model exhibiting softening in both tension and compression, already available in the commercial code Abaqus, is used for masonry. Non-linear dynamic analyses are performed along both the X and Y directions with a real accelerogram scaled to different peak ground accelerations. Some results presented in this paper show the high vulnerability of ancient masonry towers under horizontal loads.

  10. How do location and control over the music influence listeners' responses?

    Krause, Amanda E; North, Adrian C

    2017-04-01

    This study uses Mehrabian and Russell's () Pleasure-Arousal-Dominance (PAD) model to consider how responses to both the music heard and overall in-situ listening experience are influenced by the listener's degree of control over music selected for a particular listening episode and the location in which the listening takes place. Following recruitment via campus advertisements and a university research participation program, 216 individuals completed a background questionnaire and music listening task in a 3 (location) × 2 (experimenter- or participant-selected music) design. After the listening task, participants completed a short questionnaire concerning the music they heard and the overall in-situ listening experience. Results demonstrated that there was a positive relationship between control and liking for the music and episode, whether the former was considered in terms of: (1) whether the music was self-selected or experimenter-selected or (2) overt ratings of perceived control. Furthermore, the location and liking for the music were related to people's judgments of their enjoyment of the overall experience. This research indicates that the PAD model is a useful framework for understanding everyday music listening and supports the contention that, in a musical context, dominance may be operationalized as control over the music. © 2017 Scandinavian Psychological Associations and John Wiley & Sons Ltd.

  11. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  12. Plastid Located WHIRLY1 Enhances the Responsiveness of Arabidopsis Seedlings Toward Abscisic Acid

    Isemer, Rena; Krause, Kirsten; Grabe, Nils; Kitahata, Nobutaka; Asami, Tadao; Krupinska, Karin

    2012-01-01

    WHIRLY1 is a protein that can be translocated from the plastids to the nucleus, making it an ideal candidate for communicating information between these two compartments. Mutants of Arabidopsis thaliana lacking WHIRLY1 (why1) were shown to have a reduced sensitivity toward salicylic acid (SA) and abscisic acid (ABA) during germination. Germination assays in the presence of abamine, an inhibitor of ABA biosynthesis, revealed that the effect of SA on germination was in fact caused by a concomitant stimulation of ABA biosynthesis. In order to distinguish whether the plastid or the nuclear isoform of WHIRLY1 is adjusting the responsiveness toward ABA, sequences encoding either the complete WHIRLY1 protein or a truncated form lacking the plastid transit peptide were overexpressed in the why1 mutant background. In plants overexpressing the full-length sequence, WHIRLY1 accumulated in both plastids and the nucleus, whereas in plants overexpressing the truncated sequence, WHIRLY1 accumulated exclusively in the nucleus. Seedlings containing recombinant WHIRLY1 in both compartments were hypersensitive toward ABA. In contrast, seedlings possessing only the nuclear form of WHIRLY1 were as insensitive toward ABA as the why1 mutants. ABA was furthermore shown to lower the rate of germination of wildtype seeds even in the presence of abamine which is known to inhibit the formation of xanthoxin, the plastid located precursor of ABA. From this we conclude that plastid located WHIRLY1 enhances the responsiveness of seeds toward ABA even when ABA is supplied exogenously. PMID:23269926

  13. The Climate Response to Stratospheric Aerosol Geoengineering Can Be Tailored Using Multiple Injection Locations

    MacMartin, Douglas G. [Mechanical and Aerospace Engineering, Cornell University, Ithaca NY USA; Department of Computing and Mathematical Sciences, California Institute of Technology, Pasadena CA USA; Kravitz, Ben [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Tilmes, Simone [Atmospheric Chemistry, Observations, and Modeling Laboratory, National Center for Atmospheric Research, Boulder CO USA; Climate and Global Dynamics Laboratory, National Center for Atmospheric Research, Boulder CO USA; Richter, Jadwiga H. [Climate and Global Dynamics Laboratory, National Center for Atmospheric Research, Boulder CO USA; Mills, Michael J. [Atmospheric Chemistry, Observations, and Modeling Laboratory, National Center for Atmospheric Research, Boulder CO USA; Lamarque, Jean-Francois [Atmospheric Chemistry, Observations, and Modeling Laboratory, National Center for Atmospheric Research, Boulder CO USA; Climate and Global Dynamics Laboratory, National Center for Atmospheric Research, Boulder CO USA; Tribbia, Joseph J. [Climate and Global Dynamics Laboratory, National Center for Atmospheric Research, Boulder CO USA; Vitt, Francis [Atmospheric Chemistry, Observations, and Modeling Laboratory, National Center for Atmospheric Research, Boulder CO USA

    2017-12-07

    The climate response to geoengineering with stratospheric aerosols has the potential to be designed to achieve some chosen objectives. By injecting different amounts of SO2 at multiple different latitudes, the spatial pattern of aerosol optical depth (AOD) can be partially controlled. We use simulations from the fully-coupled whole-atmosphere chemistry-climate model CESM1(WACCM), to demonstrate that three spatial degrees of freedom of AOD can be achieved by appropriately combining injection at different locations: an approximately spatially-uniform AOD distribution, the relative difference in AOD between Northern and Southern hemispheres, and the relative AOD in high versus low latitudes. For forcing levels that yield 1–2°C cooling, the AOD and surface temperature response are sufficiently linear in this model so that many climate effects can be predicted from single-latitude injection simulations. Optimized injection at multiple locations is predicted to improve compensation of CO2-forced climate change, relative to a case using only equatorial aerosol injection. The additional degrees of freedom can be used, for example, to balance interhemispheric temperature differences and the equator to pole temperature difference in addition to the global mean temperature; this is projected in this model to reduce the mean-square error in temperature compensation by 30%.

  14. Investigation of deformation of elements of three-dimensional reinforced concrete structures located in the soil, interacting with each other through rubber gaskets

    Berezhnoi, D. V.; Balafendieva, I. S.; Sachenkov, A. A.; Sekaeva, L. R.

    2017-06-01

    In work the technique of calculation of elements of three-dimensional reinforced concrete substructures located in a soil, interacting with each other through rubber linings is realized. To describe the interaction of deformable structures with the ground, special “semi-infinite” finite elements are used. A technique has been implemented that allows one to describe the contact interaction of three-dimensional structures by means of a special contact finite element with specific properties. The obtained numerical results are compared with the experimental data, their good agreement is noted.

  15. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  16. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  18. Demand Response Design and Use Based on Network Locational Marginal Prices

    Morais, Hugo; Faria, Pedro; Vale, Zita

    2014-01-01

    Power systems have been experiencing huge changes mainly due to the substantial increase of distributed generation (DG) and the operation in competitive environments. Virtual Power Players (VPP) can aggregate several players, namely a diversity of energy resources, including distributed generation...... (DG) based on several technologies, electric storage systems (ESS) and demand response (DR). Energy resources management gains an increasing relevance in this competitive context. This makes the DR use more interesting and flexible, giving place to a wide range of new opportunities. This paper...... proposes a methodology to support VPPs in the DR programs’ management, considering all the existing energy resources (generation and storage units) and the distribution network. The proposed method is based on locational marginal prices (LMP) values. The evaluation of the impact of using DR specific...

  19. Design Process for Integrated Concepts with Responsive Building Elements

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  20. Locating AED Enabled Medical Drones to Enhance Cardiac Arrest Response Times.

    Pulver, Aaron; Wei, Ran; Mann, Clay

    2016-01-01

    Out-of-hospital cardiac arrest (OOHCA) is prevalent in the United States. Each year between 180,000 and 400,000 people die due to cardiac arrest. The automated external defibrillator (AED) has greatly enhanced survival rates for OOHCA. However, one of the important components of successful cardiac arrest treatment is emergency medical services (EMS) response time (i.e., the time from EMS "wheels rolling" until arrival at the OOHCA scene). Unmanned Aerial Vehicles (UAV) have regularly been used for remote sensing and aerial imagery collection, but there are new opportunities to use drones for medical emergencies. The purpose of this study is to develop a geographic approach to the placement of a network of medical drones, equipped with an automated external defibrillator, designed to minimize travel time to victims of out-of-hospital cardiac arrest. Our goal was to have one drone on scene within one minute for at least 90% of demand for AED shock therapy, while minimizing implementation costs. In our study, the current estimated travel times were evaluated in Salt Lake County using geographical information systems (GIS) and compared to the estimated travel times of a network of AED enabled medical drones. We employed a location model, the Maximum Coverage Location Problem (MCLP), to determine the best configuration of drones to increase service coverage within one minute. We found that, using traditional vehicles, only 4.3% of the demand can be reached (travel time) within one minute utilizing current EMS agency locations, while 96.4% of demand can be reached within five minutes using current EMS vehicles and facility locations. Analyses show that using existing EMS stations to launch drones resulted in 80.1% of cardiac arrest demand being reached within one minute Allowing new sites to launch drones resulted in 90.3% of demand being reached within one minute. Finally, using existing EMS and new sites resulted in 90.3% of demand being reached while greatly reducing

  1. Contributions of individual domains to function of the HIV-1 Rev response element.

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  2. Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

    Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

    2008-08-15

    The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

  3. Analysis of Taipei Basin Response for Earthquakes of Various Depths and Locations Using Empirical Data

    Vladimir Sokolov

    2009-01-01

    Full Text Available The response of Taipei basin upon earthquake excitation was studied using records of recent earthquakes. The strong-motion database includes records obtained at 32 stations of the Taipei TSMIP net work from 83 deep and 142 shallow earthquakes (M > 4.0 that occurred in 1992 - 2004. The characteristics of frequency-de pendent site response were obtained as spectral ratios between the actual earthquake records (horizontal components and those modelled for a hypothetical Very Hard Rock (VHR condition. The models for VHR spectra of Taiwan earthquakes had been recently proposed by Sokolov et al. (2005b, 2006. Analysis of site response characteristics and comparison with simple 1D models of the soil column resulted in the following conclusions: (1 The spectral ratios through out the basin obtained from deep earth quakes (depth > 35 km exhibit good agreement with the theoretical ratios calculated using the 1D models constructed using avail able geological and geotechnical data. (2 The spectral ratios obtained from shallow earth quakes show influence of: (a surface waves generated when travelling from distant sources to the basin and (b relatively low-frequency (< 1 - 2 Hz waves generated within the basin. (3 Some shallow earth quakes pro duce extremely high amplification at frequencies 0.3 - 1 Hz within the basin that may be dangerous for high-rise buildings and high way bridges. (4 The obtained results may be used in probabilistic seismic microzonation of the basin when many possible earth quakes located at various distances are considered. 2D and 3D simulation is necessary to model the seismic influence from particularly large earthquakes.

  4. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  5. Design of responsive materials using topologically interlocked elements

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  6. Influence of time pressure in a simple response task, a choice-by-location task, and the Simon task

    van der Lubbe, Robert Henricus Johannes; Jaśkowski, Piotr; Wauschkuhn, Bernd; Verleger, Rolf

    2001-01-01

    Examined the influence of strategy for a simple response task, a choice-by-location task, and the Simon task by varying time pressure in 11 Ss (mean age 28 yrs). Besides reaction time (RT) and accuracy, we measured response force and derived two measures from the event-related EEG potential to form

  7. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  8. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  10. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  11. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  12. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  13. Study on Distribution and location of selenium and other elements in different mitochondrial compartments of human liver by neutron activation analysis

    Xing Li; Chen Chunying; Li Bai; Yu Hongwei; Chai Zhifang

    2005-01-01

    Mitochondria are membrane-bound organelles and contain many kinds of enzymes and proteins. Mitochondria are the energy factories of the eukaryote cells, which play essential physiological roles in cells and principally produce the bulk of cellular ATP through oxidative metabolism. Mitochondria not only play crucial roles in the process of energy conversion but also take part in other functions, including maintaining ion homeostasis, metabolism and apoptosis. Therefore, it is considered as a key biomonitor of cell apoptosis, which is closely relevant to cell survival or death. As the main place of metabolism and detoxification, liver may contain relatively high levels of many trace elements. Subcellular distribution patterns of some elements in human liver have been analyzed in our previous work. However, the distribution of trace elements in mitochondrial ultrastructure has not been investigated yet. In present study, the distribution patterns of eleven elements in mitochondrial subfractions of normal human liver specimens were studied by applying the separating techniques of chemical treatment and differential centrifugation combined with element-specific detection of instrumental neutron activation analysis (INAA) and hydrid-generation atomic fluorescence spectrometry (HG-AFS). The quality assurance of INAA was checked by the analysis of the reference material of NIST bovine liver (1577a) and the Chinese reference materials of mussel (GBW 08571) and poplar leave (GBW 07604). Because selenium is possible to be lost via volatilization under such a long irradiation of 48 hrs, its content was determined with HG-AFS. We found that 3.3 % of the total mitochondrial protein were located in the outer membrane, 20.4 % in the intermembrane space, 63.8 % in the inner membrane and 12.5 % in the matrix of human liver mitochondria. The concentrations of Ca, Co and Zn were highest in the matrix and Ba, Cr, Fe, Sb, Sc, and Th in the outer membrane, whereas, the highest

  14. Microseismic response characteristics modeling and locating of underground water supply pipe leak

    Wang, J.; Liu, J.

    2015-12-01

    In traditional methods of pipeline leak location, geophones must be located on the pipe wall. If the exact location of the pipeline is unknown, the leaks cannot be identified accurately. To solve this problem, taking into account the characteristics of the pipeline leak, we propose a continuous random seismic source model and construct geological models to investigate the proposed method for locating underground pipeline leaks. Based on two dimensional (2D) viscoacoustic equations and the staggered grid finite-difference (FD) algorithm, the microseismic wave field generated by a leaking pipe is modeled. Cross-correlation analysis and the simulated annealing (SA) algorithm were utilized to obtain the time difference and the leak location. We also analyze and discuss the effect of the number of recorded traces, the survey layout, and the offset and interval of the traces on the accuracy of the estimated location. The preliminary results of the simulation and data field experiment indicate that (1) a continuous random source can realistically represent the leak microseismic wave field in a simulation using 2D visco-acoustic equations and a staggered grid FD algorithm. (2) The cross-correlation method is effective for calculating the time difference of the direct wave relative to the reference trace. However, outside the refraction blind zone, the accuracy of the time difference is reduced by the effects of the refracted wave. (3) The acquisition method of time difference based on the microseismic theory and SA algorithm has a great potential for locating leaks from underground pipelines from an array located on the ground surface. Keywords: Viscoacoustic finite-difference simulation; continuous random source; simulated annealing algorithm; pipeline leak location

  15. The French national inventory of radioactive waste. Elements of openness and responsibility

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  16. An inverse model for locating skin tumours in 3D using the genetic algorithm with the Dual Reciprocity Boundary Element Method

    Fabrício Ribeiro Bueno

    Full Text Available Here, the Dual Reciprocity Boundary Element Method is used to solve the 3D Pennes Bioheat Equation, which together with a Genetic Algorithm, produces an inverse model capable of obtaining the location and the size of a tumour, having as data input the temperature distribution measured on the skin surface. Given that the objective function, which is solved inversely, involves the DRBEM (Dual Reciprocity Boundary Element Method the Genetic Algorithm in its usual form becomes slower, in such a way that it was necessary to develop functions based the solution history in order that the process becomes quicker and more accurate. Results for 8 examples are presented including cases with convection and radiation boundary conditions. Cases involving noise in the readings of the equipment are also considered. This technique is intended to assist health workers in the diagnosis of tumours.

  17. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  18. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  19. Shaping the CD4+ memory immune response against tuberculosis: the role of antigen persistence, location and multi-functionality.

    Ancelet, Lindsay; Kirman, Joanna

    2012-02-01

    Abstract Effective vaccination against intracellular pathogens, such as tuberculosis (TB), relies on the generation and maintenance of CD4 memory T cells. An incomplete understanding of the memory immune response has hindered the rational design of a new, more effective TB vaccine. This review discusses how the persistence of antigen, the location of memory cells, and their multifunctional ability shape the CD4 memory T cell response against TB.

  20. The Response Time of the Magnetopause Reconnection Location to Changes in the Solar Wind: MMS Case Study

    Trattner, K. J.; Burch, J. L.; Ergun, R.; Fuselier, S. A.; Gomez, R. G.; Grimes, E. W.; Lewis, W. S.; Mauk, B.; Petrinec, S. M.; Pollock, C. J.

    2016-01-01

    Reconnection at the Earth's magnetopause is the mechanism by which magnetic fields in different regions change topology to create open magnetic field lines that allow energy, mass, and momentum to flow into the magnetosphere. It is the primary science goal of the recently launched MMS mission to unlock the mechanism of magnetic reconnection with a novel suite of plasma and field instruments. This study investigates several magnetopause crossings in the vicinity of the X-line on 19 September 2015 and compares the observed X-line location with predictions from the Maximum Magnetic Shear model. Rotations of the interplanetary magnetic field OMF) during the magnetopause crossings together with the close proximity of the four MMS satellites are used to determine the response time of the reconnection X-line location to changes in the IMF. The reconnection location exhibits a continuous motion during slow changes in the IMF but a delayed response to sudden changes in the IMF.

  1. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  2. Accumulations and sources of uranium, of its daughters and of metallic trace elements in wetlands located around old uranium mining sites

    Cuvier, Alicia

    2015-01-01

    Uranium mining and uranium ore processing increase the environmental activity of U and Th decay products and trace elements, in particular in case of releases to the adjacent rivers. Contaminants accumulate then preferentially in sedimentation areas (such as ponds or lakes) or in wetlands (peat lands, marshes or riverbanks) located downstream to the mine. Wetlands - generally located at the head of watershed - are particularly sensitive to environmental changes and anthropogenic pressure. This poses a risk of release of contaminants from these accumulation areas. The objective of the present study is to propose an easily reproducible methodology - in particular for the orphan mining sites - to identify and characterize accumulation areas. This study also aims to improve our understanding of the mechanisms of accumulation and release, in these areas. This study was performed around the former mining site of Bertholene (France). Standing and mobile in situ gamma spectrometry is used to accurately locate the accumulation areas. Soils, sediments, vegetation, water and peat are also sampled upstream and downstream of the mine, in order to (a) characterize the activities and the disequilibria of the U-Th decay chains and the associated trace elements according to the scale of observation, (b) understand the mechanisms of accumulation and release and (c) identify the potential sources using geochemical proxies and isotopic analyses. The results obtained show that radionuclides are mainly accumulated in a flooding area located downstream the mine. Strong U-238 activities (≥ 20000 Bq.kg"-"1) and strong Ra-226/U-238 and Th-230/Ra-226 activity ratios are recorded, involving preferential inputs of U-238 and Th-230 during flooding events. Trace element contamination is low, except for Mn, Ba and S. Such contaminations are potentially explained by the geochemical composition of the uranium ore and by the past and current processes of ore and water mine. Sequential extractions

  3. Contrast in air pollution components between major streets and background locations: Particulate matter mass, black carbon, elemental composition, nitrogen oxide and ultrafine particle number

    Boogaard, Hanna; Kos, Gerard P. A.; Weijers, Ernie P.; Janssen, Nicole A. H.; Fischer, Paul H.; van der Zee, Saskia C.; de Hartog, Jeroen J.; Hoek, Gerard

    2011-01-01

    Policies to reduce outdoor air pollution concentrations are often assessed on the basis of the regulated pollutants. Whether these are the most appropriate components to assess the potential health benefits is questionable, as other health-relevant pollutants may be more strongly related to traffic. The aim of this study is to compare the contrast in concentration between major roads and (sub)urban background for a large range of pollutants and to analyze the magnitude of the measured difference in the street - background for major streets with different street configurations. Measurements of PM 10, PM 2.5, particle number concentrations (PNC), black carbon (BC), elemental composition of PM 10 and PM 2.5 and NO x were conducted simultaneously in eight major streets and nine (sub)urban background locations in the Netherlands. Measurements were done six times for a week during a six month period in 2008. High contrasts between busy streets and background locations in the same city were found for chromium, copper and iron (factor 2-3). These elements were especially present in the coarse fraction of PM. In addition, high contrasts were found for BC and NO x (factor 1.8), typically indicators of direct combustion emissions. The contrast for PNC was similar to BC. NO 2 contrast was lower (factor 1.5). The largest contrast was found for two street canyons and two streets with buildings at one side of the street only. The contrast between busy streets and urban background in NO 2 was less than the contrast found for BC, PNC and elements indicative of non-exhaust emissions, adding evidence that NO 2 is not representing (current) traffic well. The study supports a substantial role for non-exhaust emissions including brake- and tyre wear and road dust in addition to direct combustion emissions. Significant underestimation of disease burden may occur when relying too much on the regulated components.

  4. Requirements and Challenges of Location-Based Access Control in Healthcare Emergency Response

    Vicente, Carmen Ruiz; Kirkpatrick, Michael; Ghinita, Gabriel

    2009-01-01

    Recent advances in positioning and tracking technologies have led to the emergence of novel location-based applications that allow participants to access information relevant to their spatio-temporal context. Traditional access control models, such as role-based access control (RBAC), are not suf...... to such settings. We overview the main technical issues to be addressed, and we describe the architecture for policy decision and enforcement points....

  5. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  6. Application of ADINA fluid element for transient response analysis of fluid-structure system

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  7. Location-specific responses to thermal stress in larvae of the reef-building coral Montastraea faveolata.

    Nicholas R Polato

    2010-06-01

    Full Text Available The potential to adapt to a changing climate depends in part upon the standing genetic variation present in wild populations. In corals, the dispersive larval phase is particularly vulnerable to the effects of environmental stress. Larval survival and response to stress during dispersal and settlement will play a key role in the persistence of coral populations.To test the hypothesis that larval transcription profiles reflect location-specific responses to thermal stress, symbiont-free gametes from three to four colonies of the scleractinian coral Montastraea faveolata were collected from Florida and Mexico, fertilized, and raised under mean and elevated (up 1 to 2 degrees C above summer mean temperatures. These locations have been shown to exchange larvae frequently enough to prevent significant differentiation of neutral loci. Differences among 1,310 unigenes were simultaneously characterized using custom cDNA microarrays, allowing investigation of gene expression patterns among larvae generated from wild populations under stress. Results show both conserved and location-specific variation in key processes including apoptosis, cell structuring, adhesion and development, energy and protein metabolism, and response to stress, in embryos of a reef-building coral.These results provide first insights into location-specific variation in gene expression in the face of gene flow, and support the hypothesis that coral host genomes may house adaptive potential needed to deal with changing environmental conditions.

  8. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  9. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  10. From dissent to resistance: Locating patterns of horizontalist self-management crisis responses in Spain

    Wigger, A.

    2018-01-01

    In response to the EU-wide austerity politics, large numbers of people took to the streets, occupied central squares, held popular assemblies, and participated in strikes or acts of civil disobedience. Scholarly attention has predominantly focused on the disruptive event politics of short-lived mass

  11. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  12. Formation and Change of Chloroplast-Located Plant Metabolites in Response to Light Conditions

    Yiyong Chen

    2018-02-01

    Full Text Available Photosynthesis is the central energy conversion process for plant metabolism and occurs within mature chloroplasts. Chloroplasts are also the site of various metabolic reactions involving amino acids, lipids, starch, and sulfur, as well as where the production of some hormones takes place. Light is one of the most important environmental factors, acting as an essential energy source for plants, but also as an external signal influencing their growth and development. Plants experience large fluctuations in the intensity and spectral quality of light, and many attempts have been made to improve or modify plant metabolites by treating them with different light qualities (artificial lighting or intensities. In this review, we discuss how changes in light intensity and wavelength affect the formation of chloroplast-located metabolites in plants.

  13. Pain locations in the postoperative period after cardiac surgery: Chronology of pain and response to treatment.

    Roca, J; Valero, R; Gomar, C

    Postoperative pain after cardiac surgery (CS) can be generated at several foci besides the sternotomy. Prospective descriptive longitudinal study on the chronological evolution of pain in 11 sites after CS including consecutive patients submitted to elective CS through sternotomy. The primary endpoints were to establish the main origins of pain, and to describe its chronological evolution during the first postoperative week. Secondary endpoints were to describe pain characteristics in the sternotomy area and to correlate pain intensity with other variables. Numerical Pain Rating Scale from 0 to 10 at rest and at movement on postoperative days 1, 2, 4 and 6. Numerical Pain Rating Scale>3 was considered moderate pain. Statistical analysis consisted in Mann-Whitney U-test, a Chi-squared, a Fisher exact text and Pearson's correlations. Forty-seven patients were enrolled. In 4 of 11 locations pain was reported as Numerical Pain Rating Scale>3 (sternotomy, oropharynx, saphenectomy and musculoskeletal pain in the back and shoulders). Maximum intensity of pain on postoperative days 1 and 2 was reported in the sternotomy area, while on postoperative days 4 and 6 it was reported at the saphenectomy. Pain at rest and at movement differed considerably in the sternotomy, saphenectomy and oropharynx. Pain at back and shoulders and at central venous catheter entry were not influenced by movement. Pain in the sternotomy was mainly described as oppressive. Patients with arthrosis and younger patients presented higher intensity of pain (P=.004; P=.049, respectively). Four locations were identified as the main sources of pain after CS: sternotomy, oropharynx, saphenectomy, and back and shoulders. Pain in different focuses presented differences in chronologic evolution and was differently influenced by movement. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. The Growth of Bosnian Pine (Pinus hedreichii Christ.) at Tree-Line Locations from Kosovo and its Response to Climate

    Bojaxhi, Faruk; Toromani, Elvin

    2016-01-01

    Background and Purpose: Pinus heldreichii Christ. is a sub-endemic species occurring at tree-line locations in Kosovo and covering an area of 2500 ha. In high elevation sites radial growth is mainly controlled by low temperatures. The main purpose of this study was the analysis of radial growth of P. heldreichii and its response to local climate conditions. Materials and Methods: Research sites comprise of three high elevation stands of P. heldreichii with specific site conditions. Core sa...

  15. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  16. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression

    Eiberg, Hans; Troelsen, Jesper; Boyd, Mette

    2008-01-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region...... within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86...... founder mutation in an OCA2 inhibiting regulatory element as the cause of blue eye color in humans. In addition, an LOD score of Z = 4.21 between hair color and D14S72 was obtained in the large family, indicating that RABGGTA is a candidate gene for hair color....

  17. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  18. Locating ethics in data science: responsibility and accountability in global and distributed knowledge production systems.

    Leonelli, Sabina

    2016-12-28

    The distributed and global nature of data science creates challenges for evaluating the quality, import and potential impact of the data and knowledge claims being produced. This has significant consequences for the management and oversight of responsibilities and accountabilities in data science. In particular, it makes it difficult to determine who is responsible for what output, and how such responsibilities relate to each other; what 'participation' means and which accountabilities it involves, with regard to data ownership, donation and sharing as well as data analysis, re-use and authorship; and whether the trust placed on automated tools for data mining and interpretation is warranted (especially as data processing strategies and tools are often developed separately from the situations of data use where ethical concerns typically emerge). To address these challenges, this paper advocates a participative, reflexive management of data practices. Regulatory structures should encourage data scientists to examine the historical lineages and ethical implications of their work at regular intervals. They should also foster awareness of the multitude of skills and perspectives involved in data science, highlighting how each perspective is partial and in need of confrontation with others. This approach has the potential to improve not only the ethical oversight for data science initiatives, but also the quality and reliability of research outputs.This article is part of the themed issue 'The ethical impact of data science'. © 2015 The Authors.

  19. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  20. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  1. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  2. Effects of heater location and heater size on the natural convection heat transfer in a square cavity using finite element method

    Ngo, Ich Long; Byon, Chan [Yeungnam University, Gyeongsan (Korea, Republic of)

    2015-07-15

    Finite element method was used to investigate the effects of heater location and heater size on the natural convection heat transfer in a 2D square cavity heated partially or fully from below and cooled from above. Rayleigh number (5 X 10{sup 2} ≤ Ra ≤ 5X10{sup 5}), heater size (0.1 ≤ D/L ≤ 1.0), and heater location (0.1 ≤ x{sub h}/L ≤ 0.5) were considered. Numerical results indicated that the average Nusselt number (Nu{sub m}) increases as the heater size decreases. In addition, when x{sub h}/L is less than 0.4, Nu{sub m} increases as x{sub h}/L increases, and Num decreases again for a larger value of x{sub h}/L. However, this trend changes when Ra is less than 10{sup 4}, suggesting that Nu{sub m} attains its maximum value at the region close to the bottom surface center. This study aims to gain insight into the behaviors of natural convection in order to potentially improve internal natural convection heat transfer.

  3. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  4. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  5. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  7. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  8. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  9. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  10. Locations and Mucosal Lesions Responsible for Major Gastrointestinal Bleeding in Patients on Warfarin or Dabigatran.

    Kolb, Jennifer M; Flack, Kathryn Friedman; Chatterjee-Murphy, Prapti; Desai, Jay; Wallentin, Lars C; Ezekowitz, Michael; Connolly, Stuart; Reilly, Paul; Brueckmann, Martina; Ilgenfritz, John; Aisenberg, James

    2018-03-27

    Different oral anticoagulants may be associated with gastrointestinal bleeding (GIB) from different locations or mucosal lesions. We aimed to test this hypothesis. Two blinded gastroenterologists independently analyzed source documents from the randomized evaluation of long-term anticoagulant therapy (RE-LY) trial of dabigatran 150 mg BID (D150), dabigatran 110 mg BID (D110) versus warfarin in non-valvular atrial fibrillation (NVAF). Major GIB events (total n = 546) and life-threatening GIB events (n = 258) were more common with D150 versus warfarin (RR 1.57 [1.28-1.92] and RR 1.62 [1.20-2.18], respectively) and similar for D110 compared to warfarin (RR 1.11 [0.89-1.38] and RR 1.16 [0.84-1.61], respectively). Fatal bleeding was similarly rare across treatment groups. Lower GI major bleeding and life-threatening bleeding were more common with D150 compared to warfarin (RR 2.23 [1.47, 3.38] and RR 2.64 [1.36, 5.13], respectively) and with D110 compared to warfarin (RR 1.78 [1.16, 2.75] and RR 2.00 [1.00, 4.00], respectively). MGIB from colonic angiodysplasia was increased with dabigatran versus warfarin (P < 0.01 for both dose comparisons). Subacute and chronic MGIB events were more common with D150 than with warfarin (RR 1.72 [1.06, 2.78] and RR 1.66 [1.12, 2.45], respectively), as were hematochezia or melena (RR 1.67 [1.18, 2.36] and RR 1.72 [1.20, 2.47], respectively). In a chronic NVAF population, D150 but not D110 is associated with increased major and life-threatening GI bleeding in comparison with warfarin. At both dabigatran doses, increased bleeding from the colorectum, in particular from angiodysplasia, is seen.

  11. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  12. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  13. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  15. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  16. Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

    Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

    2017-07-01

    Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

  17. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  18. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  19. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  20. Relation between the location of elements in the Thomsen-Bohr type periodic table and lysosomal accumulation in tumor and liver

    Ando, Atsushi; Ando, Itsuko

    1989-01-01

    This study was undertaken to evaluate the lysosomal accumulation of radioactive metal ions in tumor and liver, using tumor-bearing animals. From the experimental of lysosomal accumulation and binding substance for nineteen radioactive metal ions, the following results were obtained. Hard and borderline acids which have incomplete d-shells accumulated extensively in lysosomes of tumor and liver with time after administration of these ions. They were bound in these tissues to the acid mucopolysaccharides whose molecular weights exceed 40,000 daltons. Trivalent hard acids (Ga 3+ , In 3+ , Yb 3+ , Tm 3+ ) which have complete d-shells accumulated extensively in the lysosomes of liver, but very little in lysososmes of tumor, and were bound to the acid mucopolysaccharide with a molecular weight of about 10,000 daltons in tissues. It was clear based on these results and the facts reported previously that a very interesting relationship existed between the location of elements in the Thomsen-Bohr type periodic table and the lysosomal accumulation of metal ions

  1. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  2. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  3. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  4. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  5. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  6. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  7. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  8. Integration of growth factor signals at the c-fos serum response element.

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  9. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  10. Improvement of dynamic response in an impact absorber by frictional elements

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  11. Calculation of foundation response to spatially varying ground motion by finite element method

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  12. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  13. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  14. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  15. Location, location ... structure

    Cutler, S.; Testerink, C.

    2011-01-01

    A plant's growth, development and responses to the environment are intimately connected to internal and external signals that, through the action of signal transduction, regulate gene expression and other cellular outputs. Work from laboratories across the globe has deepened our understanding of how

  16. The transient response for different types of erodable surface thermocouples using finite element analysis

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  17. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  18. Degradation by radiation of the response of a thermocouple of a fuel element

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  19. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  20. Response of microbial community and catabolic genes to simulated petroleum hydrocarbon spills in soils/sediments from different geographic locations.

    Liu, Q; Tang, J; Liu, X; Song, B; Zhen, M; Ashbolt, N J

    2017-10-01

    Study the response of microbial communities and selected petroleum hydrocarbon (PH)-degrading genes on simulated PH spills in soils/sediments from different geographic locations. A microcosm experiment was conducted by spiking mixtures of petroleum hydrocarbons (PHs) to soils/sediments collected from four different regions of China, including the Dagang Oilfield (DG), Sand of Bohai Sea (SS), Northeast China (NE) and Xiamen (XM). Changes in bacterial community and the abundance of PH-degrading genes (alkB, nah and phe) were analysed by denaturing gradient electrophoresis (DGGE) and qPCR, respectively. Degradation of alkanes and PAHs in SS and NE materials were greater (P < 0·05) than those in DG and XM. Clay content was negatively correlated with the degradation of total alkanes by 112 days and PAHs by 56 days, while total organic carbon content was negatively correlated with initial degradation of total alkanes as well as PAHs. Abundances of alkB, nah and phe genes increased 10- to 100-fold and varied by soil type over the incubation period. DGGE fingerprints identified the dominance of α-, β- and γ-Proteobacteria (Gram -ve) and Actinobacteria (Gram +ve) bacteria associated with degradation of PHs in the materials studied. The geographic divergence resulting from the heterogeneity of physicochemical properties of soils/sediments appeared to influence the abundance of metabolic genes and community structure of microbes capable of degrading PHs. When developing practical in-situ bioremediation approaches for PHs contamination of soils/sediment, appropriate microbial community structures and the abundance of PH-degrading genes appear to be influenced by geographic location. © 2017 The Society for Applied Microbiology.

  1. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  2. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  3. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  4. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  5. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  6. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  7. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  8. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  9. Tax-Response Heterogeneity and the Effects of Double Taxation Treaties on the Location Choices of Multinational Firms

    Behrendt, Simon; Wamser, Georg

    2018-01-01

    This paper examines location choices of multinational enterprises (MNEs). We particularly focus on the consequences of double taxation treaties (DTTs) and corporate profit taxes on the probability to choose a location. DTTs have become a key policy instrument used by countries to regulate international tax issues related to the cross-border activities of MNEs. Based on three alternative location choice models, which all allow parameter estimates to vary randomly across firms, we show that fir...

  10. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  11. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  12. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  13. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  14. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  15. The key elements for genetic response in Finnish dairy cattle breeding

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  16. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  18. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  19. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  20. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  1. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  2. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  3. Examining the plankton acoustic response with a vessel mounted ADCP across oceanic fronts located in the Drake Passage

    Silvia Blanc

    2008-12-01

    Full Text Available On December 2001 and January 2006, during the LMG01-9 and LMG06-1 cruises to Antarctic Peninsula, at-sea oceanographic and acoustic measurements were conducted onboard the R/V L. M. Gould icebreaker along two transects located between (55.15 °S, 65 ºW and (64.65 °S, 65 ºW and between (55.15 ºS, 64.91 ºW and (62.7 ºS, 62.21 ºW, respectively. The scientific crew consisted of researchers from two US institutes, and a scientific observer from the Argentinean Naval Service of Research & Development under the frame of the US National Science Foundation Antarctic Program. The present work accomplishes an alternative application for a vesselmounted Acoustic Doppler Current Profiler (ADCP with an operating frequency of 153.6 kHz. Volume Acoustic Backscattering Strengths, S V, were computed from the recorded ADCP's voltages. The obtained values fell in a range of -92 dB to -62 dB, for the layer of the water column comprised between 26 m - 300 m on 2001 and in the range of -93 dB to -58 dB for the water column between 22 m - 300 m on 2006. Depth-averaged, S V, for the upper water column (about the first 150 m on experiment transects were computed as well as S V values averaged in depth and latitude. Data processing revealed interesting features about the upper ocean acoustic behaviour. On December 2001, a significant non-uniform scattering response in the ensonified water column with quite high values of S V, associated with the diel vertical migration, was obtained. Additionally, a remarkable increment in the scattering response was observed at the estimated location of the Antarctic Divergence (AD. This feature was also observed on January 2006 in addition to remarkable high values of S V, in coastal waters of the Antarctic Peninsula. Plotting and exhaustive analyses of S V (z profiles enabled the visualisation of three distinct types of qualitative patterns, namely, curves with: (I two observable maxima, (II only one maximum, (III a depth

  4. Geogenically vs. anthropogenic pollution of river sediments by potentially toxic trace elements on model locations; Geogenne vs. antropogenne znecistenie riecnych sedimentov potencialne toxickymi stopovymi prvkami na modelovych lokalitach

    Pazicka, A. [Univerzita Komenskeho, Prirodovedecka fakulta, Katedra geochemie, 84215 Bratislava (Slovakia); Michnova, J. [Univerzita Komenskeho, Prirodovedecka fakulta, Katedra loziskovej geologie, 84215 Bratislava (Slovakia)

    2013-04-16

    Rtg diffraction analysis was used to evaluate the stream sediments mineralogical composition of Maly Dunaj, Nitra and Hron rivers. Identified minerals in the sediment samples, in addition with chemical analysis of selected elements (As, Sb, Hg, Cu, Pb), helped to determine the origin (geogenic vs. anthropogenic) of these potentially toxic trace elements. The results show that Maly Dunaj sediments are mostly loaded with anthropogenic contamination (agriculture, industry). Heavy minerals identified in Nitra sediments suggest natural higher concentrations of Cu, Pb and Fe. On the other hand As and Hg contamination is caused by human activities. The main sources are the coal ash impoundments in Zemianske Kostolany and Chalmova (for As) and Novacke chemicke zavody a.s. (for Hg). Stream sediments of Hron river are mostly influneced by the geology of the catchment area (Sb - As deposits in Nizke Tatry, volcanics). (authors)

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  6. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  7. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  8. Analysis of connection element classes and locations and of some structural requirements for the mounting of different superstructure types on transport vehicles

    Zoran Đ. Majkić

    2011-04-01

    Full Text Available The paper presents the basic requirements for transport vehicles. A special request regarding the adaptation of transport vehicles for the transport of various types of cargo was taken into consideration. Superstructures and the situation arising after mounting superstructures on wheeled transport vehicles were analyzed and the following was described: console coupling, stirrups, simplex elastic coupling, two-way elastic and rigid connection elements. Vehicle torsional elasticity is provided by a proper choice of the type of connection between the superstructure and the vehicle chassis. Applying the instructions of vehicle manufacturers for using appropriate connections between the truck superstructure and the vehicle chassis provides positive torsional elasticity of the vehicle. The paper gives the general recommendations of the Volvo, Mercedes and Renault transport vehicle producers for the use of particular connection types of locations as well as structural requirements for the mounting of concrete mixers, tippers and truck tanks on their vehicles. Introduction Achieving a high level of transport effectiveness depends on a number of factors. One of the most important ones is the possibility to increase the payload share in the gross vehicle weight. This share depends on the net vehicle weight, a method of coupling the truck superstructure with the chassis frame as well as on the truck superstructure construction. Realization of this requirement is of significant importance, particularly for large business systems since it results in the reduction of number of necessary vehicles, more economic fleet maintenance and the fleet capacity increase. It is also relatively easy to adapt the vehicle for the transportation of other loads, depending on user's current needs. The adaptation is correctly performed if manufacturer's recommendations are followed during the mounting of the superstructure on the chassis. This paper gives the analysis of the

  9. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  10. The Growth of Bosnian Pine (Pinus hedreichii Christ. at Tree-Line Locations from Kosovo and its Response to Climate

    Faruk Bojaxhi

    2016-12-01

    Full Text Available Background and Purpose: Pinus heldreichii Christ. is a sub-endemic species occurring at tree-line locations in Kosovo and covering an area of 2500 ha. In high elevation sites radial growth is mainly controlled by low temperatures. The main purpose of this study was the analysis of radial growth of P. heldreichii and its response to local climate conditions. Materials and Methods: Research sites comprise of three high elevation stands of P. heldreichii with specific site conditions. Core samples were collected from 98 healthy dominant and co-dominant trees at breast height using increment borer. They were prepared and cross-dated using standard dendrochronological methods, while tree-ring widths were measured to the nearest 0.001 mm using the TSAP software. The ARSTAN program was used to standardize the tree-ring widths and to calculate dendrochronological statistical parameters. The growth-climate relationship was investigated using bootstrapped correlation function analysing the residual chronologies of each sampled site as a dependent variable and the climatic data from May of the (n-1 year up to the October of the n year for the common period 1951-2013 as an independent variable. Results: The length of Bosnian pine chronologies ranged from 175 to 541 years. All chronologies had high values of first-order autocorrelation indicating that radial growth of P. heldreichii is affected by the climate conditions of the previous growing year. Koritnik chronology had the highest values of the mean sensitivity due to the influence of drought stress. This conclusion is also supported by the result of growth-climate relationship where radial growth is negatively correlated with June temperatures and positively associated with July and August precipitation. We found that radial growth of young trees from Koritnik site is limited by the combined effect of temperatures and summer drought stress. In high elevation sites, temperature is expected to control the

  11. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  12. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  13. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  14. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  15. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  16. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  17. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  18. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  19. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  20. An approach to unfold the response of a multi-element system using an artificial neural network

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  1. Location Indices for Ordinal Polytomous Items Based on Item Response Theory. Research Report. ETS RR-15-20

    Ali, Usama S.; Chang, Hua-Hua; Anderson, Carolyn J.

    2015-01-01

    Polytomous items are typically described by multiple category-related parameters; situations, however, arise in which a single index is needed to describe an item's location along a latent trait continuum. Situations in which a single index would be needed include item selection in computerized adaptive testing or test assembly. Therefore single…

  2. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  3. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  4. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  5. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  6. Locative media

    Wilken, Rowan

    2014-01-01

    Not only is locative media one of the fastest growing areas in digital technology, but questions of location and location-awareness are increasingly central to our contemporary engagements with online and mobile media, and indeed media and culture generally. This volume is a comprehensive account of the various location-based technologies, services, applications, and cultures, as media, with an aim to identify, inventory, explore, and critique their cultural, economic, political, social, and policy dimensions internationally. In particular, the collection is organized around the perception that the growth of locative media gives rise to a number of crucial questions concerning the areas of culture, economy, and policy.

  7. Mechanics of the Compression Wood Response: II. On the Location, Action, and Distribution of Compression Wood Formation.

    Archer, R R; Wilson, B F

    1973-04-01

    A new method for simulation of cross-sectional growth provided detailed information on the location of normal wood and compression wood increments in two tilted white pine (Pinus strobus L.) leaders. These data were combined with data on stiffness, slope, and curvature changes over a 16-week period to make the mechanical analysis. The location of compression wood changed from the under side to a flank side and then to the upper side of the leader as the geotropic stimulus decreased, owing to compression wood action. Its location shifted back to a flank side when the direction of movement of the leader reversed. A model for this action, based on elongation strains, was developed and predicted the observed curvature changes with elongation strains of 0.3 to 0.5%, or a maximal compressive stress of 60 to 300 kilograms per square centimeter. After tilting, new wood formation was distributed so as to maintain consistent strain levels along the leaders in bending under gravitational loads. The computed effective elastic moduli were about the same for the two leaders throughout the season.

  8. Locating Human-Wildlife Interactions: Landscape Constructions and Responses to Large Carnivore Conservation in India and Norway

    Sunetro Ghosal

    2015-01-01

    Full Text Available People′s reactions to large carnivores take many forms, ranging from support and coexistence to resistance and conflict. While these reactions are the outcome of many different factors, in this paper we specifically explore the link between social constructions of landscapes and divergent responses to large carnivore presence. We compare case studies from four different landscapes shared by people and large carnivores, in India and Norway. We use social construction of landscapes as a key concept to explore responses to large carnivores in the context of ecological, economic, social, and cultural changes in these areas. Based on this comparison, we argue that the process of change is complex, with a plurality of responses from the groups affected by it. The response to large carnivore presence is influenced by many different factors, of which the interpretation of change-particularly landscape change-plays a significant role.

  9. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  10. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  11. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  12. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  13. Location, location, location: Extracting location value from house prices

    Kolbe, Jens; Schulz, Rainer; Wersing, Martin; Werwatz, Axel

    2012-01-01

    The price for a single-family house depends both on the characteristics of the building and on its location. We propose a novel semiparametric method to extract location values from house prices. After splitting house prices into building and land components, location values are estimated with adaptive weight smoothing. The adaptive estimator requires neither strong smoothness assumptions nor local symmetry. We apply the method to house transactions from Berlin, Germany. The estimated surface...

  14. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  15. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  16. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  17. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  18. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  19. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  20. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  1. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  2. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  3. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  4. Location-specific responses to thermal stress in larvae of the reef-building coral Montastraea faveolata.

    Polato, Nicholas R; Voolstra, Christian R.; Schnetzer, Julia; DeSalvo, Michael K; Randall, Carly J; Szmant, Alina M; Medina, Mó nica; Baums, Iliana B

    2010-01-01

    The potential to adapt to a changing climate depends in part upon the standing genetic variation present in wild populations. In corals, the dispersive larval phase is particularly vulnerable to the effects of environmental stress. Larval survival and response to stress during dispersal and settlement will play a key role in the persistence of coral populations.

  5. Location-specific responses to thermal stress in larvae of the reef-building coral Montastraea faveolata.

    Polato, Nicholas R

    2010-06-23

    The potential to adapt to a changing climate depends in part upon the standing genetic variation present in wild populations. In corals, the dispersive larval phase is particularly vulnerable to the effects of environmental stress. Larval survival and response to stress during dispersal and settlement will play a key role in the persistence of coral populations.

  6. Detecting response of Douglas-fir plantations to urea fertilizer at three locations in the Oregon Coast Range.

    Richard E. Miller; Jim Smith; Harry. Anderson

    2001-01-01

    Fertilizer trials in coast Douglas-fir (Pseudotsuga menziesii var. menziesii (Mirb.) Franco) in the Oregon Coast Range usually indicate small and statistically nonsignificant response to nitrogen (N) fertilizers. Inherently weak experimental designs of past trials could make them too insensitive to detect growth differences...

  7. Predictors of locating women six to eight years after contact: internet resources at recruitment may help to improve response rates in longitudinal research

    Gignac Monique AM

    2007-06-01

    Full Text Available Abstract Background The ability to locate those sampled has important implications for response rates and thus the success of survey research. The purpose of this study was to examine predictors of locating women requiring tracing using publicly available methods (primarily Internet searches, and to determine the additional benefit of vital statistics linkages. Methods Random samples of women aged 65–89 years residing in two regions of Ontario, Canada were selected from a list of those who completed a questionnaire between 1995 and 1997 (n = 1,500. A random sample of 507 of these women had been searched on the Internet as part of a feasibility pilot in 2001. All 1,500 women sampled were mailed a newsletter and information letter prior to recruitment by telephone in 2003 and 2004. Those with returned mail or incorrect telephone number(s required tracing. Predictors of locating women were examined using logistic regression. Results Tracing was required for 372 (25% of the women sampled, and of these, 181 (49% were located. Predictors of locating women were: younger age, residing in less densely populated areas, having had a web-search completed in 2001, and listed name identified on the Internet prior to recruitment in 2003. Although vital statistics linkages to death records subsequently identified 41 subjects, these data were incomplete. Conclusion Prospective studies may benefit from using Internet resources at recruitment to determine the listed names for telephone numbers thereby facilitating follow-up tracing and improving response rates. Although vital statistics linkages may help to identify deceased individuals, these may be best suited for post hoc response rate adjustment.

  8. Potential tank waste material anomalies located near the liquid observation wells: Model predicted responses of a neutron moisture detection system

    Finfrock, S.H.; Toffer, H.; Watson, W.T.

    1994-09-01

    Extensive analyses have been completed to demonstrate that a neutron moisture probe can be used to recognize anomalies in materials and geometry surrounding the liquid observation wells (LOWs). Furthermore, techniques can be developed that will permit the interpretation of detector readings, perturbed by the presence of anomalies, as more accurate moisture concentrations. This analysis effort extends the usefulness of a neutron moisture probe system significantly, especially in the complicated geometries and material conditions that may be encountered in the waste tanks. Both static-source and pulsed-source neutron probes were considered in the analyses. Four different detector configurations were investigated: Thermal and epithermal neutron detectors located in both the near and far field

  9. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  10. Effects induced on the transverse-spatial-impulse response of an inhomogeneous photoreceptor with a nonsymmetric refractive index profile and arbitrarily located origin

    Calvo, M.L.

    1987-01-01

    In a few earlier communications, spatial-transverse-impulse response (STIR) associated with the initial field transversely distributed across the entrance pupil of an inhomogeneous optical wave guide (photo-receptor) has been investigated. In the present work, effects of indetermination in the location of the origin on an arbitrarily defined refractive index profile, representing the degree of inhomogenity at the aperture pupil of a single receptor, have been studied. Some consequences related to a few possible technical applications have been discussed

  11. Effects induced on the transverse-spatial-impulse response of an inhomogeneous photoreceptor with a nonsymmetric refractive index profile and arbitrarily located origin

    Calvo, M.L.; Mondal, P.K.

    1987-03-01

    In a few earlier communications, spatial-transverse-impulse response (STIR) associated with the initial field transversely distributed across the entrance pupil of an inhomogeneous optical wave guide (photoreceptor) has been investigated. In the present work, effects of indetermination in the location of the origin on an arbitrarily defined refractive index profile, representing the degree of inhomogeneity at the aperture pupil of a single receptor, have been studied. Some consequences related to a few possible technical applications have been discussed.

  12. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Interactions of numerical and temporal stimulus characteristics on the control of response location by brief flashes of light.

    Fetterman, J Gregor; Killeen, P Richard

    2011-09-01

    Pigeons pecked on three keys, responses to one of which could be reinforced after 3 flashes of the houselight, to a second key after 6, and to a third key after 12. The flashes were arranged according to variable-interval schedules. Response allocation among the keys was a function of the number of flashes. When flashes were omitted, transitions occurred very late. Increasing flash duration produced a leftward shift in the transitions along a number axis. Increasing reinforcement probability produced a leftward shift, and decreasing reinforcement probability produced a rightward shift. Intermixing different flash rates within sessions separated allocations: Faster flash rates shifted the functions sooner in real time, but later in terms of flash count, and conversely for slower flash rates. A model of control by fading memories of number and time was proposed.

  14. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  15. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  16. Knowing where is different from knowing what: Distinct response time profiles and accuracy effects for target location, orientation, and color probability.

    Jabar, Syaheed B; Filipowicz, Alex; Anderson, Britt

    2017-11-01

    When a location is cued, targets appearing at that location are detected more quickly. When a target feature is cued, targets bearing that feature are detected more quickly. These attentional cueing effects are only superficially similar. More detailed analyses find distinct temporal and accuracy profiles for the two different types of cues. This pattern parallels work with probability manipulations, where both feature and spatial probability are known to affect detection accuracy and reaction times. However, little has been done by way of comparing these effects. Are probability manipulations on space and features distinct? In a series of five experiments, we systematically varied spatial probability and feature probability along two dimensions (orientation or color). In addition, we decomposed response times into initiation and movement components. Targets appearing at the probable location were reported more quickly and more accurately regardless of whether the report was based on orientation or color. On the other hand, when either color probability or orientation probability was manipulated, response time and accuracy improvements were specific for that probable feature dimension. Decomposition of the response time benefits demonstrated that spatial probability only affected initiation times, whereas manipulations of feature probability affected both initiation and movement times. As detection was made more difficult, the two effects further diverged, with spatial probability disproportionally affecting initiation times and feature probability disproportionately affecting accuracy. In conclusion, all manipulations of probability, whether spatial or featural, affect detection. However, only feature probability affects perceptual precision, and precision effects are specific to the probable attribute.

  17. Locations in Television Drama Series

    Waade, Anne Marit

    2017-01-01

    This special issue is dedicated to the analysis of the increasingly significant role of location as a key element in television drama. In recent years, the popularity of serial television has progressively been tied to the expanded use of location as a central element in productions, both as sett...... mainly been considered as a practical term in film and television productions....

  18. Modeling and assessment of the response of super-light elements to fire

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  19. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  20. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  1. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  2. Library Locations

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Carnegie Library of Pittsburgh locations including address, coordinates, phone number, square footage, and standard operating hours. The map below does not display...

  3. Cyclic and dynamic response of a bridge pier model located at the Volvi European test site in Greece

    Manos, G.C.; Kourtides, V.; Soulis, V.J.

    2005-01-01

    This paper presents results of the measured and predicted response of a bridge pier model-structures which has been erected at the Volvi-Greece European Test Site for Earthquake Engineering. The disadvantage at the Test Site is that one is unable to produce significant in-situ levels of ground motion, when desired, as can be generated by an earthquake simulator. However, one is having the advantage at the Test Site of realistic foundations conditions, which are present for model structures that are built there and are supported on the soft soil deposits in-situ. The current extension of the in-situ facility includes the possibility of subjecting large-scale model structures to low to medium intensity man-made dynamic excitations. At this point in time the model structures that are built at the test site include: a) A 6-story Reinforced Concrete building model with masonry in fills; b) A single bridge pier model, built for the purposes of the currently running Euro-Risk program, which is supported by the European Union. The variation of the dynamic characteristics of the 6-story 1/3 3-D frame model structure was measured over a period of ten years. So far, only one earthquake of moderate intensity has subjected the 6-story model structure to seismic loads and excited the permanent instrumentation system. The main objective of the recent tests, which are partially presented in this paper and involve the bridge pier model, is to include influences on the dynamic structural response arising from the flexible foundation support conditions. The bridge pier model was initially studied at the laboratory under cyclic horizontal loads that were applied simultaneously with vertical forces. Thus, the cyclic post-elastic behavior of this bridge pier model was recorded at the laboratory. Next, a series of low intensity excitations were performed at the test site over a period of two years. During this period, the pier model structure was in various configurations that included

  4. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  5. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  6. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  8. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  9. Apparatus including a plurality of spaced transformers for locating short circuits in cables

    Cason, R. L.; Mcstay, J. J. (Inventor)

    1978-01-01

    A cable fault locator is described for sensing faults such as short circuits in power cables. The apparatus includes a plurality of current transformers strategically located along a cable. Trigger circuits are connected to each of the current transformers for placing a resistor in series with a resistive element responsive to an abnormally high current flowing through that portion of the cable. By measuring the voltage drop across the resistive element, the location of the fault can be determined.

  10. Ground motion response to an ML 4.3 earthquake using co-located distributed acoustic sensing and seismometer arrays

    Wang, Herbert F.; Zeng, Xiangfang; Miller, Douglas E.; Fratta, Dante; Feigl, Kurt L.; Thurber, Clifford H.; Mellors, Robert J.

    2018-06-01

    The PoroTomo research team deployed two arrays of seismic sensors in a natural laboratory at Brady Hot Springs, Nevada in March 2016. The 1500 m (length) × 500 m (width) × 400 m (depth) volume of the laboratory overlies a geothermal reservoir. The distributed acoustic sensing (DAS) array consisted of about 8400 m of fiber-optic cable in a shallow trench and 360 m in a well. The conventional seismometer array consisted of 238 shallowly buried three-component geophones. The DAS cable was laid out in three parallel zig-zag lines with line segments approximately 100 m in length and geophones were spaced at approximately 60 m intervals. Both DAS and conventional geophones recorded continuously over 15 d during which a moderate-sized earthquake with a local magnitude of 4.3 was recorded on 2016 March 21. Its epicentre was approximately 150 km south-southeast of the laboratory. Several DAS line segments with co-located geophone stations were used to compare signal-to-noise ratios (SNRs) in both time and frequency domains and to test relationships between DAS and geophone data. The ratios were typically within a factor of five of each other with DAS SNR often greater for P-wave but smaller for S-wave relative to geophone SNR. The SNRs measured for an earthquake can be better than for active sources because the earthquake signal contains more low-frequency energy and the noise level is also lower at those lower frequencies. Amplitudes of the sum of several DAS strain-rate waveforms matched the finite difference of two geophone waveforms reasonably well, as did the amplitudes of DAS strain waveforms with particle-velocity waveforms recorded by geophones. Similar agreement was found between DAS and geophone observations and synthetic strain seismograms. The combination of good SNR in the seismic frequency band, high-spatial density, large N and highly accurate time control among individual sensors suggests that DAS arrays have potential to assume a role in earthquake

  11. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  13. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  14. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  15. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  16. Gene Locater

    Anwar, Muhammad Zohaib; Sehar, Anoosha; Rehman, Inayat-Ur

    2012-01-01

    software's for calculating recombination frequency is mostly limited to the range and flexibility of this type of analysis. GENE LOCATER is a fully customizable program for calculating recombination frequency, written in JAVA. Through an easy-to-use interface, GENE LOCATOR allows users a high degree...... of flexibility in calculating genetic linkage and displaying linkage group. Among other features, this software enables user to identify linkage groups with output visualized graphically. The program calculates interference and coefficient of coincidence with elevated accuracy in sample datasets. AVAILABILITY...

  17. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  18. Study on the Effect of the Impact Location and the Type of Hammer Tip on the Frequency Response Function (FRF) in Experimental Modal Analysis of Rectangular Plates

    Mali, K. D.; Singru, P. M.

    2018-03-01

    In this work effect of the impact location and the type of hammer tip on the frequency response function (FRF) is studied. Experimental modal analysis of rectangular plates is carried out for this purpose by using impact hammer, accelerometer and fast Fourier transform (FFT) analyzer. It is observed that the impulse hammer hit location has, no effect on the eigenfrequency, yet a difference in amplitude of the eigenfrequencies is obtained. The effect of the hammer tip on the pulse and the force spectrum is studied for three types of tips metal, plastic and rubber. A solid rectangular plate was excited by using these tips one by one in three different tests. It is observed that for present experimental set up plastic tip excites the useful frequency range.

  19. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  20. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  1. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  2. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  3. Molecular Interaction and Cellular Location of RecA and CheW Proteins in Salmonella enterica during SOS Response and Their Implication in Swarming.

    Irazoki, Oihane; Aranda, Jesús; Zimmermann, Timo; Campoy, Susana; Barbé, Jordi

    2016-01-01

    In addition to its role in DNA damage repair and recombination, the RecA protein, through its interaction with CheW, is involved in swarming motility, a form of flagella-dependent movement across surfaces. In order to better understand how SOS response modulates swarming, in this work the location of RecA and CheW proteins within the swarming cells has been studied by using super-resolution microscopy. Further, and after in silico docking studies, the specific RecA and CheW regions associated with the RecA-CheW interaction have also been confirmed by site-directed mutagenesis and immunoprecipitation techniques. Our results point out that the CheW distribution changes, from the cell poles to foci distributed in a helical pattern along the cell axis when SOS response is activated or RecA protein is overexpressed. In this situation, the CheW presents the same subcellular location as that of RecA, pointing out that the previously described RecA storage structures may be modulators of swarming motility. Data reported herein not only confirmed that the RecA-CheW pair is essential for swarming motility but it is directly involved in the CheW distribution change associated to SOS response activation. A model explaining not only the mechanism by which DNA damage modulates swarming but also how both the lack and the excess of RecA protein impair this motility is proposed.

  4. Molecular interaction and cellular location of RecA and CheW proteins in Salmonella enterica during SOS response and their implication in swarming

    Oihane Irazoki

    2016-10-01

    Full Text Available In addition to its role in DNA damage repair and recombination, the RecA protein, through its interaction with CheW, is involved in swarming motility, a form of flagella-dependent movement across surfaces. In order to better understand how SOS response modulates swarming, in this work the location of RecA and CheW proteins within the swarming cells has been studied by using super-resolution microscopy. Further, and after in silico docking studies, the specific RecA and CheW regions associated with the RecA-CheW interaction have also been confirmed by site-directed mutagenesis and immunoprecipitation techniques. Our results point out that the CheW distribution changes, from the cell poles to foci distributed in a helical pattern along the cell axis when SOS response is activated or RecA protein is overexpressed. In this situation, the CheW presents the same subcellular location as that of RecA, pointing out that the previously described RecA storage structures may be modulators of swarming motility. Data reported herein not only confirmed that the RecA-CheW pair is essential for swarming motility but it is directly involved in the CheW distribution change associated to SOS response activation. A model explaining not only the mechanism by which DNA damage modulates swarming but also how both the lack and the excess of RecA protein impair this motility is proposed.

  5. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  6. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  7. Assisting the development of innovative responsive façade elements using building performance simulation

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  8. The effect of tibia element on the tibia response due to impact loading

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  9. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  10. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  11. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  12. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  13. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  14. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  15. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  16. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  17. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula.

    Pereira, Paulo; Ubeda, Xavier; Martin, Deborah; Mataix-Solera, Jorge; Guerrero, César

    2011-02-01

    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO(2)) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40×70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (pfire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity prescribed fire will improve soil nutrient status without causing soil degradation and thus is considered to be a good management strategy. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  19. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  20. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  1. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  2. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula

    Pereira, P.; beda, X.; Martin, D.; Mataix-Solera, J.; Guerrero, C.

    2011-01-01

    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO2) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40??70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (p<0.001), water-soluble Ca, Mg, Na, SiO2 and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements p<0.001 and p<0.01, respectively, and a non-significant impact in the third, at p<0.05. In Q.R data we identified a non-significant impact on water-soluble K and Al and a significant decrease in water-soluble Fe (p<0.05). These differences are probably due to vegetation characteristics and burn severity. The fire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity prescribed

  3. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  4. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  5. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  6. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  7. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  8. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  9. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  10. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  11. A study of the utility of heat collectors in reducing the response time of automatic fire sprinklers located in production modules of Building 707

    Shanley, J.H. Jr.; Budnick, E.K. Jr.

    1990-01-01

    Several of the ten production Modules in Building 707 at the Department of Energy Rocky Flats Plant recently underwent an alteration which can adversely affect the performance of the installed automatic fire sprinkler systems. The Modules have an approximate floor to ceiling height of 17.5 ft. The alterations involved removing the drop ceilings in the Modules which had been at a height of 12 ft above the floor. The sprinkler systems were originally installed with the sprinkler heads located below the drop ceiling in accordance with the nationally recognized NFPA 13, Standard for the Installation of Automatic Sprinkler Systems. The ceiling removal affects the sprinkler's response time and also violates NFPA 13. The scope of this study included evaluation of the feasibility of utilizing heat collectors to reduce the delays in sprinkler response created by the removal of the drop ceilings. The study also includes evaluation of substituting quick response sprinklers for the standard sprinklers currently in place, in combination with a heat collector

  12. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  13. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  14. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  15. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  16. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  17. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  18. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  19. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  20. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  1. The impact of lesion location on dysphagia incidence, pattern and complications in acute stroke. Part 2: Oropharyngeal residue, swallow and cough response, and pneumonia.

    Suntrup-Krueger, S; Kemmling, A; Warnecke, T; Hamacher, C; Oelenberg, S; Niederstadt, T; Heindel, W; Wiendl, H; Dziewas, R

    2017-06-01

    Dysphagia is a well-known complication of acute stroke. Given the complexity of cerebral swallowing control it is still difficult to predict which patients are likely to develop swallowing dysfunction based on their neuroimaging. In Part 2 of a comprehensive voxel-based imaging study, whether the location of a stroke lesion can be correlated with further dysfunctional swallowing patterns, pulmonary protective reflexes and pneumonia was evaluated. In all, 200 acute stroke cases were investigated applying flexible endoscopic evaluation of swallowing within 96 h from admission. Lesions were mapped using patients' computed tomography/magnetic resonance images and these were registered to a standard space. The percentage of lesioned volume of 137 anatomically defined brain regions was determined on a voxel basis (FSL5.0). Region-specific odds ratios (ORs) were calculated with respect to the presence of oropharyngeal residue, delayed swallow response, insufficient cough reflex and occurrence of pneumonia during hospital stay. Colour-coded lesion location maps of brain regions with significant ORs were created (P pneumonia, but substantial overlap between the last two conditions. This study gives new insights on the cortical representation of single components of swallowing and airway protection behaviours. The lesion model may help to risk-stratify patients for dysphagia and pneumonia based on their brain scan. © 2017 EAN.

  2. Aperture size, materiality of the secondary room and listener location: Impact on the simulated impulse response of a coupled-volume concert hall

    Ermann, Michael; Johnson, Marty E.; Harrison, Byron W.

    2003-04-01

    By adding a second room to a concert hall, and designing doors to control the sonic transparency between the two rooms, designers can create a new, coupled acoustic. Concert halls use coupling to achieve a variable, longer and distinct reverberant quality for their musicians and listeners. For this study, a coupled-volume concert hall based on an existing performing arts center is conceived and computer-modeled. It has a fixed geometric volume, form and primary-room sound absorption. Ray-tracing software simulates impulse responses, varying both aperture size and secondary-room sound absorption level, across a grid of receiver (listener) locations. The results are compared with statistical analysis that suggests a highly sensitive relationship between the double-sloped condition and the architecture of the space. This line of study aims to quantitatively and spatially correlate the double-sloped condition with (1) aperture size exposing the chamber, (2) sound absorptance in the coupled volume, and (3) listener location.

  3. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  4. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  5. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  6. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  7. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  8. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  9. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  10. Response of Some Bread Wheat Cultivars to Foliar Application of Zn and Fe Different Forms in Two Locations with Different Soil Properties

    E Arazmjoo

    2018-05-01

    Full Text Available Introduction Zinc (Zn and iron (Fe are essential mineral nutrients for plant and human growth, and dietary Zn and Fe deficiencies are a worldwide nutritional problem. The Recommended Dietary Allowance (RDA of Zn and Fe are 15 mg and 10 mg per day for human, respectively. However, micronutrient deficiencies affect more than half of the world’s population, especially women and preschool children. Iron is one of the most important micronutrients, and approximately two billion people suffer from iron deficiency worldwide. Zinc deficiency is also considered to be quite common and affects newborn, children, pregnant women and elderly. Micronutrient malnutrition in human in developing countries is derived from deficiencies of these elements in staple food. It is believed that increasing the micronutrient concentrations in these crops could increase the dietary intake of these elements in these regions significantly. More than 80% of arable soils in Iran are zinc-deficient with an average yield depression of around 50%. It is, therefore, highly important to develop cost-effective and quick solutions to the Zn and Fe deficiency problem. Materials and Methods In order to evaluate the effect of foliar application of zinc and iron different forms on yield components, phonological and morphological traits and grain yield of some wheat cultivars in two locations with different physico-chemical soil properties, two experiments in factorial arranged in randomized complete block design with three replications conducted during 2015-16 cropping season. Experimental treatments were included: wheat cultivars Roshan, Roshan Back cross (old cultivars, Bam and Ofogh (new cultivars, zinc application in three levels of foliar application of water (control, zinc sulfate and chelated zinc and iron application in three levels of foliar application of water (control, iron sulfate and chelated iron (equivalent to 2.5 kg ha-1. The first experiment was conducted at the

  11. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  12. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  13. Genome-Wide Analyses of the NAC Transcription Factor Gene Family in Pepper (Capsicum annuum L.: Chromosome Location, Phylogeny, Structure, Expression Patterns, Cis-Elements in the Promoter, and Interaction Network

    Weiping Diao

    2018-03-01

    Full Text Available The NAM, ATAF1/2, and CUC2 (NAC transcription factors form a large plant-specific gene family, which is involved in the regulation of tissue development in response to biotic and abiotic stress. To date, there have been no comprehensive studies investigating chromosomal location, gene structure, gene phylogeny, conserved motifs, or gene expression of NAC in pepper (Capsicum annuum L.. The recent release of the complete genome sequence of pepper allowed us to perform a genome-wide investigation of Capsicum annuum L. NAC (CaNAC proteins. In the present study, a comprehensive analysis of the CaNAC gene family in pepper was performed, and a total of 104 CaNAC genes were identified. Genome mapping analysis revealed that CaNAC genes were enriched on four chromosomes (chromosomes 1, 2, 3, and 6. In addition, phylogenetic analysis of the NAC domains from pepper, potato, Arabidopsis, and rice showed that CaNAC genes could be clustered into three groups (I, II, and III. Group III, which contained 24 CaNAC genes, was exclusive to the Solanaceae plant family. Gene structure and protein motif analyses showed that these genes were relatively conserved within each subgroup. The number of introns in CaNAC genes varied from 0 to 8, with 83 (78.9% of CaNAC genes containing two or less introns. Promoter analysis confirmed that CaNAC genes are involved in pepper growth, development, and biotic or abiotic stress responses. Further, the expression of 22 selected CaNAC genes in response to seven different biotic and abiotic stresses [salt, heat shock, drought, Phytophthora capsici, abscisic acid, salicylic acid (SA, and methyl jasmonate (MeJA] was evaluated by quantitative RT-PCR to determine their stress-related expression patterns. Several putative stress-responsive CaNAC genes, including CaNAC72 and CaNAC27, which are orthologs of the known stress-responsive Arabidopsis gene ANAC055 and potato gene StNAC30, respectively, were highly regulated by treatment with

  14. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  16. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  17. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  18. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  19. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  20. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  1. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  2. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  4. Epidermis–dermis junction as a novel location for bone marrow-derived cells to reside in response to ionizing radiation

    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakae, Yuki; Terashima, Tomoya; Nakagawa, Takahiko; Kurakane, Takeshi; Okamoto, Naoki; Morohashi, Keita; Maegawa, Hiroshi; Udagawa, Jun

    2015-01-01

    Bone marrow-derived cells (BMDCs) can migrate into the various organs in the mice irradiated by ionizing radiation (IR). However, it may not be the case in the skin. While IR is used for bone marrow (BM) transplantation, studying with the epidermal sheets demonstrated that the BMDC recruitment is extraordinarily rare in epidermis in the mouse. Herein, using the chimera mice with BM from green fluorescent protein (GFP) transgenic mice, we simply examined if BMDCs migrate into any layers in the total skin, as opposed to the epidermal sheets, in response to IR. Interestingly, we identified the presence of GFP-positive (GFP + ) cells in the epidermis-dermis junction in the total skin sections although the epidermal cell sheets failed to have any GFP cells. To examine a possibility that the cells in the junction could be mechanically dissociated during separating epidermal sheets, we then salvaged such dissociated cells and examined its characteristics. Surprisingly, some GFP + cells were found in the salvaged cells, indicating that these cells could be derived from BM. In addition, such BMDCs were also associated with inflammation in the junction. In conclusion, BMDCs can migrate to and reside in the epidermis-dermis junction after IR. - Highlights: • Bone marrow-derived cells (BMDCs) migrate in the epidermis due to ionizing radiation (IR). • BMDCs dissociate from the epidermis-dermis junction in preparing epidermal sheets. • The doses of IR determine the location and the number of migrating BMDCs in the skin

  5. Epidermis–dermis junction as a novel location for bone marrow-derived cells to reside in response to ionizing radiation

    Okano, Junko, E-mail: jokano@belle.shiga-med.ac.jp [Division of Anatomy and Cell Biology, Shiga University of Medical Science, Shiga (Japan); Kojima, Hideto; Katagi, Miwako [Department of Stem Cell Biology and Regenerative Medicine, Shiga University of Medical Science, Shiga (Japan); Nakae, Yuki [Department of Internal Medicine, Shiga University of Medical Science, Shiga (Japan); Terashima, Tomoya [Department of Stem Cell Biology and Regenerative Medicine, Shiga University of Medical Science, Shiga (Japan); Nakagawa, Takahiko [TMK Project, Medical Innovation Center, Kyoto University Graduate School of Medicine, Kyoto (Japan); Kurakane, Takeshi; Okamoto, Naoki; Morohashi, Keita [Division of Anatomy and Cell Biology, Shiga University of Medical Science, Shiga (Japan); Maegawa, Hiroshi [Department of Internal Medicine, Shiga University of Medical Science, Shiga (Japan); Udagawa, Jun [Division of Anatomy and Cell Biology, Shiga University of Medical Science, Shiga (Japan)

    2015-06-12

    Bone marrow-derived cells (BMDCs) can migrate into the various organs in the mice irradiated by ionizing radiation (IR). However, it may not be the case in the skin. While IR is used for bone marrow (BM) transplantation, studying with the epidermal sheets demonstrated that the BMDC recruitment is extraordinarily rare in epidermis in the mouse. Herein, using the chimera mice with BM from green fluorescent protein (GFP) transgenic mice, we simply examined if BMDCs migrate into any layers in the total skin, as opposed to the epidermal sheets, in response to IR. Interestingly, we identified the presence of GFP-positive (GFP{sup +}) cells in the epidermis-dermis junction in the total skin sections although the epidermal cell sheets failed to have any GFP cells. To examine a possibility that the cells in the junction could be mechanically dissociated during separating epidermal sheets, we then salvaged such dissociated cells and examined its characteristics. Surprisingly, some GFP{sup +} cells were found in the salvaged cells, indicating that these cells could be derived from BM. In addition, such BMDCs were also associated with inflammation in the junction. In conclusion, BMDCs can migrate to and reside in the epidermis-dermis junction after IR. - Highlights: • Bone marrow-derived cells (BMDCs) migrate in the epidermis due to ionizing radiation (IR). • BMDCs dissociate from the epidermis-dermis junction in preparing epidermal sheets. • The doses of IR determine the location and the number of migrating BMDCs in the skin.

  6. Towards a Location-based Service for Early Mental Health Interventions in Disaster Response Using Minimalistic Tele-operated Android Robots Technology

    Vahidi, H.; Mobasheri, A.; Alimardani, M.; Guan, Q.; Bakillah, M.

    2014-04-01

    Providing early mental health services during disaster is a great challenge in the disaster response phase. Lack of access to adequate mental-health professionals in the early stages of large-scale disasters dramatically influences the trend of a successful mental health aid. In this paper, a conceptual framework has been suggested for adopting cellphone-type tele-operated android robots in the early stages of disasters for providing the early mental health services for disaster survivors by developing a locationbased and participatory approach. The techniques of enabling GI-services in a Peer-to-Peer (P2P) environment were studied to overcome the limitations of current centralized services. Therefore, the aim of this research study is to add more flexibility and autonomy to GI web services (WMS, WFS, WPS, etc.) and alleviate to some degree the inherent limitations of these centralized systems. A P2P system Architecture is presented for the location-based service using minimalistic tele-operated android robots, and some key techniques of implementing this service using BestPeer were studied for developing this framework.

  7. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  8. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  9. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  10. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  12. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  13. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  14. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  16. Wireless Damage Location Sensing System

    Woodard, Stanley E. (Inventor); Taylor, Bryant Douglas (Inventor)

    2012-01-01

    A wireless damage location sensing system uses a geometric-patterned wireless sensor that resonates in the presence of a time-varying magnetic field to generate a harmonic response that will experience a change when the sensor experiences a change in its geometric pattern. The sensing system also includes a magnetic field response recorder for wirelessly transmitting the time-varying magnetic field and for wirelessly detecting the harmonic response. The sensing system compares the actual harmonic response to a plurality of predetermined harmonic responses. Each predetermined harmonic response is associated with a severing of the sensor at a corresponding known location thereof so that a match between the actual harmonic response and one of the predetermined harmonic responses defines the known location of the severing that is associated therewith.

  17. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  18. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  19. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  20. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  1. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  2. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  3. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  4. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  5. Location Systems An Introduction to the Technology Behind Location Awareness

    LaMarca, Anthony

    2008-01-01

    Advances in electronic location technology and the coming of age of mobile computing have opened the door for location-aware applications to permeate all aspects of everyday life. Location is at the core of a large number of high-value applications ranging from the life-and-death context of emergency response to serendipitous social meet-ups. For example, the market for GPS products and services alone is expected to grow to US200 billion by 2015. Unfortunately, there is no single location technology that is good for every situation and exhibits high accuracy, low cost, and universal coverage.

  6. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  7. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  8. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species.

    Darshan Shimoga Chandrashekar

    Full Text Available Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses.We developed the 'Genomic Repeat Element Analyzer for Mammals' (GREAM for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a enrichment within chromosomal region(s of interest, and b comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20 known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species.GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting repeats in various

  9. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  10. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  11. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  12. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  13. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  14. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  15. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake.

    Shirokova, L S; Pokrovsky, O S; Moreva, O Yu; Chupakov, A V; Zabelina, S A; Klimov, S I; Shorina, N V; Vorobieva, T Ya

    2013-10-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa-0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30°C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70-80% to only 20-30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90-98% in most summers and winters to approximately 60-70% in August 2010. During this hot summer, measurable and significant (>30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved (organic matter by heterotrophic aerobic bacterioplankton and 3) photo-degradation of DOM and photo-chemical liberation of organic-bound TE. While the first process may have caused significant decreases in the total dissolved concentration of micronutrients (a factor of 2 to 5 for Cr, Mn, Fe, Ni, Cu, Zn and Cd and a factor of >100 for Co), the second and third factors could have brought

  16. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  17. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  18. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  19. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  20. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  1. Radiographic element

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  2. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  3. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  4. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  5. Standard elements; Elements standards

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  6. Investigating the turbulence response of a 1-D idealized water column located in the sub-Antarctic zone with focus on the upper ocean dynamics

    Boodhraj, Kirodh

    2017-09-01

    Full Text Available A one-dimensional ocean physical model was implemented in the sub-Antarctic Southern Ocean using the Nucleus for the European Modelling of the Ocean (NEMO) model. It was used to examine the effects of the turbulence response of the simulation...

  7. A Location Privacy Aware Friend Locator

    Siksnys, Laurynas; Thomsen, Jeppe Rishede; Saltenis, Simonas

    2009-01-01

    to trade their location privacy for quality of service, limiting the attractiveness of the services. The challenge is to develop a communication-efficient solution such that (i) it detects proximity between a user and the user’s friends, (ii) any other party is not allowed to infer the location of the user...

  8. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  9. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  10. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  11. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  12. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  13. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  14. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  15. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  16. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake

    Shirokova, L.S.; Pokrovsky, O.S.; Moreva, O.Yu.; Chupakov, A.V.; Zabelina, S.A.; Klimov, S.I.; Shorina, N.V.; Vorobieva, T.Ya.

    2013-01-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa–0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30 °C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70–80% to only 20–30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90–98% in most summers and winters to approximately 60–70% in August 2010. During this hot summer, measurable and significant (> 30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved ( 100 for Co), the second and third factors could have brought about the decrease of allochthonous DOC concentration as well as the concentration and proportion of organic and organo-mineral colloidal forms of non-essential low-soluble trace elements present in the form of organic colloids (Al, Y, Ti, Zr, Hf, Th, Pb, all REEs). It can be hypothesized that climate warming in

  17. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  18. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  19. Onderzoek Location Based Marketing: Mobile = location = effect

    Gisbergen, M.S. van; Huhn, A.E.; Khan, V.J.; Ketelaar, P.E.

    2011-01-01

    Onderzoekers van de NHTV (Internationaa Hoger Onderwijs Breda, Radboud Universiteit, DVJ Insights en Popai Benelux lieten consumenten in een virtuele supermarkt advertenties via de smartphone ontvangen wanneer men langs het geadverteerde product liep. De uitkomsten laten zien dat 'location based

  20. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  1. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  2. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  3. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  4. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  5. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  6. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  7. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  8. Bioassessment of the Effluents Discharged from Two Export Oriented Industrial Zones Located in Kelani River Basin, Sri Lanka Using Erythrocytic Responses of the Fish, Nile Tilapia (Oreochromis niloticus).

    Hemachandra, C K; Pathiratne, A

    2017-10-01

    Complex effluents originating from diverse industrial processes in industrial zones could pose cytotoxic/genotoxic hazards to biota in the receiving ecosystems which cannot be revealed by conventional monitoring methods. This study assessed potential cytotoxicity/genotoxicity of treated effluents of two industrial zones which are discharged into Kelani river, Sri Lanka combining erythrocytic abnormality tests and comet assay of the tropical model fish, Nile tilapia. Exposure of fish to the effluents induced erythrocytic DNA damage and deformed erythrocytes with serrated membranes, vacuolations, nuclear buds and micronuclei showing cytotoxic/genotoxic hazards in all cases. Occasional exceedance of industrial effluent discharge regulatory limits was noted for color and lead which may have contributed to the observed cytotoxicity/genotoxicity of effluents. The results demonstrate that fish erythrocytic responses could be used as effective bioanalytical tools for cytotoxic/genotoxic hazard assessments of complex effluents of industrial zones for optimization of the waste treatment process in order to reduce biological impacts.

  9. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  10. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  11. Galvanic element. Galvanisches Element

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  12. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  13. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  14. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  15. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  16. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  17. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Location | FNLCR Staging

    The Frederick National Laboratory for Cancer Research campus is located 50 miles northwest of Washington, D.C., and 50 miles west of Baltimore, Maryland, in Frederick, Maryland. Satellite locations include leased and government facilities extending s

  19. Appraising manufacturing location

    Steenhuis, H.J.; de Bruijn, E.J.

    2002-01-01

    International location of manufacturing activities is an issue for managers of manufacturing companies as well as public policy makers. For managers, the issue is relevant because international locations offer opportunities for lowering costs due to productivity improvements. For governments the

  20. Law Enforcement Locations

    Kansas Data Access and Support Center — Law Enforcement Locations in Kansas Any location where sworn officers of a law enforcement agency are regularly based or stationed. Law enforcement agencies "are...

  1. Response of Stream Chemistry During Base Flow to Gradients of Urbanization in Selected Locations Across the Conterminous United States, 2002-04

    Sprague, Lori A.; Harned, Douglas A.; Hall, David W.; Nowell, Lisa H.; Bauch, Nancy J.; Richards, Kevin D.

    2007-01-01

    During 2002-2004, the U.S. Geological Survey's National Water-Quality Assessment Program conducted a study to determine the effects of urbanization on stream water quality and aquatic communities in six environmentally heterogeneous areas of the conterminous United States--Atlanta, Georgia; Raleigh-Durham, North Carolina; Milwaukee-Green Bay, Wisconsin; Dallas-Fort Worth, Texas; Denver, Colorado; and Portland, Oregon. This report compares and contrasts the response of stream chemistry during base flow to urbanization in different environmental settings and examines the relation between the exceedance of water-quality benchmarks and the level of urbanization in these areas. Chemical characteristics studied included concentrations of nutrients, dissolved pesticides, suspended sediment, sulfate, and chloride in base flow. In three study areas where the background land cover in minimally urbanized basins was predominantly forested (Atlanta, Raleigh-Durham, and Portland), urban development was associated with increased concentrations of nitrogen and total herbicides in streams. In Portland, there was evidence of mixed agricultural and urban influences at sites with 20 to 50 percent urban land cover. In two study areas where agriculture was the predominant background land cover (Milwaukee-Green Bay and Dallas-Fort Worth), concentrations of nitrogen and herbicides were flat or decreasing as urbanization increased. In Denver, which had predominantly shrub/grass as background land cover, nitrogen concentrations were only weakly related to urbanization, and total herbicide concentrations did not show any clear pattern relative to land cover - perhaps because of extensive water management in the study area. In contrast, total insecticide concentrations increased with increasing urbanization in all six study areas, likely due to high use of insecticides in urban applications and, for some study areas, the proximity of urban land cover to the sampling sites. Phosphorus

  2. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The effect of the guard location in a nuclear facility on performance criteria

    Lee, Hyun-Chul; Hwang, In-Koo; An, Jin-Soo

    2002-01-01

    Full text: The major functions of a physical protection system (PPS) are detection, delay, and response. Detection function is mainly to sense an adversary's intrusion and assess alarm events, and its physical implementation includes intrusion sensors, alarm communication systems and entry control facilities. Delay function can be accomplished through various passive and active barriers, makes adversary's advance toward his goal slow. Response function is to practically stop adversary actions. There are response guards responsible for the response function in a nuclear facility. They can be located at one or more posts to take action against adversary's progress after alarm occurred. The mostly used quantitative effectiveness measure of a PPS is the probability of interruption (PI) derived from delay time after detection and guard response time. Delay time is a variable dependent on adversary's capabilities and guard response time varies with the distance between a guard post and destination to be dispatched. According to the advanced technology of digital computing, software programs such as SAVI (System Analysis of Vulnerability to Intrusion) provide PI based on user input including adversary capability, protective elements, guard response time, and other PPS information. However guard response time is considered as a constant not a variable. That means same guard response time is always set regardless of the variable guard travel time from a post to a location where guards can interrupt the adversary's action. Since the location of guards may be easily changed in contrast to detection elements or delay elements and can be considered as a flexible mean against temporarily upgraded threat, a trial to investigate the changes of PI and CDP (Critical Detection Point) in case that guard response time is a variable was started. We defined several detection and delay elements along an adversary intrusion path and guard travel times as many as the number of detection

  4. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  5. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  6. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  7. Smartphones as locative media

    Frith, Jordan

    2015-01-01

    Smartphone adoption has surpassed 50% of the population in more than 15 countries, and there are now more than one million mobile applications people can download to their phones. Many of these applications take advantage of smartphones as locative media, which is what allows smartphones to be located in physical space. Applications that take advantage of people's location are called location-based services, and they are the focus of this book. Smartphones as locative media raise important questions about how we understand the complicated relationship between the Internet and physical space

  8. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  9. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  10. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  11. Vegetation Changes in the Permafrost Regions of the Qinghai-Tibetan Plateau from 1982-2012: Different Responses Related to Geographical Locations and Vegetation Types in High-Altitude Areas.

    Zhiwei Wang

    Full Text Available The Qinghai-Tibetan Plateau (QTP contains the largest permafrost area in a high-altitude region in the world, and the unique hydrothermal environments of the active layers in this region have an important impact on vegetation growth. Geographical locations present different climatic conditions, and in combination with the permafrost environments, these conditions comprehensively affect the local vegetation activity. Therefore, the responses of vegetation to climate change in the permafrost region of the QTP may be varied differently by geographical location and vegetation condition. In this study, using the latest Global Inventory Modeling and Mapping Studies (GIMMS Normalized Difference Vegetation Index (NDVI product based on turning points (TPs, which were calculated using a piecewise linear model, 9 areas within the permafrost region of the QTP were selected to investigate the effect of geographical location and vegetation type on vegetation growth from 1982 to 2012. The following 4 vegetation types were observed in the 9 selected study areas: alpine swamp meadow, alpine meadow, alpine steppe and alpine desert. The research results show that, in these study areas, TPs mainly appeared in 2000 and 2001, and almost 55.1% and 35.0% of the TPs were located in 2000 and 2001. The global standardized precipitation evapotranspiration index (SPEI and 7 meteorological variables were selected to analyze their correlations with NDVI. We found that the main correlative variables to vegetation productivity in study areas from 1982 to 2012 were precipitation, surface downward long-wave radiation and temperature. Furthermore, NDVI changes exhibited by different vegetation types within the same study area followed similar trends. The results show that regional effects rather than vegetation type had a larger impact on changes in vegetation growth in the permafrost regions of the QTP, indicating that climatic factors had a larger impact in the permafrost

  12. Lost in Location

    Hansen, Lone Koefoed

    2009-01-01

    traversed. While becoming destination aware, the individual loses her location awareness. The article proposes that the reason people get lost when using sat-nav is due to a wrong location-performative paradigm. As an alternative, the article introduces and analyzes two performance-related examples...... that illustrate an alternative location-performative paradigm: Meredith Warner's Lost/Found knitting series and Etter and Schecht's Melodious Walkabout. In both examples, the artist's hand becomes the intermediary between alien and location. Thus, by exploring how wayfinding can be a poetically situated...... performance, the article examines how the growing locative media industry can learn from the location-aware performative strategies employed by artists who create situated and urban performances for the curious participant. The academic frames employed in the analysis draw on psychogeography, site...

  13. Internet Geo-Location

    2017-12-01

    INTERNET GEO-LOCATION DUKE UNIVERSITY DECEMBER 2017 FINAL TECHNICAL REPORT APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED STINFO COPY AIR...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) MAY 2014 – MAY 2017 4. TITLE AND SUBTITLE INTERNET GEO-LOCATION 5a. CONTRACT...of SpeedTest servers that are used by end users to measure the speed of their Internet connection. The servers log the IP address and the location

  14. Smart Location Database - Service

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  15. Smart Location Database - Download

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  16. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Global mapping of transposon location.

    Abram Gabriel

    2006-12-01

    Full Text Available Transposable genetic elements are ubiquitous, yet their presence or absence at any given position within a genome can vary between individual cells, tissues, or strains. Transposable elements have profound impacts on host genomes by altering gene expression, assisting in genomic rearrangements, causing insertional mutations, and serving as sources of phenotypic variation. Characterizing a genome's full complement of transposons requires whole genome sequencing, precluding simple studies of the impact of transposition on interindividual variation. Here, we describe a global mapping approach for identifying transposon locations in any genome, using a combination of transposon-specific DNA extraction and microarray-based comparative hybridization analysis. We use this approach to map the repertoire of endogenous transposons in different laboratory strains of Saccharomyces cerevisiae and demonstrate that transposons are a source of extensive genomic variation. We also apply this method to mapping bacterial transposon insertion sites in a yeast genomic library. This unique whole genome view of transposon location will facilitate our exploration of transposon dynamics, as well as defining bases for individual differences and adaptive potential.

  18. Green facility location

    Velázquez Martínez, J.C.; Fransoo, J.C.; Bouchery, Y.; Corbett, C.J.; Fransoo, J.C.; Tan, T.

    2017-01-01

    Transportation is one of the main contributing factors of global carbon emissions, and thus, when dealing with facility location models in a distribution context, transportation emissions may be substantially higher than the emissions due to production or storage. Because facility location models

  19. Industrial location and competitiveness

    S. Brakman (Steven); J.H. Garretsen (Harry); J.G.M. van Marrewijk (Charles)

    2006-01-01

    textabstractThe interaction between the extent of location advantages and the intensity of firm competition relative to the size of the market jointly determines the location of industrial activity. Technology, factor endowments, geography, and scale economies are influential for determining

  20. Load responsive hydrodynamic bearing

    Kalsi, Manmohan S.; Somogyi, Dezso; Dietle, Lannie L.

    2002-01-01

    A load responsive hydrodynamic bearing is provided in the form of a thrust bearing or journal bearing for supporting, guiding and lubricating a relatively rotatable member to minimize wear thereof responsive to relative rotation under severe load. In the space between spaced relatively rotatable members and in the presence of a liquid or grease lubricant, one or more continuous ring shaped integral generally circular bearing bodies each define at least one dynamic surface and a plurality of support regions. Each of the support regions defines a static surface which is oriented in generally opposed relation with the dynamic surface for contact with one of the relatively rotatable members. A plurality of flexing regions are defined by the generally circular body of the bearing and are integral with and located between adjacent support regions. Each of the flexing regions has a first beam-like element being connected by an integral flexible hinge with one of the support regions and a second beam-like element having an integral flexible hinge connection with an adjacent support region. A least one local weakening geometry of the flexing region is located intermediate the first and second beam-like elements. In response to application of load from one of the relatively rotatable elements to the bearing, the beam-like elements and the local weakening geometry become flexed, causing the dynamic surface to deform and establish a hydrodynamic geometry for wedging lubricant into the dynamic interface.

  1. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  2. Transplutonium elements

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  3. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  4. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  5. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  6. Effects of tire inclination (turning traffic and dynamic loading on the pavement stress–strain responses using 3-D finite element modeling

    Xiaodi Hu

    2017-07-01

    Full Text Available In this study, ABAQUS finite element (FE modeling in three-dimensional (3-D loading mode was utilized to analytically investigate and quantify the effects of tire inclination and dynamic loading on the stress–strain responses of a pavement structure under varying loading and environmental conditions. The input variables for modeling consisted of actual laboratory and field data obtained from an in-service highway US 59 and included the in-situ pavement structure, material properties (i.e., modulus and shear strength, traffic, and climatic (i.e., temperature data. Computational modeling and sensitivity analyses were conducted through variation of the following two input variables with a focus on the top surfacing hot-mix asphalt (HMA layer: a tire inclination angle to simulate turning traffic, and, b dynamic loading to simulate accelerating, steady rolling, and decelerating (braking traffic. The generated maximum shear stress and vertical strain responses were then analyzed and correlated to the HMA material strength and the actual measured/observed field rutting performance data. The corresponding results indicated that inclined tires (simulating turning traffic and decelerating (braking vehicles induced the most severe shear stresses and vertical strains on the pavement structure in terms of magnitude (i.e., increased; exceeding the HMA material strength in some cases. Thus, for pavement design and structural analysis purposes, the following critical highway areas that may be subjected to extreme stresses and strains due to turning and stopping (braking traffic, particularly in high temperature environments, should be given more attention with respect to material strength characterization to mitigate potential shear/rutting failures: intersections, junctions; urban stop–go sections, and curves. Keywords: 3-D FE stress–strain modeling, Rutting, Shear deformation, Shear stress, Vertical strains

  7. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  8. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  9. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  10. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  11. Allegheny County Dam Locations

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset shows the point locations of dams in Allegheny County. If viewing this description on the Western Pennsylvania Regional Data Center’s open data portal...

  12. Smart Location Mapping

    The Smart Location Database, Access to Jobs and Workers via Transit, and National Walkability Index tools can help assess indicators related to the built environment, transit accessibility, and walkability.

  13. OAS :: Our Locations

    the Human Resources of the OAS, including its organizational structure, each organizational unit's contract and travel control measure reports, the applicable procurement rules and regulations, and the Charter Organizational Charts Organizational List Authorities Our Locations Contact Us Telephone: +1 (202

  14. VT Hospital Site Locations

    Vermont Center for Geographic Information — (Link to Metadata) This data layer contains point locations of all major community, regional, comprehensive health, and healthcare provider hospitals in the state of...

  15. SGA Project Locations

    Vermont Center for Geographic Information — The stream geomorphic assessment is a physical assessment competed by geomorphologists to determine the condition and sensitivity of a stream. The SGA locations...

  16. Waste Recovery Locations

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Locations where City residents are encouraged to drop off and dispose or recycle of unwanted materials. Information provided is subject to change. Please call ahead...

  17. Global Volcano Locations Database

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC maintains a database of over 1,500 volcano locations obtained from the Smithsonian Institution Global Volcanism Program, Volcanoes of the World publication. The...

  18. USAID Activity Locations

    US Agency for International Development — The USAID Activities dataset is a snapshot of activities supported by USAID including their geographical locations within countries at the time of the snapshot. The...

  19. Uranium Location Database

    U.S. Environmental Protection Agency — A GIS compiled locational database in Microsoft Access of ~15,000 mines with uranium occurrence or production, primarily in the western United States. The metadata...

  20. Location-based Scheduling

    Andersson, Niclas; Christensen, Knud

    on the market. However, CPM is primarily an activity based method that takes the activity as the unit of focus and there is criticism raised, specifically in the case of construction projects, on the method for deficient management of construction work and continuous flow of resources. To seek solutions...... to the identified limitations of the CPM method, an alternative planning and scheduling methodology that includes locations is tested. Location-based Scheduling (LBS) implies a shift in focus, from primarily the activities to the flow of work through the various locations of the project, i.e. the building. LBS uses...... the graphical presentation technique of Line-of-balance, which is adapted for planning and management of work-flows that facilitates resources to perform their work without interruptions caused by other resources working with other activities in the same location. As such, LBS and Lean Construction share...

  1. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  3. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  4. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  5. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  6. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  7. Investigation on the Cyclic Response of Superelastic Shape Memory Alloy (SMA Slit Damper Devices Simulated by Quasi-Static Finite Element (FE Analyses

    Jong Wan Hu

    2014-02-01

    Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.

  8. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  9. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  10. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  11. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  12. AFRICOM: Does Location Matter?

    2009-03-01

    Decision Model,” 242-244. 26 Susan Hesse Owen & Mark S. Daskin , “Strategic Facility Location: A Review,” European Journal of Operational Research...Susan Hesse & Mark S. Daskin . “Strategic Facility Location: A Review,” European Journal of Operational Research 111 (1998), 423-447. Paye-Layeleh...ES) N/ A 10. SPONSORING/MONITORING AGENCY REPORT NUMBER 11. SUPPLEMENTARY NOTES The views expressed in this thesis are those of the author and

  13. On English Locative Subjects

    Gabriela Brůhová

    2017-07-01

    Full Text Available The paper analyses English sentences with thematic locative subjects. These subjects were detected as translation counterparts of Czech sentenceinitial locative adverbials realized by prepositional phrases with the prepositions do (into, na (on, v/ve (in, z/ze (from complemented by a noun. In the corresponding English structure, the initial scene-setting adverbial is reflected in the thematic subject, which results in the locative semantics of the subject. The sentences are analysed from syntactic, semantic and FSP aspects. From the syntactic point of view, we found five syntactic patterns of the English sentences with a locative subject (SV, SVA, SVO, SVpassA and SVCs that correspond to Czech sentences with initial locative adverbials. On the FSP level the paper studies the potential of the sentences to implement the Presentation or Quality Scale. Since it is the “semantic content of the verb that actuates the presentation semantics of the sentence” (Duškova, 2015a: 260, major attention is paid to the syntactic-semantic structure of the verb. The analysis of the semantics of the English sentences results in the identification of two semantic classes of verbs which co-occur with the English locative subject.

  14. Toxic Elements

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  15. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  16. Environmental mineralogy - Understanding element behavior in ecosystems

    Brown Jr, G.E.; Calas, G.

    2011-01-01

    Environmental Mineralogy has developed over the past decade in response to the recognition that minerals are linked in many important ways with the global ecosystem. Minerals are the main repositories of the chemical elements in Earth's crust and thus are the main sources of elements needed for the development of civilization, contaminant and pollutant elements that impact global and local ecosystems, and elements that are essential plant nutrients. These elements are released from minerals through natural processes, such as chemical weathering, and anthropogenic activities, such as mining and energy production, agriculture and industrial activities, and careless waste disposal. Minerals also play key roles in the biogeochemical cycling of the elements, sequestering elements and releasing them as the primary minerals in crustal rocks undergo various structural and compositional transformations in response to physical, chemical, and biological processes that produce secondary minerals and soils. These processes have resulted in the release of toxic elements such as arsenic in groundwater aquifers, which is having a major impact on the health of millions of people in South and Southeast Asia. The interfaces between mineral surfaces and aqueous solutions are the locations of most chemical reactions that control the composition of the natural environment, including the composition of natural waters. The nuclear fuel cycle, from uranium mining to the disposition of high-level nuclear waste, is also intimately related to minerals. A fundamental understanding of these processes requires molecular-scale information about minerals, their bulk structures and properties such as solubility, their surfaces, and their interactions with aqueous solutions, atmospheric and soil gases, natural organic matter, and biological organisms. Gaining this understanding is further complicated by the presence of natural, incidental, and manufactured nano-particles in the environment, which

  17. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S.

    2007-01-01

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-κB. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K

  18. Capacitive system detects and locates fluid leaks

    1966-01-01

    Electronic monitoring system automatically detects and locates minute leaks in seams of large fluid storage tanks and pipelines covered with thermal insulation. The system uses a capacitive tape-sensing element that is adhesively bonded over seams where fluid leaks are likely to occur.

  19. Final environmental impact statement for the Nevada test site and off-site locations in the State of Nevada. Public comment and response document, Volume 3, Part B responses

    1996-08-01

    This sitewide EIS evaluates the potential environmental impacts of four possible land-use alternatives being considered for the Nevada Test Site (NTS), the Tonopah Test Range, and the formerly operated DOE sites in the state of Nevada: the Project Shoal Area, the Central Nevada Test Area, and portions of the Nellis Air Force Range Complex. Three additional sites in Nevada-Eldorado Valley, Dry Lake Valley, and Coyote Spring Valley-are evaluated for collocation of solar energy production facilities. The four alternatives include Continue Current Operations (No Action, continue to operate at the level maintained for the past 3 to 5 years); Discontinue Operations 1 (discontinue operations and interagency programs); Expanded Use (increased use of NTS and its resources to support defense and nondefense programs); and Alternate Use of Withdrawn Lands (discontinue all defense-related activities at NTS; continue waste management operations in support of NTS environmental restoration efforts; expand nondefense research). Environmental impacts were assessed for each alternative by analyzing, to the extent possible, the discrete and cumulative environmental impacts associated with Defense Waste Management, Environmental Restoration, Nondefense Research and Development, and Work for Others Programs. A framework for a Resource Management Plan is included as Volume 2 of this EIS and represents the development of an ecosystem based planning process closely integrated with the National Environmental Policy Act process. This EIS, among other things, analyzed the impacts of transportation of low level waste, and site characterization activities related to the Yucca Mountain Project but did not analyze the suitability of the site as a repository. This EIS does not analyze the suitability of the Yucca Mountain site as a repository as this is an action beyond the scope of the EIS. Volume 3 of this EIS contains the public comments and the responses to the comments

  20. Telemetry location error in a forested habitat

    Chu, D.S.; Hoover, B.A.; Fuller, M.R.; Geissler, P.H.; Amlaner, Charles J.

    1989-01-01

    The error associated with locations estimated by radio-telemetry triangulation can be large and variable in a hardwood forest. We assessed the magnitude and cause of telemetry location errors in a mature hardwood forest by using a 4-element Yagi antenna and compass bearings toward four transmitters, from 21 receiving sites. The distance error from the azimuth intersection to known transmitter locations ranged from 0 to 9251 meters. Ninety-five percent of the estimated locations were within 16 to 1963 meters, and 50% were within 99 to 416 meters of actual locations. Angles with 20o of parallel had larger distance errors than other angles. While angle appeared most important, greater distances and the amount of vegetation between receivers and transmitters also contributed to distance error.

  1. General minisum circle location

    Körner, Mark; Brimberg, Jack; Juel, Henrik

    2009-01-01

    In our paper we approximate a set of given points by a general circle. More precisely, we consider the problem of locating and scaling the unit ball of some given norm k1 with respect to xed points on the plane such that the sum of weighted distances between the circle and the xed points is minim......In our paper we approximate a set of given points by a general circle. More precisely, we consider the problem of locating and scaling the unit ball of some given norm k1 with respect to xed points on the plane such that the sum of weighted distances between the circle and the xed points...

  2. Location-based games

    Ejsing-Duun, Stine

    In this dissertation, it is explored which prerequisites are necessary in location-based games (LBGs) to make meaningful the meeting between players and spatiality with an emphasis on physical locations. Throughout the dissertation, it has been shown that LBGs affect players’ perception of and be...... possible. The practical contribution is my creation of the LBG Visions of Sara. People continue to play this game in Odense more than two years after its launch, and DJEEO uses it as a showcase, enabling the company to sell similar LBGs....

  3. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  4. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  5. Fuel element

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  6. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  7. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  8. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  9. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, including glucose, on pancreatic development. We previously showed that glucose and its metabolism through the hexosamine biosynthesis pathway (HBP) promote pancreatic endocrine cell differentiation. Here, we analysed the role of the transcription factor carbohydrate-responsive element-binding protein (ChREBP) in this process. This transcription factor is activated by glucose, and has been recently described as a target of the HBP. We used an in vitro bioassay in which pancreatic endocrine and exocrine cells develop from rat embryonic pancreas in a way that mimics in vivo pancreatic development. Using this model, gain-of-function and loss-of-function experiments were undertaken. ChREBP was produced in the endocrine lineage during pancreatic development, its abundance increasing with differentiation. When rat embryonic pancreases were cultured in the presence of glucose or xylitol, the production of ChREBP targets was induced. Concomitantly, beta cell differentiation was enhanced. On the other hand, when embryonic pancreases were cultured with inhibitors decreasing ChREBP activity or an adenovirus producing a dominant-negative ChREBP, beta cell differentiation was reduced, indicating that ChREBP activity was necessary for proper beta cell differentiation. Interestingly, adenovirus producing a dominant-negative ChREBP also reduced the positive effect of N-acetylglucosamine, a substrate of the HBP acting on beta cell differentiation. Our work supports the idea that glucose, through the transcription factor ChREBP, controls beta cell differentiation from pancreatic progenitors.

  10. Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

    Matthew S Lalonde

    2011-05-01

    Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

  11. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  12. Numerical Simulation on Seismic Response of the Filled Joint under High Amplitude Stress Waves Using Finite-Discrete Element Method (FDEM

    Xiaolin Huang

    2016-12-01

    Full Text Available This paper numerically investigates the seismic response of the filled joint under high amplitude stress waves using the combined finite-discrete element method (FDEM. A thin layer of independent polygonal particles are used to simulate the joint fillings. Each particle is meshed using the Delaunay triangulation scheme and can be crushed when the load exceeds its strength. The propagation of the 1D longitude wave through a single filled joint is studied, considering the influences of the joint thickness and the characteristics of the incident wave, such as the amplitude and frequency. The results show that the filled particles under high amplitude stress waves mainly experience three deformation stages: (i initial compaction stage; (ii crushing stage; and (iii crushing and compaction stage. In the initial compaction stage and crushing and compaction stage, compaction dominates the mechanical behavior of the joint, and the particle area distribution curve varies little. In these stages, the transmission coefficient increases with the increase of the amplitude, i.e., peak particle velocity (PPV, of the incident wave. On the other hand, in the crushing stage, particle crushing plays the dominant role. The particle size distribution curve changes abruptly with the PPV due to the fragments created by the crushing process. This process consumes part of wave energy and reduces the stiffness of the filled joint. The transmission coefficient decreases with increasing PPV in this stage because of the increased amount of energy consumed by crushing. Moreover, with the increase of the frequency of the incident wave, the transmission coefficient decreases and fewer particles can be crushed. Under the same incident wave, the transmission coefficient decreases when the filled thickness increases and the filled particles become more difficult to be crushed.

  13. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  14. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  15. Utilization of a hybrid finite-element based registration method to quantify heterogeneous tumor response for adaptive treatment for lung cancer patients

    Sharifi, Hoda; Zhang, Hong; Bagher-Ebadian, Hassan; Lu, Wei; Ajlouni, Munther I.; Jin, Jian-Yue; (Spring Kong, Feng-Ming; Chetty, Indrin J.; Zhong, Hualiang

    2018-03-01

    Tumor response to radiation treatment (RT) can be evaluated from changes in metabolic activity between two positron emission tomography (PET) images. Activity changes at individual voxels in pre-treatment PET images (PET1), however, cannot be derived until their associated PET-CT (CT1) images are appropriately registered to during-treatment PET-CT (CT2) images. This study aimed to investigate the feasibility of using deformable image registration (DIR) techniques to quantify radiation-induced metabolic changes on PET images. Five patients with non-small-cell lung cancer (NSCLC) treated with adaptive radiotherapy were considered. PET-CTs were acquired two weeks before RT and 18 fractions after the start of RT. DIR was performed from CT1 to CT2 using B-Spline and diffeomorphic Demons algorithms. The resultant displacements in the tumor region were then corrected using a hybrid finite element method (FEM). Bitmap masks generated from gross tumor volumes (GTVs) in PET1 were deformed using the four different displacement vector fields (DVFs). The conservation of total lesion glycolysis (TLG) in GTVs was used as a criterion to evaluate the quality of these registrations. The deformed masks were united to form a large mask which was then partitioned into multiple layers from center to border. The averages of SUV changes over all the layers were 1.0  ±  1.3, 1.0  ±  1.2, 0.8  ±  1.3, 1.1  ±  1.5 for the B-Spline, B-Spline  +  FEM, Demons and Demons  +  FEM algorithms, respectively. TLG changes before and after mapping using B-Spline, Demons, hybrid-B-Spline, and hybrid-Demons registrations were 20.2%, 28.3%, 8.7%, and 2.2% on average, respectively. Compared to image intensity-based DIR algorithms, the hybrid FEM modeling technique is better in preserving TLG and could be useful for evaluation of tumor response for patients with regressing tumors.

  16. Plant HDAC inhibitor chrysin arrest cell growth and induce p21WAF1 by altering chromatin of STAT response element in A375 cells

    Pal-Bhadra, Manika; Bhadra, Utpal; Ramaiah, M Janaki; Reddy, T Lakshminarayan; Krishnan, Anita; Pushpavalli, SNCVL; Babu, K Suresh; Tiwari, Ashok K; Rao, J Madhusudana; Yadav, Jhillu S

    2012-01-01

    Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21 WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21 WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK

  17. The Czech Locative Chameleon

    Tarald Taraldsen

    2007-12-01

    Full Text Available We show that under certain circumstances, the Czech locative prepositions (LOC show up as directional prepositions (DIR and vice versa, (under different circumstances the Czech DIR PPs show up as LOC. We argue that such a chameleon life of the PPs is structurally dependent.

  18. Immigrants' location preferences

    Damm, Anna Piil

    This paper exploits a spatial dispersal policy for refugee immigrants to estimate the importance of local and regional factors for refugees' location preferences. The main results of a mixed proportional hazard competing risks model are that placed refugees react to high regional unemployment...

  19. Tracking, say, SKYPE Locations

    First page Back Continue Last page Graphics. Tracking, say, SKYPE Locations. Real Time Communication: Peer-to-Peer (P2P). Datagram flows between the two conversing partners; Exposes the IP addresses of all the participants to one another. If A knows B's VoIP ID, she can establish a call with Bob & obtain his current ...

  20. RFID Location Algorithm

    Wang Zi Min

    2016-01-01

    Full Text Available With the development of social services, people’s living standards improve further requirements, there is an urgent need for a way to adapt to the complex situation of the new positioning technology. In recent years, RFID technology have a wide range of applications in all aspects of life and production, such as logistics tracking, car alarm, security and other items. The use of RFID technology to locate, it is a new direction in the eyes of the various research institutions and scholars. RFID positioning technology system stability, the error is small and low-cost advantages of its location algorithm is the focus of this study.This article analyzes the layers of RFID technology targeting methods and algorithms. First, RFID common several basic methods are introduced; Secondly, higher accuracy to political network location method; Finally, LANDMARC algorithm will be described. Through this it can be seen that advanced and efficient algorithms play an important role in increasing RFID positioning accuracy aspects.Finally, the algorithm of RFID location technology are summarized, pointing out the deficiencies in the algorithm, and put forward a follow-up study of the requirements, the vision of a better future RFID positioning technology.

  1. Spatiotemporal AED Location Optimization

    Chan, Timothy C.Y.; Sun, Christopher L.F.; Demirtas, Derya; Morrison, Laurie J.; Brooks, Steven C.

    2015-01-01

    Background: Mathematical optimization can be used to plan future AED placement to maximize out-of-hospital cardiac arrest (OHCA) coverage. Many public access AEDs are placed in locations without 24/7 access. AED coverage can be overestimated unless temporal availability is considered. Objective: To

  2. Location of New Firms

    Backman, Mikaela; Karlsson, Charlie

    2017-01-01

    characteristics, such as the commuting experience. Our results show that commuting influences the firm location choice. The probability of establishing a firm in the work municipality increases if the entrepreneur is a commuter, holding constant the type of region and unobservable and observable individual...

  3. Nuclear fuel element

    Penrose, R.T.; Thompson, J.R.

    1976-01-01

    A method of protecting the cladding of a nuclear fuel element from internal attack and a nuclear fuel element for use in the core of a nuclear reactor are disclosed. The nuclear fuel element has disposed therein an additive of a barium-containing material and the barium-containing material collects reactive gases through chemical reaction or adsorption at temperatures ranging from room temperature up to fuel element plenum temperatures. The additive is located in the plenum of the fuel element and preferably in the form of particles in a hollow container having a multiplicity of gas permeable openings in one portion of the container with the openings being of a size smaller than the size of the particles. The openings permit gases and liquids entering the plenum to contact the particles. The additive is comprised of elemental barium or a barium alloy containing one or more metals in addition to barium such as aluminum, zirconium, nickel, titanium and combinations thereof. 6 claims, 3 drawing figures

  4. An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

    Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.

    1989-01-01

    An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

  5. Response

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  6. Aquatic Nuisance Species Locator

    Data in this map has been collected by the United States Geological Survey's Nonindigenous Aquatic Species program located in Gainesville, Florida (http://nas.er.usgs.gov/default.aspx). This dataset may have some inaccuracies and is only current to June 15, 2012. The species identified in this dataset are not inclusive of all aquatic nuisance species, but rather a subset identified to be at risk for transport by recreational activities such as boating and angling. Additionally, the locations where organisims have been identified are also not inclusive and should be treated as a guide. Organisms are limited to the following: American bullfrog, Asian clam, Asian shore crab, Asian tunicate, Australian spotted jellyfish, Chinese mitten crab, New Zealand mudsnail, Colonial sea squirt, Alewife, Bighead carp, Black carp, Flathead catfish, Grass carp, Green crab, Lionfish, Northern snakehead, Quagga mussel, Round Goby, Ruffe, Rusty crayfish, Sea lamprey, Silver carp, Spiny water flea, Veined rapa whelk, Zebra mussel

  7. Locating underground uranium deposits

    Felice, P.E.

    1979-01-01

    Underground uranium deposits are located by placing wires of dosimeters each about 5 to 18 mg/cm 2 thick underground in a grid pattern. Each dosimeter contains a phosphor which is capable of storing the energy of alpha particles. In each pair one dosimeter is shielded from alpha particles with more than 18 mg/cm 2 thick opaque material but not gamma and beta rays and the other dosimeter is shielded with less than 1 mg/cm 2 thick opaque material to exclude dust. After a period underground the dosimeters are heated which releases the stored energy as light. The amount of light produced from the heavily shielded dosimeter is subtracted from the amount of light produced from the thinly shielded dosimeter to give an indication of the location and quantity of uranium underground

  8. Web cache location

    Boffey Brian

    2004-01-01

    Full Text Available Stress placed on network infrastructure by the popularity of the World Wide Web may be partially relieved by keeping multiple copies of Web documents at geographically dispersed locations. In particular, use of proxy caches and replication provide a means of storing information 'nearer to end users'. This paper concentrates on the locational aspects of Web caching giving both an overview, from an operational research point of view, of existing research and putting forward avenues for possible further research. This area of research is in its infancy and the emphasis will be on themes and trends rather than on algorithm construction. Finally, Web caching problems are briefly related to referral systems more generally.

  9. Final environmental impact statement for the Nevada test site and off-site locations in the State of Nevada. Public comment and response document, Volume 3, Part A comments

    1996-08-01

    On February 2, 1996, the U.S. Department of Energy (DOE) issued the Draft Environmental Impact Statement for the Nevada Test Site and Off-Site Locations in the State of Nevada (NTS EIS) for review by the state of Nevada, Indian tribes, local governments, other federal agencies, groups and organizations, and the general public. The formal comment period lasted 90 days, ending May 3, 1996. As part of the comment process, the DOE held public hearings in St. George, Utah, and in Pahrump, Reno, and Las Vegas, Nevada. Community Workshops were held in Caliente, Tonopah, Boulder City, and North Las Vegas, Nevada, in conjunction with the University of Nevada Las Vegas to discuss the Draft NTS EIS. Volume 3 of the Final NTS EIS contains 3 chapters. Chapter 1 summarizes the major issues raised by the public. Chapter 2 contains the full text of the public comments on the Draft NTS EIS received by the DOE; it includes public hearing transcripts, written comments, and comments received via a toll-free comment open-quotes hot line.close quotes Chapter 3 contains the DOE's responses to the public comments and describes how the comments were considered in the Final NTS EIS

  10. Location based services

    Doan, Cong Nam

    2015-01-01

    Mobile devices (tablets, smart phones, laptops) are proving themselves to be the main means of accessing information of the future. The embodiment of Recommender Systems (RSs) into mobile environments, as a matter of fact, has come about to serve as a way to solve the nuisances of data overwhelming. RSs' main advantage is their ability to allow users to find useful information according to the users' preferences and location. Even though they are not free of shortcoming such as the limitation...

  11. Location Intelligence Solutions

    Schmidt, D.

    2015-01-01

    Location Intelligence (LI) means using the spatial dimension of information as a key to support business processes. This spatial dimension has to be defined by geographic coordinates. Storing these spatial objects in a database allows for attaching a 'meaning' to them, like 'current position', 'border', 'building' or 'room'. Now the coordinates represent real-world objects, which can be relevant for the measurement, documentation, control or optimization of (parameters of) business processes aiming at different business objectives. But LI can only be applied, if the locations can be determined with an accuracy (in space and time) appropriate for the business process in consideration. Therefore the first step in any development of a LI solution is the analysis of the business process itself regarding its requirements for spatial and time resolution and accuracy. The next step is the detailed analysis of the surrounding conditions of the process: Does the process happen indoor and/or outdoor? Are there moving objects? If yes, how fast are they? How does the relevant environment look like? Is technical infrastructure available? Is the process restricted by regulations? As a result, a proper Location Detection Technology (LDT) has to be chosen in order to get reliable and accurate positions of the relevant objects. At the highly challenging conditions of the business processes IAEA inspectors are working with, the chosen LDTs have to deliver reliable positioning on ''room-level'' accuracy, even if there is no location enabling infrastructure in place, the objects (people) mostly are indoors and have to work under strong regulations. The presentation will give insights into innovative LI solutions based on technologies of different LDT providers. Pros and cons of combinations of different LDT (like multi- GNSS, IMU, camera, and human interaction based positioning) will be discussed from the

  12. Ammonia Leak Locator Study

    Dodge, Franklin T.; Wuest, Martin P.; Deffenbaugh, Danny M.

    1995-01-01

    The thermal control system of International Space Station Alpha will use liquid ammonia as the heat exchange fluid. It is expected that small leaks (of the order perhaps of one pound of ammonia per day) may develop in the lines transporting the ammonia to the various facilities as well as in the heat exchange equipment. Such leaks must be detected and located before the supply of ammonia becomes critically low. For that reason, NASA-JSC has a program underway to evaluate instruments that can detect and locate ultra-small concentrations of ammonia in a high vacuum environment. To be useful, the instrument must be portable and small enough that an astronaut can easily handle it during extravehicular activity. An additional complication in the design of the instrument is that the environment immediately surrounding ISSA will contain small concentrations of many other gases from venting of onboard experiments as well as from other kinds of leaks. These other vapors include water, cabin air, CO2, CO, argon, N2, and ethylene glycol. Altogether, this local environment might have a pressure of the order of 10(exp -7) to 10(exp -6) torr. Southwest Research Institute (SwRI) was contracted by NASA-JSC to provide support to NASA-JSC and its prime contractors in evaluating ammonia-location instruments and to make a preliminary trade study of the advantages and limitations of potential instruments. The present effort builds upon an earlier SwRI study to evaluate ammonia leak detection instruments [Jolly and Deffenbaugh]. The objectives of the present effort include: (1) Estimate the characteristics of representative ammonia leaks; (2) Evaluate the baseline instrument in the light of the estimated ammonia leak characteristics; (3) Propose alternative instrument concepts; and (4) Conduct a trade study of the proposed alternative concepts and recommend promising instruments. The baseline leak-location instrument selected by NASA-JSC was an ion gauge.

  13. PELTIER ELEMENTS

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  14. Transposable elements in cancer.

    Burns, Kathleen H

    2017-07-01

    Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

  15. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  16. Roles of p300 and cyclic adenosine monophosphate response element binding protein in high glucose-induced hypoxia-inducible factor 1α inactivation under hypoxic conditions.

    Ding, Lingtao; Yang, Minlie; Zhao, Tianlan; Lv, Guozhong

    2017-05-01

    Given the high prevalence of diabetes and burn injuries worldwide, it is essential to dissect the underlying mechanism of delayed burn wound healing in diabetes patients, especially the high glucose-induced hypoxia-inducible factor 1 (HIF-1)-mediated transcription defects. Human umbilical vein endothelial cells were cultured with low or high concentrations of glucose. HIF-1α-induced vascular endothelial growth factor (VEGF) transcription was measured by luciferase assay. Immunofluorescence staining was carried out to visualize cyclic adenosine monophosphate response element binding protein (CREB) localization. Immunoprecipitation was carried out to characterize the association between HIF-1α/p300/CREB. To test whether p300, CREB or p300+CREB co-overexpression was sufficient to rescue the HIF-1-mediated transcription defect after high glucose exposure, p300, CREB or p300+CREB co-overexpression were engineered, and VEGF expression was quantified. Finally, in vitro angiogenesis assay was carried out to test whether the high glucose-induced angiogenesis defect is rescuable by p300 and CREB co-overexpression. Chronic high glucose treatment resulted in impaired HIF-1-induced VEGF transcription and CREB exclusion from the nucleus. P300 or CREB overexpression alone cannot rescue high glucose-induced HIF-1α transcription defects. In contrast, co-overexpression of p300 and CREB dramatically ameliorated high glucose-induced impairment of HIF-1-mediated VEGF transcription, as well as in vitro angiogenesis. Finally, we showed that co-overexpression of p300 and CREB rectifies the dissociation of HIF-1α-p300-CREB protein complex in chronic high glucose-treated cells. Both p300 and CREB are required for the function integrity of HIF-1α transcription machinery and subsequent angiogenesis, suggesting future studies to improve burn wound healing might be directed to optimization of the interaction between p300, CREB and HIF-1α. © 2016 The Authors. Journal of Diabetes

  17. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  18. A case report of spontaneous mutation (C33>U) in the iron-responsive element of L-ferritin causing hyperferritinemia-cataract syndrome.

    Cao, Wei

    2010-01-15

    The hereditary hyperferritinemia cataract syndrome (HHCS) is an autosomal dominant disorder characterized by juvenile-onset cataracts and elevated serum ferritin levels. It is caused by mutation in the iron response element (IRE) within the 5\\'UTR of L-ferritin gene. The mutation results in a loss of post-transcriptional negative feedback exerted by the interaction between iron regulatory proteins 1, 2 (IRP1 and IRP2) and IRE, which leads to uncontrolled expression of L-ferritin. In this paper, we describe the molecular pathogenesis of non-hereditary hyperferritinemia cataract syndrome (non-H-HCS) in a patient with typical HHCS ocular lens morphology and high ferritin levels without obvious family history. Initial sequencing of the full-length L-ferritin cloned from genomic DNA demonstrated a mutation (C33>T) in the IRE of the affected patient but not in her unaffected family members. The mutation (C\\/T heterozygote) was also detected in cDNA derived from her blood mononuclear cells. Structure-prediction-modeling indicates that this mutation would significantly alter the secondary structure of the IRE, resulting in a loss of the interaction between IRP and IRE. By using IRP1\\/IRP2-human IgG1 Fc fusion proteins, we established a novel in vitro report system (modified ELISA) to verify impaired IRE\\/IRP binding. Both the C33>U and A40G mutations (the first identified mutation for HHCS) showed a dramatically decreased binding to IRP1\\/IRP2 protein, compared to the normal IRE RNA. Surprisingly, a decrease in L-ferritin mRNA levels was observed in the affected patient compared to controls suggesting a mechanism of transcriptional negative feedback by high intracellular L-ferritin protein levels not described heretofore. Taken together, spontaneous mutation in the IRE of L-ferritin may cause non-H-HCS by the same mechanism as HHCS. In addition, under abnormal circumstances, the protein level of L-ferritin may be principally controlled by post

  19. Fuel element

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  20. Transactinide elements

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)